La COVID-19 no se transmite por vía aérea

María José Martínez Albarracín es licenciada en medicina y cirugía por la Universidad de Murcia, catedrática de procesos diagnósticos clínicos, y forma parte de la alianza internacional de Médicos por la Verdad.

Por María José Martínez Albarracín

1º) La ciencia acepta que el receptor viral del Sars-CoV-2 es el enzima ACE2. Este receptor no se expresa en el pulmón, como demostró el equipo descubridor de dicho enzima ACE2 en el año 2000 en un trabajo publicado en Journal of Biological Chemistry con el título: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE” cuya primera autora es la Dra. Sarah R. Tipnis.

El siguiente estudio, de 2020, cuyo título traducido es: “El perfil de expresión de
proteínas ACE2 en tejidos humanos” publicado en Molecular Systems Biology (doi:
10.15252/msb.20209610) de fecha 31 de marzo de 2020, analiza de forma exhaustiva los perfiles de expresión molecular de dicho receptor en diferentes tejidos y corrobora que ACE2 no se expresa en pulmón y tampoco en vías respiratorias. El equívoco se produjo en el año 2003 como explica detalladamente el documento elaborado por LA JUNTA ARGENTINA DE REVISIÓN CIENTÍFICA titulado Cronología Target Vacuna Covid-19.

2º) El Sars-CoV-2 no puede ser cultivado en células del alveolo pulmonar (A549), como demuestra este estudio publicado en Elsevier el 12/9/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) for diagnostic and research purposes”, cuyo primer autor es Sacha Stelzer-Braid. En el pulmón sólo es posible cultivarlo en células de cáncer metastásico, y las células metastásicas no son específicas de pulmón. En la ficha de la vacuna de AstraZeneca se admite esto de forma equívoca al decir textualmente que estas células A549 no permiten la replicación “del vector”.

3º) La transmisión por vía aérea (gotas y aerosoles) no está probada científicamente. Dicha transmisión sólo puede probarse mediante cultivo y secuenciación de la muestra objeto del estudio, sin embargo esto no se ha hecho tal y como admite el propio Ministerio de Sanidad Español. Cito textualmente:

“En todos los casos la cantidad de ARN detectada fue pequeña y el virus no se logró
cultivar”

Pág.8 del documento INFORMACIÓN CIENTÍFICO-TÉCNICA del Ministerio de Sanidad, CENTRO DE COORDINACIÓN DE ALERTAS Y EMERGENCIAS SANITARIAS. “Enfermedad por coronavirus, Covid-19” (actualización del 12 de noviembre de 2020).

4º) La neumonía característica de la Covid-19 es bilateral, simétrica e intersticial, lo que prueba que la patogenia se produce a través de la sangre, ya que en el intersticio pulmonar se encuentran los capilares sanguíneos.

EN CONCLUSIÓN:

Si aceptamos que la Covid-19 está producida por el Sars-CoV-2 y que el receptor celular de dicho coronavirus es ACE2, ya que este virus no puede ser cultivado en células pulmonares naturales y que el receptor ACE2 no se encuentra en tejido pulmonar, tenemos que concluir necesariamente que la Covid-19 no se transmite por vía aérea y que las mascarillas son inútiles para frenar la transmisión.

Ver este documento en formato PDF en el portal de Médicos por la Verdad.

La COVID-19 no se transmite por vía aérea – Medicos Por La Verdad

COVID-19 is not transmitted by air

1st) Science accepts that the viral receptor for Sars-CoV-2 is the enzyme ACE2. This receptor is not expressed in the lung, as the team that discovered the ACE2 enzyme demonstrated in 2000 in a work published in the Journal of Biological Chemistry with the title: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE ”whose first author is Dr. Sarah R. Tipnis. The following study, from 2020, whose translated title is: “The expression profile of ACE2 proteins in human tissues ”published in Molecular Systems Biology (doi: 10.15252 / msb.20209610) dated March 31, 2020, exhaustively analyzes the molecular expression profiles of said receptor in different tissues and corroborates that ACE2 is not expressed in the lung and neither in the respiratory tract. The mistake occurred in 2003, as explained in detail in the document prepared by THE ARGENTINE SCIENTIFIC REVIEW BOARD entitled Covid-19 Vaccine Target Chronology.

2nd) Sars-CoV-2 cannot be cultured in cells of the pulmonary alveolus (A549), as shown in this study published in Elsevier on 9/12/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2) for diagnostic and research purposes ”, whose first author is Sacha Stelzer-Braid. In the lung it is only possible to grow it in metastatic cancer cells, and metastatic cells are not lung specific. This is mistakenly admitted in the AstraZeneca vaccine file by stating verbatim that these A549 cells do not allow “vector” replication.

3º) Transmission by air (drops and aerosols) is not scientifically proven. Such transmission can only be proven by culturing and sequencing the sample under study, however this has not been done as the Spanish Ministry of Health itself admits. I quote verbatim: “In all cases the amount of RNA detected was small and the virus was not achieved cultivate” Page 8 of the document SCIENTIFIC-TECHNICAL INFORMATION of the Ministry of Health, CENTER FOR THE COORDINATION OF HEALTH ALERTS AND EMERGENCIES. “Coronavirus disease, Covid-19” (update November 12, 2020).

4th) The characteristic pneumonia of Covid-19 is bilateral, symmetric and interstitial, which proves that the pathogenesis occurs through the blood, since the blood capillaries are found in the pulmonary interstitium.

IN CONCLUSION: If we accept that Covid-19 is produced by Sars-CoV-2 and that the cellular receptor for said coronavirus is ACE2, since this virus cannot be cultured in natural lung cells and that the ACE2 receptor is not found in lung tissue , we have to necessarily conclude that Covid-19 is not transmitted by air and that masks are useless to stop the transmission.

Tribunal Portugués: Pruebas PCR “poco fiables” y Cuarentenas “Ilegales”

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de “alto riesgo de infección” basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.

