Dra. Rubik, COVID-19 y exposición a RADIACIÓN inalámbrica


Desde el año 2014 la Doctora Rubik, catedrática de biofísica y fundadora y directora del Institute for Frontier Science, ha estado investigando los efectos que tiene la radiación de los teléfonos móviles en las células humanas. Ella ha descubierto que la sangre cambia negativamente por la radiación inalámbrica. En lugar de fluir libremente la sangre en los capilares, se forman coágulos y la sangre se vuelve pegajosa; por ejemplo, llevar una mochila con un móvil 4G de 45 minutos cambia la fluidez de la sangre. Las personas mayores de 40 años mostraron peores síntomas que las personas más jóvenes. A largo plazo, este tipo de radiación contribuye a problemas cardiovasculares con ataques cardíacos y accidentes cerebrovasculares como resultado.

El método se basa en estudios bibliográficos de informes de investigación en curso sobre la fisiopatología desarrollados a través de Covid-19 en 2020 (MD Robert R. Brown), y en más de 250 informes de investigación revisados por pares de 1969-2020 sobre posibles efectos biológicos de radiofrecuencia por radiación, radiación inalámbrica. etc , en exposición a células tanto experimentales como humanas.

Se han realizado estudios a largo plazo con una conexión militar en Rusia desde 1969 y fueron traducidos por la CIA e ingresados en sus archivos como información técnica de defensa a principios de la década de 2000. La doctora Rubik estudió estos informes, pero también los informes de investigación de la sociedad civil, por ejemplo, sobre trabajadores que se enfermaron cuando se instalaron o estuvieron expuestos a Radiación electromagnética.

Los estudios de los informes de investigación de Rubik y Brown se analizaron por separado. Luego se comparó la fisiopatología del Covid-19 con la exposición a Radiación a nivel celular, encontrando y organizando cinco categorías: cambios sanguíneos y vasculares, estrés oxidativo, sistema inmunológico, aumento de los niveles de calcio y arritmias cardíacas.

La presentación clínica del Covid-19 varía mucho con una amplia gama de manifestaciones, que van desde síntomas leves: dolor de garganta, dolor de cabeza, fiebre, secreción nasal, tos, dolor articular leve, dolor de estómago, pérdida del gusto y el olfato … a otros más severos como dificultad para respirar, fiebre alta y gran cansancio.

En un gran estudio, el 80% mostró síntomas leves o ninguno, mientras que especialmente la población anciana y aquellos con enfermedades subyacentes como presión arterial alta, diabetes y obesidad tienen un mayor riesgo de enfermedad grave.

El síndrome de dificultad respiratoria aguda (SDRA) puede ocurrir rápidamente y causar dificultad respiratoria severa cuando las células endoteliales en las paredes internas de los vasos sanguíneos y las células epiteliales en las paredes internas de las vías respiratorias pierden su vida útil y el líquido rico en proteínas se filtra a los sacos de aire adyacentes.

El Covid-19 puede causar hipoxia, niveles insuficientes de oxígeno, que se han visto en hasta un 80% de los pacientes con dificultad respiratoria en la unidad de cuidados intensivos, según un informe escrito por el Doctor Gattinoni a finales de 2020. Se ha observado una disminución de la oxigenación y niveles elevados de dióxido de carbono en la sangre de los pacientes, aunque la etiología de estos hallazgos sigue sin estar clara. En radiografías y tomografías computarizadas en pacientes con Covid-19, se ha observado daño oxidativo masivo en los pulmones.

Este estrés celular indica una etiología, la causa de la enfermedad, más de naturaleza bioquímica que de virus (Dr. Cavezzi et al, 2020). Debido a que la propagación del virus puede adherirse a las células que contienen un receptor ACE-2 (enzima convertidora de angiotensina 2), la enfermedad puede propagarse y dañar órganos y tejidos blandos en todo el cuerpo, incluidos: pulmones, corazón, intestinos, riñones, grasa, testículos y ovarios. La enfermedad puede aumentar una inflamación sistemática y producir una condición de hipercoagulabilidad, es decir, una condición en la que la sangre se coagula. Sin el uso de anticoagulantes, esto puede ser fatal. (Dr. Bikdeli et al, 2020)

Los organismos son seres electroquímicos y ante una radiación de baja frecuencia de sistemas de comunicación inalámbricos como antenas de teléfonos móviles, estaciones base, WiFi, teléfonos móviles, etc. pueden interferir con muchas funciones fisiológicas, desde niveles moleculares hasta celulares, fisiológicos, conductuales y psicológicos.

