¿Hay óxido de grafeno dentro de las inyecciones?

Por Paul Anthony Taylor, Investigación global 

En la periferia de la World Wide Web, no es difícil encontrar personas que hacen afirmaciones extravagantes sobre los ingredientes contenidos en las formas de ARNm y ADN de las vacunas contra el COVID-19. Como organización basada en la ciencia, si bien cuestiona firmemente las afirmaciones de que estas inyecciones supuestamente han demostrado ser ‘seguras’, nuestra Fundación sigue un curso estricto y alejado de tales especulaciones. Sin embargo, hace unos días, nos llamó la atención un  artículo interesante  en la edición australiana de The Spectator, una revista británica de gran circulación que se centra en la política, la cultura y la actualidad. Escrito por la periodista Rebecca Weisser, describe cómo al examinar las gotas de la vacuna de ARNm de Pfizer bajo un microscopio de campo oscuro, El Dr. David Nixon, un médico de cabecera de Brisbane, observó lo que parecen ser brazos mecánicos ensamblando y desarmando estructuras rectangulares brillantes que se asemejan a circuitos y microchips.  Capturado en video, lo que filmó Nixon ciertamente invita a la reflexión, por decir lo menos.

Como  describe el artículo de The Spectator  , las estructuras que Nixon observó en las gotas de vacuna que examinó parecían inmóviles al principio. Fue solo cuando se utilizó fotografía de lapso de tiempo, condensando horas de metraje en minutos, que se reveló el movimiento de las estructuras. Nixon dice que la formación de cristales en las gotas parece ser estimulada por la radiación electromagnética, y que esto se detiene cuando el portaobjetos que contiene la vacuna se protege con una bolsa de Faraday (un recipiente hecho de un material conductor que bloquea los campos electromagnéticos externos para que no lleguen a su interior). ). El artículo de Spectator  sugiere que los hallazgos de Nixon son similares a los realizados por otros equipos de Nueva Zelanda, Alemania, España y Corea del Sur.

Nixon aparentemente compartió lo que vio con  Wendy Hoy , profesora de medicina y directora del Centro de Enfermedades Crónicas de la Universidad de Queensland en Australia. Reconocida internacionalmente por su investigación y trabajo multidisciplinarios en el riñón y enfermedades crónicas relacionadas, Hoy supuestamente ha pedido al gobierno australiano y a sus autoridades sanitarias que expliquen la aparente formación espontánea de chips y circuitos en las vacunas de ARNm, y los objetos anormales que se afirma que tienen visto en la sangre de personas vacunadas. Será interesante ver qué respuesta obtiene.

Controversia creciente

Los hallazgos de Nixon aparentemente acumulan aún más controversia sobre las formas de ARNm y ADN de las vacunas utilizadas contra COVID-19. Los efectos secundarios graves que ahora se atribuyen a las inyecciones incluyen  daño hepático severo ; recuentos de plaquetas muy bajos  (trombocitopenia); altas tasas  de reacciones alérgicas graves y potencialmente  mortales  (anafilaxia); inflamación del músculo cardíaco  (miocarditis); coágulos de sangre  (trombosis); e incluso  la muerte . Con un análisis realizado por  el editor senior del British Medical Journal  , Peter Doshi, y sus colegas, que muestra que las vacunas contra el COVID-19 de ARNm de Pfizer y Moderna tienen estadísticamente  más probabilidades de causar eventos adversos graves . que para prevenir la hospitalización, hace tiempo que su uso debió suspenderse.

¿Los extraños videos de Nixon realmente muestran brazos mecánicos ensamblando y desarmando circuitos y microchips? Francamente, sin más evidencia, es imposible decirlo con certeza. Pero sean cuales sean las estructuras filmadas por Nixon, una cosa parece segura: es poco probable que la controversia en torno a las vacunas COVID-19 basadas en ARNm y ADN desaparezca pronto.

Si bien la Dr. Rath Health Foundation no respalda necesariamente el análisis contenido en este video, lo compartimos en interés del público con el objetivo de fomentar un debate más amplio sobre el tema de las vacunas contra el COVID-19.

Fuente: https://www.sgtreport.com/2022/11/is-there-graphene-oxide-inside-the-shots-mainstream-media-article-on-physician-who-filmed-structures-resembling-circuitry-and-microchips-in-pfizer-covid-19-vaccine/

El negocio de las funerarias está en auge (y no por el COVID)


Escrito por Alex Berenson a través de Substack ‘Verdades no reportadas’,

¿Es tan grave es el aumento de la mortalidad?

Así que las malas empresas funerarias están empezando a preocuparse.

Hoy, Service Corporation International, el operador funerario con fines de lucro más grande de América del Norte, realizó su llamada de ganancias trimestrales. ¡SCI tuvo otro excelente trimestre, le complacerá saberlo! En lo que va de 2022, la empresa ha obtenido casi 500 millones de dólares en beneficios, y sus acciones han subido más del 15 % desde el informe de resultados de la semana pasada.

(¡La muerte es tu mejor inversión!)

La dirección de SCI parece bastante abierta con los inversores. Durante muchos años, gran parte del crecimiento de la empresa provino de la compra de funerarias familiares a medida que sus operadores, umm, se extinguían. El negocio funerario subyacente es de crecimiento lento y muy predecible.

Al menos solía serlo.

Como Thomas L. Ryan, presidente y director ejecutivo de Service Corporation,  les dijo a los inversionistas el miércoles por la mañana :

Si retrocede en esta industria y en particular con SCI, año tras año vería el número de muertes; probablemente en un año puede haber bajado un 1 % o un 2 %, en el próximo año habrá subido un 1 %. o 2%, lo que podría predecir fue una precisión bastante buena durante un año y sobre una gran huella como la nuestra, lo que probablemente sucedería… Llega 2020, Covid, un cambio de juego, ¿verdad? Tenemos que hacer en un momento dado un 20 por ciento más de funerales, lo cual es inaudito en un año en comparación con, digamos, uno o dos años antes.

Entonces, Service Corporation esperaba que una vez que pasara el Covid, su negocio volvería a la normalidad…

Lo que hubiéramos esperado es, ¿por qué no volveríamos a, digamos, un nivel de 2019, tal vez obtengas un porcentaje de crecimiento de 2019? Yo esperaría eso. Entonces ese sería un nivel razonable que creemos que se estabilizaría. Y eso es algo de lo que esperábamos…

Sólo que eso no es lo que ha sucedido.

Lo que les estamos diciendo es que, en el tercer trimestre de este año, hicimos un 15 % más de llamadas que en el tercer trimestre de 2019. Eso no es lo que nadie hubiera anticipado y eso tiene una  cantidad mínima de Covid. muertes  [énfasis añadido]  en él.

El covid se ha ido. Pero la gente sigue muriendo. ¿Por qué?

Como era de esperar, Ryan no mencionó las vacunas de ARNm en ninguna parte. ¿Por qué lo haría? Si lo hiciera, solo generaría dolores de cabeza que él y Service Corporation no necesitan.

Pero, anteriormente en la llamada, señaló «más muertes por cáncer» y, en términos más generales, una disminución en la salud general:

Creemos que estos servicios excesivos son de naturaleza más permanente en una combinación de demografía envejecida, mayor riesgo y estilo de vida menos saludable desarrollado durante la pandemia.

Ryan también sugirió que la atención médica retrasada podría ser un problema.

Estas explicaciones son… forzadas, en el mejor de los casos. El envejecimiento demográfico no es nuevo, y los bloqueos que impulsaron un “estilo de vida menos saludable” terminaron a mediados de 2020 en la mayoría de los estados rojos y a principios de 2021 en casi todos lados. Los opioides y las sobredosis en general siguen siendo una crisis horrenda, pero las muertes parecen haber alcanzado su punto máximo a principios de 2022 y han disminuido ligeramente desde entonces. Y a pesar de toda la discusión sobre los retrasos en la atención médica, los hospitales y los consultorios médicos han funcionado con normalidad durante al menos 18 meses.

En cualquier caso, Estados Unidos no es el único que ha visto un gran aumento de muertes en 2022, hasta ahora inexplicable.

Países desde Alemania hasta Australia y Taiwán están viendo tendencias similares.

Todos ellos tienen algo en común. No hay puntos por adivinar qué.

En cualquier caso, Service Corporation espera que el negocio siga siendo bueno en los años venideros.

“Estas tendencias son difíciles de revertir rápidamente”, dijo Ryan.

“Espero que dentro de tres, cuatro, cinco años disminuya un poco. Pero no creo que sea pronto”.

* * *

[ZH: No son solo las empresas de servicios funerarios. Los participantes del mercado se sorprendieron un poco cuando Lincoln Financial anunció los resultados la semana pasada y las acciones colapsaron más del 30% después de una pérdida impactante e inesperada de $ 2.6 mil millones en el tercer trimestre.

“Una catástrofe (y no del tipo natural)”, dijeron los analistas de Wells Fargo Securities en una nota a los clientes el miércoles por la noche, luego de la publicación de las ganancias del mercado secundario por parte de la compañía de seguros de vida y rentas vitalicias de Pensilvania.

¿Qué provocó la gran pérdida?

Pagos por fallecimiento del seguro colectivo de Lincoln National para personas en edad de trabajar en EE. UU. de 18 a 64 años. 2019 es pre covid y es la línea de base, 2020 covid no tiene vacuna 9% de aumento, 2021 covid todavía está aquí pero ahora agrega la vacuna un aumento de 163%. Para su información pic.twitter.com/Wb4B4GXjPs— Michael Evanson (@MichaelEvanson1) 

3 de noviembre de 2022

Entonces, nos preguntamos, ¿es ese el comercio de orden mundial post-vaxx-new-normal?: ¿aseguradoras de vida corta, proveedores de servicios funerarios largos? ]

Fuente: https://www.zerohedge.com/medical/funeral-business-booming-and-not-because-covid

Las “vacunas” de ARNm de COVID-19 causan cáncer; aquí está la evidencia…


Se está llevando a cabo un encubrimiento monumental para suprimir las consecuencias de la vacunación contra el Covid-19 en la salud de las mujeres. Pero lamentablemente, lo peor aún está por venir.

Ahora tenemos pruebas científicas de que las inyecciones de ARNm de Covid-19 pueden causar cáncer de ovario, páncreas y mama.

Por Joel Smalley ; Analista de datos profesional

La vía de reparación del ADN por recombinación homóloga es uno de los mecanismos que utiliza el cuerpo para evitar que las células se vuelvan cancerosas en respuesta al estrés ambiental.

Uno de los componentes más importantes de esta vía es la proteína tumoral P53 (p53), la “guardiana del genoma”. Protege nuestras células del daño celular. Bajo estrés celular, p53 entra en acción, regulando la expresión génica para controlar la reparación del ADN, la división celular y la muerte celular. Es el gen mutado más comúnmente en el cáncer.

En octubre de 2021, dos reverenciados científicos, llamados Jiang y Mei, publicaron un artículo, después de una revisión por pares, en MDPI , que mostraba que la proteína espiga del SARS-Cov-2 destruyó el mecanismo de reparación del ADN en los linfocitos.

Efecto del virus SARS-CoV-2 sobre la eficiencia de reparación homóloga (HR) en linfocitos

La proteína de pico viral era tan tóxica para esta vía que eliminó el 90% de ella. Si toda la proteína espiga entrara en el núcleo (en los ovarios), y se produjera una cantidad suficiente y se mantuviera el tiempo suficiente antes de que el cuerpo pudiera deshacerse de ella, causaría cáncer. Afortunadamente , en el caso de una infección natural, es poco probable que esto ocurra.

Desafortunadamente , el toxshot de ARNm experimental induce la producción de la proteína de pico (el pico de longitud completa coincide exactamente, aminoácido por aminoácido, con la longitud total de la proteína de pico viral¹) en y alrededor del núcleo celular² y se produce durante al menos 60 días y casi seguro que más largo³.

Los «verificadores de hechos» dijeron que la proteína de pico viral no entra en el núcleo a pesar de que los científicos expertos demostraron que sí lo hace.

Estudio de microscopía confocal que muestra la proteína espiga (verde) proliferando en el núcleo celular (azul)

Las autoridades de salud pública y los reguladores dijeron que la proteína del pico de la vacuna no entra en el núcleo a pesar de que los fabricantes de ARNm les enviaron fotografías como parte de su solicitud de uso de emergencia.

Presentación de BioNTech a la TGA australiana

Está bien, entra en el núcleo, pero la narrativa oficial dice que no permanece en el cuerpo por más de unas pocas horas. Sin embargo, un gran estudio realizado por uno de los grupos de biología molecular más respetados del mundo en la Universidad de Stanford⁴ mostró que el ARNm (que produce el antígeno del pico vacunal) todavía estaba presente y activo en el cuerpo después de 60 días .

Jiang y Mei, de manera bastante lógica y razonable, advirtieron que la proteína de punta de ARNm probablemente tendría el mismo efecto que la proteína de punta viral en p53 y, por lo tanto, causaría cáncer.

Dos meses después de que mi amigo, Jikky the Mouse, destacara esta revelación, el artículo de Jiang y Mei se retractó debido a falsas «expresiones de preocupación» (EOC) sobre los métodos del estudio a pesar de que eran una práctica estándar.

Además, los autores del EOC fueron Eric Freed, director del Instituto Nacional de Salud (NIH) de EE. UU. que financió a Moderna, el titular de la patente de la toxshot⁵ de ARNm de COVID y Oliver Shildgen, el editor real de la revista que originalmente aceptó el artículo. ! Y ninguno de ellos declaró los conflictos de intereses.

Bueno, a pesar de la retracción, la proteína espiga que circula en grandes cantidades, en la vecindad directa del núcleo celular, durante largos períodos de tiempo, todavía tiene el potencial de inducir cáncer en esas células (ovario, páncreas, mama, próstata, ganglios linfáticos ). Estos cánceres pueden tardar años en desarrollarse, por lo que es posible que no veamos una señal de seguridad durante 5 o 10 años.

Lea más aquí: la investigación exclusiva de los documentos confidenciales de Pfizer determina que la vacunación contra el COVID provocará una despoblación masiva





Fuente: https://expose-news.com/2022/08/02/the-covid-19-mrna-vaccines-cause-cancer/

Los médicos dijeron que la vacuna era segura

“Solo estábamos siguiendo órdenes”, dirán los médicos cuando se sepa la verdad. ¿Dónde hemos escuchado eso antes?

Por Dan Gelernter

La semana pasada, la eurodiputada alemana Christine Anderson calificó la coerción de vacunas como “el peor crimen jamás cometido contra la humanidad”. Esto reemplazaría convenientemente el récord anterior en esta categoría, en manos de los alemanes. Pero puede resultar que ella tenga razón. “Están saliendo muchas cosas a la luz”, dijo. “Todos los efectos secundarios adversos, numerosos estudios ahora disponibles, sobre desfiguraciones fetales. . . defectos genéticos de los bebés nacidos de mujeres que se vacunaron. . .” 

También la semana pasada, el presentador de Fox News, Tucker Carlson, llamó la atención sobre un estudio reciente publicado en el Journal of Food and Toxicology que afirma haber observado «diversas consecuencias adversas para la salud humana» de la vacuna, que podrían incluir «un vínculo causal con enfermedades neurodegenerativas, miocarditis , trombocitopenia inmune, parálisis de Bell, enfermedad hepática, inmunidad adaptativa alterada, respuesta alterada al daño del ADN y tumorigénesis”. 

Resulta que no estoy vacunado. Tampoco cogí nunca COVID, pero eso puede ser puramente una cuestión de suerte. Sin embargo, el hecho de no estar vacunado no tiene nada que ver con la casualidad: fue un acto de fuerza de voluntad frente a una presión bastante sustancial de muchas direcciones. Nueva York no me dejaba entrar sin mis documentos de identificación de vacunas y me negué a llevar una tarjeta falsa. Tengo amigos que pasaron por cosas mucho peores, incluido uno que enfrentó la expulsión de facto de la Universidad de Columbia por rechazar la vacuna. Su exención religiosa fue negada. Columbia probablemente pensó que su fe religiosa no era nada comparada con la de ellos: ella podría creer en el cristianismo, pero ellos creen en la vacuna, y ¿quién puede cuestionar su fe? 

Estaba preparado para tomar la vacuna cuando estuvo disponible por primera vez, y bien podría haberla obtenido, si no fuera por el carácter muy religioso de la presión para hacerlo. Eso me hizo sospechar. Nos aseguraron repetidamente (¡recuerden los primeros días!) que aquellos que tomaron la vacuna eran completamente invencibles contra el COVID, así que pensé que si no la tomaba solo podría dañarme a mí mismo. Pero, misteriosamente, no fue así: la vacuna fue, por un lado, completamente efectiva. Por otro lado, representaba un peligro para los vacunados al no recibirla. Ningún médico estaba dispuesto a explicarme la contradicción. 

Y creo que el problema era que muchos médicos ya se habían vacunado, y habían vacunado a sus hijos, sin pensar lógicamente en las posibles consecuencias. Luego, cuando las consecuencias potenciales comenzaron a verse mal, era mejor fingir que todo iba a estar bien que admitir que podrían haberse envenenado a sí mismos y a sus hijos. 

Sobre este tema tuve una larga conversación hace más de un año con un médico amigo mío, buen compañero y amigo del colegio. Estaba tratando de convencerme de que me vacunara, si no por mí, por los que me rodeaban. En este punto, habíamos pasado de «no contraerá COVID con la vacuna» a «no contraerá COVID tan grave». (Esto también puede ser falso, pero estaba en el Menú de la Verdad de ese día). Y entonces, el nuevo argumento era que aún podía lastimar a otras personas si no me vacunaba. El doctor me aseguró que era completamente, totalmente seguro. 

Pero, ¿cómo podríamos saber eso? Eso es todo lo que le pregunté. ¿Cómo podríamos saber? Incluso si esta vacuna no fuera una tecnología completamente nueva, incluso si fuera algo convencional, los efectos secundarios a largo plazo no podrían conocerse hasta que hubiera tiempo para que se desarrollen y se observen. 

El médico me dijo que el CDC nos aseguró que la vacuna era segura, por lo que no podía haber ningún riesgo. Pero, ¿cómo podría saber el CDC?, pregunté. Empezamos a movernos en círculos. Se negó a ver la falacia lógica y yo me negué a reconocer que el CDC podría saber algo que solo el paso del tiempo revelaría. Así que finalmente recurrió al argumento inicial: esto es una emergencia, y debes obtenerla por el bien de la sociedad. ¡Piensa en las mujeres y los niños! ¡Piense en los miembros mayores de su familia! ¡Podrías estar matándolos! 

Bien ahora. ¿Quién ha estado matando a quién? No quiero decir «te lo dije» a las personas que se vacunaron. Dios no lo quiera. Solo quiero preguntarles a todos los médicos que inyectaron a sus pacientes y prometieron seguridad total, cuando sabían que no tenían derecho a hacer tal promesa, ¿qué van a hacer ahora? ¿Qué pasa si poco a poco se hace evidente que ha dañado y dañado a cientos o miles de personas, quizás de forma permanente? 

Ya sabemos la respuesta a esto: Van a decir: “¡No fue nuestra culpa! ¡El CDC nos dijo que era seguro! ¡Pfizer dijo que era seguro! ¡Nosotros también somos víctimas! ¡Nos engañaron! ¡No teníamos forma de saberlo!” 

Pero ustedes, los médicos , sí sabían: no que la vacuna fuera necesariamente peligrosa, sino que no había forma de saber con certeza que no lo era. Y usted es responsable del daño causado por cada inyección administrada, sea lo que sea. 

En última instancia, creo que este escándalo acabará con Pfizer y Moderna. Pueden tener todo tipo de indemnizaciones contra los daños causados ​​por sus vacunas, y puede tomar 20 años, pero en última instancia, la indignación pública alcanzará tal punto álgido contra estas compañías farmacéuticas que implosionarán. Habrán negociado ganancias masivas e inauditas hoy a cambio de la ruina mañana. 

Y una de las razones por las que Pfizer y Moderna no sobrevivirán es que decenas de miles de médicos necesitarán un lugar donde echar la culpa que también debería recaer sobre sus hombros: “Solo estábamos siguiendo órdenes”, dirán los médicos. Ya hemos oído eso antes.

Fuente: https://amgreatness.com/2022/07/28/doctors-said-the-vaccine-was-safe/

La narrativa «segura y efectiva» se está desmoronando (COVID)

Por Steve Kirsch

Aquí está mi lista de casi 100 indicadores de que la narrativa «segura y efectiva» se está desmoronando.

Es una lista devastadora.

Y por alguna razón, nadie quiere verificarme.

Le tomará 42 minutos leer todo lo que es demasiado largo para la mayoría de las personas, así que siéntase libre de elegir lo que lee para tener una idea de la lista completa.

Este es un artículo de «fregadero de cocina» que enumera algunos de los mejores ejemplos que muestran que la narrativa se está desmoronando.

Siéntase libre de crear obras derivadas de esta lista (p. ej., elija su conjunto de argumentos más convincentes).