*

La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

EE.UU.: el 89% de nuestros senadores y el Congreso tienen doble ciudadanía con Israel

Este artículo tiene más de dos años, pero las elecciones de EE.UU. lo pone de nuevo en la palestra y actualidad entre muchas otras cosas, y no menores, por cierto.

El 89% de nuestros senadores y el Congreso tienen la doble ciudadanía con Israel y estamos en Siria debido a que Israel se pregunta quiénes son los verdaderos traidores al país sacrificando soldados estadounidenses en beneficio del país extranjero.

Senadores corporativos de EE.UU. y representantes que son ciudadanos duales de Israel

govbanknotes.wordpress.com/2017/06/07/us-senators-and-us-representatives-that-are-israel-dual-citizens/

Aquí hay una lista de políticos estadounidenses que tienen doble ciudadanía estadounidense/israelí. Tenga en cuenta los puestos de asesoramiento bancario y de política.


ADMINISTRACIÓN OBAMA

Jack Lew – Jefe de Gabinete del Presidente; Secretario del Tesoro

David Plouffe – Asesor Superior del Presidente

Danielle Borrin – Directora Asociada, Oficina de Participación Pública; Asistente Especial del Vicepresidente

Gary Gensler – Presidente de la Commodity Futures Trading Commission

Dan Shapiro – Embajador en Israel

Gene Sperling – Director del Consejo Económico Nacional

Mary Schapiro – Presidenta de la Comisión de Bolsa y Valores

Steven Simon – Jefe de la Mesa para Oriente Medio y el Norte de Africa en el Consejo de Seguridad Nacional

Eric Lynn – Asesor de Políticas de Oriente Medio

ADMINISTRACIÓN PASADA DE OBAMA

Rahm Emanuel (2009-2010) Jefe de Gabinete del Presidente

David Axelrod (2009-2011) Asesor Superior del Presidente

Elena Kagan (2009-2010) Procuradora General de los Estados Unidos

Peter Orszag (2009-2010) Director de la Oficina de Gestión y Presupuesto

Lawrence Summers (’09-’11) Director del Consejo Económico Nacional

Mona Sutphen (2009-2011) Jefe de Gabinete Adjunto de la Casa Blanca

James B. Steinberg (’09-’11 ) Secretario de Estado Adjunto

Dennis Ross (2009-2011) Asistente Especial del Presidente, Director Superior de la Región Central del Secretario de Estado

Ronald Klain (2009-2011) Jefe de Gabinete del Vicepresidente

Jared Bernstein (2009-2011) Economista Jefe y Asesor de Política Económica del Vicepresidente

Susan Sher (2009-2011) Jefa de Estado Mayor de la Primera Dama

Lee Feinstein (2009) Asesor de Política Exterior de la Campaña

Mara Rudman (2009) Asesor de Política Exterior Fuentes: Casa Blanca

112 CONGRESO (actual)

EL SENADO DE LOS ESTADOS UNIDOS [13]

Richard Blumenthal (D-CT) Barbara Boxer (D-CA) Benjamin Cardin (D-MD) Dianne Feinstein (D-CA) Al Franken (D-MN) Herb Kohl (D-WI) Frank Lautenberg (D-NJ) Joseph Lieberman (Independent-CT) Carl Levin (D-MI) Bernie Sanders (Independent-VT) Charles Schumer (D-) NY

CASA DE REPRESENTANTES [27]

Gary Ackerman (D-NY) Shelley Berkley (D-NV) Howard Berman (D-CA) Eric Cantor (R-VA) David Cicilline (D-RI) Stephen Cohen (D-TN) Susan Davis (D-CA) T Deutch (D-FL) Eliot Engel (D-NY) Bob Filner (D-CA) Barney Frank (D-MA) Gabrielle Giffords (D-AZ) Jane Harman (D-CA) Steve Israel (D-NY) Sander Levin (D-MI) Nita Lowey (D-NY) Jerrold Nadler (D-NY) Jared Polis (D-CO) Steve Rothman (D-NJ) Jan Schakowsky (D-IL) Allyson Schwartz (D-IL D-PA) Adam Schiff (D-CA) Brad Sherman (D-CA) Debbie Wasserman Schultz (D-FL) Henry Waxman (D-CA) Anthony Weiner (D-NY) John Yarmuth (D-KY)

¡Y esos son sólo los demócratas! Estoy seguro de que los republicanos son igual de malos si no peores, pero parece más difícil encontrar información. Aquí hay otra lista: american3rdposition.com/?p=12767

He aquí una explicación de cómo esto solía no ser permitido, entonces la ley fue cambiada, y también señala a muchos grandes titulares de doble ciudadanía en las administraciones de Bush y Clinton: www.viewzone.com/dualcitizen.html

¿Por qué está permitido? No está permitido que los ciudadanos regulares de Estados Unidos tengan doble ciudadanía, ¿verdad?

Creo que este tipo de cosas están permitidas porque los sionistas “Israel primero” son esencialmente dueños de nuestro gobierno, lo cual es porque los Rothschild poseen el sistema bancario central y tienen poderes de creación de dinero y promueven el sionismo. Así que juegas según sus reglas, o no obtienes mucho acceso a los dineros. Esta es la razón por la que la mayoría de los monopolios de la industria están encabezados por sionistas. No es una posibilidad aleatoria de que las cimas de la mayoría de las industrias son super gung-ho sobre Israel. Esta es también la razón por la que reciben la mayor ayuda, y por qué tienen los grupos de cabildeo más grandes.

Y para ser claros, no estoy hablando de judíos, la mitad de los cuales rechazan el sionismo. Hablo del sistema de creencias ideológicas, que dice que el gobierno israelí merece poseer el Monte Sión, también conocido como que Palestina necesita ser removida y la seguridad regional para Israel necesita ser asegurada en el Medio Oriente. Obama es un sionista, Biden es un sionista. Bush es un sionista. También Hillary, y Trump, como sus discursos de AIPAC mostraron con toda claridad.