Varios estudios muestran efectos nocivos para la salud que incluyen riesgo de cáncer, cambios endocrinos, aumento de la producción de radicales libres, daño al ADN, cambios en el sistema reproductivo, errores de aprendizaje y memoria y trastornos neurológicos.

La literatura científica revisada por pares en todo el mundo, que cubre más de 5,000 estudios, ha documentado evidencia de efectos biológicos dañinos de la exposición a radiación electromagnética, incluidas las frecuencias de la tecnología 5G, durante décadas. La mayoría son encuestas estadounidenses. Se han realizado estudios que abarcan solo unas pocas semanas o menos y se han realizado muy pocos estudios a largo plazo en animales y seres humanos.

Estudios a largo plazo que duraron meses realizados en animales de experimentación en la Unión Soviética y Europa del Este entre 1969 y 1970. Las enfermedades por exposición a Radiación se han documentado desde el uso temprano del radar y los científicos rusos hablan de “enfermedad de las ondas de radio”. Estos estudios rusos muestran un impacto biológico significativo incluso a niveles de exposición 100 veces inferiores a 1 mW/cm cuadrado.

Se producen un fenómeno durante la exposición prolongada a baja frecuencia sorprendente:

La sangre se coagula y se vuelve pegajosa, causando una coagulación vascular, es decir, la sangre no fluye con tanta libertad. Disminuye la oxigenación de los órganos internos, incluido el cerebro.

La siguiente tabla muestra los síntomas comunes del Covid-19 y los correspondientes efectos biológicos adversos de la exposición a Radiación electromagnética. Estos efectos se delimitan en la tabla en las cinco categorías de cambios sanguíneos y vasculares; estrés oxidativo; sistema inmunitario; aumento de los niveles de calcio (Ca2+), arritmias cardíacas, pero se debe enfatizar que estos tienen efectos superpuestos. Algunos ejemplos son la coagulación y la inflamación de la sangre. El estrés oxidativo está implicado en los cambios morfológicos de los eritrocitos, así como en la hipercoagulación, la inflamación y el daño orgánico.

La neumonía que se produce en relación con el Covid-19 no es del tipo de nuestra ‘vieja neumonía’ clásica, dice Beverly Rubik. No, se caracterizan porque la sangre se vuelve “pegajosa y coagula”. La sangre fluye mal. Las células sanguíneas no son capaces de absorber el oxígeno adecuadamente, se produce una neumonía y el paciente puede morir por asfixia si no se toman medidas rápidas.

Por lo tanto, el Covid-19 no es solo una enfermedad viral, sino también una enfermedad de la sangre. El corazón también tiene receptores especiales a los que el SARS-CoV 2 se une con arritmias como resultado.

Beverly Rubik cree que las redes 5G deberían desmantelarse de inmediato por el bien de nuestra salud, pero en cambio se están expandiendo cada vez más. Se ampliarán las estaciones base y se instalarán pequeñas antenas en los tejados de cada bloque, lo que cambiará todo nuestro planeta. Además de las muertes de insectos y aves, todas las infecciones virales futuras se verán agravadas por la Radiación electromagnética que abre los canales de iones de calcio en las células y deja entrar el virus.

Más de 100.000 satélites orbitarán en el espacio para cubrir la tecnología 5G. Todo el planeta tierra está rodeado de microfrecuencias como la del 5G. Todo el campo electromagnético alrededor de la Tierra cambiará y afectará tanto al Covid-19 como a otros virus futuros.

Entrando en el informe de investigación publicado, se puede hacer el siguiente resumen:

La política de salud pública sobre el COVID-19 se ha centrado en el virus SARS-CoV-2 y sus efectos en la salud humana, mientras que los factores ambientales han sido en gran parte ignorados. Al considerar la tríada epidemiológica (agente-huésped-medio ambiente) aplicable a todas las enfermedades, investigamos una posible factor ambiental en la pandemia COVID-19: radiofrecuencia ambiental y Radiación de los sistemas de comunicación inalámbricos, incluidas las microondas y ondas milimétricas.