  1. El director anterior de los CDC está hablando ahora sobre la mala conducta . “Estoy muy decepcionado con la comunidad científica liderada por [los Institutos Nacionales de Salud] que realmente se han esforzado desde el principio para tratar de minimizar a cualquiera de nosotros que tenga una hipótesis diferente”, dijo.
  2. Las personas dentro de los CDC, la FDA y los NIH están disgustadas con lo que está sucediendo. Esta es la mejor evidencia del progreso. Los números están aumentando, no disminuyendo. Lea este artículo: Los expertos en salud están renunciando en masa a los NIH y los CDC porque les avergüenza la «mala ciencia», incluida la vacunación de niños menores de 5 años para «hacer que sus consejos sean aceptables para la Casa Blanca», afirman los médicos , este artículo de The Defender , y este artículo :Imagen
  3. Las muertes por vacunas ahora son simplemente demasiado masivas para seguir escondiéndolas/explicándolas:
    1. Cuatro médicos en Ontario murieron justo después de la cuarta dosis . Este es un evento del Cisne Negro. Estos están sucediendo en todas partes, por supuesto, pero están siendo enterrados. También habría sido enterrado en Ontario, pero alguien armó el patrón. Tenga en cuenta que esto no está en ningún medio de comunicación principal.
    2. Ver » Abre los ojos. Esto está pasando en todas partes «. El subtítulo dice: Retroceso por las muertes en Escocia e Italia; Wayne Allan Root ha perdido a 33 amigos, todos «vacunados», por muerte o enfermedad en los últimos 18 meses; y la presentadora de televisión Kate McCann se desploma, ¡en vivo!
    3. Exceso de muertes no relacionadas con Covid: ¿por qué están aumentando? Los expertos piden una investigación a medida que aumentan las tasas de mortalidad en Inglaterra y Gales a pesar de la caída en las muertes por coronavirus
    4. El exceso de muertes está en aumento, pero no debido a CovidLos datos de la Oficina de Estadísticas Nacionales llevan a los expertos en salud a pedir una investigación urgente sobre qué está causando el exceso de mortalidad
    5. Inglaterra: exceso de muertes en aumento, pero NO debido a COVID: los expertos piden investigación
    6. ¡También está sucediendo en Irlanda! ¿Cómo pueden explotar las enfermedades cardíacas en los niños solo después de que se implementen las vacunas para niños ? Los expertos están desconcertados en cuanto a qué podría estar causando un aumento repentino de enfermedades cardíacas en los niños que está ocurriendo solo en lugares que han implementado las vacunas contra el COVID para niños. Por alguna razón, ya no les sucede a los niños en Uruguay (tal vez el juez que detuvo el programa de vacunas podría tener algo que ver con eso).
    7. Causas desconocidas es ahora la principal causa de muerte en Alberta, Canadá . No era así antes de que se lanzaran las vacunas. Los expertos descartan eso como «oh, eso es porque las personas que han tenido COVID son más susceptibles de morir». Pero, ¿por qué serían más susceptibles de morir por causas DESCONOCIDAS ? ¿ Y por qué solo los vacunados mueren por causas desconocidas?? Y si esto se debe a la infección por COVID, ¿cómo es que no está sucediendo en ningún país con una baja tasa de vacunación de COVID? ¿Y cómo explican los expertos los extraños coágulos de sangre que solo se encuentran en las personas vacunadas? La prensa todavía se olvida de hacer estas preguntas críticas. Pero al menos los principales medios de comunicación están cubriendo la misteriosa causa de las muertes. Es un comienzo. Pero están permitiendo explicaciones de «agitar la mano» cuando los «expertos» simplemente están inventando estas cosas sin datos que las respalden. Cualquier “experto” que hable con los pacientes sabe que los efectos secundarios de la vacuna son mucho mayores que los del COVID. Entonces, ¿cómo es que nuestro “experto” ni siquiera considera la vacuna como una posibilidad? Vemos los titulares casi a diario ahora de celebridades que mueren «inesperadamente» por causas «desconocidas», por lo que esta «nueva» categoría que es la número 1 ya no debería ser una sorpresa. Y les garantizo que les está pasando a montones de personas «menos conocidas» también: esas personas no generan los titulares. Pero, ¿alguna vez en su vida ha leído sobre tantas causas de muerte “inesperadas”? Recibí dos que me enviaron hoy: Busi Lurayi (36 años murió repentinamente) y el rapero Tumi Tladi (30 años, murió mientras dormía). Dos en un día, ambas celebridades internacionales de Sudáfrica?!?! ¿Cuáles son las posibilidades de que eso suceda al azar?:
    8. Los embalsamadores están viendo coágulos de sangre en más del 50 % de los pacientes que nunca habían visto en sus carreras . No es causado por COVID porque solo comenzó después del lanzamiento de la vacuna y los coágulos solo se encuentran en pacientes vacunados. Entonces, ¿cómo explican eso los expertos?
    9. Hubo un aumento del 163% en las reclamaciones de seguros de vida en Lincoln National , pero ese artículo no tuvo en cuenta que hubo una fusión (por lo que también aumentaron las primas). Son la quinta compañía de seguros más grande de los Estados Unidos. El número correcto en el que centrarse es el índice de siniestralidad que aumentó en toda la industria. La tasa de siniestralidad es en lo que hay que centrarse. En el cuarto trimestre de 2021, toda la industria experimentó un aumento del 40 % con respecto al índice de siniestralidad de 2019 y se estabilizó a alrededor del 20-25 % en el primer trimestre. Escuché que todavía hay un cambio de mezcla en el segundo trimestre de mayor a joven y que el exceso de mortalidad se ha reducido un poco. Eso no es COVID. COVID no mata en ningún lugar cerca de esa cantidad de personas. ¡Estamos viendo al asesino más grande de la historia y nadie puede descubrir qué es! Mira este video. Nunca verás una historia sobre esto en los principales medios de comunicación; lo ignoran. Tenga en cuenta que parte del aumento de siniestros se debe a aumentos de primas (adición de nuevos clientes).
    10. Mire el video aquí del CEO de OneAmerica, Scott Davison . Los verificadores de hechos afirman que todas estas muertes en exceso se deben a COVID y tratamientos médicos diferidos. Pero las personas de 18 a 64 años rara vez mueren de COVID, por lo que no puede ser COVID. Y si pospuso la atención médica, esto debería aumentar lentamente con el tiempo y comenzar a disminuir a medida que las personas regresaran a la oficina. Debería pinchar así. Así que las explicaciones no encajan. Y no explican los cientos de anomalías descritas aquí y en mi artículo de difusión de información errónea . Si todas las muertes se deben a esas dos causas, ¿por qué mis encuestas realizadas por empresas encuestadoras profesionales muestran constantemente que mueren tantas personas por COVID como por la vacuna?
    11. Las compañías de seguros de vida en países de todo el mundo están reportando cifras récord de exceso de muertes. Estas no son «fluctuaciones estadísticas». Todas las muertes son causadas por una gran intervención que está afectando la salud de millones de personas. Y es todo nuevo. Nada como esto sucedió antes de 2021. Nada de esta magnitud NUNCA ha sucedido en su historia (que se remonta a más de 100 años).
    12. Nadie responderá ninguna de las preguntas que publiqué en mi artículo sobre cómo detener la desinformación . Cuanto más dure esto, más sospechosas se volverán las personas.
    13. Las muertes de GoFundMe por accidentes cerebrovasculares y otras causas inusuales en jóvenes están por las nubes. Un lector escribió: “Escuché en mi radio local acerca de un go fund me para una señora que estaba atrapada en Tasmania porque tuvo un derrame cerebral masivo en las vacaciones, así que decidí buscar la cantidad de páginas de GoFundMe para jóvenes y niños . que han tenido ataques fue alucinante , también un montón de páginas de reacciones adversas a la vax”.
  4. ¿Cómo es posible que los fabricantes de ataúdes para niños vean repentinamente un aumento del 400 % en la demanda justo después de que se anuncien las vacunas para niños? Se supone que sucede lo contrario: una caída dramática en el negocio. En cambio, es al revés. ¿Cómo van a explicar ESE? No pueden, por lo que nunca será cubierto por los principales medios de comunicación. Lea la historia de Etana Hecht sobre uno de los mayores fabricantes de ataúdes de América del Norte que informó un aumento del 400 % en ataúdes de tamaño infantil desde diciembre de 2021 este artículo, «PEDIDOS SIN PRECEDENTES de ATAÚDES PARA NIÑOS » . Se compran a granel por primera vez .después de 30 años de estar en el negocio. ¿Podría ser una coincidencia? La historia dice que todos los directores de funerarias ven la conexión… todos los directores de funerarias saben que la vacuna está matando a los niños, pero no se les permite hablar de eso, ya que sería malo para los negocios ser antivacunas. El gobierno cubre el costo de la vacuna, pero no compensa a nadie por la pérdida de su hijo o incluso los costos del funeral. Así de cariñoso es nuestro gobierno.
  5. Incluso John Campbell, que está a favor de las vacunas , admite que un número preocupante de muertes excesivas inexplicables no solo está ocurriendo en el Reino Unido: está ocurriendo en todo el mundo . Solo escucha los primeros 30 segundos de este video . Por supuesto, los CDC no están investigando nada a pesar de que las compañías de seguros de vida estadounidenses informan muertes fuera de lo común. El CDC NUNCA va a investigar esto. Es más grande que el COVID y saben muy bien lo que es. Es por eso que NO van a investigar y The NY Times NUNCA los va a culpar por esto. Después de todo, es solo la mayor causa médica de muerte en nuestra historia.
  6. El cambio general en la causa de muerte de respiratoria a cardíaca es imposible de ignorar y no se puede explicar si las vacunas son «seguras y efectivas». Un amigo mío que vive en Massachusetts se dio cuenta de esto después de que hizo una solicitud de FOIA para los registros de defunción en Massachusetts. Observó las causas de muerte codificadas por ICD-10 y notó que las causas de muerte cambiaron principalmente de «códigos J» (respiratorias debido a COVID) a «códigos I» (circulatorias debido a la vacuna) . Ahora nos enteramos de que sucedió exactamente lo mismo en el Reino Unido en 2021 según las cifras oficiales del gobierno del Reino Unido.. Este es un efecto enorme y debe haber una causa, pero las autoridades sanitarias simplemente están desconcertadas y no pueden explicarlo (porque no se les permite culpar a la vacuna ya que eso haría quedar mal a todos). Es seguro decir que tal cambio nunca ha ocurrido antes en la historia. Claramente, algo nuevo sucedió a partir de 2021 que afectó a un gran número de personas en todo el mundo. Me pregunto qué podría haber sido eso. Las autoridades sanitarias simplemente no pueden encontrar nada nuevo en 2021.
  7. Las lesiones por vacunas de los niños pequeños que ahora tienen convulsiones no se pueden explicar. Esto ahora es una ocurrencia regular para que los niños de 2 y 3 años tengan convulsiones. Solo ocurre en niños vacunados y, con mayor frecuencia, entre 2 y 5 días después de la vacunación con la vacuna COVID. Los médicos no pueden informar estos eventos públicamente (no pueden compartir en las redes sociales ni hablar con la prensa), por lo que cada médico piensa que es simplemente un evento «único» que SOLO les está sucediendo a ellos. Si a los médicos se les permitiera hablar en público, se darían cuenta del patrón masivo. Por eso los hospitales amordazan a los médicos: para que nadie se entere. Tenemos múltiples informes de estos de enfermeras directamente de enfermeras que tienen miedo de que sus cuentas de redes sociales estén siendo monitoreadas. A los padres se les dice que es solo «mala suerte» y los padres creen lo que les dicen.
  8. Los países están empezando a darse cuenta de que las tasas de natalidad están cayendo y que hay más mortinatos. Suecia, Reino Unido, Alemania, etc. Ver mi artículo sobre tasas de natalidad .¡Superar! Nada que ver aquí, amigos.
  9. Las muertes y lesiones están ocurriendo a la vista de todos sin una explicación plausible para todas las coincidencias. Todos los eventos solo les suceden a las personas vacunadas, pero debido a que la prensa nunca menciona el estado de vacunación de las personas que «mueren inesperadamente», el público nunca se da cuenta del patrón:
    1. Piensa en todos los conciertos de rock que han sido suspendidos o cancelados por razones médicas. Justin Bieber, Santana,… Brett Michaels. Nunca dan la causa como la vacuna, así que tienen que inventar algo ( Santana ) o simplemente negarse a revelarlo ( Michaels ). Alguien me envió una lista de otros cuatro conciertos que fueron cancelados en los últimos meses. Esto no es gente normal. Pero la mayoría de la gente nunca asiste a conciertos de rock en diferentes partes del país, por lo que nunca se dan cuenta. Además, Santana canceló seis próximos conciertos para recuperarse de la deshidratación. Todos los médicos con los que hablé dijeron que eso no tiene sentido. En el peor de los casos, recibiría fluidos intravenosos y volvería a la normalidad en unas pocas horas. Así que la explicación no encaja. Pero otras celebridades están hablando sobre sus lesiones por vacunas, comoEric Clapton , pero no están bien publicitados (el video de Clapton tiene solo 66,000 visitas al 11 de julio de 2022).
    2. Consulte este artículo sobre músicos de rock que resultaron heridos después de recibir un pinchazo.
    3. ¿Cómo pueden abandonar tantos ciclistas del Tour de Francia vacunados? Nunca hemos visto esto antes. No tiene precedentes. Sólo les ocurre a los ciclistas vacunados. Sin investigaciones. Todo el mundo está desconcertado en cuanto a la causa.
    4. Piense en todas las muertes de celebridades en 2021 y 2022. Estas nunca se ocultan; no pueden ser Lo que nunca mencionan es el número total de muertes inesperadas y nunca mencionan el estado de vacunación de los fallecidos. Pero no pueden ocultar el número total. Esta es una buena manera de rastrear si el exceso de muertes está aumentando o disminuyendo porque el gobierno no puede falsear estos números porque están a la vista.
    5. Los jóvenes prácticamente nunca mueren mientras duermen. Cuando ves que esto sucede una y otra vez, no es un accidente. Cuando ves que les sucede a las celebridades, es aún más notable e imposible de encubrir, como la muerte de Dani Hampson, quien murió mientras dormía el día de su boda. No solo fue la muerte de una celebridad, sino también la muerte de una «persona joven que murió mientras dormía», un cisne negro. Muchos estadounidenses se dan cuenta de lo que está pasando. Puedes ver esto mirando los comentarios de Twitter.
    6. Los atletas mueren a plena vista a una tasa 22 veces mayor que la normal . Hoy, el exdefensor de la NHL, Bryan Marchment, murió “inesperadamente”. Pero pocas personas están rastreando esto, por lo que no tienen idea de que las tasas son mucho más altas. Parece un poco extraño. Atribuyen causas realmente extrañas a estas muertes como morir por “golpe de calor accidental” en su propia casa . Lo consulté con una enfermera. Esto nunca sucede. Pero vamos a ver mucho de esto ahora.
    7. Incluso los conductores jóvenes de UPS, como Estegan Chavez, Jr., de 24 años, mueren mientras entregan paquetes que no son tan exigentes físicamente. Y si consulta con cualquier conductor de UPS, mantienen sus camiones abiertos de par en par, lo que hace que sea prácticamente imposible morir por un golpe de calor. Y estas son solo las muertes de las que escuchas.
    8. Los pilotos están teniendo eventos a un ritmo sin precedentes, pero las aerolíneas se niegan a evaluar a los pilotos por problemas cardíacos. Cuando el capitán de American Airlines, Bob Snow, tuvo un problema cardíaco justo después de aterrizar , ni siquiera recibió una llamada del director general de American Airlines. La FAA no requerirá una evaluación piloto. Ellos saben exactamente lo que encontrarían. Entonces miran para otro lado y no dicen nada y fingen que estos eventos nunca sucedieron. Los pilotos lo saben. Cualquier miembro del público con un cerebro en funcionamiento puede resolver esto. Pero asumimos que la FAA es honesta y hará lo correcto. Gran error. La FAA fue notificada oficialmentey no han hecho absolutamente nada al respecto. Simplemente lo ignoraron como si nunca hubiera sucedido. El Congreso está haciendo lo mismo: no están responsabilizando a la FAA porque saben que los haría quedar mal. Todo el mundo confía en que nadie se entere nunca. Después de todo, encubrieron el hecho de que el gobierno de EE. UU. creó el virus en primer lugar, por lo que el razonamiento es que pueden encubrir todos los eventos cardíacos y muertes de pilotos.
    9. Las encuestas ( como esta ) muestran consistentemente que menos del 50% de los estadounidenses están dispuestos a recibir más inyecciones de la vacuna. La mayor parte de Estados Unidos está al tanto, aunque ninguna de las personas de los medios lo esté. Como resultado, el gobierno está desechando decenas de millones de dosis de vacunas debido a la demanda insuficiente (razón por la cual Peter Marks, de la FDA, dijo que haría cualquier cosa menos debatir con la oposición para reducir la vacilación de las vacunas. Así que, básicamente, literalmente estamos desechando miles de millones de dólares de dinero de los contribuyentesproducir un producto que nadie quiere. ¿Hay alguien en el Congreso quejándose del despilfarro del gobierno?: No. Ni una sola persona. ¿Alguien en los principales medios de comunicación está señalando que es estúpido pedir un producto que nadie quiere? No. Nadie en los principales medios de comunicación va a publicar un artículo de opinión como ese. Todos simplemente siguen adelante como si nada estuviera mal.
    10. Los amigos jóvenes sanos de People están teniendo problemas médicos a un ritmo sin precedentes (aunque no todos se dan cuenta de esto). Por ejemplo, hoy supe que uno de los empleados de nuestro club de campo (obligado a vacunar) que yo conocía murió de un derrame cerebral a los 52 años. Un joven candidato para el Senado de los EE. UU., John Fetterman , sufrió un derrame cerebral después de su vacunación. Puede que nunca se recupere.
    11. Cada vez que hacemos encuestas de audiencia, cada audiencia siempre informa una tasa de muerte comparable o en exceso por la vacuna frente a COVID. Entonces, incluso si no lo ve usted mismo, las encuestas de audiencia en vivo son muy convincentes ya que no hay «sesgo» en estas encuestas en vivo. Nadie, excepto los «difusores de información errónea» como yo, está dispuesto a hacer las encuestas por alguna razón.
  10. Las encuestas de usuarios realizadas por firmas de encuestas profesionales de terceros muestran consistentemente que las vacunas han matado a más personas que COVID . El NY Times 60 Minutos, etc. todos se niegan a hacer las encuestas ellos mismos. No quieren que nadie lo sepa. Nuestro próximo paso es utilizar una organización de encuestas de renombre para promover este resultado, de modo que no provenga de los «antivacunas». Esa encuesta debería ser imposible de ignorar para cualquiera. Nunca hemos realizado una sola encuesta que muestre que todo está bien y que las vacunas son perfectamente seguras. Es por eso que los principales medios de comunicación nunca harán estas encuestas. Pero la mayoría de la gente no se da cuenta de que deliberadamente no están haciendo estas encuestas. Sin embargo, puede ser difícil para nosotros hacer esto. Ha habido encuestas mucho menos devastadoras realizadas por las grandes firmas de encuestas y se niegan a permitir que se utilicen los resultados cuando descubrieron que estaban en contra de la narrativa. La razón es simple: sería malo para los negocios publicar una encuesta de este tipo porque todos dejarían de usarlos porque son «malvados». Es por eso que el público nunca ve encuestas sobre la seguridad de las vacunas: los medios no las encargarán y los encuestadores no las harán. ¡Agradecemos que se demuestre que estamos equivocados en esto!
  11. Los mandatos se están desvaneciendo a pesar de que las tasas de COVID están aumentando. Por ejemplo, vea esta historia sobre lo que está sucediendo en partes de Australia donde se están retractando de sus recomendaciones anteriores sin disculparse en absoluto:
    1. Mandatos de vacunas que desaparecen: ninguna disculpa de nuestros funcionarios de salud pública que alguna vez fueron tan entusiastas
  12. La evidencia muestra que COVID se creó en un biolaboratorio financiado por el gobierno de EE. UU. Esa es la evaluación directa del presidente de la comisión independiente encargada de investigar la causa. El profesor Jeffrey Sachs fue responsable de la investigación independiente de Lancet. Él dijo: “Presidí la comisión de The Lancet durante 2 años sobre Covid. Estoy bastante convencido de que salió de un laboratorio de biotecnología de los Estados Unidos”. Nunca encontrará esa declaración en ningún lugar de los principales medios de comunicación estadounidenses. ¿Cómo podría no estar cubierto? Pero en este video , también dijo que no hay absolutamente ningún interés en aprender más , no de ningún país en todo el mundo. Eso te dice todo lo que necesitas saber. ¿Cómo puede no haber interés en aprender más? La única forma en que no puede haber interés en aprender más es si el gobierno de EE.UU. lo hizo . Consulte este artículo en Science que intenta hacer que Sachs parezca el villano: «Las peleas por la promesa de confidencialidad y los conflictos de intereses destrozaron la investigación del origen de COVID-19: los ex miembros del grupo de trabajo de The Lancet desafían por qué el economista Jeffrey Sachs disolvió el esfuerzo «. Sachs se da cuenta de que Daszak está en conflicto y Daszak no producirá documentos que muestren un conflicto. ¡Así que el panel se pone del lado de Daszak! Es completamente sorprendente que casi todo el panel esté en conflicto y corrupto. Sachs emerge como el héroe aquí. Pide una mayor investigación por parte de una comisión imparcial .debido a la evidencia irrefutable de un contrato que “supuestamente” nunca fue financiado. Nadie lo acepta porque tiene razón; lo que quieren es una investigación corrupta solamente. El contrato encaja como anillo al dedo en el origen del COVID y la defensa de Daszak es que la obra “no estaba financiada. Por lo tanto, el trabajo no se hizo. Simple. Pero no es tan simple como eso (como señala el artículo ). Parece muy claro que Daszak está mintiendo. Verifiqué dos veces con un ex empleado de EcoHealth Alliance que estaba en condiciones de saberlo. Él fue inequívoco. Tienes que tener datos para obtener financiación en estas propuestas. La conclusión es que no se debe confiar en Peter Daszak ya que él está involucrado. Hay más, pero lo dejaremos así por ahora.
  13. Las lesiones por vacunas ahora se compensan en otros países con grandes pagos , pero no en Estados Unidos. No le hemos pagado un centavo a nadie, a pesar de los miles de solicitantes (la mayoría sabe que es inútil presentar una solicitud y no se molesta). Entonces, ¿cómo pueden las vacunas dañar a las personas fuera de los Estados Unidos, pero no dañar a nadie que haya recibido una inyección dentro de los Estados Unidos? Eso es simplemente imposible si no hay un encubrimiento del gobierno. No existe una supervisión de terceros del programa de compensación de vacunas en Estados Unidos y nadie en el Congreso (excepto el senador Ron Johnson) piensa que los pagos cero a los millones de estadounidenses que murieron, quedaron discapacitados o lesionados es un problema.
  14. Nuestras encuestas muestran consistentemente que más de 1 millón de estadounidenses han resultado lesionados o discapacitados tan severamente por las vacunas que no pueden trabajar, pero el Congreso cree que una compensación de $0 es apropiada. Vea este análisis esta historia esta historia los datos de la encuesta en este artículo .
  15. Las investigaciones más extensas jamás realizadas sobre una muerte, 14 meses de investigación intensiva, han demostrado que las vacunas matan a las personas. Jack Last, de 27 años, de Stowmarket, fue vacunado el 30 de marzo de 2021 y murió días después. Se necesitaron 14 meses de investigación para determinar que la vacuna lo mató .
  16. Ed Dowd fue entrevistado por The Defender and the CHD Roundtable e hizo los siguientes puntos:1. Las reclamaciones de vida grupales provienen de un grupo demográfico más joven y empleado que no muere ni por COVID ni por suicidio2. Este grupo, en su mayoría de la generación del milenio, alimentó «una guerra de Vietnam silenciosa» en términos de conteo de cadáveres (61,000 en 2021, no se indica cuántas compañías de seguros contaron)3. La conexión con los disparos se demuestra mediante las gráficas de “palo de hockey” de muertes versus tiempo claramente marcadas por mandatos y refuerzos: la pistola humeante4. Los directores ejecutivos que ordenaron los disparos son reacios a publicar su responsabilidad por matar a sus empleados.5. La catástrofe financiera llevará estos datos a las noticias principales tarde o temprano
    . 6. Ed estaba trabajando directamente con actuarios y ejecutivos de seguros contando específicamente las reclamaciones de vida grupales, no solo las muertes entre la población general. Las tasas exponenciales de cambio marcadas por las fechas de lanzamiento de la vacuna, las implementaciones obligatorias y los refuerzos apuntan a la inferencia de la vacuna para estas muertes informadas de esta manera. El argumento es difícil de rebatir. «Pistola humeante», como él dice. Estos son datos duros de la industria de seguros: dinero pagado. Es por eso que esto es tan impresionante y al grano.7. No hay respuesta de ningún verificador de datos al respecto.
  17. Los ex médicos muy respetados como la Dra. Naureen Shaikh en Sausalito han visto suficiente y ahora están dispuestos a salir del clóset y hablar sobre las lesiones por vacunas, aunque signifique el final de su carrera en medicina.
  18. Los artículos escritos por científicos respetados como Peter Doshi son criticados por personas que se niegan a rendir cuentas públicamente por sus comentarios. Lea este artículo del profesor Norman Fenton que resume los argumentos falsos que se han hecho para difamar a estos científicos que dicen la verdad, » Respuesta al video de Susan Oliver «Antivaxxers engañados por p-hacking y comparación de manzanas con naranjas «. Casi definitivamente, el “documento de Doshi” no se publicará por las razones explicadas en este artículo por Phil Harper . Susan Oliver, que es notablemente inepta, no tendrá una discusión con Fenton y es bastante obvio quién está difundiendo la información errónea para cualquiera que dedique tiempo a esto. En lugar de desafiar a Fenton, Susan produce un segundo video . susanaresumió su opinión sobre el artículo en este tuit (que incluía el enlace al video) que fue retuiteado por personas como el Prof. Sir David Spiegelhalter (un experto mundialmente reconocido en probabilidad y riesgo) y el Prof. Peter Hansen (Econometrista, Científico de Datos y Latene Profesor Distinguido de Economía en la UNC, Chapel Hill). Hansen y Spiegelhalter también se niegan a hablar con Fenton. A Fenton le ENCANTARÍA chatear con cualquiera de estas personas en una conversación grabada para poder hacerles preguntas clave, pero todos tienen miedo de ser desafiados: simplemente arrojan piedras y luego se esconden . Así es como funciona la “ciencia” hoy en día.
  19. Aunque no se publicarán estudios clave que destruyan la narrativa del gobierno (como se señaló en el punto anterior), los científicos lograron publicar más de 1250 artículos en revistas médicas sobre eventos adversos graves causados ​​por las vacunas contra el COVID .
  20. Dos adolescentes mueren mientras dormían en diferentes estados días después de la vacunación y el documento concluye que las muertes fueron causadas por la vacuna. Está publicado en una revista médica revisada por pares . No hay cobertura de esto en los principales medios de EE.UU. Lo mejor que pudimos encontrar es este informe sobre NTD News . Lea los comentarios en ese tweet que incluyen: “La mamá de mi amigo se despertó aterrorizada, sin poder respirar. Su esposo estaba a su lado y llamó al 911, pero ella se fue por un paro cardíaco. Ella tomó un refuerzo la mañana antes de que esto sucediera.. Duele especialmente pensar que un niño, solo, pasó por esto. Me arranca el corazón”. Los principales medios de comunicación de EE. UU. seguirán ignorando todas estas muertes para que, cuando les sucedan, la gente piense que es solo su «mala suerte», pero estas historias se están filtrando en medios alternativos.
  21. El experto en vacunas más respetado del mundo, el Dr. Paul Offit, admitió públicamente en un video de YouTube que todo el proceso de revisión externa de la FDA es una completa farsa . La FDA no revisa los datos, le entregan al comité cientos de páginas justo antes de la reunión (sabiendo que de esa manera el comité no puede revisarlas) y luego los acosan para que aprueben las vacunas sin ningún dato de eficacia. Offit admitió que si hubiera una opción de «diablos no» para su voto, eso es lo que habría hecho. Efectivamente, dijo que los demás en el comité están descerebrados porque no había datos de eficacia para justificar la aprobación: estos miembros del comité básicamente votan «sí» porque eso es lo que se espera que hagan y quieren permanecer en el comité. El gobierno ordena el medicamento incluso antes de pedirle al panel de la FDA que revise los datos, lo que demuestra que todo el «proceso de revisión» es una completa farsa. El propio Offit aún no se ha dado cuenta de que las vacunas no son seguras. No tendrá esa discusión con nadie de nuestro lado. Sin embargo, Paul Offit ignora por completo el hecho de que si no hay muertes, no puedes salvar ninguna vida. Por ejemplo, sabemos por los datos de muertes de Massachusetts que no hubo muertes en 2020 y 2021 para las edades de 5 a 11 años (solo hubo una muerte codificada como muerte por COVID, pero contactamos a la familia y descubrimos que no era cierto). Entonces, ¿cómo es que hay un «problema»? Nadie quiere hablar de eso. Ni siquiera saben que no hubo muertes en un estado grande como Massachusetts.
  22. Los padres se están volviendo sabios con el esquema. Solo el 1,3 % de los niños elegibles menores de 5 años han recibido una o dos dosis de una vacuna, según datos de los CDC (consulte este artículo de La Gran Época para obtener detalles sobre el fracaso de los CDC para engañar a los padres para inyectar a sus hijos).
  23. Pierre Kory me dijo que un médico convencional que conoce le admitió confidencialmente que las actitudes están cambiando ahora. Los médicos ahora se dan cuenta de que les han mentido, pero nadie tiene el coraje de hablar al respecto ya que perderían su licencia. Así que se callan. Pero la mayoría sabe que las vacunas están matando y lesionando a personas de todas las edades.
  24. Una de mis amigas enfermeras dijo que cuando un niño tuvo un incidente cardíaco recientemente, todo el departamento de trauma pensó en «lesión por vacuna» tan pronto como escucharon que había un adolescente con un problema cardíaco. Sin embargo, ninguno de los miembros del departamento de trauma reconocerá nada de esto públicamente porque saben que serán despedidos por admitir la verdad.
  25. Los médicos ahora están dispuestos a reunirse con miembros del Congreso e informarles sobre lo que está sucediendo. Por ejemplo, ahora tengo 25 médicos en California dispuestos a arriesgar sus carreras para hablarles a los miembros del Congreso en California. Estos médicos trabajan en hospitales de todo California. No es local.
  26. Los funcionarios de salud pública ahora están dispuestos a ser entrevistados por mí. Tengo uno para el lunes 11 de julio. ¿Puedes creerlo? ¡Un funcionario de salud pública que responderá mis preguntas! no puedo esperar
  27. Alex Berenson se reencarnó en Twitter . Twitter admite que lo eliminaron por error (después de que le dijeron a Alex que habían revisado «cuidadosamente» sus tweets y los encontraron problemáticos). Todos los demás en Twitter Heaven extrañaremos tener a Alex cerca.
  28. Un documental de la BBC no puede obtener una simple estadística de vacunación correcta (el porcentaje de no vacunados). Pero para su crédito, lo corrigieron después de que el profesor Fenton señalara el error . ¡Eso es progreso porque muestra que la verdad realmente está comenzando a importar ahora! Susan Oliver es mucho peor que la presentadora del programa de la BBC, Hannah Fry. Ninguno de ellos va a debatir nunca con Norman Fenton. Nadie lo hará.
  29. La revista Science admitió tácitamente que ya no están haciendo ciencia. Solicitamos que pidan una corrección o retractación de un documento obviamente defectuoso . La solicitud fue realizada por un profesor británico muy respetado, Norman Fenton. ¡Lo ignoraron! En resumen, la ciencia basura está bien para su revista. Realmente creo que deberían cambiar el nombre de su revista a «Ciencia basura», ya que eso sería más preciso. Pero está claro que no les importa la precisión. Puede estar seguro de que se quedarán callados sobre este papel basura. Así es como funciona la “ciencia” hoy en día.
  30. Hablé con el director ejecutivo de un hospital cerca de mí. Tan pronto como le envié información sobre el peligro de la vacuna y le sugerí que podría ser un líder mundial al ser el primer director general de un hospital en admitir la verdad, dejó de hablarme. Así que en realidad promete que incluso me respondió a pesar de que ya no lo hace. Ninguno de ellos quiere ser el primero. Todos quieren conservar sus puestos de trabajo. Tu vida no es importante para ellos.
  31. De hecho, conseguí que un reportero del San Jose Mercury News respondiera a un correo electrónico que envié. En realidad todavía estamos conversando. Chico, eso es lo primero.
  32. Los verificadores de datos ahora me tienen miedo. ¿Por qué? Porque me hice inteligente y ahora insisto en grabar todas las conversaciones. Ahora todos se niegan a hablar conmigo. Porque la verdad no es su enfoque. Escucha esta grabación. Después de hacer esta grabación, ningún verificador de datos se puso en contacto conmigo. Y sí, fue una grabación legal; ellos no discuten eso. Aquí está la historia y un enlace a la grabación . Ahora, ningún verificador de hechos me hablará ni me debatirá sobre los hechos. Maldito.
  33. El público de los EE. UU. NO puede saber qué hay dentro de las vacunas COVID. Una FOIA al gobierno británico confirmó que «la composición cuantitativa completa de todas las vacunas COVID-19 está exenta de la divulgación de la FOI». En Uruguay, un juez ordenó suspender las vacunas hasta que se revele el contenido . Aquí una historia con más detalles sobre la situación en Uruguay. Sin embargo, en los EE. UU., está perfectamente bien exigir la vacunación de los estadounidenses con sustancias que las personas no pueden conocer. Las personas que hacen el mandato ni siquiera saben lo que hay dentro de la vacuna. Ellos también están completamente despistados. Así es como funciona. Después de todo, es importante que el público (y las autoridades que ordenan) NO conozcan la verdadera composición porque si la supieran, nadie la tomaría. Por eso hay que mantenerlo en secreto. ¿Consíguelo? Es por tu propio bien. Básicamente tenemos que confiar en las compañías farmacéuticas, aunque tengan un historial de fraude y productos defectuosos. Después de todo, si no puedes confiar en Pfizer, ¿en quién puedes confiar? ¿No te hace querer confiar en ellos?
  34. Estamos aprendiendo de enormes conflictos de intereses con pagos de hasta $400 millones otorgados a personas desconocidas dentro del gobierno de los EE. UU. Sabemos que Fauci es uno de los destinatarios porque se negó a responder esa pregunta cuando el senador Rand Paul le preguntó. No se nos permite conocer ninguno de estos detalles porque se considera confidencial. En otras palabras, no sería de interés público que se conozcan los conflictos de intereses por alguna razón. Mire este video a los 7 minutos y 30 segundos desde el comienzo. La respuesta de la FOIA está redactada como puede ver. El senador Rand Paul quiere saber. El resto del Congreso: piensan que es mejor que esto se oculte al pueblo estadounidense.
  35. Aumentan los ahogamientos. Una fuente de datos de ahogamiento se encuentra en las muertes en la zona de surf de la NOAA :2015 542016 662017 732018 802019 932020 932021 1292021 aumentó 39%El aumento más alto año tras año antes de 2021 fue del 22 %.2021 fue un 51% más alto que el promedio de 7 años .Los corazones más débiles no pueden manejar la natación estresante. ¿Preguntarse por qué?
  36. Los datos de mortalidad por todas las causas posteriores a la comercialización son el estándar de oro para una vacuna. Tenemos eso en el Reino Unido que lo rastreó. Subió hasta 6 veces según los datos de la ONS del Reino Unido . Pero nuestro propio CDC no puede encontrar ninguna señal aquí, a pesar de que los números de muerte de VAERS y los números de muerte de Medicare están fuera de los gráficos. Cuando el CDC analizó los datos de muertes de VAERS (el artículo de Hannah Rosenblum VAERS publicado en The Lancet) dijeron que ninguna de las muertes en exceso fue causada por las vacunas, pero nunca dijeron qué causó las muertes. ¿Por qué nadie en la comunidad médica o la prensa quería saber la causa real del número sin precedentes de muertes en exceso? Las muertes fueron 50 veces mayores de lo normal y ninguna otra vacuna tiene un aumento en las tasas de mortalidad, solo esta. ¿Por qué los CDC no querrían saber por qué? ¿Y por qué Martha Sharan me prohíbe hablar con los autores? Se supone que los CDC ayudan a detener la desinformación. Extendí la mano para encontrar la razón «correcta» de las muertes y su respuesta fue no hablar conmigo. Eso no ayuda a corregir la “desinformación”. Solo quiero saber qué causó todas las muertes en exceso que solo ocurrieron por las vacunas COVID. es mucho para preguntar? Nadie más está haciendo la pregunta, pero es una pregunta importante que hacer.
  37. Las tasas de embolia pulmonar eran más de 1000 veces lo normal y lo sabíamos en enero de 2021 . Como muestra el artículo, los datos estaban a la vista de todos. Entonces, ¿cómo podría esto no haber activado una señal de seguridad? Ahora es el 12 de julio de 2022 y, hasta la fecha, los CDC nunca han reconocido que la vacuna podría desencadenar una embolia pulmonar. ¿Cómo es eso posible? ¿Es una de las señales de seguridad más grandes, obvias y serias que se activa en VAERS? La respuesta es simple: las personas de los CDC y la FDA no están monitoreando el sistema VAERS. Están mirando para otro lado.
  38. El CDC no está publicando ningún dato de su base de datos BEST. Sí, así es como se llama en realidad. No puedes inventar eso. Pero debido a que los datos no son de apoyo, nunca nos muestran. Se mantiene bajo llave y candado. Nadie llega a mirarlo. Uno pensaría que si la vacuna funciona como se anuncia, nos estarían mostrando los datos. El hecho de que no nos muestren los MEJORES datos… eso tiene que ser muy preocupante para cualquier persona con un cerebro funcional.
  39. No muestran al público los datos de mortalidad por todas las causas de Medicare. ¿Sabía que está en su punto más alto desde que lanzaron las vacunas? Por supuesto, no lo sabe porque los CDC no divulgarán esos datos y la prensa no les preguntará al respecto. La única razón por la que lo sé es porque un empleado honesto del HHS me avisó (sí, en realidad encontramos a un informante que está furioso por el encubrimiento).
  40. Los datos de la ONS del Reino Unido muestran que la mortalidad por todas las causas aumenta enormemente después de cada vacunación . Si no es la vacuna la que causa esto, entonces, ¿qué lo está causando? Es un efecto ENORME: hasta un aumento de hasta 6 veces en la mortalidad por todas las causas después de recibir cada vacuna en comparación con los no vacunados en grupos de edad similares. Nadie explicará esto en cámara. Todos son tímidos ante la cámara. Nadie se atreve a desafiar al profesor Norman Fenton en esto. El CDC cree que sucede lo contrario, que la vacuna te hace casi inmortal, lo que reduce el riesgo de muerte a niveles absurdamente bajos . Alguien te está mintiendo. Puedo garantizarle con seguridad que los CDC están mintiendo porque las tasas de mortalidad por todas las causas son tan bajas en el estudio VSD de los CDC que la vacuna incluso evita que usted muera en accidentes.
  41. Existe un potencial muy real de que la vacuna pueda integrarse en el ADN de una persona de forma permanente. Ver Estudio de Suecia muestra que COVID Jab puede modificar el ADN, abre puertas para nuevas demandas . La vacuna podría estar modificando permanentemente su ADN y no para mejor. Dijeron que esto no podía suceder, pero ahora es una posibilidad real y pronto tendremos confirmación si esto está sucediendo en las personas. Mientras tanto, «¿te sientes afortunado?» Esa es la pregunta que los CDC deberían hacerle a las personas antes de vacunarse. Todos deben ser advertidos sobre esto antes de recibir la inyección. Eso será un verdadero consentimiento informado. En cambio, las personas se mantienen en la oscuridad. Nadie que reciba la inyección tiene idea. ¿Es esa realmente la forma en que hacemos medicina en Estados Unidos para mantener a la gente en la oscuridad de esta manera?
  42. ¿Cómo explicarán todas las enfermedades cardíacas repentinas que ahora ocurren en los niños que solo les ocurren a los niños vacunados y que solo comenzaron a ocurrir después de que se implementaron las vacunas?
  43. Hice que los médicos revisaran más de 600 informes de muertes por vacunas. Descubrieron que 3 murieron a causa de la enfermedad de Creutzfeldt-Jakob (CJD), que es extremadamente frecuente: ocurre naturalmente en 1 de cada 1 millón de personas. Nadie puede explicar la tasa del 0,5% observada aquí. Eso es 5.000 veces lo normal. No sucedió por casualidad y lo único que estas personas tenían en común es que comenzó justo después de la vacuna contra el COVID. ¿Cómo puede una vacuna segura causar ECJ? Respuesta: una vacuna segura no puede. Una vacuna insegura puede. Ningún verificador de hechos tocará eso. Para obtener más información, consulte la sección CJD de » Mi última encuesta «.
  44. Desafortunadamente, la comunidad médica todavía está unida en que la censura de artículos en las principales revistas médicas está bien cuando entra en conflicto con la narrativa política. Por lo tanto, a todos les parece bien que artículos como el artículo de Rose sobre las tasas de miocarditis después de las vacunas COVID , que fue retirado por el editor porque no les gustó la conclusión. Todavía no hay nadie que se pronuncie en contra de Elsevier por censurar la ciencia sin ética. Ni una sola persona del lado pro-vax piensa que censurar la ciencia está mal. Es sorprendente porque es tan objetivamente poco ético. Nadie puede defender esto pero todos guardan silencio.
  45. Hubo fraude en el juicio de Pfizer. He documentado más de una docena de problemas que serían «difíciles de explicar» si no hubiera fraude, incluidos algunos que son imposibles de explicar si no hubiera fraude. Nadie quiere explicarlos. Pero ahora tenemos algo incluso mejor que mis acusaciones de fraude: una admisión de Pfizer en el Tribunal Federal de que defraudaron a la FDA. Consulte Pfizer pide a la corte que desestime la demanda de un denunciante porque el gobierno estaba al tanto del fraude . La prensa convencional no lo cubrirá, así que nadie lo sabrá.
  46. Haití no vacunó a sus ciudadanos. La tasa actual de vax es del 1,4 %; sin embargo, el país tiene una de las tasas de mortalidad por COVID más bajas del mundo. ¿Cómo es eso posible?
  47. Han admitido que nadie defenderá las políticas de los CDC o la FDA en cámara . Hicimos una convocatoria abierta para que alguien hiciera esto y no hubo respuestas. Promueven la narrativa solo cuando están seguros de que no serán cuestionados con cosas inconvenientes como evidencia y hechos.
  48. Nadie ha podido responder una sola pregunta en mi lista de más de 100 preguntas.
  49. El jefe de vacunas de la FDA, Peter Marks, ha dicho que hará cualquier cosa para ayudar a reducir las dudas sobre las vacunas, EXCEPTO debatir con cualquier científico calificado que tenga puntos de vista opuestos . Sin embargo, debatir con la oposición es la forma más efectiva para que el Dr. Marks logre su objetivo. Entonces, ¿por qué no lo está haciendo? Simple. Él no tiene los hechos de su lado.
  50. Un artículo publicado en una revista revisada por pares dice que los «propagadores de información errónea» (incluido yo mismo) están diciendo la verdad . Finalmente.
  51. Estamos viendo médicos como Andy Bostom escribiendo un artículo de opinión mordaz sobre la Universidad de Brown, donde trabaja en el encubrimiento de un estudiante que murió de miocarditis después de una vacunación forzada. Así que los médicos armados con los hechos ahora están dispuestos a sacrificar sus carreras para decir la verdad.
  52. La gente está empezando a darse cuenta del bajo riesgo-beneficio de las vacunas. Nuestras últimas encuestas dan el mismo número estimado de muertes por la vacuna que los datos de VAERS (y otras 10 fuentes) : 500,000 en este momento. Pero la cantidad estimada de vidas de COVID salvadas según el ensayo clínico es de 1 en 22,000, lo que significa alrededor de 10,000 vidas salvadas. Así que hemos matado a 500.000 personas para quizás salvar a 10.000 personas. Eso es tonto. Nadie me debatirá sobre los números. Incluso ofrecí $ 1 millón a cualquiera que pudiera refutar nuestras estimaciones y mostrarnos los números correctos. Sin tomadores.
  53. Los hogares de ancianos como Palo Alto Commons no pueden esconderse en las sombras para siempre. Mi artículo relata que 6 residentes recibieron la inyección allí y los 6 murieron dentro de las 5 semanas posteriores a la inyección mientras dormían , aunque la mayoría estaban perfectamente saludables. ¿Cómo pueden morir 6 de cada 6? En la tercera edad es donde se encuentra el mayor beneficio vs riesgo. Es un delito grave presentar un informe VAERS falso (y no hay ningún incentivo para ir a la cárcel aquí para el reportero) y Palo Alto Commons no dice nada, tratando de esconderse falsamente detrás de HIPAA.
  54. La «ciencia» detrás de usar una máscara ahora está completamente reventada gracias a que el profesor Jason Abaluck accedió a que nuestros expertos impugnaran su artículo . Pero la mitad de las personas todavía usan máscaras en los aeropuertos, por lo que el mensaje no se difunde. Pero al menos hemos reventado por completo la justificación científica de las máscaras. Se fue. Vea mi artículo sobre pedirle a Science que se retracte del estudio en el que se basaba la comunidad médica. No responderán y no podrían responder ya que no hay excusa para no retractarse del artículo. Consulte también Las máscaras no funcionan .
  55. Todavía intentan que las mascarillas funcionen como este estudio: School Masking Policies and Secondary SARS-CoV-2 Transmission Pero el comentario de Prasad y Hoeg destruye su estudio.
  56. El CDC tuvo que cambiar la definición de «vacuna» porque las vacunas contra el COVID no eran vacunas.
  57. Los números simplemente no están funcionando para los promotores de la vacuna. En NSW, Australia, la tasa de vacunación es del 96,7% . Eso significa que si las vacunas reducen el riesgo de hospitalización en un 90 %, entonces el 25 % de las personas en el hospital no deberían estar vacunadas. Eso es lo que dicen las matemáticas. Entonces, ¿por qué no hay personas no vacunadas que se enfermen?
  58. He escrito casi 1000 artículos sobre problemas con la vacuna en mi subpila. Otra excelente subpila de historias de lesiones por vacunas es stopmandatoryvaccination . Estas historias son difíciles de explicar si las vacunas son seguras y efectivas.
  59. ¿Sabías que la probabilidad de ser contagiado por alguien con COVID es proporcional a su carga viral? Probablemente no porque los CDC nunca te dijeron eso. ¿Quieres saber por qué los CDC nunca te dijeron eso? Es porque la carga viral de las personas vacunadas es la misma que la de las personas no vacunadas. Consulte este documento, el aislamiento de 4000 SARS-CoV-2 muestra que la contagiosidad está asociada con la carga viral, no con la vacuna o el estado sintomático . Su estado de vacunación no tiene nada que ver con su contagiosidad. Así que vacunarse para proteger a los demás es una tontería. Lo que significa que los mandatos de vacunación son tontos. Pero, ¿cuándo la ciencia ha tenido algo que ver con la política de salud pública? A la gente se le dice que se calle y haga lo que se le dice. Y la mayoría de la gente lo compra.
  60. ¿Alguna vez te has preguntado por qué, con evidencia como esta, nadie en la comunidad médica dice nada? Es porque todo está controlado por el gobierno y si haces enojar al gobierno, estás fuera del negocio, por eso. Recibí esta nota del director ejecutivo de un gran hospital que básicamente dice que los hospitales son solo peones y no pueden hablar ni arriesgarse a sufrir represalias por parte del gobierno y tengo que convencer a la FDA de que están equivocados. En resumen, dice que no podemos ganar porque la FDA no tiene responsabilidad ante nadie. Esto es lo que escribió después de que le pregunté si él y su hospital dirían la verdad sobre lo que está sucediendo dentro de los hospitales con todas las lesiones y muertes por vacunas: “Con respecto a mi participación, debo declinar respetuosamente. Los hospitales se rigen en gran medida por los departamentos de salud del condado local y las regulaciones del gobierno federal, por lo tanto, estoy seguro de que puede comprender que no puedo serle útil para promover su posición. Estoy feliz de escuchar, pero no puedo tomar una posición sobre este tema”. Es por eso que algunas personas han sugerido queusamos médicos y enfermeras jubilados (contra los que no se pueden tomar represalias) para convencer al público (ya que el público confía en los médicos y enfermeras) , especialmente si esos médicos y enfermeras se jubilaron por lo que estaban viendo. Pero también podemos usar documentos en la práctica actual oscureciendo su rostro/voz en la cámara.
  61. Parece que ya no hay ningún científico que trabaje en la seguridad de las vacunas en los CDC. Envié cientos de correos electrónicos internos de los CDC (todas las personas que trabajan en las vacunas COVID) preguntando si alguien consideraría evidencia que vaya en contra de la narrativa. No hay respuestas. Un verdadero científico siempre está abierto a nuevos datos y a encontrar la verdad. Así que los “científicos” de los CDC no son científicos; son “propagandistas”. Si encuentra a alguien que trabaje en los CDC que esté dispuesto a considerar evidencia que va en contra de la narrativa, hágamelo saber. Pero es probable que sean despedidos instantáneamente si consideran que los CDC podrían estar equivocados.
  62. Los datos muestran que usar una máscara aumenta la probabilidad de muerte si contrae COVID . Esto es lo contrario de lo que nos están diciendo.
  63. Simplemente hay demasiadas anécdotas de Cisnes Negros para ignorar. Por ejemplo, este Cisne Negro no debería existir solo con una población de mil millones de personas (si crees en la narrativa), pero estas historias son muy comunes. He escuchado historias de muertes múltiples dentro de una familia después de la vacuna. Son tan comunes que ya no les sigo la pista. Por ejemplo, este es uno que recibí ayer de una enfermera de la UCI que perdió a su prometido por la vacuna y cuyo hermano casi muere a causa de la vacuna, pero tuvo suerte y ahora tiene un ICD implantado probablemente por el resto de su vida:
  64. Tengo nombres y contactos familiares de 253 personas que muy probablemente hayan muerto por la vacuna . Eso no debería ser posible para una vacuna segura y efectiva. Es una gran bandera roja.
  65. Tengo una lista de 1,000 personas lesionadas por vacunas (esa es la opinión pública con la información de contacto redactada para que pueda leer las historias de terror). Pero los CDC dicen que las lesiones por vacunas son raras. Pero, ¿cómo es posible que estas personas tengan más de 80 síntomas que son comunes a los vacunados y solo desarrollen esos síntomas después de la vacuna y no antes de la vacuna? Entonces, ¿cómo puede haber grupos de Facebook de 250,000 personas lesionadas por la vacuna COVID? Facebook elimina estos grupos cuando crecen a cualquier tamaño, por lo que las personas nunca se darán cuenta de cuán grande es el problema. Estos grupos tienen que hablar en “código” para evitar ser detectados y eliminados por Facebook.
  66. ¿Sabía que los funcionarios de salud pública están ahí para proteger a las compañías farmacéuticas y no al público? Consulte estos correos electrónicos de uno de los principales funcionarios de salud pública de Canadá (Bonnie Henry) . Y tenga en cuenta las técnicas que utilizan todos los buenos funcionarios de salud pública para ocultar la verdad al público (ver 3:00 en el video ). Hay muchos otros problemas señalados en el video y luego comienza a mostrar los correos electrónicos reales alrededor de las 10:00 en el video. Verás que la prioridad es la mensajería pública para no implicar a la vacuna en la muerte y no hay interés en evaluar la causalidad.
  67. La Colaboración de Brighton se utiliza para las definiciones de eventos adversos, pero ahora está controlada por CEPI, que está controlada por las compañías farmacéuticas. Entonces, las compañías farmacéuticas pueden redefinir las definiciones de eventos adversos. Y lo hacen. Que conveniente. ¿Y pensaste que todo esto era objetivo, en el nivel? De ninguna manera. Vea este video a las 17:00 para obtener una explicación de los conflictos de interés. Un médico en Canadá me escribió después de enterarse de esto: “Sí, el video fue muy interesante . En particular, su uso de los criterios de Brighton que explica por qué no estamos detectando una señal de seguridad aquí en Canadá. Creo que vale la pena desarrollarlo más”.
  68. Robert Malone hace un trabajo brillante al describir los conflictos de intereses y cómo se juega el juego en su discurso de 15 minutos en este foro de seguridad de vacunas en el MIT el 16 de mayo que patrociné . Comience a mirar a las 5:26 (son cinco horas y 26 minutos de video). Es excelente. Aquí está la reseña del evento del MIT .
  69. Las muertes de bebés están siendo reportadas en la prensa en Israel , pero aquí están siendo suprimidas. Es solo cuestión de tiempo antes de que esto se extienda a Europa y eventualmente sea imposible de ignorar en los EE. UU. Ese mismo artículo habla de que las compañías farmacéuticas tienen “listas negras” de médicos que buscan silenciar porque criticaron la droga. Esto es del testimonio de la corte. También habla de la vacuna para ganado de Pfizer (PregSure BVD) que mató al 15% de las vacas. Pasaron 4 años antes de que se retirara del mercado en 2010. Está ocurriendo nuevamente, esta vez en las personas (aunque con una tasa de mortalidad de solo el 0,2 % para las personas).
  70. Tengo todos los registros de defunción en Nuevo México para 2020. ¿Adivina qué? Cuando observa los códigos ICD-10 de los registros de defunción, encontrará que solo hubo alrededor de 330 muertes verdaderas por COVID, no 2,000. Entonces, 5 de cada 6 muertes por COVID fueron simplemente «con COVID» y no «por COVID». Nuevo México tiene una población de 2 millones y mueren 2 millones al año, por lo que estamos viendo un aumento total de ACM del 1,5 % por COVID en 2020 , ¡¿ y eso se consideró una emergencia y una pandemia?! Eso es ridículo. Entonces, el punto es que exageraron la percepción publicitando cualquier muerte por COVID, y luego la respaldaron con números inflados para crear la percepción de una emergencia. NADIE irá a la cámara conmigo para disputar esto.
  71. El CDC admitió en una solicitud de FOIA que no comenzaron a observar las señales de seguridad en VAERS hasta abril de 2021 . El programa de vacunación comenzó en 2020. ¿Por qué esperaron? La respuesta es obvia: no les importa encontrar señales de seguridad. ¿Por qué el público no está horrorizado por esto? ¡Simple! Porque los principales medios de comunicación no le dirán al público que los CDC no monitorearon los datos de seguridad.
  72. La negación de los acontecimientos adversos es impresionante. Hubo grupos de Facebook con más de 250,000 personas lesionadas por vacunas que fueron eliminadas. Personalmente tengo una lista de 1.000 heridos por vacunas. Entonces, cuando le pregunté a un panel de científicos del MIT si creían en los CDC que dicen que no han encontrado ningún vínculo entre las vacunas COVID y las vacunas lesionadas, el 100% de los panelistas dijeron «sí, creen que los CDC le están diciendo a los verdad.» ¡Incluso me atacaron personalmente por hacer la pregunta! Todo está en video. Puedes verlo a las 4:56:00 . Es asombroso que haya tal lavado de cerebro.
  73. Me ofrecí a pagar personalmente los costos médicos de cualquier aerolínea estadounidense dispuesta a evaluar a todos sus pilotos para detectar problemas cardíacos . Sin tomadores. ¿Qué te dice eso? De hecho, si lee el artículo, señala que si las vacunas fueran realmente seguras, Moderna y Pfizer estarían ofreciendo montones de dinero a las aerolíneas para evaluar a todos sus pilotos que, si dicen la verdad, PROBARÍAN que sus vacunas no lo son. No causará problemas cardíacos. Pero ellos no están haciendo eso. ¿Por que no?
  74. Si las vacunas son tan seguras, ¿cómo puede haber un aumento del 25% en los eventos de emergencia cardíaca ? Si no fue la vacuna, ¿cuál fue la causa?
  75. Los médicos ahora se dan cuenta de que las vacunas están causando lesiones masivas. No pasará mucho tiempo para que caiga el otro zapato porque esto ahora se está haciendo público con artículos como este donde cinco médicos diferentes admitieron que las lesiones fueron causadas por la vacuna, pero ninguno de los cinco médicos lo admitirá públicamente . Este es un gran progreso. Al principio, estarías bateando 0 de 5 en privado. Ahora es 5 de 5. El cambio de 0% a 100% es un avance importante. Además, el hecho de que esto se haya informado en los principales medios de comunicación también es un excelente progreso. Eso nunca hubiera sucedido antes.
  76. Nunca hemos tenido una vacuna en la que los datos muestren que los beneficios superan el riesgo. Si existiera tal vacuna, las vacunas contra el COVID estarían en el último lugar de la contienda, ya que los eventos adversos de la vacuna contra el COVID son más que todas las demás vacunas en los 30 años de historia de VAERS combinadas. Sería difícil para alguien argumentar que esta es la primera vacuna segura.
  77. Cada vez es más conocido, gracias al libro de RFK, que los CDC cancelaron deliberadamente el proyecto ESP:VAERS, lo que habría aumentado enormemente la sensibilidad del sistema VAERS a eventos adversos . El proyecto fue cancelado porque demostró que todas las vacunas no eran seguras. Eso fue políticamente imposible, por lo que tuvieron que cancelar el proyecto. Es por eso que tenemos un sistema de notificación de eventos adversos tan poco convincente en los EE. UU. en la actualidad.
  78. El fraude por parte de las revistas está siendo expuesto. Por ejemplo, este estudio fraudulento publicado en Frontiers in Medicine exageró las muertes pediátricas. Fenton usó tasas CFR e IFR bien establecidas para demostrar su punto (para los menores de 20 años, la IFR debe ser inferior a 1 en 37 000). La revista se negó a comentar sobre el análisis de Fenton.
  79. El profesor Norman Fenton ha expuesto que los datos del gobierno del Reino Unido sobre la seguridad y eficacia de las vacunas son fraudulentos . Esa tabla deja al descubierto cuán corrupto ha sido el gobierno del Reino Unido al manipular los datos. Ahora se ha demostrado que todas las afirmaciones que ha hecho el gobierno sobre la eficacia y la seguridad de las vacunas son falsas . Nadie quiere hablar de eso. La censura es la técnica que utilizan para contrarrestar esto ya que no tienen datos.
  80. Los números de la ONS del Reino Unido muestran que es mucho más probable que la vacuna lo mate que lo ayude para las edades de 10 a 14 años. Vea mi artículo que muestra que incluso cuando manipulan los números, ¡la señal de muerte de los niños es demasiado difícil de ocultar !
  81. En el Reino Unido, los niños que morían en el hospital eran enviados directamente a la cremación . Hubo un gran número de muertes que fueron encubiertas y pedidos masivos de ataúdes para bebés .
  82. La gente se está despertando y notando que los recién nacidos australianos no tienen respuestas inmunitarias contra virus comunes como la influenza . Esto está sucediendo ahora, después de que la mayoría de las madres hayan sido vacunadas contra el COVID. Claramente no fue causado por COVID porque recién estamos viendo esto ahora. Puede tomar un tiempo para que las personas descubran que esto se debe a las vacunas «seguras y efectivas». Una vez más, nadie me debatirá esto frente a la cámara. Esto, junto con el aumento del 400 % en la demanda de ataúdes para niños, debería hacer que toda persona pensante presione el botón de pausa .
  83. Hay demasiadas personas hablando ahora, diciendo lo mismo . ¿Cómo podrían estos antivacunas estar tan unidos en su oposición? No hay coordinación entre ellos, pero están diciendo lo mismo.
  84. Demasiadas personas murieron en solo 7 días en el Reino Unido para ser consideradas normales.
  85. Acaba de salir a la luz que Moderna se coludió con la FDA para eludir las pruebas de seguridad normales .
  86. Los médicos que están siendo censurados se están defendiendo en los tribunales:ImagenImagen
  87. Los paramédicos dicen que están viendo más heridos por vacunas que casos de COVID . ¿Cómo es eso posible para una vacuna que es 100% segura? ¿Cómo alguien explica esto?
  88. Ahora sabemos que Israel mantuvo las muertes de niños fuera de la vista del público para que la vacuna pareciera segura .
  89. Podríamos poner fin a la pandemia al instante si un país rompiera filas e implementara las mejores prácticas para la atención ambulatoria y hospitalaria . Esto podría suceder en cualquier momento.
  90. Ni una sola persona que apoya la narrativa falsa ha estado de acuerdo con la solicitud del profesor Vinay Prasad de la UCSF para una discusión abierta. En el momento en que esto cambie, será una gran grieta en la presa. Pero por ahora, han estado dando vueltas al 100% y nadie rompe filas. El artículo de opinión de Prasad se tituló » Los científicos que expresan diferentes puntos de vista sobre el covid-19 deben ser escuchados, no demonizados «. Apareció hace más de dos años y, hasta la fecha, no ha habido ni una sola discusión abierta.
  91. Más y más personas cayendo a plena vista. Es muy difícil ignorar esto: una enfermedad repentina detiene el espectáculo en Hungría (Sir Tom Jones), Madrid (Jane Birkin) y Dresde (Aida); los mejores atletas tienen que abandonar el Tour de Francia y el US Open; y dos llamadas cercanas, en Israel y Turquía y
  92. Médicos de Nueva Zelanda se han reunido para pedir a la policía que investigue las muertes por la vacuna . Hay una larga lista de muertes en ese artículo que no se puede explicar (demasiados cisnes negros).
  93. La tasa de enfermedad priónica posterior a la vacunación es demasiado alta para ser normal: 0,5 % en nuestra muestra de muertes por vacunas . Un estudio en Francia mostró que sucede justo después de la vacunación . No hay forma de que alguien explique eso si las vacunas son seguras.
  94. El gobierno alemán admitió que una tasa de 1 de cada 5000 inyecciones causa efectos secundarios graves el 20 de julio de 2022. Hemos administrado 600 millones de dosis en los EE. UU., lo que representa 120 000 lesiones graves causadas por las vacunas.
  95. Las estadísticas oficiales del gobierno canadiense muestran que las vacunas pueden aumentar el riesgo de muerte por COVID en un 50% ; las personas vacunadas pero no vacunadas tenían un 50 por ciento más de probabilidades de ser hospitalizadas o morir de covid que las personas no vacunadas. Eso es realmente sorprendente porque las vacunas no solo lo ayudan a morir de COVID, sino que también matan a un gran número de personas que no tienen COVID y estaban perfectamente sanas. Los datos de Manitoba parecen marcar la primera vez que una agencia gubernamental realmente ha encontrado un mayor riesgo de muerte por COVID en personas vacunadas.
  96. Robert Malone no se anda con rodeos cuando describe las causas de la pandemia . Básicamente, nuestro gobierno confió en las personas y organizaciones equivocadas. Simple como eso. Pueden pasar años antes de que lo descubran, pero al menos está todo sobre la mesa.
  97. Este artículo muestra que las vacunas tienen un impacto severo en la salud reproductiva, el ensayo de Paxlovid se detuvo por falta de eficacia en pacientes de riesgo estándar, no hubo diferencias claras entre el uso de máscaras médicas/quirúrgicas en comparación con los respiradores N95/P2 en trabajadores de la salud cuando se usa en atención de rutina para reducir la infección viral respiratoria. El CDC nos mintió sobre todo esto.
  98. La gente está empezando a darse cuenta de que nuestra ética médica antes era baja. Ahora son aún más bajos .