Estos grandes banqueros necesitan dejar de ser capaces de tirar de las cuerdas de todos, pero eso no se detendrá hasta que la gente se dé cuenta de que sus habilidades de creación de dinero se basan en narrativas legales que provienen de falsas esperanzas y la falsa apariencia de autoridad. El gobierno debería ser capaz de crear su propio dinero, no pedir prestado a un banco privado en un sistema de creación de dinero basado en deudas donde siempre habrá, matemáticamente, más deuda adeudada de la que existe dinero, lo que les da poder sobre el gobierno porque son los cobradores de deudas.

Todo esto es una farsa absurda para cualquiera que vea la verdad de ello.

“Es bastante bien que la gente de la nación no entienda nuestro sistema bancario y monetario, porque si lo hicieran, creo que habría una revolución antes de mañana por la mañana”.

www.reddit.com/r/conspiracy/comments/4zm640/why_do_so_many_us_politicians_have_dual_usisraeli/?st=jf1r0ugy&sh=17467c91

 por IWB

https://www.investmentwatchblog.com/89-of-our-senators-and-congress-hold-dual-citizenship-citizenship-with-israel/

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.

Los votos de Joe Biden violan la Ley de Benford

O dicho de otra manera, la ley y las estadísticas de Benford demuestran (o como mínimo, digamos, es bastante sospechoso) que Trump ganó las elecciones de 2020.

En los tres casos, los datos de Biden infringen la curva normal (puntos rojos). Los datos de Trump parecen estar bien.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

“Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico”.

https://www.msn.com/es-es/entretenimiento/noticias/la-extra%C3%B1a-muerte-por-coronavirus-de-un-anciano-argentino-que-viv%C3%ADa-aislado/ar-BB1aIm4l?ocid=msedgntp

The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

“Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, “said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, “he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, “the doctor recalled”.

Ex funcionarios “bipartidistas” de Washington insertos en el mundo privado revelaron su plan para desatar el caos si Trump gana las elecciones.

Un grupo de republicanos neoconservadores “bipartidistas” y demócratas del establishment han “simulado” múltiples escenarios de catástrofe para la elección de 2020, incluyendo una simulación en donde una clara victoria del titular provoca medidas “sin precedentes”, la cual podría ser tomada por la campaña de Biden para frustrar una nueva llegada al poder de Trump.

Por Whitney Webb 

Un grupo conformado por exfuncionarios de Gobierno insertos en el mundo privado del Partido Demócrata, por exfuncionarios de la era de Obama y Clinton y también por una facción de republicanos neoconservadores del movimiento “Nunca Trump” han realizado, durante los últimos meses, simulaciones y “juegos de guerra” sobre los diferentes escenarios apocalípticos de la elección de 2020. 

Según varios informes de los medios sobre el grupo, llamado Proyecto de Integridad en la Transición” (TIP, por su sigla en inglés), justifican estos ejercicios como una preparación específica para un escenario donde el presidente Trump pierde la elección del 2020 y se niega a dejar el poder, lo que causaría una posible crisis constitucional. Sin embargo, según documentos propios del TIP, incluso sus simulaciones que implican una “victoria clara”  para Trump en la próxima elección podrían causar una crisis constitucional, tal como predijeron la campaña de Biden, la cual haría movimientos atrevidos para asegurar la presidencia, sin importar el resultado de la elección.  

Esto es particularmente alarmante, dado que TIP tiene vínculos importantes con el gobierno de Obama, en donde Biden fue vicepresidente, así como con varios grupos que están fuertemente a favor de Biden, además de su campaña misma. En efecto, el hecho de que un grupo de exfuncionarios de gobierno insertos en el mundo privado que apoyan abiertamente a Biden hayan creado escenarios para posibles resultados electorales y sus consecuencias, todos terminando en Biden llegando a la presidencia o en una crisis constitucional, indica que fuerzas poderosas que influencian a la campaña del candidato demócrata lo impulsan a negarse de conceder la elección, incluso si la pierde.

Por supuesto, esto debilita gravemente la afirmación de TIP de garantizar la “integridad” en el proceso de transición presidencial y en cambio, indica que el grupo planea abiertamente la manera de asegurar que Trump deje la presidencia sin importar el resultado o la forma de fabricar la propia crisis constitucional que el grupo dice prevenir a través de sus simulaciones. 

Dichas preocupaciones se amplían por las recientes afirmaciones hechas por la candidata presidencial del 2016 del Partido Demócrata y ex secretaria de Estado del gobierno de Obama, Hillary Clinton, que dicen que Biden “no debe ceder bajo ninguna circunstancia”. “Creo que esto se prolongará, y creo que ,eventualmente, él ganará si no cedemos ni un centímetro, y si es que estamos igual de concentrados e implacables que el otro lado”, indicó Clinton en una entrevista con Showtime en septiembre.  El resultado de las simulaciones del TIP ha hecho un eco importante a las afirmaciones de Clinton de que Biden “eventualmente” ganará si el proceso para determinar el resultado de las elecciones se “prolonga”.

Los juegos de guerra unipartidistas

Los miembros del TIP se reunieron en junio para realizar cuatro “juegos de guerra” que simularon unas oscuras 11 semanas entre el día de la elección y la investidura presidencial en las cuales “Trump y sus aliados republicanos usaron todos los aparatos del gobierno, como el Servicio Postal, legisladores del Estado, el Departamento de Justicia, agentes federales y los militares, para mantenerse en el poder y los demócratas se tomaron las cortes y las calles para tratar de detenerlos”, según un informe de The Boston Globe.Sin embargo, una de estas simulaciones que examinó lo que podría ocurrir entre el día de la elección y el día de la investidura presidencial si Trump obtiene una “victoria clara”, mostró que el TIP no solamente simuló como los republicanos pueden usar todo lo que tengan a su disposición para “mantenerse en el poder”, también simuló cómo los demócratas podrían hacer lo mismo si no ganan la elección del 2020.