El COVID-19 apareció en Wuhan, [China] poco después de la implementación de la tecnología 5G en toda la ciudad (quinta generación de radiación inalámbrica), y difundirse globalmente, demostrando una correlación estadística entre comunidades con antenas 5G ya instaladas. En este estudio, se examina la revisión de la literatura científica sobre los efectos biológicos perjudiciales de la radiofrecuencia y la radiación (RFR) e se identificó varias formas en las que la RFR puede ser el factor que contribuye al COVID-19 como cofactor ambiental tóxico.

Concluimos que la RFR y, en particular la tecnología 5G, ha exacerbado la prevalencia y gravedad de COVID-19 al debilitar la inmunidad del huésped y aumentando la virulencia del SARS-CoV-2:

– causando cambios morfológicos en los eritrocitos, incluidos los equinocitos y formación de rouleaux que puede estar contribuyendo a la hipercoagulación;

– perjudicando la microcirculación y reducir los niveles de hemoglobina y eritrocitos por exacerbación de la hipoxia;

– amplificando la disfunción del sistema inmunológico, que incluye inmunosupresión, autoinmunidad e hiperinflamación;

– aumentando estrés oxidativo celular y la producción de radicales libres que exacerban la lesión vascular y daño de órganos;

– aumentando el Ca 2+ intracelular esencial para la entrada, replicación y liberación de virus, además de promover la propagación por vías inflamatorias;

– empeorando las arritmias cardíacas y sus trastornos.

En resumen, la RFR es un factor de estrés ambiental omnipresente que contribuye a los resultados de salud adversos del COVID-19.

Invocamos el principio de precaución y recomendamos encarecidamente una moratoria sobre el 5G y toda su infraestructura inalámbrica en este momento crucial para ayudar a mitigar la pandemia, y para preservar la salud pública hasta que los estándares de seguridad gubernamentales para RFR la exposición basada en investigaciones actuales y futuras se definan y empleen adecuadamente, recomienda encarecidamente el equipo de investigación de este nuevo trabajo científico.

Cuando el SARS-CoV-2 infecta por primera vez el cuerpo humano, ataca las células que recubren la nariz, la garganta y las vías respiratorias superiores, albergando un receptor ACE-2. Una vez que el virus gana acceso a una célula a través de su proteína de pico, convierte la célula en una máquina de autorreplicación. En respuesta al COVID-19 como infección, tanto una inmunidad innata sistémica inmediata presenta una respuesta adaptativa retrasada que se ha demostrado que ocurre (Dr. Cao, 2020). El virus también puede causar una desregulación de la respuesta inmune, particularmente en la disminución de la producción de linfocitos T (Dr. Qin et al. ,2020). Los casos severos tienden a tener linfocitos más bajos, recuentos más altos de leucocitos y neutrófilos proporciones de linfocitos, así como porcentajes más bajos de monocitos, eosinófilos y basófilos (Dr. Qin et al. , 2020).

La exposición a RFR no térmica de bajo nivel conduce al aumento de cálcio Ca 2+ intracelular a través de la activación de voltaje-canales de calcio regulados (Dr. Martin Pall, 2013), que se considera ser uno de los principales mecanismos de acción de la RFR sobre los organismos. El Ca 2+ intracelular también es esencial para la entrada, replicación y liberación de virus, y ha sido informado que los virus secuestran los canales de calcio y aumentar el Ca 2+ intracelular (Dr. Chen et al., 2019). Incluso aunque no se han reportado pruebas directas, hay evidencia indirecta de que el aumento de Ca 2+ intracelular puede ser involucrado en COVID-19. En un estudio reciente, ancianos pacientes hospitalizados con COVID-19 tratados con calcio bloqueadores de canales (BCC amlodipino o nifedipino) tuvieron más probabilidades de sobrevivir y menos probabilidades de requerir intubación o ventilación mecánica que los controles (Dr. Solaimanzadeh, 2020). Además, los fármacos CCB limitan fuertemente la entrada y la infección del SARS-CoV-2 en células pulmonares epiteliales cultivadas (Dr. Straus et al., 2020).

En esta interesante entrevista, la Dra. Bervely Rubik nos explica que nuestro entorno global se está inundando con nuevas formas y frecuencias de radiación electromagnética, así como con nuevos productos químicos. “Somos como ranas que se calientan lentamente en una olla de agua”, explicó. Pero, con el tiempo, estos cambios ambientales están afectando la salud pública y, en particular, la salud mental. Ella sostiene que el cuerpo humano es tanto químico como electromagnético, al igual que las entidades subatómicas pueden ser tanto partículas como ondas.