Actualizaré esta lista con el tiempo, pero esa es la lista que se me viene a la cabeza sobre lo que está pasando. Por lo que puedo ver, todo el impulso se está moviendo en nuestra dirección.

Como siempre, consulte los comentarios a continuación para obtener información adicional de mis lectores. Sólo estoy contando una parte de la historia. Hay más de 1000 comentarios que deberías leer además de mi artículo.

1350 comentarios más…


Fuente: https://stevekirsch.substack.com/p/the-safe-and-effective-narrative

La normalización del nuevo Imperio «normal»


Escrito por CJ Hopkins a través de The Consent Factory,

Lo sé, probablemente estés harto y cansado de escuchar sobre  el ascenso del nuevo Reich normal . Quieres que se acabe. Yo también. No ha terminado… ni mucho menos. Puede parecer que se acabó donde estás. Me imagino que sí si vives en Florida, Texas, el Reino Unido, Suecia o Croacia, o en algún otro país o estado en el que la mayoría de las «restricciones de Covid» se han levantado, o quizás nunca se introdujeron. en primer lugar. Si ese es el caso, me alegro por ti.

Resulta que vivo en la Alemania de la Nueva Normalidad, la punta actual de la lanza de la Nueva Normalidad, o una de las puntas de una de sus lanzas (o agujas hipodérmicas con ARNm), los otros son países y estados como Canadá, China, Australia, Nueva York, California y una variedad de otros focos de Nuevo Normalismo. Si vives en una de estas fortalezas de la Nueva Normalidad, como yo, eres muy consciente de que no ha terminado.

Sí,  el culto covidiano está kaput . El hechizo se ha roto. Solo los cultistas de la Nueva Normalidad más locamente fanáticos continúan caminando en público con sus máscaras contra la peste y sus trajes caseros para materiales peligrosos. Pero el Reich de la Nueva Normalidad no está kaput. El Reich de la Nueva Normalidad está siendo… bueno, normalizado.Las masas están siendo condicionadas sistemáticamente para aceptar el estado policial de bioseguridad que las clases dominantes capitalistas globales han estado implementando durante los últimos tres años. A pesar de la evidencia ahora irrefutable de que las «vacunas» no previenen la transmisión del virus, «los no vacunados» todavía están siendo segregados, se les prohíbe trabajar, asistir a la escuela, competir en eventos deportivos importantes, etc. Todavía se obliga a la gente a usar máscaras, el símbolo del Reich de la Nueva Normalidad, en aviones, trenes, transporte público, consultorios médicos, hospitales, etc. Aquí, allá y en todas partes, los símbolos y rituales sociales de la Nueva Normalidad se integran permanentemente en la vida cotidiana.

Estos símbolos y rituales son más que solo el escaparate del Reich de la Nueva Normalidad. Son cómo nuestra nueva «realidad» se está creando y manteniendo. Las masas son como actores obligados a invertir emocionalmente en la «realidad» de una obra de teatro absurda. Cuanto más repiten la actuación, más convincente se vuelve la “realidad” ficticia, independientemente de cuán patentemente absurda sea… y se está volviendo cada vez más absurda.

Por ejemplo, en los aeropuertos de New Normal Canada, los ciudadanos que intentan ingresar a su propio país sin la llamada  aplicación «ArriveCAN»  en sus teléfonos inteligentes para proporcionar prueba de su «estado de vacunación»  (incluidos los octogenarios que no poseen teléfonos inteligentes)  están sujetos al acoso absurdo prolongado de los payasos imbéciles de New Normal con chalecos rojos. Aquí, en la Alemania de la Nueva Normalidad,  el gobierno se está preparando para obligar a todos a usar máscaras de aspecto médico en público cada otoño e invierno , no solo por la «plaga apocalíptica», sino también  por la gripe invernal normal . El pretexto ya no importa. El punto es la exhibición de uniformidad ideológica.

Mientras tanto, el Ministerio Federal de Salud de Alemania se vio obligado a publicar un hangout limitado sobre lesiones y muertes por «vacunas». Lo hicieron al estilo clásico goebbelsiano.

Aparentemente, no les gustaron los datos reales sobre la cantidad de efectos adversos graves, por lo que decidieron simplemente mentir sobre ellos en Twitter.

(Se informaron efectos adversos graves en aproximadamente 1 de cada 5000 dosis, no en 1 de cada 5000 personas «vacunadas». Se han administrado aproximadamente 184 000 000 de dosis a personas en Alemania y… bueno, puede hacer los cálculos). 

Naturalmente, la Corporación Twitter ha estado lanzando su falsa advertencia “engañosa” en los retuits señalando la mentira del Ministerio de Salud , porque la verdad es lo que dice la Corporatocracia, y todo lo demás es “desinformación”.

Si cree que estoy siendo duro o hiperbólico al caracterizar la mentira del Ministerio como una mentira, tenga en cuenta que el Ministro de Salud alemán, Karl Lauterbach, ha estado mintiendo repetidamente al público alemán durante más de dos años. Aquí está mintiendo sobre las “vacunas sin efectos secundarios” en agosto de 2021, justo cuando ordenó la segregación de “los no vacunados” y fomentó el odio hacia cualquiera que se negara a ajustarse a la ideología de la Nueva Normalidad…

Y ahora, decenas de miles de personas en Alemania, como mínimo, ya que los efectos adversos de las vacunas siempre han sido significativamente subestimados, han resultado gravemente heridos o… ya sabes, asesinados, porque Karl y sus compinches fascistas de la Nueva Normalidad mintieron a todos, una y otra vez, y los medios alemanes repitieron esas mentiras, y las masas de la Nueva Normalidad repitieron esas mentiras, y el gobierno y las corporaciones globales censuraron, denigraron y demonizaron a aquellos de nosotros que desafiamos esas mentiras como «extremistas de extrema derecha», «extremistas de la ciencia». negacionistas”, “antivacunas”, etc.

Y estos son solo algunos ejemplos recientes. No creo que sea necesario proporcionar una lista exhaustiva. En este punto, o eres muy consciente y capaz de enfrentar lo que está sucediendo, o no lo eres, en cuyo caso te estás diciendo lo que necesitas decirte para fingir que lo que está sucediendo no está sucediendo.

Si eso es lo que estás haciendo, no puedo ayudarte. Nada de lo que escriba o diga le llegará. Los hechos no harán ninguna diferencia para usted. Los funcionarios del gobierno y de la salud y las cabezas parlantes de los medios te mentirán en la cara, una y otra vez, y te atraparán mintiendo, y tú seguirás repitiendo sus mentiras con firmeza, no porque no entiendas que son mentiras, sino porque no te importa. que son mentiras. No te importa que estés matando e hiriendo a innumerables personas con tus mentiras aprobadas oficialmente, con tu cobardía, con tu obediencia sin sentido. Su objetivo es permanecer dentro de los límites de la «normalidad», y no recibir muchos insultos y ser condenado al ostracismo de su círculo social, y si mucha gente tiene que morir y usted tiene que abandonar cualquier apariencia de integridad y honestidad intelectual. para lograr eso, que así sea.

En cuanto al resto de nosotros, aquellos que somos conscientes de lo que está pasando y estamos haciendo nuestro mejor esfuerzo para enfrentar lo que está pasando, incluso si no entendemos lo que está pasando, o no estamos de acuerdo sobre por qué está pasando, me gustaría tener algo inteligente que ofrecer en términos de cómo hacer que deje de suceder.

Yo no, aparte de lo que he estado defendiendo, es decir, la desobediencia civil organizada y no violenta, como lo que hicieron los camioneros canadienses en Ottawa, como lo que están haciendo los granjeros holandeses en los Países Bajos. Columnas como esta, los memes de las redes sociales, las manifestaciones masivas esporádicas de los domingos y los actos individuales de incumplimiento no van a detener al gigante de la Nueva Normalidad. Continuará la normalización de la Nueva Normalidad, continuará la patologización de la sociedad, continuará la desestabilización y reestructuración de la economía global, a menos que suceda algo verdaderamente histórico y los trabajadores del mundo se unan (o si los individuos soberanos del mundo se unan si «trabajadores» suena demasiado comunista para ti) y clavar una llave inglesa en la maquinaria de la Nueva Normalidad.

Las posibilidades de que eso suceda son escasas. En mis 60 años de existencia corporal, nunca había experimentado un momento en que las personas estuvieran tan alienadas, desesperanzadas y en la garganta de los demás. No puedo recordar un momento en que la gente fuera tan sin sentido del humor, santurrona y viciosa… y estoy hablando de las personas que podrían marcar la diferencia, no de las masas de la Nueva Normalidad que siguen el orden. Si alguna vez hubo un momento en que las clases trabajadoras necesitaban dejar de lado sus diferencias políticas y flexionar sus músculos colectivos, es este, pero la mayoría de nosotros estamos demasiado ocupados enojándonos unos a otros para ganar puntos baratos en Twitter, Gettr o Telegram. , o, ya sabes, donde sea.

Siento terminar con una nota tan pesimista… Me estoy recuperando de la plaga apocalíptica, así que tal vez me siento demasiado pesimista.

Probablemente todo estará bien , y la gente finalmente recuperará la razón, y las clases dominantes capitalistas globales cancelarán todo el asunto de la Nueva Normalidad, y nadie necesitará organizar ningún tipo de campaña internacional no violenta de desobediencia civil, y , un día, nos despertaremos y revisaremos nuestros teléfonos y descubriremos que no hubo un Reich de la Nueva Normalidad, y que nadie murió a causa de una vacuna, y revisaremos nuestro estado de crédito social y le diremos a nuestras cocinas inteligentes que Comience a cocinar nuestros grillos y abra la Guerra del día en nuestras ViewScreens para que podamos apoyar a quien sea que nos hayan dicho que apoyemos… y todo finalmente volverá a ser «normal».

Fuente: https://www.zerohedge.com/geopolitical/normalization-new-normal-reich

¿Viruela del mono? ¿Hepatitis? ¿Síndrome de muerte súbita del adulto? Algo anda muy mal y es por las Vacunas del Covid-19


Parece que no podemos pasar una sola semana sin escuchar sobre el resurgimiento o el surgimiento de una enfermedad o dolencia en este momento.

Hemos tenido un misterioso brote de hepatitis entre los niños, un aumento del «Síndrome de muerte súbita del adulto» y el gobierno del Reino Unido declaró un «incidente nacional» después de supuestamente descubrir el virus de la poliomielitis en Inglaterra .

Y ahora, el Director General de la Organización Mundial de la Salud ha anulado la decisión de la Organización Mundial de la Salud de declarar por sí sola el presunto brote de viruela del simio como una emergencia de salud pública de importancia internacional.

Todos estos brotes siguen a una supuesta pandemia de covid-19, y todos ellos están ocurriendo «casualmente» después de que a millones de personas en todo el mundo se les haya inyectado una vacuna experimental de covid-19 de ARNm.

Pero esta es precisamente la razón por la que no deberíamos estar tan sorprendidos. Porque todo lo que estamos presenciando son las consecuencias del daño causado a millones de sistemas inmunológicos en todo el mundo por estas vacunas experimentales.

Los datos oficiales del Gobierno lo demuestran e indican que el daño es tan severo que los vacunados contra el Covid-19 están desarrollando el Síndrome de Inmunodeficiencia Adquirida.

Echemos un vistazo a algunas de las enfermedades y virus recientes que se publicitan en los principales medios de comunicación.

El 22 de junio, la Agencia de Seguridad Sanitaria del Reino Unido (UKHSA), en colaboración con la Agencia Reguladora de Medicamentos y Productos Sanitarios (MHRA), anunció que había encontrado poliovirus en muestras de aguas residuales recogidas en London Beckton Sewage Treatment Works.


El último caso de poliomielitis salvaje contraído en el Reino Unido se confirmó en 1984. El Reino Unido fue declarado libre de poliomielitis en 2003. La vigilancia de las aguas residuales se está ampliando para evaluar el alcance de la transmisión e identificar áreas locales para acciones específicas.

Desde mediados de mayo de 2022, lo más probable es que haya escuchado o visto la palabra Monkeypox mencionada varias veces en los principales medios de comunicación. Si no lo has hecho, estás a punto de hacerlo.

Esto se debe a que el sábado 23 de julio de 2022, el Director General de la Organización Mundial de la Salud, el Dr. Terdros, anuló la decisión de la Organización Mundial de la Salud de declarar por sí sola el presunto brote de viruela del simio como una emergencia de salud pública de importancia internacional. ( Fuente )

Supuestamente, por primera vez desde su descubrimiento entre humanos en África hace más de 50 años, el virus de la viruela del simio está circulando en varios países, incluidos EE. UU., Reino Unido, Canadá, Brasil, Australia y la mayor parte de Europa, todo al mismo tiempo.

Pero da la casualidad de que cada país donde supuestamente circula la viruela del simio también es un país que ha distribuido la inyección Pfizer Covid-19 a su población; excluyendo algunos países de África donde la enfermedad ha sido endémica durante los últimos 50 años.

Haga clic en la imagen a continuación y observe detenidamente para comparar qué países han informado casos de viruela del simio a la OMS desde mayo de 2022 y qué países han distribuido la inyección Pfizer Covid-19.

Todos los países que han informado casos de viruela símica también han distribuido el jab de Pfizer. Y solo hay un puñado de países donde se administró la inyección de Pfizer que no han informado un caso de viruela símica a la OMS.

A continuación tenemos la hepatitis.

El 15 de abril de 2022, la Organización Mundial de la Salud emitió una alerta mundial sobre una nueva forma de hepatitis aguda grave de etiología (causa) desconocida que afecta a niños previamente sanos. Las pruebas han excluido todos los virus de hepatitis previamente conocidos.

El anuncio se produjo después de que la Agencia de Seguridad Sanitaria del Reino Unido (UKHSA) detectara recientemente tasas de inflamación del hígado (hepatitis) más altas de lo normal en los niños.

Se había confirmado que las infecciones de hepatitis afectaron a niños en al menos doce países diferentes, y la mayoría de esos casos aumentaron en el Reino Unido.

¿Recuerdas ese viejo dicho?

‘Esperas cien años para una pandemia y luego aparecen tres o cuatro a la vez’.

Por supuesto, no lo haces. Y no todas estas emergencias de salud ocurren debido a una desafortunada coincidencia. Están ocurriendo porque las inyecciones de Covid-19 hacen que los receptores desarrollen el Síndrome de Inmunodeficiencia Adquirida, y podemos probarlo.

Durante meses, los gobiernos han estado publicando datos que sugieren fuertemente que las inyecciones de Covid-19 dañan tanto el sistema inmunológico que los receptores están desarrollando alguna nueva forma de Síndrome de Inmunodeficiencia Adquirida (SIDA). El ejemplo más fiable de esto proviene de la Agencia de Seguridad Sanitaria del Reino Unido (UKHSA).

El siguiente gráfico muestra la eficacia de la vacuna contra el covid-19 entre la población triplemente vacunada en Inglaterra en los informes de vigilancia de vacunas de la semana 3 , semana 7 y semana 13 de la UKHSA de 2022:

Esto ciertamente no está cerca del 95% de efectividad declarado por Pfizer, ¿verdad?

El siguiente gráfico muestra la tasa de mortalidad de Covid-19 por cada 100,000 personas por estado de vacunación entre el 28 de febrero y el 27 de marzo de 22. La tasa de casos no vacunados se tomó de la página 45 del Informe de Vigilancia de Vacunas de UKHSA – Semana 13 – 2022 , y el doble vacunado La tasa de casos se ha calculado con el número de muertes proporcionado en la página 44 del mismo informe:

Las cifras anteriores prueban que las inyecciones de Covid-19 están dañando el sistema inmunológico porque la efectividad de la vacuna no es en realidad una medida de una vacuna, es una medida del sistema inmunológico.

Las vacunas Covid-19 le indican al cuerpo que produzca la proteína de pico (S) del virus Covid-19 original. Luego, se supone que el sistema inmunitario debe deshacerse del cuerpo de estas proteínas de punta fabricadas y recuerda hacerlo si alguna vez se encuentra con el virus «real» en el futuro.

Por lo tanto, las cifras de la UKHSA demuestran que el sistema inmunitario de los vacunados está funcionando mucho peor que el sistema inmunitario de los no vacunados.

Un estudio científico también encontró que las vacunas Covid-19 suprimen el sistema inmunológico innato.

El estudio titulado ‘ Supresión inmune innata por vacunas de ARNm de SARS-CoV-2: el papel de los cuádruplex G, exosomas y microARN ‘ se publicó el 21 de enero y presenta una serie de pruebas de que las modificaciones genéticas introducidas por el mRNA Covid -19 vacunas tienen diversas consecuencias para la salud humana.


Éstos incluyen –

  • un vínculo causal potencialmente directo con la enfermedad neurodegenerativa;
  • miocarditis;
  • trombocitopenia inmune;
  • parálisis de Bell;
  • enfermedad del higado;
  • alteración de la inmunidad adaptativa;
  • aumento de la producción o formación de un tumor o tumores;
  • y daños en el ADN

Se puede leer un desglose completo del estudio aquí .

Es un error común pensar que el Síndrome de Inmunodeficiencia Adquirida (SIDA) solo es causado por el virus del VIH. Esto simplemente no es cierto.

La inmunodeficiencia adquirida (o secundaria) es una de las principales causas de infecciones en adultos. Estos trastornos de inmunodeficiencia afectan su sistema inmunológico en forma parcial o total, lo que convierte a su cuerpo en un blanco fácil para varias enfermedades e infecciones. ( Fuente )

Cuando los trastornos de inmunodeficiencia afectan su sistema inmunológico, su cuerpo ya no puede combatir las bacterias y las enfermedades. ( Fuente )

Varios factores ambientales pueden causar trastornos de inmunodeficiencia secundaria. ‌ ( Fuente )

Algunos comunes son:

  • Radiación o quimioterapia, que pueden provocar un trastorno de inmunodeficiencia secundario conocido como neutropenia
  • Las infecciones por el virus de la inmunodeficiencia humana (VIH) pueden provocar el síndrome de inmunodeficiencia adquirida (SIDA)
  • Leucemia, un cáncer que comienza en las células de la médula ósea y que puede provocar hipogammaglobulinemia, un tipo de inmunodeficiencia secundaria.
  • Desnutrición, que afecta hasta al 50% de la población en países subdesarrollados y deja a las personas vulnerables a infecciones respiratorias y diarrea.

Pero algunas de las causas menos comunes incluyen drogas o medicamentos. Fuente )

Por lo tanto, es perfectamente posible que un medicamento o droga cause el síndrome de inmunodeficiencia adquirida. Y la evidencia anterior sugiere que la inyección de Covid-19 debería agregarse a la lista.

¿De qué otra manera explica los datos de los EE. UU. que muestran que el cincuenta y uno por ciento de todas las reacciones adversas asociadas con el SIDA notificadas desde el año 2000 se notificaron en 2021, y un 16 % más en 2022 hasta ahora?

Datos fuente

¿De qué otra manera explicaría un aumento del 1919 % en el cáncer común asociado con el SIDA que se informó al Sistema de Informes de Eventos Adversos de Vacunas de los Centros para el Control de Enfermedades de EE. UU. en 2021 en comparación con el promedio de 2000 a 2020?

Datos fuente

¿Realmente debemos creer que esto es solo una desafortunada coincidencia? ¿O estamos presenciando el informe público estadounidense a los Centros para el Control de Enfermedades de que las inyecciones de Covid-19 les están causando el síndrome de inmunodeficiencia adquirida?

A juzgar por el hecho de que no podemos pasar una sola semana sin escuchar sobre el resurgimiento o el surgimiento de una enfermedad o dolencia, vamos a optar por lo último.

Los datos del mundo real no mienten. Algo anda muy mal, y es por las Inyecciones de Covid-19.

Fuente: https://expose-news.com/2022/07/24/monkeypox-hep-sads-covid-vaccine-injury-coverup/

Viróloga dice a BMJ que la hepatitis de causa desconocida que mata a los niños se debe a la vacuna COVID del vector viral de AstraZeneca con bloqueos


Un respetado virólogo/inmunólogo ha escrito al British Medical Journal para explicar que la hepatitis de origen desconocido que está matando y causando que los niños reciban trasplantes de hígado urgentes, está ocurriendo debido a la vacuna AztraZeneca Covid-19 que se administró a millones en el REINO UNIDO.

Una hepatitis misteriosa y mortal de origen desconocido está afectando ahora a niños de todo el mundo. Las autoridades de Salud Pública han descartado los virus comunes que suelen causar la afección, y decenas de niños han requerido trasplantes de hígado urgentes, mientras que otros lamentablemente han muerto.

Sin embargo, la pregunta en boca de todos es ‘¿qué demonios está causando este brote mortal de inflamación del hígado entre los niños?’

Una respetada viróloga/inmunóloga llamada Dra. Ann-Cathrin Engwall escribió al British Medical Journal para explicar cuál podría ser realmente la misteriosa causa. Su carta está impresa en su totalidad a continuación…

‘Estimado editor

Las infecciones por adenovirus pueden causar la hepatitis aguda observada en los niños. Está presente en el 70% de los niños afectados en comparación con el SARS-CoV-2 presente en solo el 15% [1].

Además, el SARS-CoV-2 se ha extendido por todo el mundo durante más de dos años sin que antes aparecieran casos. Las infecciones por adenovirus normalmente no causan hepatitis en niños sanos, lo que sugiere que se podría haber introducido un tipo completamente nuevo de adenovirus en la población humana.

La pregunta que uno debe hacerse en este caso es qué factores y eventos han ocurrido recientemente que distinguen al Reino Unido de otros países, ya que parece ser el origen y donde la mayoría de los niños han sido afectados por hepatitis de causa desconocida.

Una proporción sustancial de la población del Reino Unido ha recibido Vaxzevria, que es una vacuna de vector de adenovirus de AstraZeneca desarrollada por el Instituto Jenner en Oxford [2].

El vector viral de chimpancé fue seleccionado debido a la baja inmunidad de rebaño en la población humana y se origina a partir de un adenovirus purificado de las heces de cachorros de chimpancé [3].

El vector se modifica genéticamente para que no pueda multiplicarse y se pueden añadir genes de interés. En Vaxzervria, se insertó la secuencia de ADN que expresa la proteína espiga del virus Wuhan SARS-CoV-2 original [4].