Si bien, algunos medios de comunicación principalmente de derecha, como este artículo de The National Pulse, señalaron que las simulaciones del TIP involucran a la campaña de Biden negándose a ceder, el documento del TIP sobre las maniobras reveló que se tomarán acciones específicas por parte de la campaña de Biden luego de que la campaña de Trump obtuviese una “victoria clara”. Como no es de extrañar, estas acciones podrían agravar las tensiones políticas actuales en los Estados Unidos, un resultado final que el TIP afirma que ellos fueron creados para evitarlo, lo que debilita la justificación oficial para sus simulaciones, junto con la razón oficial para la existencia del grupo.

En el escenario del TIP que muestra una victoria clara de Trump (véase la página 17), Joe Biden, dirigido en el juego de guerra por John Podesta, el director de la campaña del 2016 de Hilary Clinton, se retractó de su concesión de la noche de las elecciones y posteriormente convenció a “tres estados con gobernadores demócratas (Carolina del Norte, Wisconsin y Michigan) para que pidieran recuentos” Luego, los gobernadores de Wisconsin y Michigan “envió listas separadas de electores para contrarrestar a los enviados por la legislatura estatal” al Colegio Electoral, en donde Trump había ganado, en un intento de debilitar, si no evitar, esa victoria.

Luego, “la campaña de Biden alentó a los estados del oeste, particularmente a California, pero también a Oregon y Washington, que colectivamente se conocen como “Cascadia”, a separarse de la Unión a menos que los republicanos del Congreso accedieran a hacer un conjunto de reformas estructurales. (de una manera enfática)”. Posteriormente “aconsejado por el ex presidente Obama”, la campaña de Biden estableció esas “reformas” de la siguiente manera:

  1. Otorgar condición de Estado a Washington, DC y Puerto Rico.
  2. Dividir a California en cinco estados “para representarlos en el Senado de una manera mucho más fiel a su población.
  3. Exigir que los jueces de la Corte Suprema se jubilen a los 70.
  4. Eliminar el Colegio Electoral

En otras palabras, éstas “reformas estructurales” implican la creación de lo que esencialmente equivale a tener a Estados Unidos compuesto por 56 estados, con los nuevos estados establecidos para asegurar una mayoría continua para los demócratas, ya que sólo las áreas con una mayoría demócrata (DC, Puerto Rico y California) reciben la estatidad. Destacadamente, en otros escenarios donde Biden gana el Colegio Electoral, los demócratas no apoyaron su eliminación. 

También es destacado el hecho de que, en esta simulación, el TIP culpó a la campaña de Trump por la decisión de los demócratas por haber tomado “acciones provocativas y sin precedentes” expuestas anteriormente, al afirmar que tal campaña había “creado las condiciones para forzar a que la campaña de Biden” tome estas acciones al hacer ciertas cosas, como dar “una entrevista” a The Intercept en donde Trump indicó que el habría perdido la elección si es que Bernie Sanders hubiese sido nominado” como candidato presidencial demócrata, en vez de Biden.  

El TIP también afirmó que la campaña de Trump buscaría pintar estas “acciones provocativas y sin precedentes” como “un intento de los demócratas de intentar orquestar un golpe de estado ilegal”, a pesar de que eso es esencialmente lo que implican todas estas acciones. De hecho, otras simulaciones en donde la campaña de Trump se comportó en esta línea, la retórica del TIP sobre esta categoría de acciones extremas es claramente diferente.

Sin embargo, las acciones simuladas de la campaña de Biden en este escenario no terminaron allí. Posteriormente la campaña de Biden “provocó un colapso en la sesión conjunta del Congreso (el 6 de enero) al lograr que la Cámara de Representantes acordara otorgarle la presidencia a Biden”, y agregó que esto se” basó en las presentaciones alternativas con apoyo a Biden enviada a los gobernadores que apoyan al ex vicepresidente. Obviamente, el Partido Republicano no consintió e indicó que Trump había ganado la elección a través de su victoria en el Colegio Electoral. En la simulación de la “victoria clara de Trump” terminó con ningún presidente electo para la investidura del 20 de enero, con el TIP indicando que “no está claro lo que harían los militares en esta situación”. 

Por supuesto que algunos miembros de TIP, incluyendo a la cofundadora Rosa Brooks, ex-consejera del Pentágono en la era de Obama y actual miembro del think tank “New America”, tienen su preferencia en “que harían los militares en esta situación.” Por ejemplo, Brooks,  escribiendo 2 semanas después de la investidura de Trump del año 2017, explicó en Foreign Policy que “un golpe militar o al menos una negación de ciertas órdenes de parte de los militares” fue una de las cuatro posibilidades de remover a Trump del mandato previa a la elección del 2020.

¿Quién está detrás del TIP?

El TIP se creó a fines del año 2019 supuestamente “debido a la preocupación de que la Administración de Trump pueda manipular, ignorar, debilitar o interrumpir las elecciones presidenciales del 2020 y su proceso de transición.  Fue cofundado por Rosa Brooks junto con Nils Gilman y su actual directora es Zoe Hudson.  Brooks, como se mencionó previamente, fue consejera para el Pentágono y para el Departamento de Estado dirigido por Hilary Clinton durante el gobierno de Obama. Rosa también formó parte del consejo general del presidente del Instituto Open Society (OSF, por su sigla en inglés), una organización polémica financiada por el multimillonario George Soros. Zoe Hudson, directora del TIP, también es una figura importante en el OSF desempeñándose como analista política superior y enlace entre las fundaciones y el gobierno de los Estados Unidos por 11 años.

Los vínculos del OSF con el TIP son una bandera roja por un número de razones, concretamente debido al hecho de que el OSF y otras organizaciones financiadas por Soros tuvieron un rol fundamental en fomentar las llamadas “revoluciones de colores” para derrocar a gobiernos no alineados, particularmente durante el gobierno de Obama. Ejemplos de vínculos del OSF con todas estas “revoluciones” fabricadas, incluyendo la de Ucrania en el 2014y la “Primeravera Arabe,” que empezó el año 2011 y vio a varios gobiernos en el Medio Oriente y África del Norte que eran problemáticos para los intereses occidentales convenientemente quitados del poder.  