Concluimos que la RFR y, en particular, la tecnología 5G, que implica la densificación del 4G, ha exacerbado la Pandemia del COVID-19 al debilitar la inmunidad del huésped y aumentando la virulencia del SARS-CoV-2 al causar cambios morfológicos en los eritrocitos que incluyen formación de equinocitos y rouleaux que puede contribuir a la hipercoagulación; perjudicial microcirculación y reducción de eritrocitos y niveles de hemoglobina que exacerban la hipoxia; amplificando disfunción inmunológica, incluida la inmunosupresión, la autoinmunidad e hiperinflamación; aumentando el estrés oxidativo celular y la producción de libre radicales que exacerban la lesión vascular y el daño orgánico; aumentar el Ca 2+ intracelular, esencial para la entrada, replicación y lanzamiento, además de promover vías proinflamatorias; empeoramiento del corazón arritmias y trastornos cardíacos.

En resumen, la radiación inalámbrica de comunicación es un medio ambiente omnipresente, estresante, y la evidencia presentada aquí sugiere que es un factor que contribuyó a la pandemia de COVID-19.Este es el primer artículo científico que documenta un enlace entre la RFR emitida por comunicación inalámbrica y dispositivos y COVID-19. Trabajadores de la salud y los formuladores de políticas deben considerar la RFR como un cofactor que agrava la pandemia de COVID-19. Los métodos para reducir la exposición a RFR deben ser proporcionados a todos los pacientes y la población en general.

(Fuentes: https://plataforma.quieroauditoriaenergetica.org/); (Astillas de realidad)

¿Podrían las vacunas contra el ARNm alterar permanentemente el ADN? La ciencia reciente sugiere que podrían.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might.

Por Equipo de Defensa de la Salud Infantil

La investigación sobre el ARN SARS-CoV-2 realizada por científicos de Harvard y el MIT tiene implicaciones sobre cómo las vacunas contra el ARNM podrían alterar permanentemente el ADN genómico, según Doug Corrigan, Ph.D., un biólogo bioquímico-molecular que dice que se necesita más investigación.

Durante el año pasado, sería casi imposible para los estadounidenses no darse cuenta de la decisión de los medios de comunicación de hacer de las vacunas la narrativa dominante de COVID, apresurada a hacerlo incluso antes de que ocurrieran muertes atribuidas al coronavirus.

La cobertura inclinada de los medios de comunicación ha proporcionado un impulso particularmente fructífero de las relaciones públicas para las vacunas con ARN mensajero (ARNM), décadas en desarrollo pero nunca aprobadas para uso humano, ayudando a acercar la tecnología experimental a la línea de meta regulatoria.

En circunstancias ordinarias, el cuerpo produce (“transcribes”) ARNm a partir del ADN en el núcleo de una célula. A continuación, el ARNM viaja fuera del núcleo hacia el citoplasma, donde proporciona instrucciones sobre qué proteínas hacer.

En comparación, las vacunas contra el ARNM envían su carga útil de ARNm sintetizada químicamente (incluida con instrucciones de fabricación de proteínas de pico) directamente al citoplasma.

Según los Centros para el Control y la Prevención de Enfermedades (CDC) y la mayoría de los científicos de vacunas contra el ARNM, el dinero se detiene allí: las vacunas contra el ARNM “no afectan ni interactúan con nuestro ADN de ninguna manera”, dicen los CDC. Los CDC afirman primero que el ARNM no puede entrar en el núcleo de la célula (donde reside el ADN), y segundo, que la célula , al estilo Misión Imposible, “se deshace del ARNm poco después de que termine de usar las instrucciones”.

Una preimpresión de diciembre sobre el SARS-CoV-2, por científicos del Instituto Tecnológico de Harvard y Massachusetts (MIT), produjo hallazgos sobre coronavirus salvajes que plantean preguntas sobre cómo funciona el ARN viral.

Los científicos llevaron a cabo el análisis porque estaban “perplejos por el hecho de que hay un número respetable de personas que están dio positivo para COVID-19 por PCR mucho después de que la infección se había ido”.

Sus hallazgos clave fueron los siguientes: los RNAs SARS-CoV-2 “pueden ser transcritos inversamente en células humanas”, “estas secuencias de ADN se pueden integrar en el genoma celular y posteriormente ser transcritas” (un fenómeno llamado “integración retro”) y hay vías celulares viables para explicar cómo sucede esto.