¿Podría la vacuna de vector de adenovirus haber contribuido a un nuevo virus recombinante? Incluso si el vector del virus no se multiplica, existe un riesgo evidente de exponer a un número tan grande de individuos que podría producirse una recombinación con un adenovirus.

La reactivación de multiplicidad (MR) es un mecanismo de supervivencia descubierto para los adenovirus en 1971 por Yamamoto y Shimojo [5]. Es un proceso en el que los genomas de adenovirus dañados pueden interactuar con otros adenovirus presentes en la célula formando un nuevo genoma viral viable.

El mecanismo se describe como una variante temprana de un proceso reproductivo (sexual) que puede ocurrir en microorganismos [6]. Una proporción de la población, especialmente las personas con un sistema inmunitario comprometido, es portadora de adenovirus latentes.

En Suecia, aproximadamente el 20 % de los adultos y el 50 % de los niños de jardín de infancia son portadores. Este problema de seguridad de los sistemas de administración de vectores virales se discutió a menudo al comienzo del desarrollo de estas herramientas médicas.

Es la primera vez en la historia que tantas personas han estado expuestas a vacunas de vectores de adenovirus. Por lo tanto, aumenta el riesgo de recombinación con adenovirus.

El bloqueo, el cierre de la sociedad con el objetivo de detener la propagación del coronavirus, también ocurrió recientemente en el Reino Unido. Lamentablemente, la susceptibilidad a todo tipo de infecciones aumentará después debido a la menor inmunidad colectiva, especialmente en los niños pequeños.

Están relativamente poco expuestos a diferentes virus y necesitan desarrollar inmunidad contra diferentes patógenos. Por lo tanto, un nuevo adenovirus puede propagarse más rápidamente después de las medidas de aislamiento porque existe una deuda de inmunidad en la población.

La carga del virus puede volverse alta en individuos susceptibles causando infecciones más severas y daño al área gastrointestinal que podría conducir a una hepatitis viral.

Si las infecciones por adenovirus causan hepatitis aguda en los niños, los casos graves podrían ser solo la punta del iceberg y la mayoría de los infectados por el adenovirus tendrían síntomas menos graves. Es posible que el virus se haya propagado a otros países desde el Reino Unido, pero también es posible que se hayan producido recombinaciones de adenovirus de forma independiente en otras partes del mundo donde también se han utilizado vacunas de vectores de adenovirus.

El desarrollo de un nuevo adenovirus más patógeno podría deberse al uso de vacunas de vectores de adenovirus en grandes poblaciones, y es coherente con los datos disponibles. Para investigar este importante problema de seguridad de las vacunas con vectores virales, es necesario secuenciar los genomas de adenovirus completos de los casos y compararlos con el vector viral de la vacuna para verificar o descartar esta hipótesis.

1. https://www.gov.uk/government/news/increase-in-hepatitis-liver-inflammat…
2. Folegatti, Pedro M et al. «Seguridad e inmunogenicidad de la vacuna ChAdOx1 nCoV-19 contra el SARS-CoV-2: un informe preliminar de un ensayo controlado aleatorizado, simple ciego, de fase 1/2». Lancet (Londres, Inglaterra) vol. 396,10249 (2020): 467-478. doi:10.1016/S0140-6736(20)31604-4.
3. Morris, Susan J et al. «Adenovirus simios como vectores de vacunas». Futura virología vol. 11,9 (2016): 649-659. doi:10.2217/fvl-2016-0070
4. Zhu, Na et al. «Un nuevo coronavirus de pacientes con neumonía en China, 2019». La revista de medicina de Nueva Inglaterra vol. 382,8 (2020): 727-733. doi:10.1056/NEJMoa2001017
5. Yamamoto H, Shimojo H «Reactivación de multiplicidad de adenovirus humano tipo 12 y virus simio 40 irradiados por luz ultravioleta». Virología. 45,2 (1971): 529–31. doi:10.1016/0042-6822(71): 90355-2. PMID 4328814.
6. Michod, Richard E et al. “Valor adaptativo del sexo en patógenos microbianos”, Infección, Genética y Evolución, vol. 8,3 (2008): 267-285. ISSN 1567-1348, https://doi.org/10.1016/j.meegid.2008.01.002 . ( https://www.sciencedirect.com/science/article/pii/S156713480800004X )

Conflicto de intereses: Sin intereses en competencia

Ann-Cathrin Engwall

PhD, inmunología, virología

Upsala, Suecia’

La carta original al BMJ se puede ver aquí .

Fuente: https://expose-news.com/2022/07/16/hepatitis-children-astrazeneca-vaccine-lockdown-letter-bmj/

Experto advierte que 700 millones morirán por inyecciones de COVID para 2028 – Apagón de los medios

Por Sean Adl Tabatabai

Un destacado médico advirtió que las inyecciones de Covid se están utilizando como una forma de genocidio en toda la población y predijo que más de 700 millones de personas podrían morir para el año 2028.

En una entrevista reciente (publicada a continuación) con Greg Hunter, el Doctor David Martin presenta evidencia de que las inyecciones de COVID-19 no son vacunas reales sino armas biológicas.

En marzo de 2022, Martin presentó una demanda federal contra el presidente Biden, el Departamento de Salud y Servicios Humanos y los Centros de Servicios de Medicare y Medicaid alegando que las inyecciones de COVID-19 convierten el cuerpo en una fábrica de armas biológicas, fabricando proteína de punta. 2

Uncanceled.news informa: “Y no solo no seremos demandados por, ya sabes, ninguna difamación o información errónea, sino que en realidad estamos responsabilizando penalmente a las personas por su terrorismo doméstico, sus crímenes contra la humanidad y la historia del armamentismo del coronavirus que se remonta a 1998”, dice Martin. 3

SARS-CoV-2 ha estado en proceso durante décadas

Martin ha estado en el negocio del seguimiento de solicitudes y aprobaciones de patentes desde 1998. Su empresa, M-Cam International Innovation Risk Management, es el suscriptor de activos intangibles utilizados en finanzas más grande del mundo en 168 países. M-Cam también ha monitoreado las violaciones de los tratados de armas biológicas y químicas en nombre del gobierno de los EE. UU., luego del susto del ántrax en septiembre de 2001.4

Según Martin, hay más de 4.000 patentes relacionadas con el coronavirus del SARS. Su compañía también ha realizado una revisión exhaustiva de la financiación de la investigación relacionada con la manipulación de coronavirus que dio lugar al SARS como subclado de la familia de coronavirus beta.

Gran parte de la investigación fue financiada por los Institutos Nacionales de Alergias y Enfermedades Infecciosas (NIAID) bajo la dirección del Dr. Anthony Fauci. 5  Martín explicó: 6

“Creo que es importante que sus oyentes y espectadores recuerden que fue en 1999 cuando Anthony Fauci y Ralph Baric de la Universidad de Carolina del Norte en Chapel Hill decidieron comenzar a armar el coronavirus que patentaron en 2002, y escucharon esa fecha correctamente, eso es un año. antes del brote de SARS en China.

La primera vez que patentaron lo que llamaron una ‘quimera defectuosa de replicación infecciosa’ del coronavirus. Y vamos a desempacar lo que eso significa.

Infeccioso significa que en realidad es más letal para el objetivo. La replicación defectuosa significa que su daño es principalmente para el objetivo y no para la familia, los amigos, la comunidad o cualquier otra cosa del objetivo. Y en 2002, la Universidad de Carolina del Norte, Chapel Hill, patentó la quimera de coronavirus infeccioso defectuoso en la replicación, que luego se convirtió en la primera instancia de SARS.

Y se perfeccionó en 2013 a 2016 durante la moratoria de ganancia de función, donde la Universidad de Carolina del Norte Chapel Hill recibió una exención de la moratoria de ganancia de función para que pudieran continuar armando el virus hasta el punto en que en 2016, Ralph Baric publicó un artículo en el que decía que el virus uno del Instituto de Virología de Wuhan, el coronavirus, estaba «preparado para la emergencia humana», por lo que lo sabían todo el tiempo.

Ya sabes, sabían que era un arma biológica desde 2005. Sabían que era eficaz para eliminar poblaciones, dañar a las poblaciones, intimidar y coaccionar a las poblaciones. Y lo hicieron todo muy intencionalmente con el propósito de destruir a la humanidad”.

Las vacunas contra el COVID-19 son un ‘acto de bioterrorismo’

Según Martin, la proteína espiga que fabrican las inyecciones de COVID-19 es una simulación por computadora de una quimera de la proteína espiga del coronavirus. “De hecho, no es una vacuna contra el coronavirus. Es una instrucción de proteína de pico para hacer que el cuerpo humano produzca una toxina, y esa toxina ha sido programada como un agente biológico conocido de preocupación con respecto a las armas biológicas durante la última década y media”, dijo. 7

En lugar de ser una medida de salud pública como se promovió ampliamente, las inyecciones de COVID-19 son un acto de armas biológicas y bioterrorismo. Martin compartió que en 2015, el Dr. Peter Daszak, jefe de EcoHealth Alliance que canalizó dólares de investigación del NIAID al Instituto de Virología de Wuhan para la investigación del coronavirus, declaró: 8

“Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-coronavirus. Un impulsor clave son los medios y la economía seguirá el bombo publicitario. Necesitamos usar esa exageración a nuestro favor, para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso”.

Daszak, a quien Martin se refiere como “el lavador de dinero en jefe”, “en realidad declaró que todo este ejercicio fue una campaña de terror doméstico para lograr que el público aceptara la plataforma de vacuna universal utilizando un arma biológica conocida. Y esas son sus propias palabras, no mi interpretación”, dijo Martin. 9

Martin: 100 millones pueden morir debido a vacunas COVID

Tanto las vacunas contra el COVID-19 de Pfizer como las de Moderna contienen secuencias de ácido nucleico que no son parte de la naturaleza y no se han introducido previamente en el cuerpo humano. Esto equivale a un experimento de ingeniería genética que no pasó por estudios en animales ni ensayos clínicos.

Sin embargo, ya hay personas que mueren a causa de las inyecciones y, afirma Martin, “muchas más morirán” debido a problemas como coágulos de sangre, daño al sistema cardiovascular y problemas con la función hepática, renal y pulmonar. 10

También se prevé una avalancha de casos de cáncer reproductivo y relacionados con las inyecciones. “El hecho es que una enorme cantidad de personas que se inyectan ya llevan las semillas de su propia muerte”, dijo Martin. 11  En cuanto a cuántos pueden morir, Martin cree que los números pueden haber sido revelados en 2011, cuando la Organización Mundial de la Salud anunció su «década de vacunación»: 12

“Basado en su propia estimación de 2011, y… esta es una estimación escalofriante, pero tenemos que publicarla… Cuando la Fundación Bill y Melinda Gates, los CDC de China, Jeremy Farrar Wellcome Trust y otros publicaron La Década de la Vacunación para la Organización Mundial de la Salud en 2011, su objetivo declarado era una reducción de la población del 15% de la población mundial.

Ponga eso en perspectiva, eso es alrededor de 700 millones de personas muertas… y eso pondría a la participación de EE. UU. en eso ciertamente como una proporción de la población inyectada en algún lugar entre 75 y 100 millones de personas».

Cuando se le preguntó en qué período de tiempo podrían morir estas personas, Martin sugirió que «hay muchas razones económicas por las que la gente espera que sea entre ahora y 2028». 13  Esto se debe a “una pequeña falla en el horizonte”: la falta de liquidez proyectada de los programas de Seguro Social, Medicare y Medicaid para 2028.

“Entonces, cuantas menos personas reciban Seguro Social, Medicare y Medicaid, mejor”, dijo Martin. «No es sorprendente que probablemente sea una de las motivaciones que llevaron a la recomendación de que las personas mayores de 65 años fueran las primeras en inyectarse». 14  Otras poblaciones en riesgo son los cuidadores, incluidos los proveedores de atención médica, y otros miembros de la fuerza laboral que se vieron obligados a inyectarse, como los pilotos.

“¿Por qué de repente se cancelan (en USA) 700 vuelos al día porque, supuestamente, las aerolíneas no tienen pilotos? … el sucio secreto … hay muchos pilotos que tienen problemas microvasculares y problemas de coagulación, y eso los mantiene fuera de la cabina, que es un buen lugar para no tenerlos si van a arrojar un coágulo por un derrame cerebral o un ataque al corazón”,  dijo Martin.

“Pero el problema es que vamos a comenzar a ver exactamente el mismo fenómeno en la industria de la atención médica y a una escala mucho mayor, lo que significa que ahora tenemos, además del problema de la morbilidad y mortalidad reales, lo que significa que las personas se enferman. y gente muriendo.

De hecho, tenemos ese objetivo en la industria del cuidado de la salud en grande, lo que significa que vamos a tener médicos y enfermeras que estarán entre los enfermos y los muertos. Y eso significa que los enfermos y los moribundos tampoco reciben atención”. 15

Por qué las vacunas COVID pueden cambiar su ADN

Los medios de comunicación y los funcionarios de salud pública han enfatizado que las vacunas contra el COVID-19 no alteran el ADN. Sin embargo, Martin llama la atención sobre una subvención poco conocida de la Fundación Nacional de Ciencias, conocida como sistemas químicos darwinianos, 16  que involucró la investigación para incorporar ARNm en genomas específicos. Según Martín: 17

“Moderna se inició… gracias a una subvención de 10 años de la Fundación Nacional de Ciencias. Y esa subvención se llamó sistemas químicos darwinianos… el proyecto que dio origen a la propia empresa Moderna fue un proyecto en el que estaban averiguando específicamente cómo hacer que el ARNm se escribiera en el genoma de cualquier objetivo que persiguieran.

Se desconoce por completo cuáles serán los efectos a corto o largo plazo del análogo de proteína de pico que se encuentra dentro de las personas que recibieron inyecciones de COVID-19. Pero con respecto a la alteración del genoma, Martin afirma que los datos muestran que el ARNm tiene la capacidad de escribir en el ADN de los humanos, y “como tal, los efectos a largo plazo no van a ser meramente sintomáticos. Los efectos a largo plazo serán que el genoma humano de los individuos inyectados se verá alterado”. 18

El fraude elimina el escudo de responsabilidad de las grandes farmacéuticas

El ataque de ántrax de 2001, que surgió de la investigación médica y de defensa, condujo a la aprobación de la Ley PREP, que eliminó la responsabilidad de los fabricantes de contramedidas médicas de emergencia.

Esto significa que mientras EE. UU. esté en estado de emergencia, cosas como las «vacunas» contra el COVID-19 están permitidas bajo autorización de uso de emergencia. Y mientras la autorización de uso de emergencia esté vigente, los fabricantes de estas terapias génicas experimentales no son financieramente responsables de ningún daño que resulte de su uso.

Es decir, siempre que sean «vacunas». Si estas inyecciones NO son vacunas, entonces el escudo de responsabilidad desaparece, porque no existe un escudo de responsabilidad para una contramedida de emergencia médica que es la terapia génica. Además, las demandas que pueden probar que las empresas cometieron fraude también anularán el escudo de responsabilidad. Martín afirma: 19

“Una de las cosas convenientes de la Ley PREP es que el escudo de inmunidad de responsabilidad en realidad es tan bueno como la ausencia de fraude. Porque si hubo fraude en la promulgación de los eventos, lo que condujo a una autorización de uso de emergencia, entonces todo el escudo de inmunidad se eliminó.

Entonces, la razón por la que es tan importante que las conversaciones como la que estamos teniendo realmente se promuevan y avancen es porque las compañías farmacéuticas, y esto incluye a Pfizer, Moderna y J&J, saben que están perpetuando un fraude. Lo bueno de esto es que cuando se establece el fraude, el 100 % de la responsabilidad vuelve a ellos.

… cuando un fraude fue la base de un fraude, entonces en realidad tenemos una serie de otros remedios legales que le permiten levantar ese velo. Entonces, al final, no hay duda… y es bastante evidente en base a los datos actuales de mortalidad y morbilidad dado el hecho de que cuando se trata de armas biológicas y bioterrorismo, cada cargo conlleva una multa de $100 millones. Eso es lo que nos da el estatuto federal.

La sanción por terrorismo doméstico corporativo, cuando tienes $ 100 millones por cuenta de responsabilidades emergentes, esa es una amenaza existencial que lleva a una compañía como Pfizer o lleva a una compañía como Moderna fuera de existencia. Y eso es por lo que estamos trabajando todos los días”.

Si desea seguir el progreso de los casos legales en curso que buscan exponer la verdad, que una organización criminal busca obtener el control de la población mundial a través de la creación de armas biológicas patentadas comercializadas como nuevos virus e inyecciones, puede encontrar todo los detalles en ProsecuteNow.io, un sitio web compilado por Martin y sus colegas. 20


Fuente: https://newspunch.com/expert-warns-100-million-will-die-from-covid-jabs-by-2028-media-blackout/

Los principales medios de comunicación informan de una larga lista de causas de coágulos y ataques cardíacos, pero no incluyen las vacunas contra el COVID-19

Publicado por Yudi Sherman

Cambio climático, soledad, palear en la nieve. incluidos en factores de riesgo fatal

Los principales medios de comunicación informan una larga lista de causas de coágulos sanguíneos y ataques cardíacos, pero no incluyen las vacunas contra el COVID-19

Los medios corporativos agregaron hoy la cafeína a la lista de cosas que pueden causar coágulos de sangre. 

“Coágulos de sangre: la bebida favorita de la nación podría hacer que su sangre se vuelva pegajosa, lo que aumenta el riesgo”, informó el Daily Express el lunes. La razón explicada en el artículo es que la cafeína puede provocar deshidratación, lo que luego puede hacer que la sangre se vuelva «pegajosa», lo que puede provocar un coágulo de sangre. 

El titular aparece una semana después de que el medio de comunicación informara que las malas posiciones para dormir también pueden causar coágulos de sangre. 

“Coágulos de sangre: ¿Cómo duermes? Una posición puede aumentar el riesgo de trombosis venosa profunda”, informó el Daily Express la semana pasada.  

Si bien los hallazgos del estudio han demostrado que las vacunas contra el COVID-19 causan coágulos de sangre, no han aparecido en la lista de causas de coágulos de sangre de los medios. 

Los medios también mantienen una lista de varias causas de eventos cardíacos. Aunque un estudio revisado por pares muestra que los eventos cardíacos han aumentado un 25 % debido a las vacunas contra el COVID-19, la vacuna tampoco está en esta lista. 

“Su salario, código postal y padres afectan su riesgo de enfermedad cardíaca”, advirtió The Conversation Sunday, una publicación que respalda en gran medida la vacuna COVID-19. 

“Advertencia urgente para los jardineros ya que el suelo ‘aumenta el riesgo de enfermedades cardíacas mortales’”, informó The Sun la semana pasada. 

Saltarse el desayuno también es un factor de riesgo. 

“Por qué saltarse el desayuno puede aumentar el riesgo de sufrir un ataque al corazón”, advirtió The Mirror. 

“ La soledad puede aumentar el riesgo de enfermedad cardíaca en un 27 por ciento en mujeres mayores”, informó el Washington Post. 

“Infertilidad, insuficiencia cardíaca y enfermedad renal: ¿Cómo afecta el cambio climático al cuerpo humano?” escribió Euronews . 

“ La exposición a cualquier luz durante el sueño [está] relacionada con la obesidad [y otros] problemas de salud graves [un] estudio encuentra”, dijo CNN , explicando que quedarse dormido frente al televisor puede aumentar la frecuencia cardíaca. 

Pero, de nuevo, también puede hacerlo la actividad física. 

“ La actividad física puede aumentar el riesgo de ataque al corazón, sugiere un estudio”, afirmó The Irish Times. 

También puede hacerlo el sonido de un avión. 

“ El sonido de un avión volando por la noche podría ser lo último que escuche, ya que un estudio encuentra que el ruido puede desencadenar un ataque al corazón en dos horas”, informó el Daily Mail. 

“¿Eres demasiado viejo para palear en la nieve ? Si tiene más de 45 años, tenga cuidado con los ataques al corazón, dice el médico”, según USA Today. 

En mayo, The Lakewood Scoop informó un extraño aumento de ataques cardíacos y accidentes cerebrovasculares en hombres jóvenes; y aunque el sitio publicó un video con muchos profesionales médicos que instan a los hombres jóvenes a «hacerse la prueba», no especificaron para qué. 

“Debido a un aumento reciente en la ocurrencia de ataques cardíacos repentinos en hombres jóvenes de Lakewood de entre 30 y 40 años, e incluso entre 20 y 20 años, Lev Rochel Bikur Cholim realizará un examen de salud crítico para hombres el domingo…” 

Y así…

Fuente: https://americasfrontlinenews.com/post/mainstream-media-report-long-list-of-blood-clot-heart-attack-causes

Experto en genómica censurado por preocupaciones sobre la estabilidad de la vacuna

El artículo del científico genómico que trató de comparar las diferencias entre la vacuna y la proteína de pico del virus fue censurado después de una revisión por pares favorable.

Kevin McKernan  tiene una licenciatura en ciencias con formación en farmacología, toxicología e ingeniería biomédica. Anteriormente estuvo involucrado en el Proyecto del Genoma Humano y ha sido pionero en el trabajo en los campos de la secuenciación del genoma durante 30 años.  

Recientemente, se asoció con el renombrado disidente de COVID Peter McCullough y Anthony Kyriakopoulos para escribir un artículo titulado Diferencias en la vacuna y el ARNm derivado de la replicación del SARS-CoV-2: Implicaciones para la biología celular y la enfermedad futura . Buscaron la publicación en la editorial de acceso abierto, Hindawi.   

McKernan se refiere a esta «vacuna» como una tecnología familiar, ya que las modificaciones del ARNm que se incluyen en las vacunas son similares a las que usó en los secuenciadores de ADN.

“Las bases [de ADN] en las vacunas de ARNm no son las mismas que las bases que están en el virus. No solo son diferentes en la secuencia debido a la optimización de codones, sino que también son diferentes porque incluyen un nucleótido químicamente diferente conocido como N1-metilpseudoridina”, dice.

“Es una base que no tiene mucha fidelidad”, continúa McKernan, lo que significa que “es un poco descuidado con lo que se empareja”.

Esto significa que cuando la célula intenta leer el ARNm, existe la posibilidad de que cometa muchos errores, que es lo que los autores querían investigar en el artículo que, «lamentablemente, nos llevó en la dirección de que no hay muchos de datos por ahí”, dice McKernan mientras reitera la aterradora constatación de que falta información pública sobre “qué ARNm hay en estos viales y en qué se convierten realmente cuando le pides a las células humanas que los expresen”.

Mientras discutía las diferencias en la proteína de pico de la vacuna versus el virus, una distinción clave es cómo el virus ingresa al cuerpo, McKernan me dijo que “El virus ingresa a su conducto nasal y se replica [allí] tardando de 5 a 7 días en alcanzar su punto máximo antes de se aclara La inyección te proporciona ~40 billones de ARNm en una sola inyección que tiene un nucleótido modificado que hace que sea muy difícil que tu cuerpo lo elimine”, explica McKernan.

“En términos generales, desea que la cantidad de antígeno sea la más pequeña posible para impulsar la respuesta inmunitaria, particularmente si se demuestra que el antígeno en sí tiene algún tipo de patogenicidad, no desea presentarle al paciente demasiado de eso”, señalando que “ La proteína Spike no es tan inocua como nos hicieron creer”.

McKernan se remite a un artículo de Cheng et al que clasifica la proteína del pico del SARS-CoV-2 como un superantígeno. “Tiene una gran similitud con un arma biológica. Es una secuencia corta y hay mucha controversia con ese término, así que quiero ser muy claro aquí: tomar una subporción de la secuencia puede crear una tormenta de citoquinas». 

Ahora que la inmunidad de la población está aumentando, el documento destaca aún más la preocupación en torno a las poblaciones con ARNm y el virus simultáneamente. “¿Esas moléculas interactúan de alguna manera? no lo sabemos Tenemos que considerar la biología del ARNm y el virus: ¿pueden las dos moléculas interactuar y recombinarse y generar variantes? Es una incógnita que debe ser considerada”.

El documento ahora está en proceso de revisión por pares después de dos revisiones favorables. El consejo editorial se desvía hacia un reclamo de «revisión de integridad de la investigación». McKernan, como científico bien publicado , se refiere a esto como una barrera periodística, y nunca había visto este tipo de proceso retrasado durante meses. 

“Ahora estamos pasando a inyectar a los niños estas cosas y cada día que nos demoramos en sacar a la luz cualquier crítica o posible revisión de esto, solo crea más incertidumbre para las personas”.

Al compartir sus pensamientos finales, McKernan resume sus preocupaciones de manera articulada.

“Este [producto] de ARNm entrará en sus células y creará el fármaco y solo están teorizando sobre lo que va a crear. No han demostrado públicamente qué es el ARNm desde el punto de vista de la secuenciación donde vemos las lecturas sin procesar y vemos la tasa de error en la producción de vacunas… estos ARNm no se reproducen fielmente. Así que tenemos una prodroga, que está produciendo una [otra] droga y la droga no se conoce y no se ha caracterizado y se inyecta a miles de millones de personas con cero responsabilidad. Esto nunca ha sucedido antes en la medicina”.

Fuente: https://www.rebelnews.com/genomics_expert_censored_over_concerns_about_vaccine_stability

Jacinda Ardern admite que Nueva Zelanda altamente vacunada está perdiendo la batalla de COVID porque las vacunas no funcionan

Por Guy Hatchard y Narayani Hatchard

El destacado epidemiólogo de Nueva Zelanda, el profesor Michael Baker, en una entrevista con el NZ Herald, dice que estamos “perdiendo la carrera armamentista con el virus” . Los casos de covid han aumentado un 50% en los últimos 9 días en un “aumento abrupto”. Baker dijo: “Es una dinámica, una batalla entre nosotros y el virus y hay factores que favorecen principalmente al virus” . El artículo informó que los hospitales estaban abrumados.

Los datos de Nueva Zelanda muestran que los casos de covid y las hospitalizaciones están disminuyendo entre los no vacunados, pero aumentando entre los vacunados, pero increíblemente, Baker pidió que se implementen con urgencia nuevas vacunas de ARNm. En particular, Baker usó terminología generalmente asociada con tiempos de guerra. 

Inexplicablemente, el exceso de mortalidad por todas las causas no ha afectado la política de pandemia

Por el contrario, el profesor John Gibson, economista de la Universidad de Waikato, ha publicado un artículo que muestra que los refuerzos no solo son ineficaces, sino que el exceso de mortalidad que se registra actualmente en Nueva Zelanda apunta a un grave déficit de salud entre los vacunados. Se han medido aumentos similares en todo el mundo, que a menudo afectan a los jóvenes y en edad de trabajar. Entonces, ¿por qué este tipo de análisis no llama la atención?

Nueva Zelanda se encuentra entre las naciones más vacunadas del mundo. Dado que los datos y análisis científicos publicados parecen ofrecer algunas conclusiones de salud negativas muy claras sobre la vacunación con ARNm, ¿por qué todavía carecemos de una resolución racional y simplemente pedimos más vacunación? Es una preocupación muy personal para todos nosotros descifrar cómo sucedió esto.

Muchos de ustedes me escriben con su propio análisis y también envían enlaces a otros escritores e investigadores. Algunas personas se centran en el papel del Foro Económico Mundial y el gran reinicio, otras en el afán de lucro de las empresas farmacéuticas. Existe una amplia gama de perspectivas políticas, científicas, sociales, médicas y religiosas entre los comentaristas y corresponsales. Algunas personas perciben objetivos siniestros y alarmantes en el trabajo.

De todo esto, hay prioridades obvias:

  • ¿Qué nos ayudará a dar sentido a lo que está sucediendo? 
  • ¿Qué comprensión marcará la diferencia en el resultado final?
  • ¿Cómo puedo reabrir la mente racional de los demás?

La intervención biotecnológica tiene un historial de errores

Cualesquiera que sean las fuerzas que están en el trabajo impulsando los eventos actuales, hay una historia de errores y tendencias que deben tenerse en cuenta. La era de la biotecnología comenzó con el descubrimiento del ADN a principios de los años cincuenta, hace más de 70 años. Los enormes riesgos de la edición genética deberían haber sido evidentes desde el principio, pero la promesa de un nuevo tipo de supermedicina se revisó gradualmente y ahora ha superado a la precaución. 

¿Es esto suficiente para explicar lo que está pasando hoy? No. La irracionalidad predominante de nuestra situación actual no puede explicarse únicamente por la creencia o la inversión en biotecnología. Ciertamente, como hemos argumentado, la experimentación biotecnológica debe detenerse, esta es una parte vital de una posible solución. La gente también necesita entender cómo llegamos a donde estamos hoy. 

La crisis actual involucra a muchos actores con diferentes motivaciones y entendimientos, pero ¿qué los une a todos en la estructura cohesiva de la política de pandemia y la uniformidad médica global obligatoria? ¿Por qué ocurre esto ante la evidente ineficacia y los peligros irreversibles de la nueva medicina biotecnológica?

Guerra biotecnológica

La respuesta puede estar en la historia. Cuando estalla la guerra mundial, las naciones toman partido y, en muchos sentidos, comienzan a dejar atrás el sentido común. Forman lealtades que ignoran los límites tradicionales. El objetivo predominante es el dominio global. Por lo tanto, Japón no era el aliado natural de Hitler, pero la política de guerra dictaba un matrimonio de conveniencia en la búsqueda de un territorio de influencia ampliado.

Antes de la pandemia, durante muchos años se había estado ejerciendo presión para adoptar la biotecnología, primero en la agricultura y la alimentación, y luego en la medicina y, ciertamente, en el armamento. Para los aspirantes a ganadores, las ganancias potenciales parecían enormes. Los alimentos, las medicinas y los conflictos son los mercados globales que florecen llueva o truene. La presión financiera se estaba acumulando detrás de la represa biotecnológica.

El lanzamiento en 2019 de un nuevo patógeno biotecnológico, ya sea accidentalmente o no, fue la primera salva de un tipo completamente nuevo de guerra global. Como en todos los megaconflictos, el mundo entero empezó a tomar partido. El proceso de polarización, tan típico de los conflictos, comenzó a dominar los asuntos de todos los países. Se soltaron los perros de la guerra.

Las vacunas biotecnológicas eran las supuestas armas defensivas y todo el proceso económico se dedicó a la producción y promoción de vacunas. No había que escatimar en gastos. En algunos países, como en Nueva Zelanda, los partidos políticos cerraron filas detrás del esfuerzo bélico. Los anuncios proclamaban su deber patriótico de respaldar la vacunación y aún lo hacen. Todos fueron llamados a trabajar. Si eras objetor de conciencia, te rechazaban. Los derechos humanos fueron suspendidos.

La guerra tiene sus propias formas de justificación racional, pero sus efectos son siempre terribles. Hombres y mujeres jóvenes son sacrificados al conflicto sin escrúpulos. Esto iba a ser igualmente cierto para la guerra biotecnológica. Pero no hay causas nobles involucradas. Estamos siendo sacrificados en aras de oscuros intereses creados en laboratorios universitarios y divisiones de investigación farmacéutica que buscan lanzarse a la estratosfera del poder global. 

Estos traficantes de poder casi han tenido éxito en exigir el cumplimiento. Los vacunados eran héroes, alabados, condecorados y premiados por el gobierno. Los heridos por la vacuna tuvieron mala suerte, pero de alguna manera, como las bajas en la guerra, se quedaron cortos y fueron ignorados. 

En esta guerra, en lugar de proteger a los jóvenes alejándolos de los lugares de conflicto. Han sido trasladados al centro del escenario. A pesar de que tienen poco o ningún riesgo de infección por Covid, han estado expuestos a un riesgo significativo y medible de daño cardíaco a través de la vacunación con ARNm. Esto se ha hecho para satisfacer una idea teórica, pero ahora comprobada, completamente falsa de que la inmunidad inducida por la vacuna «protegería» a sus padres y a la sociedad en general de una posible infección.

Como en el Reich de Hitler, la ciencia se ha vuelto subordinada al estado. Se castigan las voces científicas disidentes que instan a la cautela. En lugar de detenerse a reflexionar, los esfuerzos de investigación biotecnológica se han concentrado en el desarrollo de armas aún más riesgosas, tanto vacunas como enfermedades. Los políticos compiten entre sí para parecer los más comprometidos y los más generosos con la financiación.  

Dentro de la psicología social de la guerra, hay muchas tendencias. Hay especuladores que hacen fortunas a costa de todos. Hay sádicos a los que por fin se les da rienda suelta. Hay rumores absurdos que circulan libremente. Hay propaganda del gobierno reproducida fielmente por los medios de comunicación que oscurecen aún más la verdad en la niebla de la guerra. Todos ellos han estado presentes en buena medida durante la pandemia.

La guerra biotecnológica es un desastre global en desarrollo 

Esta no es una guerra convencional, es un desastre terrible que abarca a todos con miedo y mala salud. La respuesta global a la pandemia ha sido completamente errónea. Frente a un arma biológica indiscriminada, cuyo efecto final se desconocía, las llamadas naciones poderosas del mundo desplegaron una biotecnología más móvil e invasiva. Abrieron aún más la tapa de la caja de Pandora.

Las guerras a menudo terminan con victorias vacías sobre el enemigo, rendición, tregua o agotamiento. La guerra biotecnológica no tiene una nación enemiga tradicional a la que derrotar. El enemigo es una nueva forma de vida hecha por el hombre: no humana, antinatural, tóxica, pero bastante capaz de sobrevivir e incluso multiplicarse. 

Esta guerra ha comenzado, pero ¿ya hemos hundido nuestro buque insignia? El conflicto entre la inmunidad humana y los patógenos es un conflicto ancestral que los humanos siempre han ganado, pero ahora, por locura, hemos obstaculizado nuestro sistema inmunológico flexible a través de una vacuna prescriptiva de ARNm diseñada en un laboratorio, nunca suficientemente probada y forzada a todos a través de la coerción. y la eliminación de nuestros derechos a la educación y al trabajo. Se desconoce el resultado final, pero ya los últimos datos de Nueva Zelanda indican que se avecina una deficiencia inmunitaria. 

Todas las partes en el espectáculo secundario de la pandemia económica han clavado sus colores en el mismo asta de bandera. Las armas biotecnológicas son igualdad de oportunidades, están acabando con los soldados de a pie de ambos bandos como en la guerra de trincheras, pero en este caso también están acabando con los arquitectos, los generales y los no combatientes.

Los gobiernos inevitablemente tendrán que reconsiderar o enfrentar pérdidas abrumadoras

Nosotros, los manifestantes, hemos ido con la gorra en la mano al gobierno, pidiendo que nos devuelvan nuestros derechos, pidiendo que nos dejen tomar nuestras propias decisiones médicas. Nos hemos ido con las manos vacías. A medida que aumentan las bajas, los gobiernos tendrán que volver a la mesa con la gorra en la mano. 

La naturaleza es el último recurso de estabilidad. A medida que las variedades híbridas de papa fallan y se vuelven propensas a las enfermedades, los mejoradores tienen que volver a las reservas de semillas de variedades naturales en América del Sur para restaurar la viabilidad. El gran recurso de la salud se encuentra en los no vacunados, cuyo sistema inmunológico sigue funcionando con su asombrosa inteligencia innata, aprendiendo a vencer a un enemigo viral que ni siquiera se ve a simple vista.