Unos correos filtrados posteriormente revelaron los estrechos vínculos entre Soros y la ex-secretaria de Estado Hilary Clinton, incluyendo un correo electrónico en el que Soros dirigió la política de Clinton al respecto de los disturbios en Albania, diciéndole que “se necesitan hacer dos cosas urgentemente” que eran “hacer que todo el peso de la comunidad internacional recaiga sobre el primer ministro Berisha” y “nombrar a un alto funcionario europeo como mediador”. Ambas tareas “urgentes” fueron perpetradas posteriormente por Clinton, posiblemente, a petición de Soros.

Además de sus vínculos con el gobierno de Obama y el OSF, Brooks es actualmente una académica en el  Instituto de Guerra Moderna de la Academia Militar de West Point, en donde se enfoca en “la relación entre los militares y la política interna” y también en el Programa de Innovación y Liderazgo de la Universidad de Georgetown. Actualmente ella es un actor clave en el empuje liderado por OSF para “capitalizar” los llamados legítimos de la reforma policial para justificar la creación de una policía federalizada con el pretexto de retirar fondos o eliminar departamentos de policía locales. El interés de Brooks por la “difusa línea” entre los militares y la policía es importante dado por su defensa pasada hacia un golpe militar para remover a Trump del mandato y la conclusión posterior del TIP que los militares “podrían” intervenir si Trump logra ganar la elección del 2020, según los “juegos de guerra” del grupo descritos con anterioridad.

Brooks también es una alta miembro del think tank New America. La declaración de misión de New America señala que la organización está enfocada en “enfrentar de forma honesta los desafíos causados por el rápido cambio tecnológico y social, y aprovechar las oportunidades que esos cambios crean”. Está financiado en gran parte por multimillonarios de Silicon Valley, incluidos Bill Gates (Microsoft), Eric Schmidt (Google), Reid Hoffman (LinkedIn), Jeffrey Skoll y Pierre Omidyar (eBay). Además, ha recibido millones directamente del Departamento de Estado de los EE. UU. para investigar la “clasificación de los derechos digitales”. En particular, de estos patrocinadores, Reid Hoffman fue sorprendido “entrometiéndose” en las primarias demócratas más recientes para debilitar la candidatura de Bernie Sanders durante el Caucus de Iowa y mientras otros, como Eric Schmidt y Pierre Omidyar, son conocidos por sus estrechos vínculos con la familia Clinton e incluso por vínculos con la campaña de Hillary Clinton en 2016.

Los nunca trumpistas

Además de Brooks, el otro cofundador de TIP es Nils Gilman, quien es el actual vicepresidente de proyectos del Instituto Berggruen y que antes trabajó para Salesforce, una importante empresa contratista gubernamental y de tecnología. Gilman está particularmente enfocado en la inteligencia artificial y el transhumanismo. De hecho, hace poco le dijo al New York Times que su trabajo en el Instituto Berggruen se centra en “construir [unas] redes transnacionales de filósofos + tecnólogos + políticos + artistas que están pensando en cómo las IA y la edición de genes están transfigurando lo que significa ser un humano”. Nicholas Berggruen, quien le da su nombre al Instituto Berggruen, es parte de la facción liderada por multimillonarios, junto con Steve Schwarzman y Eric Schmidt de Blackstone. Todos ellos buscan desarrollar las IA y la llamada “Cuarta Revolución Industrial” en conjunto con los líderes políticos y la élite económica de China.

Ellos critican y rivalizan con aquellos en el bando “nacionalista” con respecto a las IA y China, el cual prefiere “ignorar” de forma agresiva las capacidades del país asiático en cuanto a las IA, con el objetivo de mantener la hegemonía global de Estados Unidos frente a un “nuevo orden” promovido por Berggreun, Schmidt, Schwarzman y Henry Kissinger, otro miembro clave de la facción de la “cooperación”. La batalla por la futura política estadounidense de IA con respecto a China parece ser una de las razones principales, aunque enormemente ignorada, de la antipatía que los miembros de la facción de la “cooperación” le tienen a Trump, incluidos los que contratan a los fundadores del TIP. Esto se debe a la tendencia del presidente de los EE. UU. a apoyar, al menos de forma pública, las políticas “America First” y de aumentar las tensiones con China. Por el contrario, la familia Biden invierte en las empresas chinas de IA, lo que indica que Biden estría más dispuesto en seguir los intereses de la facción de la “cooperación” que los de Trump.

Si bien las identidades de los fundadores y el actual director del TIP se han hecho públicas, su lista completa de miembros es desconocida. Sin embargo, la organización “hermana” del TIP, llamada Grupo de Trabajo Nacional sobre Crisis Electorales (NTFEC, por sus siglas en inglés), cuenta con una lista pública de sus miembros y también se sabe que varios de ellos son miembros de TIP. Algunos de estos miembros coincidentes son Michael Chertoff, exjefe del Departamento de Seguridad Nacional (DHS, por sus siglas en inglés), Michael Steele, ex presidente del Comité Nacional Republicano, y Lawrence Wilkerson, jefe de gabinete del exsecretario de Estado, Colin Powell. Chertoff, Steele y Wilkerson, a pesar de ser republicanos, son parte del movimiento llamado “Nunca Trump”, al igual que otros conocidos miembros del TIP que son del mismo partido. Por lo tanto, si bien la naturaleza “bipartidista” del TIP puede se precisa en términos de afiliación partidaria, todos sus miembros conocidos, independiente de su partido, están unidos por su oposición a otro mandato del actual presidente.