Según el doctor en bioquímica y biólogo molecular Dr. Doug Corrigan,estos importantes hallazgos (que van en contra del “dogma biológico actual”) pertenecen a la categoría de “Cosas que estábamos absolutamente e inequívocamente seguros de que no podían suceder lo que realmente sucedió”.

Los hallazgos de los investigadores de Harvard y el MIT también pusieron las suposiciones de los CDC sobre las vacunas contra el ARNM en terreno más inestable, según Corrigan. De hecho, un mes antes de que apareciera la preimpresión Harvard-MIT, Corrigan ya había escrito un blog en el que se esbozaban posibles mecanismos y vías por las que las vacunas contra el ARNM podían producir el fenómeno idéntico.

En una segunda entrada de blog, escrita después de que la preimpresión salió a la bolsa, Corrigan enfatizó que los hallazgos de Harvard-MIT sobre el ARN coronavirus tienen implicaciones importantes para las vacunas contra el ARNM, un hecho que describe como “el gran elefante en la habitación”. Aunque no afirma que el ARN de la vacuna necesariamente se comportará de la misma manera que el ARN coronavirus , es decir, alterando permanentemente el ADN genómico, Corrigan cree que la posibilidad existe y merece un escrutinio estrecho.

En opinión de Corrigan, la contribución de la preimpresión es que “valida que esto es al menos plausible, y muy probablemente probable”.

transcripción inversa

Como la frase “transcripción inversa” implica, la vía de ADN a ARNm no siempre es una calle de un solo sentido. Las enzimas llamadas transcriptasas inversas también pueden convertir el ARN en ADN, permitiendo que esta última se integre en el ADN en el núcleo celular.

Tampoco es poco frecuente la transcripción inversa. Los genetistas informan que “más del 40% de los genomas de mamíferos comprenden los productos de la transcripción inversa”.

La evidencia preliminar citada por los investigadores de Harvard-MIT indica que las enzimas transcriptasa inversas endógenas pueden facilitar la transcripción inversa de los ANR coronavirus y desencadenar su integración en el genoma humano.

Los autores sugieren que si bien las consecuencias clínicas requieren más estudio, los efectos perjudiciales son una posibilidad distinta y, dependiendo de los “sitios de inserción en el genoma humano” de los fragmentos virales integrados y del estado de salud subyacente de un individuo, podrían incluir “una respuesta inmune más grave … como una ‘tormenta de citoquinas’ o reacciones autoinmunes”.

En 2012, un estudio sugirió que la integración del genoma viral podría “conducir a consecuencias drásticas para la célula huésped, incluyendo la alteración genética, la mutagénesis insertal y la muerte celular”.

Corrigan hace un punto de decir que las vías hipotizadas para facilitar la retro-integración del ARN viral – o vacuna – en el ADN “no son desconocidas para las personas que entienden la biología molecular a un nivel más profundo”.

Aun así, la discusión de la preimpresión sobre la transcripción inversa y la integración del genoma provocó una vorágine de comentarios negativos de lectores reacios a repensar el dogma biológico, algunos de los cuales incluso abogaron por la retractación (aunque las preimpresiones son, por definición, inéditas) con el argumento de que “teóricos de la conspiración … llevará este documento a la “prueba” de que las vacunas contra el ARNM pueden, de hecho, alterar su código genético”.

Los lectores más reflexivos estuvieron de acuerdo con Corrigan en que el documento plantea preguntas importantes. Por ejemplo, un lector declaró que falta evidencia confirmatoria “para mostrar que la proteína de pico sólo se expresa por un corto período de tiempo (digamos 1-3 días) después de la vacunación”, y agregó: “Creemos que este es el caso, pero no hay evidencia para eso”.

De hecho, el tiempo que el ARNm sintético de las vacunas —y por lo tanto las instrucciones para que las células sigan fabricando proteína de espiga— persisten dentro de las células es una pregunta abierta.

Normalmente, el ARN es una molécula “notoriamente frágil” e inestable. Según los científicos, “esta fragilidad es cierta en el ARNm de cualquier ser vivo, ya sea que pertenezca a una planta, bacterias, virus o humanos”.