Los tratados de paz de la primera guerra pandémica deberán implicar el cese del conflicto y la experimentación biotecnológica. Tendrán que implicar un nuevo examen de todo el concepto de salud. Tendrán que implicar una reevaluación de las normas científicas y la ética médica. Tendrán que reconocer que nuestro sistema educativo se olvidó de recordar las lecciones de la historia y la santidad de la vida. Tendrán que exponer los peligros de los alimentos producidos artificialmente y expandir nuestro concepto de nutrición para incluir la relación evolutiva simbiótica entre los alimentos naturales y la salud humana.

Necesitamos entender y reconocer que la psicología colectiva o la conciencia de la guerra es dañina. Hay muchas fuentes de comprensión e investigación en este campo. 

Ciertamente necesitamos rediseñar nuestros modelos políticos y constituciones para evitar la precipitación hacia la guerra. Necesitamos una Declaración de Derechos que evite que los partidos políticos, los científicos deshonestos y los intereses comerciales nos utilicen como carne de cañón mientras prueban sus arriesgadas ideas experimentales. 

Las salvaguardas son tan importantes con la biotecnología como lo fueron después del descubrimiento de la energía atómica. Posiblemente más. Una vez liberadas, las armas biotecnológicas no pueden retirarse. Se esparcen lejos de su sitio u origen alrededor del mundo por sus propios medios. 

Las salvaguardias deben promoverse sin hacer referencia a opiniones políticas ferozmente sostenidas y divisiones políticas. Sí, la primera guerra pandémica está alimentada por ambiciones políticas, financieras y autoritarias, pero solo llegará a su fin cuando las personas responsables de todos los bandos hagan causa común con sentido común. Llamado a una pausa en la experimentación biotecnológica. Sin esto, no habrá paz ni seguridad.

Fuente: https://expose-news.com/2022/07/08/ardern-admits-covid-vaccines-dont-work/

Los efectos devastadores de la vacuna COVID-19 confirmados: nos mintieron: Fin del juego, ganamos. Steve Kirsch

Por Steve Kirsch

Una de mis encuestas tenía una señal fuerte. Así que hice que una firma de encuestas de terceros lo hiciera frente a una audiencia neutral. Los resultados son devastadores. Muestra que nos mintieron. Gran momento. No hay otra forma de girarlo.

Ahora tengo una pregunta de encuesta que, cuando se prueba con una audiencia neutral, da una señal muy fuerte. Resulta que la mayoría de la gente piensa que las vacunas contra el COVID han matado a más personas en solo un año y medio que las más de 70 vacunas combinadas en los últimos 32 años. Cuanto menos vacunado esté, más probabilidades tendrá de notar esto. Si ha tenido cuatro dosis, estaba casi empatado.

Aquí está la tabla dinámica de los resultados de Pollfish para que pueda ver los votos frente al estado de la vacuna:

Aquí están los datos subyacentes para que pueda verificar el resultado. Y aquí está el resumen en PDF que proporcionaron.

Lo que esto significa es que hemos ganado. No hay manera de defender esto.

A menos que me haya perdido algo, están totalmente jodidos. Simplemente no hay forma de «girar esto» a su favor. Esta encuesta es simple de replicar y destruye por completo la narrativa «segura y efectiva» porque no hay forma de «girar» los resultados a su favor. es devastador

El CDC argumentaría: “Le está pidiendo al público que emita un juicio no profesional sobre la causalidad. En el CDC no hemos determinado ningún vínculo causal. ¡Todas estas muertes son simplemente coincidencias!”

¡Los verificadores de hechos estarán de acuerdo con ellos!

Está bien.

Simplemente explique por qué hay más de 1,7 veces más «coincidencias» con las vacunas contra el COVID que con las más de 70 vacunas en los últimos 32 años . Alegrame el dia. Respalde con datos reales que demuestren su punto, no con un argumento de mano.

O muéstrame tu encuesta. Y explique por qué, en los 18 meses que la vacuna ha estado en el mercado, nunca buscó encontrar la tasa de incidencia de eventos adversos y muertes en una encuesta proactiva en lugar de quedarse sentado con un sistema de vigilancia pasiva. ¿Y explícanos por qué nunca revelaste a nadie los datos de mortalidad de Medicare? ¿Cuál fue la razón para mantener eso en secreto? Explícanos eso.

Lamentablemente, la prensa simplemente aceptará cualquier argumento de los CDC, sin importar cuán idiota sea. Así lo defenderán. Nunca harán las preguntas en mi párrafo anterior.

Así que aún no ha terminado, pero nos estamos acercando.

Confirmación de la encuesta en el sistema VAERS

Esto no es una casualidad.

El sistema VAERS esencialmente está emitiendo la misma señal de seguridad con una proporción que es bastante cercana a lo que encontró nuestra encuesta.

Resulta que el 69% de todas las muertes en VAERS (limitándonos solo a las muertes en EE. UU.) son por las vacunas COVID.

Entonces, esto significa que las vacunas COVID han matado a 2,3 veces más personas que las más de 70 vacunas en los últimos 32 años.

¿Cómo explicas eso? No puede ser un informe excesivo de las muertes de fondo porque el perfil de eventos adversos de las muertes por COVID no coincide con las «causas naturales». Así que estos estúpidos argumentos de agitar las manos no funcionan.

Aquí están las consultas que utilicé y los resultados.

Muertes solo por las vacunas COVID, limitadas a los estados de EE. UU. Hay más de 2,3 veces más muertes por las vacunas COVID que por todas las demás vacunas juntas desde el inicio del sistema VAERS hace 32 años. Esa es una tasa de muertes impresionante.

Muertes por TODAS las vacunas mayores de 32 años solo en los estados de EE. UU.

Otras encuestas preocupantes para la narrativa dominante

La encuesta anterior es solo el comienzo.

La validación de audiencia neutral de las siguientes encuestas también llegará en breve.


Las vacunas están dañando a más personas que el COVID. Los protocolos de tratamiento hospitalario son el #2. ¿Por qué no podemos dejar que los médicos sean médicos?

La vacuna COVID es la mayor fuente de lesiones, seguida de los protocolos hospitalarios COVID, seguida por el propio virus en último lugar. Las «curas» dictadas por el gobierno tienen muchas más probabilidades de lesionarlo que el virus mismo.


El gran asesino: la vacuna. Los protocolos de tratamiento hospitalario son el #2. ¿Por qué no podemos dejar que los médicos sean médicos?

La vacuna COVID es la principal causa de muerte, seguida de los protocolos hospitalarios COVID, seguida por el virus en sí mismo en último lugar. Las «curas» dictadas por el gobierno tienen muchas más probabilidades de matarlo que el virus mismo.

Tasas de miocarditis

Los médicos dicen que la miocarditis por COVID es mayor que por la vacuna. Aunque cosa divertida…. No pude encontrar ningún cardiólogo que haya visto más tasas de miocarditis antes de que se implementaran las vacunas. Parece que no estoy solo.

La presentación “El elefante en la habitación” tiene más ejemplos

¿Quieres más pruebas de que te han engañado? Echa un vistazo a mi conjunto de diapositivas Elefante en la habitación y descubrirás muy rápidamente por qué nadie quiere hablar sobre el elefante en la habitación: que los CDC, la comunidad médica, el Congreso, los funcionarios de salud estatales y locales, los principales medios de comunicación y las principales redes sociales las compañías son responsables de matar a más de 500,000 estadounidenses al incitarlos a tomar una vacuna que era mucho más probable que los matara que los salvara.

Ninguna de las intervenciones fue necesaria. Tuvimos un protocolo de tratamiento temprano efectivo en marzo de 2020 , pero los NIH y los CDC lo ignoraron y aún lo hacen hasta el día de hoy. No hay muertes ni COVID de largo recorrido si a las personas se les da ese protocolo. Más de 10.000 personas fueron tratadas sin muerte ni hospitalización si el paciente inicia el tratamiento inmediatamente después de los primeros síntomas. La razón por la que se ignora es simple: Tony Fauci dice que tales protocolos no funcionan, aunque sí lo hacen. No es que miraron el protocolo y lo rechazaron. Es como si nunca hubieran mirado el protocolo.

También entenderás por qué nadie quiere debatirme.


Esta encuesta es demoledora porque se confirma con una audiencia neutral. La encuesta y varias más ahora serán repetidas por una firma encuestadora de fama internacional.

Así que ya sabes quién va a ganar la partida: la verdad.

Y ahora es sólo cuestión de tiempo. Será divertido ver a la gente tratar de atacarme mientras tanto.

Mi consejo para ellos es simple: si te encuentras en un hoyo, deja de cavar.

Siguiente paso: espera a que el nuevo encuestador famoso publique esta encuesta y varias otras. Son muy respetados.

Fuente: https://www.globalresearch.ca/impacts-covid-19-vaccine-game-over-we-won-steve-kirsch/5782830

El confinamiento de Shanghái. Visto desde otro ángulo

Por Peter Koenig

Mientras que casi todo el mundo critica a China y la acusa de abusos contra los derechos humanos por encerrar a los 26 millones de ciudadanos de Shanghai, cuando solo se detectaron unos 26.000 casos positivos de «Covid-19». A primera vista, eso parece anormal, o incluso una gran exageración. A primera vista.

Pero veamos de nuevo.

¿Recuerdas el brote de SARS (Severe Acute Respiratory Syndrome) de 2002 a 2004?

Infectó a unas 8.000 personas y causó 774 muertes. Con mucho, la mayoría de los casos y de las muertes se encontraron en China continental y Hong Kong, algunos en Taiwán e incluso unos pocos en Japón, Estados Unidos y, aparentemente, en más de 20 países de todo el mundo.

Lo que es notable es que todos los «casos» eran personas con el genoma chino. En otras palabras, el virus atacó específicamente a la «raza china», es decir, fue hecho a medida para atacar a China y sus ciudadanos.

«Casualmente», unos años antes, en 1999 y 2000, el gobierno chino detectó a cientos de «científicos» occidentales, generalmente de Harvard y otros institutos y laboratorios de aprendizaje de renombre occidental, recolectando muestras de ADN de personas en las zonas rurales de China, principalmente en las provincias del noroeste de China.

Estos «científicos» contrataron a ciudadanos chinos para que les ayudaran a recolectar muestras de sangre en regiones aisladas a cambio de un pago. Los occidentales fueron, por supuesto, expulsados, una vez detectados. Sin embargo, demasiado tarde. Ya habían sacado de contrabando de China miles de muestras de ADN tomadas de chinos nativos. Vea esto.

Estas muestras servirían más tarde para diseñar un coronavirus especial dirigido al genoma chino. El brote de SARS resultante de 2002-2004 en China fue una prueba, para mal por venir.

¿Recuerdas también el Evento 201 que tuvo lugar en Nueva York el 18 de octubre de 2019? patrocinado por la Fundación Bill y Melinda Gates, el Foro Económico Mundial (WEF) y el Centro Johns Hopkins para la Seguridad de la Salud, que también fue el anfitrión del evento.

Durante este evento, todos los actores mundiales importantes, como el Banco Mundial, el FMI, la ONU y muchos de los organismos especializados de las Naciones Unidas, incluidos UNICEF y, por supuesto, la OMS, así como las principales instituciones bancarias y financieras, los principales institutos de salud de los Estados Unidos, como los CDC, la FDA e incluso los CDC de China, e incluso muchos más, participaron en esta simulación de escritorio, que iba a producir en todo el mundo más de 60 millones de muertes en el lapso de aproximadamente dos a tres años. Vea esto.

Como las autoridades chinas eran muy conscientes del virus genéticamente dirigido, estaban alertas cuando el SARS-Cov-2 golpeó Wuhan a principios de 2020. Su reacción fue lógica, inmediata y severa. Cerraron no solo Wuhan (pop. 11 millones) a la vez, sino una gran parte, unos 50 millones de personas, de la provincia de Hubei, de la cual Wuhan es la capital. Posteriormente, más áreas dentro de China, donde se detectó el SARS-Cov-2, fueron bloqueadas. Significó el comienzo de la tolerancia cero para lo que más tarde fue convenientemente renombrado por la OMS como Covid-19. También recuerde que el Covid-19, alias SARS-Cov-2, nunca fue aislado ni identificado como un nuevo virus.

Conociendo los antecedentes de los virus diseñados genéticamente o por raza, la reacción de China para proteger a sus ciudadanos fue lógica e inmediata. De hecho, con esta política, China dominó la enfermedad en gran medida en unos seis a ocho meses. Durante esos duros confinamientos, alrededor del 80% del complejo industrial chino quedó paralizado. Pero a finales de 2020, la mayoría de los aparatos de producción, fábricas, líneas navieras y producción agrícola chinos estaban zumbando de nuevo, y de nuevo en la corriente.

Esta es una de las principales razones por las que el crecimiento económico chino apenas sufrió durante este nuevo brote de covid. De hecho, frente a la proyección del FMI de un crecimiento del 1,2% en 2021, y la propia proyección china de una expansión económica del 3,5% en 2021, el crecimiento real chino en 2021 se registró como del 5,5%. Este crecimiento y el potencial de exportación resultante han ayudado a muchos países, especialmente en el continente asiático, a reducir sus pérdidas inducidas por covid y a hacer avanzar sus economías.

Desde la revolución comunista del presidente Mao Zedong en 1949, China fue una espina persistente en los ojos capitalistas occidentales. A medida que China se ha convertido gradualmente en una superpotencia, tanto económica como estratégicamente hablando, los ataques y las sanciones occidentales contra China también han crecido. No importa cuán ilegal sea, contra el derecho internacional y contra los derechos humanos -liderados por Estados Unidos, Occidente está imponiendo implacablemente sanciones económicas a China- y, por supuesto, también al aliado más cercano de China, Rusia.

A pesar de estas sanciones, China pronto, dentro de los próximos 3 a 4 años, si no antes, superará a la economía estadounidense. De hecho, cuando se mide de acuerdo con los únicos indicadores económicos reales, a saber, el factor PPA (Paridad de Poder Adquisitivo, es decir, el valor de los bienes que una moneda puede comprar), China ha superado a los Estados Unidos hace ya varios años.

China es una cadena de suministro de piezas vitales de producción provisional y / o de producción de uso final, Occidente necesita hacer que sus bienes de consumo funcionen y los consumidores felices. Rusia, por otro lado, suministra la mayoría de las materias primas disponibles en su vasto territorio para producir estos bienes que Occidente codicia.

Tanto China como Rusia son económica y estratégicamente cruciales para Occidente. También son aliados cercanos. Representan una amenaza para la supremacía occidental. Occidente no tolera esto, ya que la dominación está en los genes de Occidente. Basta con mirar hacia atrás a mil años de colonias occidentales en el Sur Global.

En lugar de buscar acuerdos de cooperación con estos socios vitales, Occidente busca dominarlos y aniquilarlos, con sanciones y con guerra física. La principal institución de guerra de Occidente, la OTAN, no pierde el ritmo para amenazar e intentar intimidar a Rusia y China, invadiendo las fronteras de estos dos aliados, así como jugando su poderío militar en maniobras armadas cercanas a sus fronteras. No es de extrañar que China se haya unido recientemente a Rusia para oponerse a una mayor expansión de la OTAN, a medida que los dos países se acercan frente a la presión occidental.


Ahora viene la guerra de Ucrania con Rusia, de la cual la expansión de la OTAN es solo una de las razones. A estas alturas, la mayor parte del mundo sabe, incluso la corriente principal ya no lo oculta, que el entonces secretario de Estado de los Estados Unidos, James Baker III, y los aliados europeos de Washington prometieron en la capitulación de la Unión Soviética en 1991, el entonces presidente soviético / ruso Mikhail Gorbachev, no mover a la OTAN una pulgada más al este de Berlín.

Esta fue una promesa hecha a cambio de permitir que Alemania se reuniera con Alemania Oriental e integrara Berlín Oriental en Berlín Occidental, rehaciendo la ciudad combinada de Berlín nuevamente la capital de Alemania.

Como todos sabemos, esta promesa se ha roto miserablemente. En 1991 la OTAN contaba con 16 países miembros, de los cuales 2 en las Américas (Estados Unidos y Canadá) y 14 en Europa. Hoy, unos 30 años después, la OTAN cuenta con 30 miembros. Los 14 nuevos están en Europa, muchos de los cuales se acercan cada vez más a las fronteras de Rusia. Ucrania fue el siguiente candidato de la OTAN. Esto, Rusia no podía tolerarlo.

Imagínese, Rusia o China construyeran bases militares en México o América Central, cómo reaccionaría Estados Unidos. Tenemos un ejemplo lívido de la crisis de Bahía de Cochinos de 1961, cuando el entonces presidente estadounidense JFK y el presidente ruso Nikita Khrushchev evitaron una guerra nuclear potencialmente destructiva, a través de negociaciones en una reunión en Viena.

Las preocupaciones del presidente Putin hoy son más que comprensibles, y explican parcialmente su intervención en Ucrania. Esto no justifica una guerra de ninguna manera, sino que explica parcialmente la reacción de Rusia.

Conectando los puntos con el confinamiento de Shanghai

Sin embargo, posiblemente una razón aún más importante que la amenaza de la OTAN para la intervención del presidente Putin en Ucrania son los biolaboratorios de tipo bélico de 20 a 30 (grado 3) financiados por Estados Unidos en Ucrania. Fueron construidos durante los últimos 20 años, la mayoría de ellos después del golpe de Maidan instigado por Occidente en febrero de 2014 que condujo al estado actual de las cosas con Ucrania, y entre Ucrania y Rusia.

Por razones de seguridad nacional, Rusia tiene que controlar y posiblemente destruir estos laboratorios mortales. Para ello, era necesaria una intervención. El momento de las agresiones occidentales para desencadenar la intervención rusa, especialmente los asesinatos de civiles de los batallones nazis Azov en la región separatista de Donbas, no es una coincidencia. En 8 años transcurridos desde el golpe de Maidan, se registraron 14.000 muertes de civiles, de las cuales aproximadamente un tercio son niños. Se ajusta a la narrativa del Reinicio Global del WEF que apunta a la dominación global de la población mundial total, todos los 193 países miembros de la ONU, a través de muchos medios.

Todo esto es parte de la infame Agenda 2030 de la ONU. El comienzo fue la falsa guerra del miedo al Covid, bajando el sistema inmunológico de las personas y la voluntad de resistir; por lo tanto, llevándolos como una oveja oída a las llamadas cámaras vaxx, donde se les inyectó lo que la narrativa de la mentira llama vacunas anti-covid-19, cuando en realidad son jabs de prueba de ARNm (modificadores del ADN).

Diferentes viales de vacunas producidos en Occidente contienen diferentes composiciones bioquímicas, incluido el óxido de grafeno para facilitar eventualmente las manipulaciones cerebrales electromagnéticas, coincidiendo con el sueño de Klaus Schwab y su 4ª Revolución Industrial donde, en última instancia, el resto del mundo sobreviviente estaría completamente digitalizado.

Según Mike Yeadon, ex vicepresidente y jefe de ciencia de Pfizer, estas vacunas falsas reducen aún más el sistema inmunológico de los humanos. El primer pinchazo en aproximadamente un 30%, el segundo en otro 30% y el tercer jab, el llamado booster (refuerzo), en otro 20%. Eso deja intacto alrededor del 20% del sistema autoinmune de hombres y mujeres. En otras palabras, dentro de uno a tres años de ser vacunadas, las personas podrían morir de una variedad de enfermedades, incluidos cánceres agresivos y diferentes tipos de dolencias cardíacas que serían difíciles de rastrear hasta los vacunas. Como ejemplos vemos esto, las vacunas Covid para esterilizar a las mujeres y este Covid vacunas para incluir ingredientes del VIH.

¿Y si el 4º y 5º y así sucesivamente son los «impulsores»: todos programados?, ¿se soltarán e impondrán a la humanidad en los próximos 7 u 8 años hasta la finalización de la Agenda 2030 de la ONU?

Además, la constante narrativa vaxx adoctrinada por los medios de comunicación occidentales deja a muchas personas, hoy todavía como mayoría, en un estado de disonancia cognitiva; es decir, no pueden admitir que les hayan mentido a sí mismos su gobierno, que supuestamente eligieron y pagaron con sus impuestos para protegerlos. Tal traición es demasiado para creer y admitirse a sí mismos. La cábala oscura detrás de este plan y detrás de la tiránica Agenda 2030 de la ONU lo sabe. Eso hace que sea aún más difícil despertar a la gente y llevarla a una oposición solidaria.

Volver a los laboratorios de virus de Ucrania

Estos biolaboratorios de tipo bélico de grado 3 son capaces de producir virus específicos del genoma que pueden dirigirse para atacar diferentes genomas rusos y personas de ADN chino, así como otros, si se programan en consecuencia. Numerosas pruebas de este tipo de virus hechos a medida se han llevado a cabo durante las últimas dos o tres décadas. No menos importante el brote de ébola en África occidental (2014-2016), que afecta principalmente a Guinea, Sierra Leona y Liberia, el epicentro del brote. Durante la duración de esta epidemia de ébola, hubo 28.616 casos sospechosos, probables y confirmados de estos tres países y 11.310 muertes, lo que llevó a una horrenda tasa de muertes por caso de alrededor del 40%. Compare esto con la llamada tasa de mortalidad por Covid-19 de alrededor de 0.07 a 0.1%; una incidencia similar a la de la gripe.

¿Quién sabe si un ébola dirigido al genoma o cualquier otro virus mortal está o estaba siendo producido en laboratorio en uno de los biolaboratorios financiados por Estados Unidos, que las fuerzas rusas «intervinieron» para destruir por el bien de la humanidad?

Por supuesto, no hay garantía de que ninguno de esos gérmenes mortales y diezmadores de la población de la guerra biológica haya «escapado» o haya sido liberado antes de la intervención rusa, en línea con el Gran Reinicio y Bill Gates predijo un nuevo y mucho más peligroso brote epidémico.

Una advertencia similar sobre un posible brote de Marburgo (hemorragia interna similar al ébola) fue hecha a principios de este año por el primer ministro francés, Jean Castex, cuando advirtió que las elecciones francesas a principios de abril de 2022 podrían tener que posponerse … no sucedió, hasta ahora. Pero quién sabe, si tal brote puede ocurrir y cuándo.

¿Y quiénes serían los principales objetivos de tales virus? – ¿China y Rusia?

Si bien no hay evidencia concreta de un ataque biológico, ¿tal vez la «tolerancia cero al covid» de China, y el cierre total de Shanghai, ahora se entiende mejor?

Nosotros, el pueblo, en solidaridad unos con otros, dentro y con todas las naciones, debemos hacer todo lo posible para derribar esta «agenda oscura» y traer la Luz, incluso si requiere sacrificio temporal. – Al final, ten cuidado, la Luz vence a la oscuridad.


Peter Koenig es analista geopolítico y ex economista principal del Banco Mundial y la Organización Mundial de la Salud (OMS), donde ha trabajado durante más de 30 años en agua y medio ambiente en todo el mundo. Da conferencias en universidades de estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea y es autor de Implosion – An Economic Thriller about War, Environmental Destruction and Corporate Greed; y coautor del libro de Cynthia McKinney «When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis» (Clarity Press – 1 de noviembre de 2020)

Peter es investigador asociado del Centro de Investigación sobre la Globalización (CRG).

También es miembro senior no residente del Instituto Chongyang de la Universidad Renmin, Beijing.

Fuente: https://www.globalresearch.ca/shanghai-lockdown-seen-from-another-angle/5778124?utm_campaign=magnet&utm_source=article_page&utm_medium=related_articles

Las crisis ambientales invisibles que destruyen a la humanidad

Por Ryan Matters

En la parte 1 de esta serie, analizamos un reciente documento de política de Rockefeller que pide un cambio transformador en la producción de alimentos y cómo eso se relaciona con la nueva agenda alimentaria.

En la parte 2, examinamos la historia turbia de la agroindustria moderna y algunas de las élites e instituciones ricas que promueven cultivos genéticamente modificados y tecnologías peligrosas de impulsores genéticos.

En la parte 3, examinaremos las crisis ambientales reales que afectan a la humanidad todos los días, pero ignoradas por muchos de los llamados activistas y «filántropos». Empezando por…


Durante décadas, estimados científicos y pensadores nos han advertido sobre el impacto de la mala nutrición en la salud. Entre ellos se encuentran Sir Robert McCarrison, el Dr. Lawrence Plaskett, Weston Price y el dos veces ganador del Premio Nobel, el Dr. Linus Pauling.

A lo largo de los años, sus advertencias han sido ignoradas, subvertidas o desacreditadas. Basta con echar un vistazo a los principales medios de comunicación para encontrar afirmaciones como «los suplementos vitamínicos no son más que orina cara».

A esto se suma el hecho de que los médicos (incluso aquellos que se especializan en el intestino) reciben poca o ninguna educación en nutrición. Como se indica en la introducción a A Physician’s Handbook on Orthomolecular Medicine[1]:

Existe un amplio espectro de opiniones inexpertas desinformadas sobre la importancia práctica de una nutrición de calidad en nuestra vida diaria».

Eso fue escrito en 1977 y, lamentablemente, parece que sigue siendo cierto hasta el día de hoy.

En 2002, investigadores de la Escuela de Medicina de Harvard publicaron un artículo titulado Vitaminas para la prevención de enfermedades crónicas.

Aunque sus hallazgos pueden haber sido obvios para los profesionales ortomoleculares décadas antes, sus conclusiones no fueron menos importantes, reconociendo el hecho de que la mayoría de las personas no consumen una cantidad óptima de todas las vitaminas solo con la dieta, y (aunque con cautela) abogando por el uso de suplementos vitamínicos para todos los adultos.

Aún más importante, los investigadores reconocieron los efectos generalizados en la salud de la ingesta subóptima de vitaminas (incluso por encima de los requisitos estándar):

… La ingesta insuficiente de vitaminas es aparentemente una causa de enfermedades crónicas. La evidencia reciente ha demostrado que los niveles subóptimos de vitaminas, incluso muy por encima de los que causan síndromes de deficiencia, son factores de riesgo para enfermedades crónicas como las enfermedades cardiovasculares, el cáncer y la osteoporosis. Una gran proporción de la población general aparentemente está en mayor riesgo por esta razón».

A pesar de hallazgos importantes como estos, rara vez se toman medidas para garantizar que las personas obtengan cantidades adecuadas de nutrientes. Por ejemplo, parece que cientos de miles de muertes podrían haberse evitado solo en el Reino Unido, si el gobierno hubiera actuado sobre la evidencia convincente de los beneficios del ácido fólico.

El ácido fólico reduce los niveles de homocisteína, un aminoácido que está relacionado con ataques cardíacos y accidentes cerebrovasculares. Los niveles subóptimos de ácido fólico también pueden causar defectos del tubo neural y contribuir a la displasia cervical, el cáncer, la osteoporosis y la depresión mental.

La cantidad diaria recomendada de la mayoría de los nutrientes es posiblemente demasiado baja, sin tener en cuenta los beneficios de una ingesta óptima. Además, tener un requisito para cada persona no tiene en cuenta la singularidad de cada individuo.

La vitamina D ha estado en los medios de comunicación recientemente debido a investigaciones que indican que es eficaz en el tratamiento de «Covid-19». Sin embargo, la importancia de la vitamina D, no solo para prevenir enfermedades respiratorias, sino para tratar una variedad de enfermedades crónicas, se conoce desde hace al menos 20 años. A pesar de esto, la deficiencia de vitamina D sigue siendo generalizada.

Según los investigadores Vásquez, Cannell y Manso:

La deficiencia / insuficiencia de vitamina D es una epidemia en el mundo desarrollado que hasta ahora ha recibido una atención insuficiente de los médicos a pesar de la documentación de su prevalencia, consecuencias y el imperativo de la suplementación diaria a niveles superiores a las recomendaciones inadecuadas actuales de 200-600 UI «.

La razón de esto es doble; En primer lugar, los médicos están trabajando desde una comprensión obsoleta, viendo la vitamina D como nada más que un nutriente óseo (la investigación indica que este claramente no es el caso).

Y en segundo lugar, las pruebas de laboratorio que miden los niveles de vitamina D se establecen demasiado bajas, subestimando el requisito fisiológico de niveles más altos de vitamina D.

La gravedad de la deficiencia de vitamina D (una deficiencia que puede corregirse fácilmente a través de la suplementación o la educación sobre la importancia de la exposición al sol), ha llevado a algunos investigadores a cuestionar la ética de no tratar un problema tan generalizado.

Dada la profundidad y amplitud de la investigación revisada por pares que documenta la frecuencia y las consecuencias de la hipovitaminosis D, la falta de diagnóstico y tratamiento de este trastorno es éticamente cuestionable (particularmente en mujeres embarazadas) y es inconsistente con la prestación de atención médica de calidad basada en la ciencia».

Al igual que con la vitamina D, a pesar de la voluminosa investigación que muestra sus enormes beneficios, la deficiencia de magnesio todavía está muy extendida. Aunque rara vez se nos educa sobre la importancia de este mineral, el magnesio es esencial para la mayoría de los procesos corporales y los niveles subóptimos pueden resultar en una amplia gama de síntomas desagradables (y a veces fatales).

La importancia del magnesio se explica en un artículo titulado Magnesio en la prevención y la terapia,

El magnesio es el cuarto mineral más abundante en el cuerpo. Ha sido reconocido como un cofactor para más de 300 reacciones enzimáticas, donde es crucial para el metabolismo del trifosfato de adenosina (ATP). El magnesio es necesario para la síntesis de ADN y ARN, la reproducción y la síntesis de proteínas».

Los niveles bajos de magnesio se han asociado con una serie de enfermedades crónicas, como la enfermedad de Alzheimer, la resistencia a la insulina y la diabetes mellitus tipo 2, la hipertensión, las enfermedades cardiovasculares (por ejemplo, accidente cerebrovascular), las migrañas y el trastorno por déficit de atención con hiperactividad (TDAH).

En su esclarecedor libro El milagro del magnesio[2], la Dra. Carolyn Dean dedica más de 600 páginas a la importancia de este mineral raramente mencionado. También destaca el vínculo importante, aunque a menudo pasado por alto, entre la deficiencia de magnesio y la enfermedad mental.

Las personas no tienen ansiedad, ataques de pánico o depresión porque tienen una deficiencia de Valium o Prozac. Nuestros cuerpos no requieren estas sustancias para los procesos metabólicos esenciales. Sin embargo, podemos desarrollar una miríada de síntomas psicológicos debido a una deficiencia de magnesio, un nutriente que nuestros cuerpos requieren».

Según el Dr. Dean, las granjas comerciales no logran reponer el suelo agotado, y el magnesio que queda no puede ser absorbido por las plantas debido a los fertilizantes de potasio altos o los residuos de pesticidas. La investigación ha demostrado que el glifosato, por ejemplo, se une con el magnesio, evitando la absorción.

Como resultado, las raíces de muchas deficiencias de nutrientes se remontan al suelo en el que se cultiva gran parte de nuestros alimentos.

La revista Life Extension comparó las tablas de alimentos del USDA desde 1963 hasta la actualidad y encontró una caída sorprendente en el contenido de nutrientes. Algunas vitaminas han disminuido hasta en un 40%.

Por ejemplo, la cantidad de vitamina A en las manzanas ha disminuido de 90 mg a solo 53 mg. La cantidad de potasio y magnesio en la col rizada ha disminuido de 400 mg a 170 mg y de 57 mg a 9 mg respectivamente.

Una tendencia similar se observa en prácticamente todas las demás verduras y frutas, lo que indica que las frutas y verduras están perdiendo su contenido de nutrientes a un ritmo rápido. Más preocupante es el hecho de que el USDA (Departamento de Agricultura de los Estados Unidos) se niega a actuar. Cuando Organic Gardening Magazine se puso en contacto con el Servicio de Investigación Agrícola del USDA preguntando si les preocupaba que los estadounidenses no estuvieran recibiendo los nutrientes adecuados, respondieron con indiferencia.

El USDA aparentemente no está preocupado y no está interesado en el drenaje de vitaminas, a pesar de su mandato de garantizar alimentos seguros de alta calidad. En su carta a Organic Gardening, johnson dijo que el contenido nutricional de los productos no es tan importante como cosas como la apariencia y el gran rendimiento.

Para que uno no piense que el agotamiento de nutrientes es una crisis reservada para los estadounidenses, se ha encontrado que lo mismo es cierto en el Reino Unido.

El experto en minerales y miembro de la Sociedad Geológica, David Thomas, analizó la 6ª edición de The Composition of Foods de McCance y Widdowson y encontró una severa caída en el contenido de nutrientes en la mayoría de los alimentos en el Reino Unido en los últimos 60 años. Según Thomas,

McCance & Widdowson proporcionan los registros históricos más detallados y sofisticados de los valores nutricionales de los alimentos disponibles para cualquier nación en todo el mundo».

Esto hace que los hallazgos de su estudio sean aún más alarmantes. El estudio de Thomas tampoco se limita a las frutas y verduras. Su análisis ha revelado una caída drástica en el contenido de nutrientes (especialmente minerales esenciales) en casi todos los grupos de alimentos (esto incluye la carne y los productos lácteos).

En los últimos 60 años ha habido cambios fundamentales en la calidad y cantidad de alimentos disponibles para nosotros como nación. El carácter, el método de cultivo, la preparación, la fuente y la presentación final de los alimentos básicos han cambiado significativamente en la medida en que los oligoelementos y el contenido de micronutrientes se han agotado gravemente».

La principal crítica a la investigación de Thomas es que los métodos analíticos eran menos precisos en el pasado y, por lo tanto, no es válido comparar el contenido de nutrientes. Sin embargo, esto parece ser una afirmación falsa, ya que los propios McCance y Widdowson sostienen que, aunque los métodos analíticos utilizados en el pasado ahora se consideran «primitivos», no eran menos precisos que los métodos de análisis más modernos[3].

La segunda crítica es que las variedades de cultivos han cambiado a lo largo de los años, lo que hace que cualquier comparación similar no tenga sentido. Sin embargo, este argumento también falla, ya que, incluso si las variedades de cultivos han cambiado, esto no cambia el hecho de que el valor nutritivo de la dieta de la persona promedio ha disminuido sustancialmente.

Thomas resume la gravedad de esta crisis de nutrientes en la conclusión de su artículo de 2007:

Qué dilema nos hemos encontrado. La investigación de todo el mundo ha demostrado la realidad de la pérdida de micronutrientes de nuestros alimentos y proporciona evidencia de que las deficiencias de micronutrientes socavan significativamente nuestra salud, contribuyendo a enfermedades fisiológicas y psicológicas crónicas en personas de todas las edades».


La industria manufacturera es responsable de emitir cantidades masivas de productos químicos tóxicos al medio ambiente y los efectos de muchos de estos son completamente desconocidos.

La Oficina de Seguridad Química y Protección contra la Contaminación (OCSPP) de la EPA es la organización responsable de proteger a las personas de los riesgos de la exposición a pesticidas y productos químicos tóxicos. El OCSPP realiza pruebas para evaluar los niveles de tolerancia de varios productos químicos y decide sobre los niveles máximos de residuos de plaguicidas permitidos en los alimentos.

Sin embargo, como John Kepner de BeyondPesticides.com argumenta acertadamente,

Las exposiciones a pesticidas en el mundo real no son incidentes aislados. Más bien, son una serie de incidentes marcados por combinaciones de exposiciones».

Continúa diciendo que,

Los científicos han argumentado durante años que las exposiciones tóxicas a los pesticidas deben medirse como ocurrirían normalmente, en combinación entre sí. Sin embargo, la ley federal actual no requiere este tipo de pruebas de pesticidas en el mercado, excepto en casos muy limitados».

Sorprendentemente, según la American Chemical Society (ACS),

Nadie, ni siquiera la Agencia de Protección del Medio Ambiente, sabe cuántos productos químicos se utilizan hoy en día».