Otros miembros conocidos del TIP son David Frum (the Atlantic), William Kristol (Proyecto para el Nuevo Siglo Estadounidense, The Bulwark), Max Boot (the Washington Post), Donna Brazile (ex-CND), John Podesta (es director de campaña de Clinton en 2006), Chuk Hagel (ex Secretario de Defensa), Reed Galen (cofundador del Proyecto Lincoln) y Norm Ornstein (American Enterprise Institute).

De sus miembros más conocidos, el más directo es Lawrence Wilkerson, quien se ha convertido a sí mismo en el portavoz “no oficial” del grupo, al haber hecho la mayoría de las entrevistas con los mediosdonde le hizo promoción al grupo y sus “juegos de guerra”. En una entrevista a finales de junio con el periodista Paul Jay, Wilkerson señala que el TIP carece de transparencia y que, además de sus “juegos de guerra”, sus otras actividades son en gran parte confidenciales.

Específicamente declaró que:

“Existe cierta confidencialidad sobre lo que acordamos hacer público, lo que hemos hecho público y quien es el responsable de eso, y otros aspectos de nosotros haciendo eso. Hasta este punto el Proyecto de Integridad de Transición es muy, muy cercano, completo y confidencial”.

En esa misma entrevista, Wilkerson también señaló que la actual “combinación de eventos” que involucran los recientes disturbios en varias ciudades de Estados Unidos, la crisis del coronavirus, el debate nacional sobre la vigilancia policial, la recesión económica y las elecciones de 2020 fueron la base para una revolución en los EEUU. Él le dijo a Jay que:

 “Quiero decir que así es como son las cosas, como 1917 y Rusia, como 1979 y Teherán y como 1789 en Francia. Así es como comienzan este tipo de cosas. Así que debemos tener mucho cuidado con la forma en la que tratamos con estos asuntos. Y eso me preocupa porque no tenemos un individuo muy cuidadoso en la Casa Blanca”.

Caos preplanificado: ¿quién se beneficia?

Si bien es realmente posible que en caso de una clara victoria de Biden, el presidente Trump puede negarse a dejar la Casa Blanca o tomar otras acciones que desafíen la fe de muchos estadounidenses en el sistema electoral nacional. Sin embargo, aunque en el TIP afirman que están específicamente preocupados de esta eventualidad y de “salvaguardar” la democracia sin favorecer a ninguno de los candidatos, claramente no es el caso, ya que su simulación de una clara victoria de Trump muestra ese comportamiento extremo y “antidemocrático”, en su opinión tal comportamiento es permisible si evita otros cuatro años de Trump en el mandato. Sin embargo, este claro doble estándar revela que un grupo influyente de ex funcionarios “bipartidistas” de gobierno insertos en el sector privado tiene la intención de crear una “crisis constitucional” si Trump gana y están planeando una crisis similar independientemente de los resultados de las elecciones de 2020.

Mucho antes de que surgiera el TIP o cualquiera de sus grupos afiliados para realizar estas simulaciones electorales apocalípticas, otros grupos participaron de forma similar en “juegos de guerra” que predijeron un completo caos en los Estados Unidos el día de las elecciones, así como la imposición de la ley marcial seguida de la aparición de disturbios y desórdenes sin precedentes en el país.

Varios de estos los detallé en una serie a principios de este año, donde me enfoque  principalmente en las simulaciones de la “Operación Blackout” realizadas por la empresa estadounidense-israelí Cybereason. Esa empresa tiene vínculos considerables con la inteligencia estadounidense e israelí y su mayor inversor es Softbank. En particular, Softbank es nombrado por la Comisión de Seguridad Nacional sobre IA de los EE. UU. (NSCAI, por su sigla en inglés) liderada por Eric Schmidt como la “columna vertebral” de un marco global de empresas impulsadas por IA favorecidas por la facción de la “cooperación” como un medio para promulgar la “Cuarta Revolución Industrial” en colaboración con la élite económica y política de China.

Además de Cybereason, varios informes de los principales medios de comunicación y una serie de “predicciones” sospechosas de la inteligencia de los Estados Unidos y otras agencias federales publicadas el año pasado habían sembrado la narrativa que las elecciones de 2020 no solo fracasarían de forma espectacular, sino que la democracia estadounidense “nunca se recuperaría”. Actualmente, con las simulaciones del TIP agregadas a la mezcla y el advenimiento del caos previamente predicho en todo el país con las próximas elecciones de 2020, está claro que las elecciones del 3 de noviembre no solo serán un completo desastre, sino que eso estaba planificado de antemano.

La pregunta entonces es, ¿quién se beneficia del caos total durante y después de las elecciones de 2020? Como señaló el TIP en varias de sus simulaciones, el papel poselectoral de los militares en términos de vigilancia nacional. Por cierto, la experiencia exacta de la cofundadora del TIP, Rosa Brooks, cobra gran importancia, ya que la mayoría de las simulaciones electorales apocalípticas antes mencionadas terminaron con la imposición de la ley marcial o la intervención de los militares para volver al orden y supervisar la transición.

El marco nacional para imponer la ley marcial en los EE. UU., a través de los protocolos de “continuidad del gobierno”, se activó a principios de este año bajo el disfraz de la crisis del coronavirus y sigue en vigor. Actualmente, una serie de grupos profundamente ligados al establishment de Washington, las agencias de inteligencia nacionales y extranjeras han predicho las formas exactas para diseñar una elección fallida y manipular sus consecuencias.

¿Quién sería el más beneficiado con la imposición de la ley marcial en los Estados Unidos? Yo diría que uno no necesita mirar más allá de la batalla dentro de las facciones de poder de Washington sobre el futuro de las IA, tema que el sector público, privado y los prominentes think tank consideraron de importancia crítica para la seguridad nacional. La NSCAI liderada por Schmidt y otros organismos que determinan las políticas sobre IA del país planean implementar una serie de políticas a las que la mayoría de los estadounidenses se resistirán, estas van desde la eliminación de la propiedad individual de automóviles hasta la eliminación del dinero en efectivo, así como la imposición de sistema de vigilancia orwelliana, entre otras cosas.