Pero el ARN sintético en las vacunas COVID es una historia diferente. De hecho, el paso que finalmente permitió a los científicos y fabricantes de vacunas resolver su impasse de la vacuna contra el ARNM de décadas fue cuando descubrieron cómo modificar químicamente el ARNM para aumentar su estabilidad y longevidad, es decir, producir ARN “que se queda en la célula mucho más tiempo que el ARN viral, o incluso arneses que nuestra célula normalmente produce para la producción normal de proteínas”.

Nadie sabe lo que está haciendo el ARNm sintético mientras está “dando vueltas”, pero Corrigan especula que su mayor longevidad aumenta la probabilidad de que “se convierta en ADN”.

Además, debido a que el ARNM de la vacuna también está diseñado para ser más eficiente al traducirse en proteínas, “los efectos negativos podrían ser más frecuentes y más pronunciados con la vacuna en comparación con el virus natural”.

Señales de dólar

Corrigan reconoce que algunas personas pueden rechazar sus advertencias, diciendo: “Si el virus es capaz de lograr esto, entonces ¿por qué debería importarme si la vacuna hace lo mismo?”

Tiene una respuesta lista y convincente:

“Hay una gran diferencia entre el escenario en el que las personas al azar, y sin darse cuenta, tienen su genética en mono porque estaban expuestas al coronavirus, y el escenario en el que vacunamos deliberadamente a miles de millones de personas mientras les decimos que esto no está sucediendo”.

Lamentablemente, la actitud predominante parece ser que la “carrera para vacunar al público” justifica la asunción de estos riesgos adicionales.

A mediados de noviembre, después de que el Jerusalem Post dijera a los lectores que “cuando el mundo comience a inocularse con estas vacunas completamente nuevas y revolucionarias, no sabrá prácticamente nada sobre sus efectos a largo plazo”, un director de hospital israelí argumentó que no vale la pena esperar dos años más para eliminar los “riesgos únicos y desconocidos” o los posibles efectos a largo plazo de las vacunas contra el ARNM.

En los Estados Unidos, el entusiasmo por la tecnología de ARNm es igualmente sin restricciones. Apenas unos días después de que los CDC publicaran datos actualizados que mostraban que más de 2.200 muertes de personas que habían recibido las vacunas contra el ARNm Pfizer o Moderna habían sido reportadas a partir del 26 de marzo, The Atlantic elogió la tecnología, sugiriendo que la “ingeniosa” tecnología sintética de ARNM detrás de las vacunas COVID de Pfizer y Moderna representaba un “avance” que podría “cambiar el mundo”.

En lugar de descartar la perspectiva de la integración retro del ADN extranjero como una “teoría de la conspiración”, los científicos deberían estar llevando a cabo estudios con el ARNm vacunado para evaluar los riesgos reales.

Por ejemplo, Corrigan cree que si bien los datos in vitro en líneas celulares humanas (una de las fuentes de datos examinadas por los investigadores de Harvard-MIT) ofrecen resultados “herméticos”, todavía hay una necesidad de demostrar concluyentemente la alteración genómica de la vida real a través de “PCR, secuenciación de ADN o Blot del Sur … ADN genómico purificado de pacientes con COVID-19″ y individuos vacunados.

Sin embargo, en lugar de abordar estas brechas de investigación, las empresas están salivando sobre el potencial de utilizar el ARNm editado por humanos para “comandar nuestra maquinaria celular” y “hacer casi cualquier proteína bajo el sol”.

Un comunicado de prensa del 10 de marzo en el que se pronunciaban las vacunas contra el ARNM, los claros ganadores de la carrera vacunal COVID-19 señalaron que todas las principales compañías farmacéuticas están ahora “probando la tecnología [mRNA] mediante la celebración de acuerdos de licencia y/o colaboración con empresas de ARN bien establecidas”.

En viejos dibujos animados de Disney, los espectadores a menudo presenciaban al tío rico del Pato Donald, Scrooge McDuck, “ojos abultados [se convierten] en signos de dólares de máquinas tragamonedas de Las Vegas de gran tamaño” al contemplar oportunidades para aumentar su ya inmensa riqueza.

A juzgar por la disposición de los ejecutivos de las compañías farmacéuticas a pasar por alto los riesgos a largo plazo y posiblemente multigeneracionales de las vacunas contra el ARNM, deben estar igualmente atraídos por visiones de signo de dólar de una interminable cartera de productos de ARNm “plug and play”.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might. • Children’s Health Defense

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.

¿Exagero?

Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.