Si la EPA ni siquiera sabe cuántos productos químicos están en uso hoy en día, ¿cómo pueden evaluar sus efectos en la salud de las personas? La respuesta es que no pueden. Y las razones de esto se derivan de los sistemas regulatorios existentes de la EPA, que se establecen para servir a los intereses corporativos sobre la salud de la población.

Esto es esbozado extensamente por Dawn Lester y David Parker en su libro What Really Make You Ill[4]:

Los sistemas regulatorios existentes… favorecer cada vez más a la industria sobre el consumidor; permiten la rápida liberación de productos en el mercado, pero implican muchas dificultades para la eliminación de productos después del descubrimiento de cualquier efecto adverso».

Como si los sistemas regulatorios fallidos no fueran lo suficientemente malos, los denunciantes dentro de la EPA han revelado recientemente la enorme presión ejercida sobre los científicos dentro de la agencia para minimizar o eliminar la evidencia que apunta a posibles efectos adversos de varios productos químicos. Algunos de estos efectos adversos incluyen trastornos neurológicos, defectos de nacimiento y cáncer.

Según The Intercept:

En varias ocasiones, la información sobre los peligros se eliminó de las evaluaciones de la agencia sin informar o solicitar el consentimiento de los científicos que los escribieron. Algunos de estos casos llevaron a la EPA a retener información crítica del público sobre exposiciones químicas potencialmente peligrosas».

Algunos de estos productos químicos pueden alterar el sistema endocrino. El sistema endocrino es lo que regula todos los procesos biológicos del cuerpo. Esto incluye el desarrollo del cerebro y el sistema nervioso, el funcionamiento del sistema reproductivo, los niveles de azúcar en la sangre y mucho más.

El sistema endocrino se basa en mantener un fino equilibrio de diferentes hormonas, algunas de las cuales solo están presentes en pequeñas cantidades. «La dosis hace el veneno» sigue siendo el dogma aceptado con respecto a la seguridad o toxicidad de la mayoría de los productos químicos.

Sin embargo, décadas de investigación sobre los efectos de los productos químicos disruptores endocrinos (EDC) han demostrado que esta teoría es incorrecta. De hecho, los EDC pueden tener efectos a dosis bajas que no se predicen a dosis más altas.

Aún más alarmante es el hecho de que, durante muchos años, no han existido pruebas para evaluar los productos químicos en busca de posibles efectos de alteración endocrina. Como resultado, ninguno de los muchos miles de productos químicos en uso hoy en día ha sido examinado para tales efectos. Según un artículo de 2003 del Dr. Theo Colborn,

La lista está creciendo de disruptores endocrinos conocidos que tienen una amplia gama de mecanismos de acción que pueden interferir con el desarrollo del cerebro».

Durante casi tres décadas, la Dra. Theo Colborn se dedicó a estudiar los efectos nocivos de los productos químicos disruptores endocrinos en la vida biológica y el medio ambiente.

En 2003, el Dr. Colborn fundó The Endocrine Disruption Exchange (TEDX), una organización sin fines de lucro que, durante 16 años, buscó «reducir la producción y el uso de productos químicos que interfieren con la función hormonal saludable».

Su investigación fue impulsada, en parte, por la explosión relativamente reciente de muchas enfermedades relacionadas con el sistema endocrino, incluidos los trastornos autoinmunes, el autismo, el asma, la diabetes, la enfermedad de la tiroides, el TDAH y algunas formas de cáncer. Actualizada por última vez en septiembre de 2018, la lista TEDX de disruptores endocrinos conocidos incluye unos 1.482 productos químicos.

Aunque aparentemente es un pequeño porcentaje de todos los productos químicos en uso, esta lista solo incluye aquellos productos químicos que han mostrado signos de alteración endocrina en la investigación científica.

Como se indicó anteriormente, la gran mayoría de los productos químicos no han sido probados para tales propiedades. Por lo tanto, podemos estar razonablemente seguros de que el número real de sustancias químicas disruptoras endocrinas en nuestro entorno es mucho mayor.

Gran parte de los hallazgos del Dr. Colborn se repiten en la investigación de Joseph Thornton, un investigador del Instituto de la Tierra de la Universidad de Columbia que se especializa en los efectos devastadores de la contaminación por organoclorados.

Los organoclorados son moléculas orgánicas que contienen al menos un átomo de cloro unido covalentemente. Un ejemplo de un organoclorado bien conocido es el DDT, un pesticida altamente tóxico utilizado ampliamente durante las décadas de 1940 y 1950.

En su libro, Pandora’s Poison[5], Thornton escribe que:

La producción de cloro gas a partir de la sal prepara el escenario para la producción intencional y accidental de una gran cantidad de nuevos productos químicos que interrumpen los sistemas naturales en su nivel más fundamental. La práctica de la química del cloro ha desatado una serie de consecuencias químicas y ecológicas no deseadas que nuestras tecnologías más sofisticadas no son capaces de prevenir».

Muchos organoclorados resisten la degradación natural y pueden acumularse en el medio ambiente. Algunos, como la dioxina, no se descomponen en absoluto y permanecerán en el medio ambiente casi indefinidamente.

Esto es increíblemente preocupante teniendo en cuenta que los organoclorados se liberan en el medio ambiente en inmensas cantidades (¡la industria del cloro produce alrededor de 40 millones de toneladas de gas cloro cada año!).

Como explica Thornton, muchos organoclorados son más solubles en grasa que en agua. Esto lleva a que se acumulen en los tejidos grasos de los organismos vivos, especialmente aquellos cerca de la parte superior de la cadena alimentaria (es decir, los humanos). Según Thornton,

Las especies altas en la cadena alimentaria, como los humanos, sirven como reservorios vivos donde estos contaminantes se acumulan en concentraciones cada vez más altas».

Debido a su larga vida útil, los organoclorados viajan sobre las corrientes de viento, formando un manto global de contaminación atmosférica con graves consecuencias para la salud y el bienestar humanos.

El libro de Thornton describe cómo la producción de productos químicos tóxicos se ha convertido en uno de los «problemas ambientales más insidiosos de nuestro tiempo», contribuyendo a la infertilidad, la supresión inmune, el cáncer y los trastornos del desarrollo.

Como se mencionó anteriormente, los disruptores endocrinos pueden afectar el desarrollo fetal del sistema reproductivo, lo que a veces puede conducir al hermafroditismo. De hecho, la investigación ha encontrado que un número creciente de niños nacen con «variación intersexual» (es decir, genitales ambiguos).

En su libro, Revolve: Man’s Scientific Rise to Godhood[6], Aaron Franz plantea la inquietante posibilidad de que la contaminación ambiental generalizada con EDC pueda ser un acto deliberado, uno dirigido a promover el objetivo transhumanista de crear un hombre andrógino.

Tanto la fuerza masculina como la femenina han sido blanco de destrucción. No solo se han confundido nuestros roles de género, sino que también hemos sido bombardeados químicamente. Se nos ha librado una guerra química para destruir nuestro género biológico».

Como explica Franz en su libro, los transhumanistas se toman muy en serio la necesidad de trascender el género, un concepto al que los investigadores se refieren como «posgénero». Los transhumanistas ven el género como algo que nos limita y buscan ir más allá utilizando medios tecnológicos.

Otro contaminante ambiental que puede afectar el sistema endocrino es la radiación electromagnética.


En respuesta al despliegue planificado de la cobertura 5G en la UE y los Estados Unidos en 2018, Martin Pall (profesor emérito de Bioquímica y Ciencias Médicas Básicas en la Universidad Estatal de Washington), compiló un informe detallado, que describe ocho efectos fisiopatológicos probables que se observarían como resultado de una mayor exposición a la radiación electromagnética.

Estos efectos incluyen efectos neurológicos, alteración endocrina, estrés oxidativo, mutaciones en el ADN, reducción de la fertilidad y cáncer. El profesor Pall resumió sus pensamientos sobre el despliegue de 5G llamándolo «la idea más estúpida que alguien haya tenido en la historia del mundo».

La preocupación por el 5G se debió en parte al hecho de que la nueva tecnología no se sometió a una sola prueba de seguridad. Las preocupaciones en torno al aumento de la exposición a la radiación electromagnética están bien fundadas, teniendo en cuenta la amplia evidencia que tenemos para sugerir que dicha exposición causa daño biológico.

De hecho, el profesor Pall estima que hay más de 14.000 estudios científicos revisados por pares que muestran efectos adversos de los CEM a niveles por debajo de las directrices de seguridad[7].

Los estudios ya han demostrado que la radiación del teléfono móvil por sí sola puede reducir el recuento de espermatozoides y la motilidad en los hombres. Un metaanálisis de 2017 encontró una disminución alarmante en el recuento de espermatozoides entre los hombres en naciones tecnológicamente avanzadas.

Los investigadores escriben que «se necesita urgentemente investigación sobre las causas de esta disminución continua». Sin embargo, si la causa emana de una tecnología promovida por una de las industrias más ricas y poderosas del mundo, es poco probable que se realicen más investigaciones.

Los estudios han demostrado que los CEM pueden causar estrés oxidativo. Se plantea la hipótesis de que esto a su vez puede conducir a la aparición de una variedad de trastornos neuropsiquiátricos, algunos de los cuales han visto una prevalencia creciente en nuestra sociedad moderna. Esto incluye insomnio, fatiga, dolores de cabeza, depresión, ansiedad, irritabilidad o, lo que es peor, autismo.

Otro efecto conocido de la exposición a los CEM es un mayor riesgo de cáncer. Un estudio de 25 millones de dólares realizado por el Programa Toxicológico Nacional (NTP) encontró un aumento en la incidencia de cáncer cerebral y cardíaco en animales expuestos a CEM por debajo de las pautas de «seguridad» de ICNIRP.

Eventualmente, incluso la Agencia Internacional para la Investigación del Cáncer (una rama de la Organización Mundial de la Salud) se vio obligada a clasificar los campos electromagnéticos de radiofrecuencia como «posiblemente cancerígenos para los humanos».

La investigación sugiere que los CEM también están contribuyendo a la disminución de las poblaciones de insectos y aves en todo el mundo. En su esclarecedor libro, The Invisible Rainbow[8], Arthur Firstenberg documenta el rápido declive de muchas especies de insectos y aves, incluido el humilde gorrión doméstico.

Un estudio realizado por el zoólogo Sainudeen Pattazhy en Kerala, India, durante 2008 y 2009 encontró que los gorriones domésticos estaban prácticamente extintos allí. La conclusión de Pattazhy es la misma que la de Balmori: las torres celulares están dejando a los gorriones sin lugar para vivir».

Luego cita a Pattazhy de la siguiente manera:

La penetración continua de la radiación electromagnética a través del cuerpo de las aves afecta su sistema nervioso y sus habilidades de navegación. Se vuelven incapaces de navegar y alimentarse. Se encuentra que las aves que anidan cerca de las torres abandonan el nido en una semana».

Las poblaciones de abejas también están disminuyendo en ciertas áreas del mundo. Si bien la razón de esto puede ser multifacética, la investigación sugiere que una de las causas puede ser la radiación electromagnética.

Un artículo de 2019 publicado en Science of The Total Environment encontró que la exposición crónica al campo electromagnético de radiofrecuencia (RF-EMF) redujo significativamente la eclosión de las reinas de las abejas melíferas. Otros estudios han encontrado cambios de comportamiento perturbadores en las abejas expuestas a los CEM.

A pesar de toda esta evidencia que apunta a un daño biológico, poco se ha hecho para reducir la exposición de las personas a la radiación dañina de RF. Esta crisis ambiental cada vez más grave podría haberse evitado si las autoridades hubieran puesto en marcha medidas de seguridad adecuadas.

Sin embargo, al igual que con big pharma y big agribusiness, Big Wireless es una industria multimillonaria que pone las ganancias y el control por encima de lo que es ética y moralmente correcto.

En un artículo de 2018, Paul Héroux PhD, profesor de toxicología electromagnética en la Universidad McGill, explica la corrupción que acecha dentro de los organismos reguladores que establecen y supervisan las pautas de seguridad para la radiación de RF.

… Conscientes del enorme potencial de este mercado [es decir, la industria inalámbrica], los ingenieros lograron que estas radiaciones se caracterizaran como inofensivas, a través de 50 años de esfuerzos sostenidos, infiltrándose y monopolizando los comités de estandarización».

Las llamadas «directrices de seguridad» son establecidas por la Comisión Internacional de Protección contra la Radiación No Ionizante (ICNIRP), una organización que afirma que su objetivo es «proteger a las personas y al medio ambiente contra los efectos adversos de la radiación no ionizante (NIR)».

Sin embargo, en un informe titulado The International Commission on Non-Ionizing Radiation Protection: Conflicts of interest, corporate capture and the push for 5G por Klaus Buchner y Michèle Rivasi, llegan a una conclusión bastante diferente con respecto a la naturaleza de la ICNIRP.

IcNIRP se presenta, y es descrito por la Comisión Europea y en los medios de comunicación, como una comisión internacional independiente que da consejos basados en evidencia científica. Creemos que hay varias razones para cuestionar esta (auto)imagen».

Un hallazgo importante de Buchner y Rivasi es que la mayoría de los científicos de la ICNIRP han completado o están realizando investigaciones financiadas (al menos en parte) por la industria.

También encontraron que las nuevas pautas de seguridad de RF publicadas por la ICNIRP en 2020 fueron el resultado de la cooperación con el IEEE (Instituto de Ingenieros Eléctricos y Electrónicos) y el ICES (Comité Internacional de Seguridad Electromagnética), dos organizaciones que trabajan en estrecha colaboración con grandes compañías de telecomunicaciones.

En 2014, la OMS lanzó un borrador de una monografía sobre los campos de RF y la salud para comentarios públicos. Sin embargo, 5 de los 6 miembros del Grupo Básico a cargo del proyecto estaban afiliados a la ICNIRP, un conflicto de intereses flagrante.

Un artículo de 2017 describe una reunión posterior en la OMS donde los funcionarios mostraron poco interés en colaborar con científicos que fueron invitados a presentar evidencia sobre los efectos adversos para la salud de los CEM.

El artículo concluye de la siguiente manera:

En vista de los enormes intereses económicos incorporados en las directrices de la ICNIRP, y los vínculos de varios de sus miembros expertos con la industria, sin duda se trata de un gran conflicto de intereses que socavará seriamente no sólo la credibilidad de la Monografía sobre la radiación de RF, sino también la credibilidad de la OMS como protectora de la salud mundial».

La creciente densidad de la radiación electromagnética en el suelo se compara con el inminente bombardeo desde el espacio. En su boletín de enero de 2022, Arthur Firstenberg contabiliza el número de satélites de órbita baja operativos, aprobados y propuestos, llegando a la sorprendente cifra de 441.449 satélites.

En este total se incluyen más de 40.000 satélites SpaceX (casi 12.000 de los cuales ya han sido aprobados), planeados para formar parte de la red «Starlink» de Elon Musk, proporcionando acceso 5G en todo el mundo. Firstenberg escribe que,

Mientras que la atención de un mundo aterrorizado se ha centrado en un virus, y mientras que la preocupación por la radiación se ha centrado en 5G en el suelo, el asalto a los cielos ha alcanzado proporciones astronómicas».

Han surgido informes que afirman que la FCC, al otorgar permiso a Musk para lanzar tantos satélites, violó la Ley de Política Ambiental Nacional (NEPA), al no evaluar el impacto ambiental del despliegue de tantos satélites en órbita terrestre baja.

Según Firstenberg, el impacto ambiental será catastrófico. Es bien sabido que las emisiones de los lanzamientos de cohetes dañan la capa de ozono, pero lo que más preocupa a Firstenberg es el efecto sobre la ionosfera.

A lo que todo el mundo está completamente ciego es al efecto de toda la radiación de los satélites en la ionosfera y, en consecuencia, en la fuerza vital de cada ser vivo. El circuito que es generado por la ionosfera y que fluye perpetuamente entre el cielo Yang (positivo) y la tierra Yin (negativa). El circuito que nos conecta con la tierra y el cielo y que fluye a través de nuestros meridianos dándonos vida y salud. Un circuito que no debe contaminarse con frecuencias emitidas por cien mil satélites, algunos de cuyos haces tendrán una potencia efectiva de hasta diez millones de vatios. Eso es pura locura, y hasta ahora nadie está prestando atención».


Si bien se pone mucho énfasis en la necesidad de reducir las emisiones de gases de efecto invernadero, y miles de millones de dólares se canalizan a fondos climáticos turbios, parece que ninguno de los «élites» globales tiene interés en combatir las crisis mencionadas anteriormente.

Debemos preguntarnos: ¿qué se está haciendo para reponer el contenido de nutrientes de nuestros alimentos? ¿Qué medidas están tomando las agencias de protección ambiental para prohibir los productos químicos tóxicos y eliminar los organoclorados de la atmósfera? ¿Qué se está haciendo para reducir nuestra exposición a la radiación electromagnética dañina y establecer métodos de comunicación más seguros?

No se equivoquen, las verdaderas crisis ambientales no se mencionan en la Cumbre del G20, no se informa de ellas en los principales medios de comunicación y no nos las resolverán los gobiernos, los banqueros, los filántropos o los tecnócratas.

Puedes leer la primera parte aquí y la segunda parte aquí.


Ryan Matters es un escritor y libre pensador de Sudáfrica. Después de un período de enfermedad que cambió su vida, comenzó a cuestionar la medicina convencional, la ciencia y el verdadero significado de lo que es estar vivo. Algunos de sus escritos se pueden encontrar en newbraveworld.org, también puedes seguirlo en Twitter y Gab.


[1] Roger J. Williams y Dwight K. Kalita. Manual del médico sobre medicina ortomolecular. 1977.[volver]

[2] Carolyn Dean, M.D, N.D. El milagro del magnesio. 2003.[volver]

[3] Food Standards Agency (2002) McCance y Widdowson’s The Composition of Foods, Sexta edición resumida. Cambridge: Real Sociedad de Química. (véase el prólogo de la 5ª edición). [volver]

[4] Dawn Lester, David Parker. Lo que realmente te enferma: por qué todo lo que pensabas que te daba noticias sobre la enfermedad está mal. 2019.[volver]

[5] Joseph Thornton. El veneno de Pandora: cloro, salud y una nueva estrategia ambiental. 2001.[volver]

[6] Aaron Franz. Revolve: El ascenso científico del hombre a la divinidad. 2012.[volver]

[7] Entrevista con Martin L. Pall, PhD, «How Wireless Causes Harm». Cumbre 5G. 2019.[volver]

[8] Arthur Firstenberg. El arco iris invisible, una historia de electricidad y vida. 2017.[volver]

Fuente: https://off-guardian.org/2022/02/16/the-unseen-environmental-crises-destroying-humanity/

El Dr. Luc Montagnier y las próximas revoluciones en biofísica óptica


Por Matthew Ehret-Kump

El 8 de febrero de 2022, el virólogo ganador del Premio Nobel, el Dr. Luc Montagnier, falleció.

Desde los primeros momentos de la aparición de COVID-19, Montagnier fue calumniado y ridiculizado por sus desafíos a las suposiciones subyacentes de las causas y remedios de la enfermedad a pesar de las constantes hondas y flechas del estado profundo que buscaba cerrar la puerta a toda discusión tan peligrosa.

Más importante que las afirmaciones de Montagnier sobre los orígenes de laboratorio de una enfermedad (que parece tener más que ver con causas bacteriológicas que virales), se encuentran en un dominio pasado por alto de la biofísica óptica que el buen científico revolucionó por completo durante los últimos 15 años de su fructífera vida.

Es este aspecto menos comprendido, pero infinitamente más importante, de la contribución de Montagnier al conocimiento humano el que ha caído bajo el radar de demasiados analistas y ciudadanos, por el que creo que querría ser recordado.

¿Qué es la biofísica óptica y qué descubrió Montagnier?

La biofísica óptica es el estudio de las propiedades electromagnéticas de la física de la vida. Esto significa prestar atención a las emisiones de luz y las frecuencias de absorción de las células, el ADN y las moléculas de materia orgánica, cómo estas interactúan con el agua (que constituyen más del 75% de un cuerpo humano) y moderadas por la matriz anidada de campos magnéticos ubicados en el nivel cuántico y que se extienden hasta el nivel galáctico.

Para no descartar la naturaleza bioquímica de la vida que es hegemónica en el ámbito de las ciencias de la salud, el biofísico óptico pregunta: ¿cuál de estos es PRIMARIO en el crecimiento, la replicación y la división del trabajo de células individuales o especies enteras de organismos? ¿Son los atributos químicos de la materia viva o las propiedades electromagnéticas?

Permítanme explicar un poco más la paradoja.

Hay aproximadamente 40 billones de células altamente diferenciadas en el cuerpo humano promedio, cada una de las cuales realiza funciones muy específicas y requiere un inmenso campo de coherencia e intercomunicación. Cada segundo mueren aproximadamente 10 millones de esas células, para ser reemplazadas por 10 millones de nuevas células que nacen. Muchas de esas células están formadas por bacterias, y gran parte del ADN y el ARN dentro de esas células está formado por virus (en su mayoría inactivos), pero que pueden activarse / desactivarse mediante una variedad de métodos tanto químicos como electromagnéticos.

Aquí está la gran pregunta:

¿CÓMO podría este complejo sistema ser mantenido solo por procesos químicos, ya sea en el transcurso de un día, mes o toda una vida útil?

La simple física del movimiento de las enzimas que transportan información en el cuerpo de un lugar a otro simplemente no se acerca a tener en cuenta la coordinación de la información requerida entre todas las partes. Aquí es donde entra en juego la investigación de Montagnier.

Después de ganar el Premio Nobel de 2008, el Dr. Montagnier publicó un artículo revolucionario pero herético de 2010 llamado «Ondas de ADN y agua» que tomó por asalto a la comunidad médica. En este artículo, Montagnier demostró cómo la radiación electromagnética de baja frecuencia dentro de la parte de ondas de radio del espectro se emitía desde el ADN bacteriano y viral y cómo dicha luz era capaz de organizar el agua y transmitir información. Los resultados de sus experimentos se mostraron maravillosamente en este video de 8 minutos:

Usando un dispositivo de fotoamplificación inventado por el Dr. Jacques Benveniste en la década de 1980 para capturar las emisiones de luz ultra bajas de las células, Montagnier filtró todas las partículas de ADN bacteriano de un tubo de agua y descubrió que las soluciones post-filtradas que no contenían partículas materiales continuaban emitiendo ondas de frecuencia ultra baja. Esto se volvió más fascinante cuando Montagnier demostró que bajo condiciones específicas de un campo de fondo de 7 Hz (lo mismo que la resonancia de Schumann que ocurre naturalmente entre la superficie de la tierra y la ionosfera), el tubo de agua no emisor que nunca había recibido material orgánico podría ser inducido a emitir frecuencias cuando se coloca muy cerca del tubo emisor. Aún más interesante es que cuando las proteínas base, los nucleótidos y los polímeros (bloques de construcción del ADN) se pusieron en el agua pura, ¡se formaron clones casi perfectos del ADN original!

El Dr. Montagnier y su equipo plantearon la hipótesis de que la única forma de que esto sucediera era si el modelo del ADN se imprimía de alguna manera en la estructura misma del agua, lo que resultaba en una forma de «memoria del agua» que había sido iniciada anteriormente por el inmunólogo Jacques Benveniste (1935-2004), cuyos resultados se muestran en este increíble documental de 2014 «Memoria del agua».

Así como Benveniste sufrió una de las cacerías de brujas más feas de los tiempos modernos (dirigida en gran medida por la revista Nature en 1988), el premio Nobel de Montagnier no lo protegió de un destino similar al que una campaña internacional de calumnias lo ha seguido en los últimos 10 años de su vida. Cerca de 40 premios Nobel han firmado una petición denunciando a Montagnier por su herejía y el gran científico se vio obligado incluso a huir de Europa para escapar de lo que describió como una cultura de «terror intelectual». En respuesta a esta calumnia, Montagnier declaró a la revista LaCroix:

«Estoy acostumbrado a los ataques de estos académicos que son solo burócratas jubilados, cerrados a toda innovación. Tengo las pruebas científicas de lo que digo».

Al describir los mayores desafíos para avanzar en esta investigación, Montagnier declaró:

«Hemos optado por trabajar con el sector privado porque no podrían provenir fondos de instituciones públicas. El caso Benveniste ha hecho que cualquiera que se interese por la memoria del agua sea considerado… Quiero decir que huele a azufre. Es el infierno».

La larga ola de descubrimientos (y el choque de dos ciencias)

La lucha de Montagnier es simplemente una sombra de un choque mucho más grande dentro de la propia ciencia occidental. Si bien muchas personas piensan de manera simplista que hay una rama singular de la ciencia desde Galileo hasta Descartes y Newton hasta el presente, la realidad tras una inspección más cercana nos muestra que en realidad hay dos paradigmas opuestos, uno de los cuales ha sido oscurecido sistemáticamente por la caza de brujas por motivos políticos desde incluso antes de los días del Club X de Huxley y la fundación de la revista Nature en 1869.

Dado que esta lucha a menudo se pasa por alto, se deben decir algunas palabras aquí y ahora.

En oposición a la tradición materialista que ha intentado imponer «causas materiales» a los fenómenos naturales, la escuela más potente de biofísica óptica encarnada por Montagnier fue puesta en marcha nada menos que por Louis Pasteur. Mucho antes de que surgiera la controversia Beschamp-Pasteur, y mucho antes de realizar trabajos sobre pasteurización, el trabajo científico temprano de Pasteur fue moldeado por descubrimientos sobre las propiedades ópticas de la materia viva y los fenómenos de la vida. En resumen, durante su temprano período creativamente potente, Pasteur descubrió que las soluciones que tenían material orgánico disuelto dentro de ellas tenían la increíble propiedad de girar la luz polarizada hacia la «izquierda», mientras que las soluciones líquidas desprovistas de material orgánico no tenían esa capacidad.

En una carta de 1870, Pasteur describió su visión cosmológica de la propiedad disimétrica de la vida a un amigo Jules Raulin diciendo:

«Ustedes saben que yo creo que hay una influencia disimétrica cósmica que preside constante y naturalmente sobre la organización molecular de principios inmediatamente esenciales para la vida; y que, como consecuencia de ello, las especies de los tres reinos, por su estructura, por su forma, por la disposición de sus tejidos, tienen una relación definida con los movimientos del universo. Para muchas de esas especies, si no para todas, el Sol es el primum movens de la nutrición; pero creo en otra influencia que afectaría a toda la organización [geometría], pues sería la causa de la disimetría molecular propia de los componentes químicos de la vida. Quiero por experimento captar algunas indicaciones sobre la naturaleza de esta gran influencia disimétrica cósmica. Debe, puede ser electricidad, magnetismo …»

Esta propiedad «zurda» a la vida todavía confunde a los astrobiólogos más de un siglo después.

Con la misteriosa muerte en 1906 de Pierre Curie, que había avanzado en la investigación de Pasteur, y cuando la Primera Guerra Mundial descarriló este curso de investigación (muchas de las mentes jóvenes más brillantes de Europa fueron enviadas a una picadora de carne de cuatro años de guerra de trincheras), la batuta fue abandonada en Europa, solo para ser retomada por dos científicos ruso-ucranianos que trabajaron juntos estrechamente en la Universidad de Crimea: Vladimir Vernadsky (padre de la ciencia atómica rusa y fundador de la escuela de biogeoquímica 1863-1945) y su amigo Alexander Gurwitsch (1874-1954).

Vernadsky revive la visión de Pasteur

Vernadsky utilizó ampliamente el trabajo de Pasteur en su propia construcción de la biosfera y siempre señaló que las propiedades electromagnéticas de la vida eran la fuerza impulsora de la bioquímica. Yendo más lejos que nadie vivo para definir los mecanismos de la biosfera, Vernadsky explicó que el verdadero científico no debe comenzar con organismos individuales y «trabajar de abajo hacia arriba» como muchos darwinianos radicales eran propensos a hacer, sino más bien comenzar, como Louis Pasteur lo había hecho de antemano, con la galaxia y una conciencia de la fuerza impulsora de las radiaciones electromagnéticas / cósmicas que dan forma al flujo dirigido de la evolución biosférica.

En su libro de 1926 la Biosfera, Vernadsky comenzó su descripción de la biosfera con las siguientes observaciones:

«La biosfera puede ser considerada como una región de transformadores que convierten las radiaciones cósmicas en energía activa en formas eléctricas, químicas, mecánicas, térmicas y de otro tipo. Las radiaciones de todas las estrellas entran en la biosfera, pero captamos y percibimos sólo una parte insignificante del total. No se puede dudar de la existencia de radiación originada en las regiones más distantes del cosmos. Las estrellas y las nebulosas emiten constantemente radiaciones específicas, y todo sugiere que la radiación penetrante descubierta en las regiones superiores de la atmósfera por Hess se origina más allá de los límites del sistema solar, tal vez en la Vía Láctea, en nebulosas o en estrellas».

Radiación mitogénica de Alexander Gurwitsch

Vernadsky utilizó ampliamente el trabajo de Pasteur en su propia construcción de la biosfera y siempre señaló que las propiedades electromagnéticas de la vida eran la fuerza impulsora de la bioquímica. Mientras Vernadsky pasaba su vida centrándose en los macroestados de la biosfera y cómo interactuaba con la litosfera y la noosfera (los dominios anidados de la no vida, la vida y la razón creativa) organizados dentro de matrices anidadas de campos magnéticos que moderaban el flujo de radiación cósmica a través del universo, su colega Gurwitsch se centró en la intersección de la luz y los campos magnéticos dentro de los microestados de las células vivas.

Al describir su descubrimiento en un estudio de 2011 sobre la biorradiación cósmica, el investigador Cody Jones describió la visión básica de Gurwitsch:

«Gurwitsch desarrolló tres niveles anidados de estructuras de campo, dispuestas de acuerdo con la complejidad y la extensión espacial, que van desde lo molecular (constelaciones moleculares), a lo celular (relaciones entre células), a los niveles organísmicos (los diferentes órganos y sistemas que constituyen un solo organismo). Cada campo anidado podría describirse en términos de diferentes mecanismos en cuanto a cómo avanzaba la morfología para cualquier estructura en particular, sin embargo, todos estaban unificados hacia la realización de un estado futuro definido de existencia».

Gurwitsch revolucionó por primera vez las ciencias de la vida al dar forma a un elegante experimento que demostró que las células emiten ráfagas débiles de luz ultravioleta a medida que pasan por la mitosis. Para probar su teoría, Gurwitsch estableció dos raíces de cebolla que crecían en direcciones perpendiculares y descubrió que las tasas más altas de emisiones de luz que ocurrían en la punta más nueva de las raíces indujeron un crecimiento celular del 30-40% cuando se acercaban a una raíz de cebolla más vieja. Aunque no existieron instrumentos lo suficientemente sensibles como para captar estas frecuencias ultra débiles durante su vida, Gurwitsch demostró que la luz del espectro ultravioleta debe generarse a partir de nuevas células separando las raíces de cebolla viejas y nuevas por varios tipos de lentes que bloqueaban diferentes partes del espectro y descubrió que solo cuando la luz UV estaba bloqueada el efecto del aumento del crecimiento celular del 30% llegaba a su fin. Gurwitsch llamó a esto «Radiación mitogénica».

Alexander Gurwitsch y su experimento original de raíz de cebolla. Dos cebollas (Z1 y Z2) crecen perpendicularmente con el punto W que representa el punto de intersección de la raíz más joven emitida por Z1 y la raíz más vieja de Z2 separadas por una lente de cuarzo que bloquea las emisiones de emisiones ultravioletas de Z1 a Z2.

Si bien Gurwitsch fue condenado al ostracismo por el establecimiento científico durante su vida, surgieron tecnologías entre la comunidad astrofísica en la década de 1950 que permitieron a los científicos medir frecuencias de luz extremadamente débiles en el rango de la radiación mitogénica de Gurwitsch (obviamente útil para captar señales débiles de otras galaxias en el espacio profundo). Cuando equipos de astrónomos italianos aplicaron sus equipos a material orgánico, el descubrimiento de Gurwitsch se verificó experimentalmente por primera vez.

Uno hubiera pensado que tal descubrimiento habría revolucionado toda la biología, la medicina y las ciencias de la vida en el acto, sin embargo, después de un breve aumento en el interés, el descubrimiento pronto fue olvidado y relegado a una característica secundaria «insignificante» de la vida que no tenía ningún papel causal que desempeñar en ninguna de las mecánicas o el comportamiento de la actividad orgánica. Los materialistas y reduccionistas que deseaban mantener que toda la vida era simplemente la suma de partes ganaron el día.

Luego, otro biofísico llamado Fritz-Albert Popp apareció en escena.

Los descubrimientos biofotónicos de Fritz Popp

Durante la década de 1970, Popp era un investigador del cáncer que trataba de averiguar por qué solo uno de los dos isómeros de Benzpyrene causaba cáncer. Un isómero a veces se conoce como una configuración de imagen especular de una molécula que es químicamente idéntica, pero cuyas propiedades pueden diferir enormemente. Bajo la lógica materialista/reduccionista, no había ninguna razón por la cual un isómero (Benzpireno 3,4) que se encuentra en los cigarrillos y el alquitrán induciría el crecimiento del cáncer en el tejido pulmonar, mientras que otro isómero (Benzpireno 1,2) sería completamente benigno.

Después de descubrir el trabajo de Gurwitsch, el Dr. Popp comenzó a medir las emisiones de luz ultra débiles de las moléculas de benceno y sus efectos sobre el crecimiento celular en los tejidos hepáticos y descubrió que las propiedades extremadamente altas de absorción / emisión de luz de Benzpyrene 3,4 eran la causa de la falta de armonía de la regulación celular. Medir la actividad de los fotones del crecimiento de células hepáticas cancerosas frente a las sanas es una forma sorprendente de ver claramente que el crecimiento canceroso coincide con las emisiones exponenciales de fotones, mientras que las emisiones de fotones hepáticos sanos son muy estables.

En el transcurso de su vida altamente productiva, el Dr. Popp descubrió que estas emisiones de luz ocurrían en diferentes longitudes de onda de acuerdo con los tipos de células, la función y la especie. Cuando Popp acercó dos muestras biológicas, las cosas se volvieron adicionalmente interesantes ya que el «ritmo» de sus emisiones de fotones se sincronizaba maravillosamente cuando estaban cerca y no estaban sincronizadas cuando se separaban. Esto fue esbozado en su artículo Sobre la coherencia de los biofotones.

Al describir la aplicación clínica de estos descubrimientos, el Dr. Popp declaró:

«La luz puede iniciar, o detener, reacciones similares a cascadas en las células, y ese daño celular genético puede ser virtualmente reparado, en cuestión de horas, por débiles haces de luz. Todavía estamos en el umbral de comprender completamente la compleja relación entre la luz y la vida, pero ahora podemos decir, enfáticamente, que la función de todo nuestro metabolismo depende de la luz».

Los descubrimientos de Popp amplifican los del gran científico ruso A.B. Burlakov, quien descubrió que las emisiones de luz ultra débiles que emanan de dos juegos de huevos de pescado fertilizados separados por un vaso demostraron un poderoso efecto armonizador. Si un conjunto de huevos fuera más viejo, entonces los huevos más jóvenes madurarían y se desarrollarían mucho más rápido si se acercaran. Sin embargo, si la diferencia de edad entre los dos conjuntos fuera demasiado grande, entonces el científico descubrió que el conjunto más joven vería una mayor tasa de muerte, deformidades y retraso del desarrollo.