Todas estas agendas han avanzado bajo el disfraz de combatir el coronavirus, pero su progreso sólo puede seguir usando esa justificación durante un tiempo. Para grupos como la NSCAI, los estadounidenses deben dar la bienvenida a estos avances impulsados por las IA, incluso si eso significa que los ciudadanos se enfrentan a perder sus trabajos o sus libertades civiles. De lo contrario, estos grupos y sus multimillonarios patrocinadores argumentan que a Estados Unidos se le “dejará fuera” y se le “dejará atrás” cuando llegue el momento de establecer los nuevos estándares globales para la tecnología de las IA, ya que la creciente industria de IA de China, la cual se alimenta de su propia implementación de estas tecnologías, superará a la de EE. UU. Al mantener a los estadounidenses enojados y distraídos por la división partidista a través del caos electoral preplanificado, un “Nuevo Estados Unidos” espera entre bastidores, uno que se avecina independientemente de lo que suceda el día de las elecciones. Por su puesto, eso pasará a menos de que los estadounidenses se den cuenta de la treta.

Autor: Whitney Webb

Whitney Webb ha sido escritora profesional, investigadora y periodista desde 2016. Ha escrito para varios sitios web y, de 2017 a 2020, fue escritora y reportera senior de investigación para Mint Press News. Actualmente escribe para The Last American Vagabond.

Arzobispo Viganò: Carta abierta a Donald Trump, advierte sobre el “Gran Reinicio”.

DONALD J. TRUMP

Domingo, 25 de octubre de 2020

Presidente

Permítanme dirigirme a ustedes en esta hora en la que el destino de todo el mundo está siendo amenazado por una conspiración global contra Dios y la humanidad. Os escribo como arzobispo, como Sucesor de los Apóstoles, como antiguo nuncio apostólico en los Estados Unidos de América. Os escribo en medio del silencio de las autoridades civiles y religiosas. Que acepten estas palabras mías como la “voz de uno que grita en el desierto” (Jn 1, 23).

Como dije cuando les escribí mi carta en junio, en este momento histórico las fuerzas del Mal se alinean en una batalla sin cuartel contra las fuerzas del Bien; fuerzas del Mal que parecen poderosas y organizadas al oponerse a los hijos de la Luz, que están desorientados y desorganizados, abandonados por sus líderes temporales y espirituales.

Todos los días sentimos que los ataques se multiplican de aquellos que quieren destruir la base misma de la sociedad: la familia natural, el respeto por la vida humana, el amor al país, la libertad de educación y de los negocios. Vemos a los jefes de naciones y líderes religiosos atorándose a este suicidio de la cultura occidental y su alma cristiana, mientras que los derechos fundamentales de los ciudadanos y los creyentes son negados en nombre de una emergencia de salud que se está revelando cada vez más plenamente como instrumental para el establecimiento de una tiranía inhumana sin rostro.

Un plan global llamado Gran Reinicio está en marcha. Su arquitecto es una élite global que quiere someter a toda la humanidad, imponiendo medidas coercitivas con las que limitar drásticamente las libertades individuales y las de poblaciones enteras. En varias naciones este plan ya ha sido aprobado y financiado; en otros todavía está en una etapa temprana. Detrás de los líderes mundiales que son los cómplices y ejecutores de este proyecto infernal, hay personajes sin escrúpulos que financian el Foro Económico Mundial y el Evento 201,promoviendo su agenda.

El propósito del Gran Reinicio es la imposición de una dictadura de la salud con el objetivo de la imposición de medidas liberticidas, ocultas detrás de tentadoras promesas de asegurar un ingreso universal y cancelar la deuda individual. El precio de estas concesiones del Fondo Monetario Internacional será la renuncia a la propiedad privada y la adhesión a un programa de vacunación contra Covid-19 y Covid-21 promovido por Bill Gates con la colaboración de los principales grupos farmacéuticos. Más allá de los enormes intereses económicos que motivan a los promotores del Gran Restablecimiento,la imposición de la vacunación irá acompañada de la exigencia de un pasaporte sanitario y un DNI digital, con el consiguiente rastreo de contactos de la población de todo el mundo. Aquellos que no acepten estas medidas serán confinados en campos de detención o puestos bajo arresto domiciliario, y todos sus bienes serán confiscados.

Señor Presidente, me imagino que ya es consciente de que en algunos países se activará el Gran Restablecimiento entre finales de este año y el primer trimestre de 2021. Para ello, se prevén nuevos bloqueos, que se justificarán oficialmente con una supuesta segunda y tercera oleada de la pandemia. Ustedes son muy conscientes de los medios que se han desplegado para sembrar pánico y legitimar las limitaciones draconianas a las libertades individuales, provocando artísticamente una crisis económica mundial. En las intenciones de sus arquitectos, esta crisis servirá para que el recurso de las naciones al Gran Reinicio sea irreversible, dando así el golpe final a un mundo cuya existencia y muy memoria quieren cancelar por completo. Pero este mundo, señor Presidente, incluye personas, afectos, instituciones, fe, cultura, tradiciones e ideales: personas y valores que no actúan como autómatas, que no obedecen como máquinas, porque están dotados de un alma y un corazón, porque están unidos por un vínculo espiritual que extrae su fuerza de arriba, de ese Dios que nuestros adversarios quieren desafiar, tal como Lucifer hizo al principio de los tiempos con “suno serma”.

Muchas personas, como bien sabemos, están molestas por esta referencia al choque entre el Bien y el Mal y el uso de matices “apocalípticos”, que según ellos exaspera espíritus y agudiza las divisiones. No es de extrañar que el enemigo se enoje por ser descubierto justo cuando cree que ha llegado a la ciudadela que busca conquistar sin perturbaciones. Lo sorprendente, sin embargo, es que no hay nadie que haga sonar la alarma. La reacción del estado profundo a quienes denuncian su plan está rota e incoherente, pero comprensible. Justo cuando la complicidad de los medios de comunicación convencionales había logrado hacer la transición al Nuevo Orden Mundial casi indoloro y desapercibido, todo tipo de engaños, escándalos y crímenes están saliendo a la luz.