Este modo de pensar sobre la vida hace que la mente del científico se acerque a la vida de una manera más común con un músico que sintoniza su instrumento con una orquesta o un director que sostiene múltiples ondas de sonido en su mente simultáneamente como una idea musical completa que es mayor que simplemente la suma de sus partes. Es un modo de pensar mucho más natural y efectivo que el enfoque materialista / reduccionista hoy dominante en la mayoría de las universidades occidentales que trata al organismo como una máquina y al todo como una suma de partes químicas.

Un barrido más completo de estos descubrimientos se presentó en una conferencia de 2020 presentada por este autor, que se puede ver en su totalidad aquí:

Lanzando la investigación de Montagnier bajo una nueva luz

Volviendo una vez más a Luc Montagnier con un renovado aprecio por la ola más larga de tradición científica que él forma parte de amplificar, podemos apreciar algunas de las conclusiones que ha extraído de las propiedades a menudo ignoradas pero completamente verificables de las ondas de luz, el agua estructurada, las bacterias y el ADN que pueden hacernos redefinir nuestra comprensión de la «vida». «enfermedad» y «medicina» para siempre. Este ejercicio posiblemente nos hará apreciar la importancia de un programa internacional de choque en la investigación de biofísica óptica y la terapia de ondas de luz / interferencia para tratar enfermedades que afectan a la humanidad, incluida COVID-19.

En una entrevista de 2011, el Dr. Montagnier recapituló las consecuencias de sus descubrimientos:

«La existencia de una señal armónica que emana del ADN puede ayudar a resolver preguntas de larga data sobre el desarrollo celular, por ejemplo, cómo el embrión es capaz de hacer sus múltiples transformaciones, como si estuviera guiado por un campo externo. Si el ADN puede comunicar su información esencial al agua por radiofrecuencia, entonces existirán estructuras no materiales dentro del ambiente acuoso del organismo vivo, algunas de ellas ocultando señales de enfermedad y otras involucradas en el desarrollo saludable del organismo».

Con estas ideas en mente, Montagnier ha descubierto que muchas de las frecuencias de emisiones EM de una amplia variedad de ADN microbiano también se encuentran en los plasmas sanguíneos de pacientes que sufren de influenza A, hepatitis C e incluso muchas enfermedades neurológicas que no se consideran comúnmente influenciadas por bacterias, como el Parkinson, la esclerosis múltiple, la artritis reumatoide y el Alzheimer. ¡En los últimos años, los equipos de Montagnier incluso encontraron ciertas señales en los plasmas sanguíneos de personas con autismo y varias variedades de cánceres!

Más de una docena de médicos franceses han tomado las ideas de Montagnier lo suficientemente en serio como para recetar antibióticos para tratar el autismo en el transcurso de seis años y, en oposición a las teorías convencionales, han descubierto que entre 240 pacientes tratados, ¡4 de cada 5 vieron sus síntomas retroceder dramáticamente o desaparecer por completo!

Estos resultados implican una vez más que ciertas especies difíciles de detectar de microbios emisores de luz están más cerca de la causa de estos males de lo que la industria farmacéutica moderna quisiera admitir.

Un nuevo dominio de pensamiento: por qué las grandes farmacéuticas deberían tener miedo

Como demostró el experimento filmado de 2014, Montagnier fue aún más lejos para demostrar que las frecuencias de las emisiones de onda dentro de un filtrado ubicado en un laboratorio francés se pueden registrar y enviar por correo electrónico a otro laboratorio en Italia, donde esa misma grabación armónica se infundió en tubos de agua no emisora, ¡lo que hace que los tubos italianos comiencen a emitir señales lentamente! ¡Estas frecuencias de ADN pudieron estructurar los tubos de agua italianos de la fuente principal a mil millas de distancia, lo que resultó en una réplica exacta del ADN del 98%!

De pie como estamos, en la cúspide de tantos avances emocionantes en la ciencia médica, deberíamos preguntarnos: ¿qué podrían significar estos resultados para el complejo industrial farmacéutico multimillonario que se basa en mantener al mundo encerrado en una práctica de medicamentos químicos y vacunas?

Hablando de este punto, Montagnier declaró:

«El día que admitamos que las señales pueden tener efectos tangibles, las usaremos. A partir de ese momento podremos tratar a los pacientes con ondas. Por lo tanto, es un nuevo dominio de la medicina que la gente teme, por supuesto. Especialmente la industria farmacéutica… algún día podremos tratar los cánceres usando ondas de frecuencia».

El amigo y colaborador de Montagnier, Marc Henry, profesor de Química y Mecánica Cuántica en la Universidad de Estrasburgo, declaró:

«Si tratamos con frecuencias y no con medicamentos, se vuelve extremadamente rentable en cuanto a la cantidad de dinero gastado. Gastamos mucho dinero para encontrar las frecuencias, pero una vez que se han encontrado, no cuesta nada tratarlas».

Ya sea que se produzca en un laboratorio como afirma Montagnier o que haya aparecido naturalmente como afirma nature Magazine, Bill Gates y el Dr. Fauci, el hecho es que la actual pandemia de coronavirus ha acelerado un colapso del sistema financiero mundial y ha obligado a los líderes del mundo a discutir la realidad de un nuevo paradigma necesario y un nuevo orden económico mundial. Queda por ver si ese nuevo sistema será impulsado por los cárteles farmacéuticos y los financieros que dirigen la política de salud global o si será impulsado por los estados nacionales que dan forma a los términos de ese nuevo sistema en torno a las necesidades humanas.

Si los estados nacionales logran permanecer en el asiento del conductor de este nuevo sistema, entonces tendrá que ser impulsado por ciertos principios fundamentales de la atención médica para todos, la reforma de la práctica científica y una reforma política / económica más amplia en la que el carácter sagrado de la vida humana se coloca por encima de todas las consideraciones de ganancia monetaria. En este sentido, tales programas de choque en proyectos a largo plazo en ciencia espacial, defensa de asteroides y desarrollo lunar / marte serán tan necesarios en el dominio astrofísico como los programas de choque en energía de fusión serán en el dominio atómico. Uniendo ambos mundos, es el dominio de las ciencias de la vida que cruza las propiedades electromagnéticas de los átomos, las células y el ADN con las propiedades electromagnéticas a gran escala de la Tierra, el Sol y la galaxia en su conjunto.

Fuente: https://www.globalresearch.ca/


Un patrón de muertes que debería hacer reaccionar a las autoridades

Datos impactantes de mortalidad de Alemania, Austria, Israel, Inglaterra: miles de muertes no relacionadas con Covid posteriores a las ‘vacunas’ parecen estar siendo encubiertas, clasificadas erróneamente como muertes de no vacunados … Según el profesor alemán Christof Kuhbandner, de la Universidad de Regensberg, estamos ante una “situación extremadamente alarmante”.

El profesor de la Universidad de Regensberg Christof Kuhbandner descubrió lo que él llama una situación extremadamente alarmante, en la que miles y miles de muertes que se están ocultando en las estadísticas.

Informe de Inglaterra enciende las alarmas

Según este informe austriaco transmitido por servus.tv, el profesor Kuhbandner se encontró con un estudio preliminar reciente en la revista ResearchGate, donde los autores examinaron el informe de vigilancia de mortalidad por vacunas ONS del Reino Unido.

Aunque a primera vista la mortalidad por todas las causas parecía mucho más baja en los vacunados que en los no vacunados, en una inspección más cercana encontraron inconsistencias y anomalías fundamentales en los datos y que había habido una «categorización errónea sistémica de muertes entre las diferentes categorías de no vacunados y vacunados», entre otros factores.

Para el período de las semanas 1-38 de 2021, las Figuras 8 y 9 muestran fuertes picos en la mortalidad no relacionada con Covid para los grupos de edad de 60-69 y 70-79 años no vacunados, mientras que la mortalidad entre los vacunados se mantuvo estable.

A primera vista, esto sugeriría que las vacunas estaban funcionando bien en Inglaterra y Gales. Pero el final no es feliz …

Inquietante: los picos se produjeron al mismo tiempo

El Prof. Kuhbandner notó que algo muy inusual estaba sucediendo y examinó la tendencia también para el grupo de edad de más de 80 años. Las siguientes son las parcelas para los tres grupos de edad. Los picos y las muertes fueron compensados.

Además, los autores del artículo también comentaron:

«En años anteriores, cada uno de los grupos de 60-69, 70-79 y 80+ tiene picos de mortalidad al mismo tiempo durante el año (incluido 2020 cuando todos sufrieron el pico de covid de abril al mismo tiempo). Sin embargo, en 2021, cada grupo de edad tiene picos de mortalidad no relacionados con Covid para los no vacunados en un momento diferente, es decir, el momento en que los programas de vacunación para esas cohortes alcanzan su pico”.

Es decir, las vacunas se implementaron por etapas, primero se administraron a los más ancianos (más de 80 años) y luego al siguiente grupo (70-79) y luego al grupo de 60-69 algunas semanas después. Los picos de muerte siguieron luego a las etapas de vacunación.

Entonces, ¿por qué según la historia oficial las personas que NO reciben la vacuna son las que mueren en grandes cantidades y no las que reciben la vacuna?

Esto se debe a que en Europa, el estado de «vacunado» se asigna por primera vez 14 días después de recibir la vacuna final. ¡Por lo tanto, cualquier muerte que ocurra antes de esto termina contándose como una «muerte no vacunada»! Entonces, si un paciente que recibió una vacuna muere menos de 14 días después, se cuenta como una muerte sin vacunar. Así es como se ocultan las muertes por vacunas. Y hay muchos miles.

Como muestran las Figuras 5 a 7 anteriores, se produjeron miles de muertes poco después de que se administraron las vacunas, y muchas de ellas probablemente estaban relacionadas con la vacuna misma. Si este es el caso a nivel mundial, y no solo en Gran Bretaña, entonces la cantidad de muertes por vacunas puede ser profunda. La pesadilla parece ser cierta, muestra el profesor Kuhbandner.

Mismo patrón en Alemania

El Prof. Kuhbandner luego examinó los datos de mortalidad de Alemania y encontró el mismo patrón: grandes saltos en la mortalidad inmediatamente después de las campañas de vacunación. Estas muertes parecen ser el resultado directo de las vacunas. Es demasiada coincidencia como para descartarlo.

“Cuando expresas esto en números, se traduce en un promedio de 700 muertes más por día”, le dijo Kuhbandner a servus.tv, mirando solo los números alemanes.

“Sería como dos aviones comerciales llenos de gente estrellándose todos los días”.

Kuhbandner también encontró el mismo patrón de muerte posterior a la vacunación en Israel.

El profesor de la Universidad de Ratisbona se puso en contacto con los institutos Robert Koch y Paul Ehrlich alemanes para presentar sus hallazgos, pero hasta ahora los han ignorado. El Instituo Robert Koch escribió que no “tenía la capacidad de evaluar las sospechas de cada individuo”.

“Situación extremadamente alarmante”

Tal como están las cosas, nadie sabe cuándo las autoridades responsables tomarán en serio estos hallazgos extremadamente inquietantes. Sin embargo, hasta que lo hagan, muchos miles más van a morir todos los días.

“Si resulta que hay un efecto causal con las vacunas, entonces nos enfrentamos a una situación extremadamente alarmante”, dice Kuhbandner. “Entonces tenemos un caso aquí en el que miles de personas mueren diariamente por la vacuna sin que nos demos cuenta”.

Vídeo: Prof-Kuhbandner-Tote-nach-Impfungen-Servus-TV-01-2022/11

Klark Jouss

(Fuentes: http://astillasderealidad2.blogspot.com/;  https://msyc1.wordpress.com/; visto en https://trikoobanews.com/)

Los últimos hombres libres

Somos los últimos de una especie, una raza de hombres y mujeres libres, que reclama su legítima soberanía y reivindica sus valores primordiales por encima de todas las cosas, con orgullo, con decisión, y dispuestos a luchar por ello hasta las últimas consecuencias.

Somos los que no se venden, los que no ceden, los que no se arrodillan, los que nunca entrarán por el aro, pese a quien pese, y caiga quien caiga.

Somos los de la sangre pura, los del corazón intacto, los que nunca permitirán que modifiquen su ADN natural con ese experimento cientificista al que llaman vacuna.

Somos el primer movimiento disidente de la historia que nace de forma natural, desde las entrañas, en el mismo corazón de nuestras calles, pueblos y ciudades, sin politizar, sin dirigir, sin subvencionar.

No existe bozal, vacuna, o pasaporte covidicio que pueda con nosotros, hemos cruzado una linea de no retorno, y no nos detendremos jamás, crearemos nuevas estructuras sociales, económicas, sanitarias, educativas, todo para no depender nunca más de ese manicomio putrefacto al que llaman sistema.

Han intentado someternos, humillarnos, destruirnos, y han fracasado en todo, se acerca nuestro momento. Señores políticos, médicos, periodistas, docentes, jerifaltes de las élites financieras, iremos a por ustedes, y pagarán por cada crimen que hayan cometido, por cada anciano que hayan asesinado, por cada niño que hayan inoculado, por cada negocio que hayan arruinado, no habrá paz para los malvados, no claudicamos, no olvidamos.

Somos hombres y mujeres libres, por eso caminamos con la cabeza alta, y la cara descubierta, porque no tenemos miedo, porque conocemos nuestro poder y el propósito de nuestra misión, somos los últimos de una raza, somos el futuro de la especie, no cedemos, no callamos … y nunca nos rendiremos.

Feliz semana a todos los miembros de la resistencia, energía y Rock and Roll, la cabeza alta y la cara descubierta siempre!!

Martín Sánchez

Fuente: http://astillasderealidad2.blogspot.com/ http://astillasderealidad2.blogspot.com/2022/02/los-ultimos-hombres-libres.html

Operación Exterminio: el plan para diezmar el sistema inmunológico humano con un patógeno generado en laboratorio


«Si alguien quisiera matar a una parte significativa de la población mundial en los próximos años, los sistemas que se están implementando en este momento lo permitirían». Dr. Mike Yeadon, ex vicepresidente de Pfizer

«Y este es el espíritu del anticristo, del cual habéis oído venir; y ahora ya está en el mundo». 1 Juan 4:2–3

Pregunta– ¿La vacuna contra el Covid-19 daña el sistema inmunológico?

Respuesta– Lo hace. Afecta la capacidad del cuerpo para combatir infecciones, virus y enfermedades.

Pregunta– Si eso es cierto, entonces ¿por qué no han muerto más personas después de vacunarse?

Respuesta– ¿No estoy seguro de lo que quieres decir? La vacuna ha matado a más personas que cualquier otra vacuna en la historia. «Hasta ahora, en los Estados Unidos, el número de muertos es tres veces mayor que el total de todas las vacunas en los últimos 35 años». Eso es simplemente asombroso. También hemos visto un aumento constante en la mortalidad por todas las causas y el exceso de muertes en los países que lanzaron campañas de vacunación masiva a principios de año. A veces, el aumento es de hasta un 20 por ciento sobre el promedio de cinco años. Eso es un aumento masivo en las muertes, y es en gran parte atribuible a la vacuna. Entonces, ¿a qué te refieres cuando dices: «¿Por qué no han muerto más personas»? ¿Esperabas ver a la gente agarrándose el corazón y cayendo muerta después de ser golpeada? Esa es una comprensión muy ingenua de cómo funciona la inyección. (Ver: «Muertes por COVID antes y después de los programas de vacunación», You Tube; 2 minutos)

Pregunta– Todo lo que estoy diciendo es que el porcentaje de personas que han muerto es bastante pequeño en comparación con las decenas de millones que han sido vacunadas.

Respuesta– Y todo lo que estoy diciendo es que si la vacuna es un patógeno generado por el laboratorio, y creo que lo es, entonces ciertamente no fue diseñada para matar a las personas en el acto. Fue diseñado para producir una reacción tardía que erosiona gradual pero implacablemente la salud de los vacunados. En otras palabras, el impacto total de los coágulos de sangre, el sangrado, los problemas autoinmunes y otras lesiones generadas por la vacuna solo se sentirá completamente en una fecha posterior a través del aumento de los incidentes de ataques cardíacos, accidentes cerebrovasculares, enfermedades vasculares e incluso cáncer. (Echa un vistazo a la «última tendencia de asistencias cardíacas por parte del Servicio de Ambulancias de Escocia: esto es * exceso * por encima de la norma 2018/19. Gran aumento en verano, 500 llamadas de ambulancia por semana por encima de lo normal, principalmente de 15 a 64 años. Se estaba asentando, luego volvió a subir desde finales de octubre». Unidad Escocesa – Grupo de Edimburgo)

Respuesta– La tabla anterior muestra por qué los problemas cardíacos han atraído mucha atención últimamente, pero el daño al sistema inmunológico es aún más preocupante.

Pregunta– ¿Puedes explicar a qué te refieres sin ser demasiado técnico?

Respuesta– Puedo hacerlo mejor que eso. Puedo darle un breve clip de un artículo que cubre las últimas investigaciones. Mira esto:

«Un estudio de laboratorio sueco (titulado «SARS-CoV-2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro», NIH) publicado a mediados de octubre encontró que la proteína espiga … entra en el núcleo de las células e interfiere significativamente con las funciones de reparación del daño del ADN comprometiendo la inmunidad adaptativa de una persona y tal vez fomentando la formación de células cancerosas.

«Mecánicamente, encontramos que la proteína espiga se localiza en el núcleo e inhibe la reparación del daño en el ADN», escribieron. «Nuestros hallazgos revelan un mecanismo molecular potencial por el cual la proteína espiga podría impedir la inmunidad adaptativa y subrayar los posibles efectos secundarios de las vacunas basadas en espigas de longitud completa». («La proteína espiga en el virus COVID y las inyecciones debilita el sistema inmunológico, puede estar relacionada con el cáncer: estudio sueco», Lifesite News)

Lo que los investigadores encontraron es que la proteína espiga bloquea la producción de las enzimas que se necesitan para reparar el ADN roto que, a su vez, previene la «proliferación» de células B y T que se necesitan para combatir la infección.

Pregunta– ¿Puedes explicarlo en un lenguaje sencillo?

Respuesta– Seguro. Significa que la vacuna cortocircuita su sistema inmunológico, lo que despeja el camino para la infección, la enfermedad y una muerte prematura. Tal vez, piensas que puedes tener una vida larga y feliz con un sistema inmunológico disfuncional, pero creo que estás equivocado. El sistema inmunológico es el escudo que lo protege de todo tipo de virus, bacterias e infecciones potencialmente letales. No es solo la primera línea de defensa, es la única línea de defensa. En ausencia de la protección total de las células B y T para combatir a los intrusos extranjeros, las perspectivas de supervivencia son minúsculas en el mejor de los casos.

Para subrayar ese punto, echa un vistazo a este video del director funerario británico, John O’ Looney, quien ha proporcionado actualizaciones periódicas sobre lo que está viendo en el terreno 10 meses después del lanzamiento de la vacunación. Es un relato inquietante de la catástrofe que ahora se está desarrollando ante nuestros ojos:

(Marca de 30 segundos) «Entonces, lo que estamos viendo es un número anormalmente grande de muertes debido a ataques cardíacos, accidentes cerebrovasculares, aneurismas; y todos estos son el resultado de la trombosis … Embolias en los pulmones, las piernas, varios lugares que están causando estas muertes que están bien documentadas por los forenses locales y bien documentadas en todo el país. Y nadie parece estar preocupado por el alarmante aumento de (coágulos de sangre) que he visto más en este año que en los últimos 14 años….

Ese es un tipo de muerte que estamos viendo, el otro tipo son las personas que se están enfermando ahora a medida que sus sistemas inmunológicos finalmente se rinden. Entonces, han tenido los pinchazos tal vez hace 6 u 8 meses, y ha estado carcomiendo su sistema inmunológico, y ahora están luchando para combatir cosas como el resfriado común. Entonces, estamos en invierno y hay resfriados y gripes alrededor y estas personas no pueden combatirlos. El gobierno se apresura a etiquetarlo como «Omicron»… pero están enfermos con el resfriado común. Sus sistemas inmunológicos están diezmados. Es muy parecido a un paciente con cáncer, que pasa por la quimioterapia y diezma su sistema inmunológico. Y tienen que tener mucho cuidado porque el resfriado común o la gripe pueden matarlos. Y esto es lo que estamos viendo ahora…

Han pasado casi 12 meses desde que comenzaron los primeros pinchazos, por lo que sus sistemas inmunológicos se están desmoronando; esa es la realidad y eso es lo que estoy viendo. y ya no pueden hacer frente a un resfriado. … Cuando fui a la reunión en Westminster en septiembre, el científico predijo que esto es lo que sucedería y, he aquí, eso es lo que está sucediendo. La gente se está enfermando y muriendo… Es aterrador». («Omicron es ‘lesión por vacuna’; no es más que eso». John Looney, Rumble)

¿Tiene razón? ¿El aumento en las muertes NO es otra ola de Covid, sino los efectos en cadena de una inyección citotóxica que se dirige al sistema inmunológico dejando a millones de personas indefensas contra infecciones y enfermedades de rutina?

Suena factible y ciertamente encaja con la agenda de despoblación que requiere un biológico híbrido que no mate a su objetivo directamente, sino que básicamente desmantele los sistemas de defensa críticos que hacen posible la supervivencia humana. Al disfrazar una «proteína asesina» como un antígeno inofensivo, nuestros administradores de la pandemia han podido acceder al torrente sanguíneo de millones de personas, lo que les permite insertar una bomba de tiempo que devasta poblaciones cruciales de células T y B, dejando a las víctimas vulnerables a cualquier insecto que circule en la población. Como señala Looney, los científicos advirtieron de este mismo resultado cuando se propuso por primera vez la vacunación masiva. Naturalmente, los puntos de vista opuestos fueron ignorados y censurados. Aquí hay más de un documento de investigación de preimpresión en el servidor medRxiv. Ayuda a explicar el impacto de la vacuna en el sistema inmunológico:

«Investigadores en los Países Bajos y Alemania han advertido que Pfizer-BioNTech … (COVID-19) la vacuna induce una reprogramación compleja de las respuestas inmunes innatas que deben considerarse en el desarrollo y uso de vacunas basadas en ARNm. Después de la vacunación, las células inmunes innatas tuvieron una respuesta reducida al receptor tipo toll 4 (TLR4), TLR7 y TLR8, todos ligandos que desempeñan un papel importante en la respuesta inmune a la infección viral.

«Múltiples estudios han demostrado que las respuestas inmunes innatas a largo plazo pueden aumentar (inmunidad entrenada) o regularse a la baja (tolerancia inmune innata) después de ciertas vacunas o infecciones». …

Estos resultados demuestran colectivamente que los efectos de la vacuna BNT162b2 van más allá del sistema inmune adaptativo. La vacuna BNT162b2 también induce la reprogramación de las respuestas inmunes innatas, y esto debe tenerse en cuenta». … («La investigación sugiere que la vacuna Pfizer-BioNTech COVID-19 reprograma las respuestas inmunes innatas», New-Medical net)

¿Cuántas personas se habrían vacunado si hubieran sabido que reprogramaría su sistema inmunológico?

Probablemente, nadie, por lo que nuestros funcionarios de salud pública nunca abordan el tema. Cualquier cosa que se desvíe incluso ligeramente de la narrativa de «las vacunas son buenas para ti» se omite de la cobertura general y se borra en las redes sociales. Pero, ¿no tienen derecho las personas a saber qué está pasando, qué se está inyectando en sus cuerpos y qué impacto tendrá en sus vidas y salud? ¿No es eso lo que se entiende por «consentimiento informado» o es otra víctima de la prisa por inocular a las 7 personas en el planeta tierra? Aquí hay un clip de una breve entrevista con el patólogo, el Dr. Ryan Cole:

«Cuando administramos estas inyecciones, podemos ver los tipos de glóbulos blancos en el cuerpo … y usted tiene una amplia gama de células inmunes que trabajan juntas para combatir los virus y mantener los cánceres bajo control. Ya estamos viendo las señales en el laboratorio de disminuciones en las células T de importancia crítica que necesita … en su sistema inmune innato. Estos son los marines en su cuerpo; luchando contra los virus que combaten el cáncer…. Pero lo que estamos viendo en el laboratorio después de que las personas reciben estas inyecciones, estamos viendo un perfil muy preocupante y bajo de estas importantes células T asesinas que desea en su cuerpo. (Células CD8) Y lo que hacen es mantener a todos los demás virus bajo control.

¿Qué estoy viendo en el laboratorio? Estoy viendo un aumento de los virus de la familia del herpes, estoy viendo herpes zóster, estoy viendo Mono, estoy viendo un gran aumento en el virus del papiloma humano … Literalmente estamos debilitando el sistema inmunológico de estos individuos.

Lo más preocupante de todo es que hay un patrón de estos tipos de células inmunes en el cuerpo que mantienen el cáncer bajo control. Desde el 1 de enero (en el laboratorio) he visto un aumento de 20 veces del cáncer de endometrio sobre lo que veo anualmente». («Patólogo Ryan N Cole de la Clínica Mayo sobre lo que estamos viendo en los resultados de laboratorio», Rumble; 2 minutos)

«¡Herpes, culebrilla, mono e incluso cáncer!» ¿Qué diablos está pasando? Esto no puede ser cierto, ¿verdad?

Sí, es cierto; la inmunosupresión conduce a todo tipo de resultados de salud terribles. Algunos lectores pueden recordar cómo el vacunólogo canadiense Dr. Byram Bridle hizo afirmaciones similares en una entrevista hace solo unas semanas. Esto es lo que dijo:

«Lo que he visto demasiado es gente que tenía cánceres que estaban en remisión, o que estaban siendo bien controlados; sus cánceres se han salido completamente de control después de recibir esta vacuna. Y sabemos que la vacuna causa una caída en el número de células T, y esas células T son parte de nuestro sistema inmunológico y son parte de las armas críticas que nuestro sistema inmunológico tiene para combatir las células cancerosas; así que hay un mecanismo potencial allí. Todo lo que puedo decir es que he tenido demasiadas personas que me contactan con estos informes para que me sienta cómodo. Diría que esa es mi mayor preocupación de seguridad más reciente, y también es la que va a ser la más poco informada en la base de datos adversa, porque si alguien ha tenido cáncer antes de la vacuna, no hay forma de que los funcionarios de salud pública lo vinculen con la vacuna». («Dr Byram Bridle speaks», Bitchute, :55 segunda marca)

Una vez más, ¿Cuántas personas habrían decidido vacunarse si supieran que podría desencadenar un brote de virus latentes o cánceres en remisión? ¿Quién correría ese riesgo?

Pero no saben que se están arriesgando, ¿verdad?, porque no se les ha dicho la verdad. Y la razón por la que no se les ha dicho la verdad es porque son un objetivo en una guerra de exterminio que se les está librando. A veces es muy difícil para las personas admitir lo que saben que es la verdad, pero la verdad es evidente. Nuestros gerentes de la pandemia y sus soldados de a pie en los medios de comunicación, la salud pública y el gobierno quieren hacernos daño, quieren inyectarnos una sustancia misteriosa que causará estragos en nuestro sistema inmunológico y acortará nuestras vidas. Esto no es solo una lucha por la libertad personal o la autonomía corporal, es una batalla por la supervivencia. Estamos defendiendo nuestro derecho a vivir. Aquí hay más de la inmunóloga viral Dra. Jessica Rose:

«Hay estudios que están saliendo ahora, y hay amplias señales en los datos de eventos adversos, de que estos productos (vacunas Covid) no solo están inmunomodulando el sistema inmunológico y causando hiperinflamación; ahora hay señales de que están afectando muy negativamente a las poblaciones de células T CD8. Para aquellos que no lo saben, esta es una muy mala noticia. Es solo en unas pocas personas hasta ahora, pero los datos no se ven bien hasta ahora. Estas células T son las llamadas «células asesinas». Su trabajo… es matar células infectadas viralmente que muestran marcadores extraños en su superficie. Entonces, si estas poblaciones se agotan, entonces eso es una muy mala noticia, porque no tenemos una población de células en el sistema inmunológico adquirido para eliminar las células infectadas viralmente. …

Hay signos claros que están empezando a surgir, de que hay un «síndrome de deficiencia de inmunidad» que se produce como resultado de estos productos (vacunas) Como resultado de la hiperestimulación … Las células T están (disminuidas), y la presencia constante de inyecciones repetidas de una proteína citotóxica… Nunca, nunca recomendaría que alguien que está inmunocomprometido se acerque a estas cosas, porque casi puedo garantizarle que su condición va a empeorar. Otra cosa que estamos viendo en VAERS es cánceres que salen de la remisión y muchos médicos están informando esto en el terreno. Y, por cierto, esto nunca ha sucedido antes, ni en esta escala; ni siquiera cerca … Entonces, hay algo que está sucediendo aquí que merece una mayor investigación, y no se ve bien». Jessica Rose explica la información preocupante que surge sobre la inmunidad comprometida de los vacunados», Odysee)

¿Puedes ver el patrón todavía? ¿Puedes ver cómo todos dicen lo mismo? ¿Por qué es eso, crees?

Es porque es la verdad, la verdad pura y sin adornos.

El punto que estamos tratando de hacer no puede ser exagerado: la vacuna es un arma biológica hecha por el hombre, generada en laboratorio, que desactiva el sistema de defensa crítico del cuerpo que aumenta la susceptibilidad a la enfermedad en muchos órdenes de magnitud. Con cada inyección adicional, uno es menos capaz de montar una respuesta suficiente a infecciones de rutina, gripes o virus. Eso conducirá a un tsunami de enfermedades que probablemente abrumará nuestro sistema de salud pública y hundirá al país más profundamente en la crisis. ¿Es ese el plan? ¿Es eso lo que nuestros señores globalistas tienen reservado para nosotros?

Veremos. Ahora echa un vistazo a este último clip del video del vacunólogo Geert Vanden Bossche:

«Lo primero que me gustaría destacar es que el Covid-19 no es una enfermedad de personas sanas. Las personas que están en buen estado de salud tienen un sistema inmunológico innato saludable que puede hacer frente a una serie de virus respiratorios sin ningún problema. Estas personas no solo están protegidas contra la enfermedad, sino que incluso, en muchos casos, pueden prevenir la infección. Estas son personas que pueden contribuir a la esterilización de la inmunidad y a la inmunidad de rebaño, que es muy, muy importante. Entonces, escucha: Nunca, nunca permitas que nadie o algo interfiera o suprima tu sistema inmunológico innato. Usted puede hacer un mal trabajo usted mismo llevando una vida poco saludable, que va a suprimir su inmunidad innata, pero aún peor, son los anticuerpos inducidos por la vacuna que suprimen su inmunidad innata. Y estos anticuerpos vacunanos no pueden sustituirlo porque pierden su eficacia contra el virus y se vuelven cada vez menos efectivos. A diferencia de los anticuerpos innatos, no pueden prevenir la infección, no pueden esterilizar el virus. Por lo tanto, contribuyen a la inmunidad de rebaño …

Si suprimimos estos anticuerpos innatos en los niños, podría conducir a enfermedades autoinmunes. Este es un absoluto «No ir» No podemos vacunar a nuestros hijos con estas vacunas. La supresión de la inmunidad innata ya es un problema entre los vacunados, y de hecho, van a tener dificultades para controlar una serie de enfermedades, no solo Covid-19, sino también otras enfermedades … y requerirá un cambio muy dramático en las estrategias para ayudar a los vacunados, y mi corazón está con ellos, porque necesitarán un tratamiento extenso en muchos casos.

… Potenciarlos , lo que significa darles una tercera dosis – es absolutamente una locura, porque lo que hará, es aumentar la presión inmune de los anticuerpos vacunales, sobre su inmunidad innata. Así que impulsar es una tontería absoluta; es peligroso y no debe hacerse….

Entonces, ¿qué nos dice la ciencia? Nos dice que es la inmunidad innata la que nos protegerá, no la vacuna». («Geert Vanden Bossche sobre las vacunas y la supresión de la inmunidad innata», Rumble)

Entonces, ahora sabemos que, junto con los coágulos de sangre, el sangrado, los ataques cardíacos, los accidentes cerebrovasculares, las enfermedades vasculares y neurológicas, la vacuna también está diseñada para destripar el sistema que nos protege de la enfermedad y la muerte, el sistema inmunológico. Cuán inmerso en la negación uno debe estar para no ver el mal que está ahora entre nosotros.

Vea también: Dr. Nathan Thompson: la vacuna Covid induce autoinmunidad, Odysee https://odysee.com/@EndYourSlavery:8/My-Jaw-DROPPED-when-I-Tested-Someone’s-Immune-System-After-the-2nd-Jab:d

Y esto: Síndrome de Inmunodeficiencia Adquirida por Vacuna (VAIDS): ‘Deberíamos anticipar ver esta erosión inmune más ampliamente'», https://americasfrontlinedoctors.org/news/post/vaccine-acquired-immune-deficiency-syndrome-vaids-we-should-anticipate-seeing-this-immune-erosion-more-widely/ Los Médicos de Primera Línea de las Américas https://americasfrontlinedoctors.org/news/post/vaccine-acquired-immune-deficiency-syndrome-vaids-we-should-anticipate-seeing-this-immune-erosion-more-widely/

Fuente: https://www.unz.com/mwhitney/operation-extermination-the-plan-to-decimate-the-human-immune-system-with-a-lab-generated-pathogen/

Gráficos muestran que las «vacunas» contra el COVID no funcionan

[Omicron es tinta de calamar. Quieren que te sigas pinchando pero ¿Por qué? y sobre todo, ¿Para qué? (LTC)]

Como sabemos, el objetivo de la vacunación es eliminar o reducir significativamente la incidencia de la enfermedad. Si una vacuna funciona, entonces en una población altamente vacunada veremos la eliminación completa de la enfermedad o una disminución significativa de su incidencia.

Dado que generalmente no es factible lograr una tasa de inoculación del 100 por ciento, la pregunta es ¿cuál es el nivel de vacunación que controlará la enfermedad o la eliminará por completo?

Este nivel a veces se conoce como «inmunidad de rebaño». Los expertos, especialmente el Dr. Anthony Fauci, nos dijeron al principio que la tasa de vacunación del 60 al 70 por ciento conferiría inmunidad colectiva con respecto al Covid 19.

La posición de Fauci estaba más o menos en línea con nuestra experiencia con muchas otras enfermedades en las que tales niveles de inoculación las han eliminado o las han hecho endémicas, es decir, lo suficientemente limitadas como para que no representen una amenaza epidémica a gran escala para la comunidad.

Unos doce meses después de la campaña mundial de vacunación, ahora hay varios países con tasas de vacunación de entre el 60 y el 70 por ciento. También hay algunos países y áreas geográficas con tasas del 80 por ciento o más.

Si bien no conocemos la cifra precisa que conferiría inmunidad colectiva contra esta enfermedad, podemos estar seguros de una cosa: si las vacunas son efectivas, las tasas de vacunación de más del sesenta por ciento deberían resultar en una reducción significativa de su incidencia.

[Nota del autor: El efecto de las vacunas se ve aumentado aún más por la inmunidad natural que, según algunos expertos, puede llegar hasta el 50% en algunas poblaciones. Casi dos años después de la pandemia, las poblaciones en muchos lugares han estado ampliamente expuestas al virus y, como resultado, poseen anticuerpos naturales. Por lo tanto, inocular, digamos, al 65 por ciento de la población con una buena vacuna debería resultar en una inmunidad general superior al 80 por ciento. Con este tipo de nivel de inmunidad deberíamos esperar, si no la eliminación de la enfermedad, entonces ciertamente una disminución considerable en su aparición.]

Esto, sin embargo, no es en absoluto lo que ha sucedido en la mayoría de los países y regiones altamente vacunados. Lo que ha ocurrido en muchos de ellos ha sido todo lo contrario. Tras el «éxito» de sus campañas de vacunación, se produjeron oleadas dramáticas de Covid 19. Aún más sorprendente, varios de estos países registraron un número récord de casos justo después de lograr sus cifras de vacunación muy altas.