Hasta hace unos meses, era fácil desprestigorarse como “teóricos de la conspiración” aquellos que denunciaron estos terribles planes, que ahora vemos que se llevan a cabo hasta el más mínimo detalle. Nadie, hasta el pasado mes de febrero, hubiera pensado que, en todas nuestras ciudades, los ciudadanos serían arrestados simplemente por querer caminar por la calle, respirar, querer mantener sus negocios abiertos, querer ir a la iglesia el domingo. Sin embargo, ahora está sucediendo en todo el mundo, incluso en la Italia de postales que muchos estadounidenses consideran un pequeño país encantado, con sus monumentos antiguos, sus iglesias, sus ciudades encantadoras, sus pueblos característicos. Y mientras los políticos están atrincherados dentro de sus palacios promulgando decretos como sátrapas persas, las empresas están fallando, las tiendas están cerrando y se impide que la gente viva, viaje, trabaje y ore. Las desastrosas consecuencias psicológicas de esta operación ya se están viendo, comenzando con los suicidios de empresarios desesperados y de nuestros hijos, segregados de amigos y compañeros de clase, que se les dice que sigan sus clases mientras se sientan en casa solo frente a una computadora.

En la Sagrada Escritura, san Pablo nos habla de “el que se opone” a la manifestación del misterio de la iniquidad,el kath-kon (2 Tes 2, 6-7). En el ámbito religioso, este obstáculo para el mal es la Iglesia, y en particular el papado; en el ámbito político, son los que impiden el establecimiento del Nuevo Orden Mundial.

Como ahora está claro, el que ocupa la Cátedra de Pedro ha traicionado su papel desde el principio para defender y promover la ideología globalista, apoyando la agenda de la iglesia profunda, que lo eligió de sus filas.

Señor Presidente, usted ha declarado claramente que desea defender a la nación : Una Nación bajo Dios,libertades fundamentales y valores innegociables que se niegan y luchan contra hoy. Eres tú, querido Presidente, quien es “el que se opone” al estado profundo, el asalto final de los hijos de las tinieblas.

Por esta razón, es necesario que todas las personas de bien sean persuadidas de la importancia de la época de la inminente elección: no tanto por el bien de este o de ese programa político, sino por la inspiración general de vuestra acción que mejor encarna , en este contexto histórico particular, ese mundo, nuestro mundo, que quieren cancelar por medio del encierro. Vuestro adversario es también nuestro adversario: es el enemigo de la raza humana, el que es “un asesino desde el principio” (Jn 8, 44).

A tu alrededor están reunidos con fe y coraje aquellos que te consideran la guarnición final contra la dictadura mundial. La alternativa es votar por una persona que es manipulada por el estado profundo, gravemente comprometida por escándalos y corrupción, que hará a los Estados Unidos lo que Jorge Mario Bergoglio está haciendo a la Iglesia, el Primer Ministro Conte a Italia, el Presidente Macron a Francia, el Primer Ministro Sánchez a España, y así sucesivamente. La naturaleza chantajable de Joe Biden, al igual que la de los prelados del “círculo mágico” del Vaticano, lo expondrá a ser utilizado sin escrúpulos, permitiendo que los poderes ilegítimos interfieran tanto en la política interna como en los equilibrios internacionales. Es obvio que aquellos que lo manipulan ya tienen a alguien peor que él listo, con quien lo reemplazarán tan pronto como surja la oportunidad.

Y sin embargo, en medio de este panorama sombrío, surge este avance aparentemente imparable del “Enemigo Invisible”, un elemento de esperanza. El adversario no sabe amar, y no entiende que no sea suficiente asegurar un ingreso universal o cancelar hipotecas para subyugar a las masas y convencerlas de que sean marcadas como ganado. Este pueblo, que durante demasiado tiempo ha soportado los abusos de un poder odioso y tiránico, está redescubriendo que tiene un alma; entiende que no está dispuesto a intercambiar su libertad para la homogeneización y cancelación de su identidad; está empezando a entender el valor de los lazos familiares y sociales, de los lazos de fe y cultura que unen a las personas honestas. Este Gran Restablecimiento está destinado a fracasar porque los que lo planearon no entienden que todavía hay gente dispuesta a tomar las calles para defender sus derechos, para proteger a sus seres queridos, para dar un futuro a sus hijos y nietos. La inhumanidad nivelada del proyecto globalista se destrozará miserablemente frente a la firme y valiente oposición de los hijos de la Luz. El enemigo tiene a Satanás de su lado, Aquel que sólo sabe odiar. Pero de nuestro lado, tenemos al Señor Todopoderoso, el Dios de los ejércitos dispuestos para la batalla, y la Santísima Virgen, que aplastará la cabeza de la antigua Serpiente. “Si Dios es para nosotros, ¿quién puede estar contra nosotros?” (Rm 8:31).

Señor Presidente, usted es muy consciente de que, en esta crucial hora, los Estados Unidos de América se consideran el muro defensor contra el que se ha desatado la guerra declarada por los defensores del globalismo. Pon tu confianza en el Señor, fortalecido por las palabras del apóstol Pablo: “Puedo hacer todas las cosas en Aquel que me fortalece” (Flp 4, 13). Ser un instrumento de la Divina Providencia es una gran responsabilidad, por la cual sin duda recibirás todas las gracias de estado que necesitáis, ya que están siendo fervientemente implorados para vosotros por las muchas personas que te apoyan con sus oraciones.

Con esta esperanza celestial y la seguridad de mi oración por vosotros, por la Primera Dama y por vuestros colaboradores, con todo mi corazón os envío mi bendición.

¡Dios bendiga a los Estados Unidos de América!

+ Carlo Maria Viganò

Teta Arzobispo de Ulpiana

Ex Nuncio Apostólico en los Estados Unidos de América

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.