Esta noticia puede sorprender a muchas personas porque la conexión entre las altas tasas de vacunación y la posterior explosión de casos ha sido prácticamente ignorada por los principales medios de comunicación.

Le mostraremos la realidad de la situación presentando los datos relevantes de una manera fácil de ver y directa. Hacemos esto yuxtaponiendo gráficos que representan las tasas de vacunación con gráficos que muestran las tasas en países con alta aceptación de vacunas.

Ninguna de las partes en el debate discutiría la validez de los datos que se presentan a continuación. Los datos están tomados de la herramienta Google Coronavirus Statistics, que extrae su material de fuentes oficiales y bases de datos gubernamentales. Los datos están a disposición del público y son ampliamente accesibles. Si desea verificar o reproducir los datos utilizados en este artículo, puede hacerlo fácilmente yendo a google.com y escribiendo «coronavirus» más el nombre del país cuyas estadísticas desea examinar. Una vez que aparecen los datos del país, puede elegir en el menú horizontal que se ejecuta justo debajo del término «Estadísticas» qué gráfico desea ver: «Nuevos casos» o «Vacunas».


El 17 de noviembre, Gibraltar registró su mayor número de nuevos casos en más de 10 meses. El aumento se convirtió en una causa de gran preocupación y llevó al gobierno a posponer las festividades navideñas. La última vez que Gibraltar tuvo tantos casos fue en el apogeo de la ola invernal a mediados de enero de 2021.

(Datos de Gibraltar a través de Google.com enlace)

El aspecto más sorprendente del aumento actual es que Gibraltar es la región más vacunada del mundo, con más del 99 por ciento de su población completamente vacunada. Aún más sorprendente, más del 40 por ciento de los gibraltareños ya han recibido su refuerzo.

Teniendo en cuenta lo que nos han dicho sobre las vacunas los medios corporativos y los funcionarios del gobierno, estaría justificado pensar que se trata de algún tipo de desinformación o error. Sin embargo, es un hecho innegable que aquí, en medio del actual aumento de Gibraltar, el 99 por ciento de sus residentes están completamente vacunados. Esto es algo que puedes ver por ti mismo en la tabla a continuación.

El ejemplo de Gibraltar debería ser una lección clara y una advertencia grave para los funcionarios de salud y los políticos de todo el mundo que están tratando de obligar a sus poblaciones a una alta aceptación de la vacunación. Gibraltar muestra claramente que incluso una tasa de vacunación del 99 por ciento seguida de un refuerzo intenso no domesticará ni eliminará el Covid 19 de la población. Muy por el contrario, puede coincidir con picos casi récord que probablemente superarán los máximos anteriores, especialmente porque en las próximas semanas el país entra en el período de invierno.


Para el 26 de octubre, casi el 83 por ciento de la población de Singapur recibió su curso de inyecciones de Covid. Esto significa que más de 8 de cada 10 singapurenses habían alcanzado el estado de vacunados por completo.

(Datos de Singapur a través de Google.com enlace)

La muy alta tasa de vacunación de Singapur, sin embargo, no hizo nada para disminuir la presencia de la enfermedad en la nación. De hecho, sucedió exactamente lo contrario. El 27 de octubre de 2021, Singapur publicó su recuento récord de casos de 5.324 nuevos casos.

Esta cifra fue casi un 300 por ciento más alta que el récord anterior de 1,426 que ocurrió el 20 de abril de 2021. En ese momento, la tasa de vacunación de Singapur era solo del 15 por ciento.

Si la vacuna fuera incluso remotamente efectiva, tal situación nunca podría haber surgido. Simplemente no hay forma de que un país donde el 83 por ciento de la población recibió una vacuna efectiva pueda experimentar un aumento tan récord. En lugar de una explosión de Covid, la tasa de vacunación muy alta de Singapur debería haber provocado inmunidad colectiva.


Al 12 de noviembre, la vacunación de Dinamarca era de más del 75 por ciento.

(Datos de Dinamarca a través de Google.com enlace)

El mismo día, Dinamarca registró 4.585 nuevos casos de Covid 19, que fue el nuevo récord de casos del país. El récord anterior de Dinamarca fue de 4.508 casos registrados en diciembre de 2020 en el apogeo de la ola invernal del año pasado.

En el momento del antiguo registro de casos, la tasa de vacunación en Dinamarca era del 0 por ciento.

La altísmica tasa de vacunación del país no solo no eliminó la enfermedad, sino que coincidió con cifras récord de casos. Si las vacunas inyectadas en los cuerpos de dos tercios de los daneses fueran efectivas, tal situación nunca podría haberse dado.


El 16 de noviembre de este año, Irlanda contaba con una tasa de vacunación de más del 75 por ciento.

(Datos de Irlanda a través de Google.com enlace)

Ese día, Irlanda registró 8.965 nuevos casos de Covid-19. Este fue un nuevo máximo para la nación.

El máximo anterior se registró el 8 de enero de 2021. La cifra se situaba entonces en 8.227. En ese momento, la tasa de vacunación de Irlanda era del 0 por ciento.

La vacunación de 4,5 millones de personas en Irlanda, más de dos tercios de la población, fue acompañada por una explosión de casos y un nuevo aumento de casos para la nación.


El 16 de noviembre de 2021, la tasa de vacunación del país se situó en el 76,4 por ciento.

(Datos de Islandia a través de Google.com enlace)

El 15 de noviembre de 2021, Islandia registró 420 nuevos casos de Covid-19. Este fue un récord que superó el máximo anterior del país en un 500 por ciento cuando la tasa de vacunación del país era cero.

Islas Caimán

El 12 de noviembre de 2021, la tasa de personas completamente vacunadas del país se situó en el 83,9 por ciento de la población total.

(Datos de las Islas Caimán a través de Google.com enlace)

El mismo día, Islas Caimán registró 953 nuevos casos de Covid-19, lo que fue un nuevo máximo para el país.

Superó el máximo del país de 258 casos en más del 300% desde el mismo día del año anterior. En ese momento la tasa de vacunación era del cero por ciento.


El 17 de noviembre de 2021, la tasa de vacunación del país era del 67,7 por ciento de la población total.

(Datos de Alemania a través de Google.com enlace)

Ese día Alemania registró 68.366 nuevos casos de Covid-19. Esto estableció un nuevo récord. Superó en casi un 50 por ciento el máximo anterior de 45.333 casos desde enero de 2021. En el momento del máximo anterior, la tasa de vacunación en Alemania era del 0 por ciento.


El 19 de noviembre de 2021, la tasa de vacunación completa del país se situó en el 65 por ciento.

(Datos de Austria a través de Google.com enlace)

El mismo día, Austria registró 15.809 nuevos casos de Covid-19. Este fue un nuevo máximo. Superó en más del 50% el récord anterior del país de 9.586 casos desde el 13 de noviembre de 2020. En ese momento, la tasa de vacunación en Austria era del cero por ciento.


El 10 de noviembre de 2021, la tasa de vacunación del estado se situó en el 71%.

(Datos de Vermont a través de Google.com enlace)

Al mismo tiempo, el estado de Vermont registró 611 nuevos casos de Covid-19, lo que fue un nuevo máximo. Superó con más del 100% el récord anterior de Vermont de 277 casos reportados el 2 de enero de 2021. En ese momento, la tasa de vacunación en Vermont era inferior al 1 por ciento.


El 13 de septiembre de 2021, la tasa de vacunación completa del país se situó por encima del 60 por ciento.

(Datos de Israel a través de Google.com enlace)

El mismo día, Israel registró 11.800 nuevos casos de Covid-19. Este fue un nuevo caso alto para el país en esta pandemia. En ese momento, Israel era un líder mundial en la administración de vacunas y se mantuvo como un ejemplo para el resto del mundo. Sin embargo, al mismo tiempo, la tasa de infección de Israel fue la más alta del planeta. La situación se volvió tan grave que la tasa de infección de Israel era más del 50 por ciento más alta que la del segundo país clasificado en esa métrica, Mongolia. En cuanto a la cuestión de la eficacia de la vacuna, es bastante revelador que Israel lidere el mundo tanto en vacunación como en infección.

El récord de septiembre de Israel superó en casi un 50% el máximo anterior del país de 7.305 casos publicado el 28 de enero de 2021. En el momento del máximo anterior, la tasa de vacunación en Israel era del 18,3%.


Hemos visto una y otra vez recuentos récord de casos en países y regiones con altas tasas de vacunación. Esto demuestra que la alta aceptación de la vacuna no reduce la incidencia de Covid 19.

Las vacunas no solo no reducen la incidencia de esta enfermedad, sino que también tienden a correlacionarse con su aumento. Como hemos visto anteriormente, varios países han experimentado aumentos sin precedentes justo después de lograr altas tasas de inoculación.

Los países con tasas de vacunación del 65 por ciento o más definitivamente no deberían estar en la pandemia ni sufrir aumentos repentinos. Sin embargo, lo hacen porque las infecciones «irruptivas» en los vacunados son ahora muy comunes y frecuentes. Sabemos a toda certeza que las vacunas no evitan que las personas se infecten. Esto fue confirmado en agosto por la directora de los CDC, Rochelle Walensky, quien admitió abiertamente en una entrevista con CNN que las vacunas pueden «prevenir la transmisión» por más tiempo.

Con la llegada del invierno, hay razones para estar profundamente preocupados, ya que las altas tasas de vacunación y la consiguiente explosión de casos se lograron, en su mayor parte, en el verano y principios del otoño, cuando el virus es débil. A medida que los países del hemisferio norte están entrando en la temporada de invierno y los recuentos de muertes siguen aumentando rápidamente, parece que estamos al borde de un período extremadamente difícil en los próximos meses.

Esta situación existe a pesar de que muchos países han alcanzado tasas de vacunación cercanas al 70 por ciento. La tasa media de vacunación completa de Europa, por ejemplo, se sitúa actualmente en el 65,5 por ciento, mientras que el 69,9 por ciento de los europeos han recibido al menos una inyección.

La alta aceptación de vacunas en Europa se encuentra dentro del rango de inmunidad colectiva especificado a principios de este año por el Dr. Fauci y otros expertos. Con tal tasa de inoculación, la pandemia debería estar, si no ha terminado, definitivamente bajo control. En cambio, está fuera de control.

Muchas naciones europeas, así como países de otras partes del mundo, están haciendo sonar la alarma e imponiendo una nueva ola de confinamientos.

Si las vacunas fueran incluso remotamente efectivas, esto nunca podría haber sucedido en territorios altamente vacunados.

Las vacunas no solo no han cumplido con su promesa, sino que los datos indican que en varios lugares han empeorado la situación al provocar aumentos repentinos.

Los datos demuestran claramente que las vacunas no tienen el efecto que se suponía que debían tener. Las cifras y gráficos anteriores proporcionan pruebas contundentes del fracaso de la vacuna.

Que los gobiernos persigan altas tasas de vacunación con las vacunas obviamente ineficaces es equivocado y contraproducente. También es altamente irresponsable y peligroso debido a los efectos secundarios extensos y severos de las vacunas.


Vasko Kohlmayer nació y creció en la antigua Checoslovaquia comunista. Puedes seguir sus escritos suscribiéndote a su boletín substack ‘Notes from the Twilight Zone’. Es autor de The West in Crisis: Civilizations and Their Death Drives

Fuente: https://www.globalresearch.ca/hard-data-shows-covid-vaccines-dont-work/5763136

Sacrificio masivo de niños a plena vista

[Hoy haré un juego de intercambio y prestidigitación atómico y supremo. En primer lugar aparecerá por arte de magia lo que debería estar atrás, en lugar secundario, casi escondido. Después viene lo que se suele llamar, la madre, el meollo de la cuestión. Este último y en segundo lugar es lo que me ha estimulado y percutido para copiar y pegar, y divulgar, con todo el respeto al artículo y al articulista y no por ello falto de autenticidad, lo que de verdad importa. Y recuerden, lo primero se escribió por lo segundo. Y aún así, diré, la Historia la movieron los segundones.] (LTC)

Comentario de un usuario al artículo:

Fidelios Automata dice:

«Primero, este descargo de responsabilidad no debería ser necesario, pero nunca condenaría a los judíos como pueblo, ya que han producido muchos individuos buenos y ejemplares. Dicho esto, parece obvio que el horrible trato de Israel a los palestinos está relacionado con la historia de sus progenitores hebreos. Con respecto al libelo de sangre, creo que la gran mayoría de las acusaciones eran falsas. Recuerde, esta era una época en la que la gente creía que las brujas podían volar por el aire en escobas. Sin embargo, los humanos tienen una capacidad casi ilimitada para el mal, estira la credulidad asumir que tales cosas NUNCA sucedieron».

El artículo: Sacrificio masivo de niños a plena vista


Varios comentaristas en línea han señalado que Covid escrito al revés se convierte en דיבוק en hebreo, que significa dybbuk, un espíritu poseedor malicioso.

Usando Google Translate, descubrí que divoc produjo דיבוק, pero ahora, Google ha jugado con דיבוק por lo que simplemente se traduce como «obsesionado». Muy lindo. Exorcizar, dybbuk es simplemente una pasión excesiva, ya ves, como un amor por el chocolate. Incluso las coincidencias verbales deben ser desinfectadas, para que la gente no tenga ideas.

Lejos de estar poseído por el Covid, con sus confinamientos, pasaporte con derecho a vivir y vacunas de coágulos, solo estás obsesionado con estar a salvo, eso es todo, por lo que tus hijos también deben ser inyectados con proteína espiga y células fetales, para destruir su sistema inmunológico y arruinar su fertilidad futura, si no matarlos.

En esta guerra covid, y definitivamente es una guerra, contra todos nosotros, la propaganda es masiva y constante, y cualquier cuestionamiento de ella se tilda inmediatamente como una «teoría de la conspiración». No se nos permite desafiar a aquellos que están conspirando contra nosotros.

Steve Kirsch pregunta: «¿Cómo van a explicar a todos los recién nacidos con problemas cardíacos?» A sus madres se les ha inyectado proteína espiga, pero no hay correlación, estamos seguros. La directora de los CDC, Rochelle Walensky, insiste en que la proteína espiga no solo es segura para las mujeres embarazadas, sino que es especialmente útil.

Dado que los adultos ya están muriendo por cientos de miles de «vacunas» Covid, e incluso los mejores atletas caen muertos en el campo, ¿por qué estos golpes letales no terminan de inmediato, sino que se extienden a los niños?

Investigando 13 casos de niños que murieron después de ser vacunados, Kirsch señala: «Mi análisis de los registros de VAERS mostró que 5 de los 13 murieron de paro cardíaco. Eso no es normal para los niños. En un período reciente de 5 años (2015 a 2019), ha habido cero muertes que enumeran el paro cardíaco en ese grupo de edad (como era de esperar). ¡Cero muertes en 5 años! Así que las 5 muertes son tanto excesivas como sospechosas y merecen una investigación. Pero no según los CDC».

En 2019, se descubrieron en Perú esqueletos de 227 víctimas de sacrificios, de entre cinco y 14 años. Un año antes, 200 esqueletos infantiles más habían sido desenterrados en otros dos sitios peruanos. Todos habían sido asesinados hace unos 550 años.

Ejemplos de sacrificio de niños se pueden encontrar mucho más cerca de casa. ¿Quién no está edificado, si no encantado, por la historia de Jefté y su hija?

Luchando contra los amonitas, Jefté pidió ayuda a Yahvé, con la promesa de que sacrificará como ofrenda quemada lo que salga por su puerta a su regreso victorioso.

Ciertamente es una promesa extraña, porque ¿no crees que un miembro de la familia era más probable que fuera el primero en saludarlo, incluso si es una oveja, si Jefté estaba durmiendo con una oveja?

Resultó ser su única hija, una hija.

Cuando su padre le dijo que tenía que asesinarla, para cumplir su promesa al Señor, esta niña anónima le pidió «dos meses para vagar por las colinas y llorar con mis amigos, porque nunca me casaré». Conmovedoramente, este «nunca se casará» se repite como un estribillo solo dos oraciones después.

Permitió esta breve suspensión de la ejecución, vagó por las colinas y lloró con sus amigos, antes de que su propio padre la quemara hasta la muerte. (Ver Jueces 11:30-40) Cada año, las hijas pequeñas de Israel pasan cuatro días conmemorando este horrible incidente.

Mucho más conocida es la historia de Abraham y su hijo, Isaac, por supuesto. De la nada, Dios le ordenó a Abraham que quemara a Isaac en una montaña, por lo que el judío obediente estuvo de acuerdo sin preguntas.

Lo que es más interesante para mí son los dos casos en los que Abraham mintió. Primero, les dijo a sus dos siervos que él e Isaac necesitaban ir a adorar, y que volverían. Luego le mintió a su hijo. Es escalofriante:

Abraham tomó la madera para la ofrenda quemada y la colocó sobre su hijo Isaac, y él mismo llevó el fuego y el cuchillo. Mientras los dos avanzaban juntos, Isaac habló y le dijo a su padre Abraham: «¿Padre?»

«¿Sí, hijo mío?» Abraham respondió.

«El fuego y la leña están aquí», dijo Isaac, «pero ¿dónde está el cordero para la ofrenda quemada?»

Abraham respondió: «Dios mismo proveerá el cordero para la ofrenda quemada, hijo mío». (Génesis 22:6-8)

Para matar, a menudo debes engañar.

En el sitio, Abraham ató a su hijo traicionado, puso al niño sobresaltado en la madera y sacó su cuchillo, luego Dios intervino.

Sometiendo a Abraham a tal prueba, un malvado Yahvé lo corrompió, porque Abraham estaba listo para asesinar a su hijo inocente. Yahvé también destruyó la confianza sagrada del niño en su padre, cuyo primer deber era proteger a su descendencia, obviamente. Ese no es mi Dios.

Algunos judíos, entonces, podían asesinar piadosamente a sus propios hijos, pero muchos, muchos más no se abstuvían de masacrar a los goyische. De hecho, tenían que hacerlo.

Discutiendo The Bloody Satanic Sacrifice Rituals of the Jewish Race de Ariel Toaff, Ron Unz escribe: «Parece que un número considerable de judíos asquenazíes tradicionalmente consideraban que la sangre cristiana tenía poderosas propiedades mágicas y la consideraban un componente muy valioso de ciertas observancias rituales importantes en fiestas religiosas particulares. Obviamente, la obtención de tal sangre en grandes cantidades estaba plagada de riesgos considerables, lo que aumentaba en gran medida su valor monetario, y el comercio de los viales de ese preciado bien parece haber sido ampliamente practicado. Toaff señala que dado que las descripciones detalladas de las prácticas de asesinato rituales judías se describen de manera muy similar en lugares ampliamente separados por geografía, idioma, cultura y período de tiempo, es casi seguro que son observaciones independientes del mismo rito. Además, señala que cuando los judíos acusados eran capturados e interrogados, a menudo describían correctamente oscuros rituales religiosos que no podrían haber sido conocidos por sus interrogadores gentiles, que a menudo ocultaban detalles menores. Por lo tanto, era muy poco probable que estas confesiones hubieran sido inventadas por las autoridades».

El asesinato en masa de goyim, incluidos los bebés, ha sido sancionado durante mucho tiempo por Yahweh. Aquí hay algunos ejemplos de rizo de sangre en la Biblia hebrea:

Esto es lo que dice el Señor Todopoderoso: ‘Castigaré a los amalecitas por lo que le hicieron a Israel cuando los dejaron paso cuando vinieron de Egipto. Ahora vete, ataca a los amalecitas y destruye totalmente todo lo que les pertenece. No los perdones; ejecutados hombres y mujeres, niños y lactantes, bovinos y ovinos, camellos y burros.» (1 Samuel 15:2-3)

El pueblo de Samaria debe cargar con su culpa, porque se han rebelado contra su Dios. Caerán por la espada; sus pequeños serán lanzados al suelo, sus mujeres embarazadas rasgadas». (Oseas 13:16)

Como una gacela cazada, como ovejas sin pastor, todos volverán a su propio pueblo, huirán a su tierra natal. Quienquiera que sea capturado será empujado a través; todos los que sean atrapados caerán por la espada. Sus bebés serán des pedazos ante sus ojos; sus casas serán saqueadas y sus esposas violadas. (Isaías 13:14-16)

Hay más, pero entiendes la idea. El último es Yahvé furioso contra los babilonios, cuyas mujeres, según esta divinidad judía, merecían ser violadas en masa.

Tanto gore y grimness. Es hora de un descanso musical judío, «Hija Babilonia, condenada a la destrucción, feliz es la que te paga de acuerdo con lo que nos has hecho. Feliz es el que se apodera de tus bebés y los arroja contra las rocas». (Salmo 137:8-9)

Si bien ciertamente hay sabiduría y poesía en la Biblia hebrea, especialmente en Eclesiastés, Jonás y Job, demasiado de ella está enferma. Además, estos no son relatos históricos sino leyendas, con recientes descubrimientos arqueológicos en Israel que refutan el Éxodo de Egipto y el Reino de Salomón, etc. (Para obtener más información, lea La invención del pueblo judío de Shlomo Sand).

Aunque falsas, las leyendas preciadas revelan mucho sobre la psicología de un pueblo. Para facilitar el escape ficticio de los judíos de Egipto, «A medianoche el Señor derribó a todos los primogénitos en Egipto, desde el primogénito del Faraón, que se sentó en el trono, hasta el primogénito del prisionero, que estaba en la mazmorra, y el primogénito de todo el ganado también». (Éxodo 12:29)

Repetidamente, se nos recuerda, si tan solo prestamos atención, los judíos adoran a un Dios genocida.

«Jesús dijo a [los judíos]: ‘Si Dios fuera tu Padre, me amarías, porque he venido aquí de Dios. No he venido solo; Dios me envió. ¿Por qué mi lenguaje no es claro para ti? Porque eres incapaz de escuchar lo que digo. Perteneces a tu padre, el diablo, y quieres llevar a cabo los deseos de tu padre. Fue un asesino desde el principio, sin aferrarse a la verdad, porque no hay verdad en él. Cuando miente, habla su lengua materna, porque es un mentiroso y el padre de las mentiras». (Juan 8:42-48)

Con tantas pistas, uno no puede evitar preguntarse si la «vacuna» Covid no es solo el último y más ambicioso episodio de asesinato ritual judío, aunque, por supuesto, también hay muchos goyim satánicos o de Shabat que se unen.

La corriente principal controlada por los judíos y las redes sociales son ciertamente uniformes en el empuje de este genocidio. Así es como expiamos su Holocausto, en su mayoría mítico.

Dado que su Dios es tan vengativo, la venganza nunca está lejos de sus mentes.

El último libro de Linh Dinh es Postcards from the End of America.

Fuente: https://www.unz.com/ldinh/mass-child-sacrifice-in-plain-sight/

Inyección letal: Doctores dan escalofriantes relatos de enfermedades inusuales inducidas por las vacunas Covid. (Por favor, ¡despierten!)

MIKE WHITNEY / https://www.unz.com/

«Los estadounidenses están muertos de miedo… La gente está saliendo del trabajo, no porque quieran perder sus trabajos, ¡pero no quieren morir por la vacuna! … Dicen: ‘Escucha, no quiero morir. Esa es la razón por la que no estoy tomando la vacuna». Así de claro». Dr. Peter McCullough

Un informe en el U.K. Telegraph explica cómo la vacuna Covid-19 ha llevado a un fuerte aumento en el exceso de muertes. Aquí hay un extracto del artículo:

«Casi 10.000 personas más de lo habitual han muerto en los últimos cuatro meses por razones no Covid, ya que los expertos pidieron una investigación urgente del gobierno sobre si las muertes eran prevenibles…

Las últimas cifras de la Oficina de Estadísticas Nacionales mostraron que Inglaterra y Gales registraron 20.823 muertes más que el promedio de cinco años en las últimas 18 semanas. Solo 11.531 muertes involucraron Covid». («La alarma crece a medida que las morgues se llenan con miles de muertes adicionales no Covid», UK Telegraph)

La mortalidad está aumentando porque más personas están muriendo. Y más personas están muriendo porque más personas han sido vacunadas. Existe un vínculo entre el aumento de la mortalidad y la vacuna contra el Covid-19. Naturalmente, los medios de comunicación quieren trasladar la responsabilidad de las muertes a «tratamientos retrasados» y «la falta de atención prevenible». Pero esto es solo una distracción. La causa principal de muerte es la inyección de un patógeno tóxico en el torrente sanguíneo de aproximadamente el 70% de la población. Eso es lo que está causando la coagulación, el sangrado, las embolias pulmonares, los ataques cardíacos, los accidentes cerebrovasculares y las muertes prematuras. Es la vacuna. Aquí hay más

«Las cifras semanales para la semana que terminó el 5 de noviembre mostraron que hubo 1.659 muertes más de lo que normalmente se esperaría en esta época del año. De ellos, 700 no fueron causados por Covid.

Es probable que el exceso crezca a medida que se registren más muertes en las próximas semanas.

Los datos de la Agencia de Seguridad Sanitaria del Reino Unido muestran que ha habido miles de muertes más que el promedio de cinco años en insuficiencia cardíaca, enfermedades cardíacas, afecciones circulatorias y diabetes desde el verano.

El número de muertes en hogares particulares también está un 40,9 por ciento por encima del promedio de cinco años, con 964 muertes en exceso registradas en la semana más reciente, que se extiende hasta el 5 de noviembre. («La alarma crece a medida que las morgues se llenan con miles de muertes adicionales no Covid», UK Telegraph)

El repentino aumento de la mortalidad no es un error sin sentido en el radar. Es una señal de alerta que indica una ruptura significativa en la tendencia de cinco años. Algo ha ido terriblemente mal. Se suponía que la vacunación masiva reduciría el número de casos, hospitalizaciones y muertes. En cambio, las muertes continúan aumentando.

¿Por qué?

La respuesta a esa pregunta se puede encontrar en los propios datos. Como admite el autor, ha habido un fuerte aumento en la insuficiencia cardíaca, las enfermedades cardíacas, las afecciones circulatorias y los accidentes cerebrovasculares. (La diabetes es el valor atípico) Estas son precisamente las dolencias que uno esperaría ver si uno acabara de inyectar a millones de personas con un biológico generador de coágulos que desencadena una respuesta inmune violenta que ataca el revestimiento interno de los vasos sanguíneos infligiendo un daño severo a la infraestructura crítica del cuerpo. Entonces, sí, la mortalidad por todas las causas ha aumentado, y es seguro que subirá aún más a medida que más personas se vacunen y sucumban gradualmente a los efectos (frecuentemente) tardíos de un brebaje híbrido que es la piedra angular de un plan maligno para reducir drásticamente la población mundial. Echa un vistazo a esta tabla seguida de un breve comentario de la patóloga de diagnóstico, la Dra. Claire Craig:

Dra. Clare Craig @ClareCraigPath

«Desde el verano ha habido el doble de muertes por covid, pero siete veces más muertes en exceso que el año pasado».

Y aquí hay otro anuncio de Craig:

«Si comienzas en la semana 22 y sumas todas las muertes desde entonces para cada año, entonces algo muy anormal está sucediendo este año entre los hombres de 15 a 19 años».

Por lo tanto, no solo están muriendo más personas, sino que la demografía se ha desplazado hacia abajo a medida que las personas cada vez más jóvenes se ven atraídas al vórtice de la vacuna. En pocas palabras, el número de jóvenes que mueren por un paro cardíaco infligido por la vacuna y miocarditis continúa aumentando sin un final a la vista.

No es sorprendente que la mortalidad por todas las causas sea mayor entre los vacunados que entre los no vacunados, lo que, una vez más, hace que sea más fácil rastrear el problema hasta su raíz, una «vacuna contra la muerte por veneno» citotóxica que suprime el sistema inmunológico innato, daña los órganos vitales y afeita años de la vida de las personas normales y sanas.

Tal vez, haya visto uno de los muchos videos cortos de atletas jóvenes en forma que de repente han caído muertos en el campo de juego o han sido llevados al hospital poco después de recibir la inyección. Si no, aquí hay un enlace a dos de ellos. (Los atletas colapsan después de la vacunación: Ver aquí y aquí)

Según Las noticias israelíes en tiempo real, ha habido un «aumento del 500% en las muertes de jugadores en 2021 … ¡Desde diciembre, 183 atletas y entrenadores profesionales se han derrumbado repentinamente! ¡108 de ellos murieron!»

«Aumento del 500% en las muertes» de atletas?!? ¿Qué vamos a hacer con esto?

Para empezar; la vacuna contra el Covid-19 no es un medicamento. Es el componente esencial en el plan elitista para el exterminio a escala industrial. Está diseñado para infligir lesiones físicas graves a las personas que lo toman. Es impactante que las personas estén tan profundamente en negación que no pueden ver lo que está sucediendo justo ante sus ojos. (Por favor, miren los videoclips de los atletas. Estas son las personas más acondicionadas del planeta y, sin embargo, están siendo golpeadas por la sustancia misteriosa de la vacuna). Así es como el médico sudafricano Shankara Chetty lo resumió en un video reciente publicado en Bitchute:

«El patógeno que está causando todas las muertes por la enfermedad es la proteína espiga. Y la proteína espiga es lo que se supone que la vacuna debe hacer en su cuerpo. … La proteína espiga es uno de los venenos más artificiales que el hombre ha hecho. Y, el objetivo de esta toxina, es matar a miles de millones de personas sin que nadie se dé cuenta. Así que es un veneno con una agenda». («El médico sudafricano Dr. Shankara Chetty habla sobre «El plan más grande», Bitchute)

Ahí está en pocas palabras. Y Chetty no es el único que vincula la vacuna a la agenda de las élites globalistas que planean usar la cobertura de una pandemia para implementar su esquema de «gestión de la población». El ex vicepresidente de Pfizer, Mike Yeadon, ofreció una opinión similar hace unos días en su sitio web. Él dijo:

«Estamos en medio del programa de despoblación más grande que el mundo haya visto, donde la mayoría de la humanidad está actuando como idiotas útiles para él y para su propia desaparición».

De hecho, y hemos tratado de proporcionar la mayor cantidad de información posible sobre el agente biológico que se está utilizando para perseguir esta agenda maligna, la proteína espiga. En los primeros informes, transmitimos la investigación del Dr. Patrick Whelan, quien comprendió el peligro de la proteína espiga antes que nadie. Aquí hay un breve resumen de su análisis de una carta que presentó a la FDA el 8 de diciembre de 2020:

«Me preocupa la posibilidad de que las nuevas vacunas destinadas a crear inmunidad contra la proteína espiga del SARS-CoV-2 tengan el potencial de causar lesiones microvasculares en el cerebro, el corazón, el hígado y los riñones de una manera que actualmente no parece evaluarse en los ensayos de seguridad de estos medicamentos potenciales.

… Meinhardt et al…. muestran que la proteína espiga en las células endoteliales cerebrales se asocia con la formación de microtrombos (coágulos)… En otras palabras, las proteínas virales parecen causar daño tisular sin replicar activamente el virus. La vacuna de Pfizer/BioNTech (BNT162b2) está compuesta por un ARNm que produce una proteína espiga de longitud completa anclada a la membrana. Los estudios en ratones sugieren que una forma no autenticada de la proteína S1 como esta puede causar una microvasculopatía en los tejidos que expresan mucho receptor ACE2.

… parece que la proteína espiga viral … es también uno de los agentes clave que causan el daño a órganos distantes que pueden incluir el cerebro, el corazón, los pulmones y los riñones. Antes de que cualquiera de estas vacunas sea aprobada para su uso generalizado en humanos, es importante evaluar en sujetos vacunados los efectos de la vacunación en el corazón. Tan importante como es detener rápidamente la propagación del virus inmunizando a la población, sería mucho peor si cientos de millones de personas sufrieran daños duraderos o incluso permanentes en su microvasculatura cerebral o cardíaca como resultado de no apreciar a corto plazo un efecto no deseado de las vacunas basadas en proteínas de espiga de longitud completa en estos otros órganos. («La FDA se encoge de hombros ante la terrible advertencia sobre la proteína espiga letal», Truth in the Age of Covid)

Desde el principio, los reguladores gubernamentales y sus aliados en el establecimiento de la salud pública han ignorado (o censurado) las advertencias de médicos e investigadores capaces. También despidieron al inmunólogo y vacunólogo de carrera, el Dr. Byram Bridle, quien fue el primero en su profesión en identificar la proteína espiga como «un agente causal específico de la enfermedad»; «un patógeno». Aquí está Bridle:

«‘Hemos sabido durante mucho tiempo que la proteína espiga es patógena … Es una toxina. Puede causar daño en nuestro cuerpo si está en circulación. Ahora, tenemos evidencia clara de que… la vacuna en sí, más la proteína, entra en circulación sanguínea».

Una vez que eso sucede, la proteína espiga puede combinarse con receptores en las plaquetas sanguíneas y con células que recubren nuestros vasos sanguíneos. Es por eso que, paradójicamente, puede causar tanto coagulación de la sangre como sangrado. «Y, por supuesto, el corazón está involucrado, como parte del sistema cardiovascular … Es por eso que estamos viendo problemas cardíacos. La proteína también puede cruzar la barrera hematoencefálica y causar daño neurológico.

«En resumen,… cometimos un gran error. No nos dimos cuenta hasta ahora. No nos dimos cuenta de que al vacunar a las personas las estamos inoculando inadvertidamente con una toxina». … («Científico de vacunas: ‘Hemos cometido un gran error'», Mujer conservadora)

Una vez más, tenemos a un inmunólogo de gran consideración, con más de 3 décadas de experiencia en su haber, que ofreció su investigación informada y basada en la evidencia sobre un tema que debería haber sido de gran interés para los reguladores que estaban tomando decisiones sobre la seguridad a largo plazo del medicamento experimental que estaban imponiendo a millones de personas en todo el país. Pero no había interés en absoluto. A pesar del hecho de que la ciencia apoyó sus conclusiones, Bridle fue brutalmente atacado, censurado, arrastrado por el barro y obligado a abandonar su lugar de trabajo.

¿Por qué?

Porque sacó las mismas conclusiones que el Dr. Patrick Whelan. Realmente no hay una diferencia sustantiva entre los dos, excepto que los comentarios de Bridle atrajeron más atención en los medios de comunicación, lo que lo convirtió en una mayor amenaza para la estrategia de «vacunación universal». Ese fue su verdadero crimen; descubrió la verdad y puso sus hallazgos a disposición del público, básicamente alertándolos sobre los peligros del «disparo de muerte por veneno». Por eso fue aplastado.

Desde entonces, Bridle ha hecho otras afirmaciones que deberían preocupar a cualquier persona cuyo cáncer pueda estar en remisión. Esto es lo que dijo en una entrevista reciente:

«Lo que he visto demasiado es gente que tenía cánceres que estaban en remisión, o que estaban siendo bien controlados; sus cánceres se han salido completamente de control después de recibir esta vacuna. Y sabemos que la vacuna causa una caída en el número de células T, y esas células T son parte de nuestro sistema inmunológico y son parte de las armas críticas que nuestro sistema inmunológico tiene para combatir las células cancerosas; así que hay un mecanismo potencial allí. Todo lo que puedo decir es que he tenido demasiadas personas que me contactan con estos informes para que me sienta cómodo. Diría que esa es mi mayor preocupación de seguridad más reciente, y también es la que va a ser la más poco informada en la base de datos adversa, porque si alguien ha tenido cáncer antes de la vacuna, no hay forma de que los funcionarios de salud pública lo vinculen con la vacuna». («Dr Byram Bridle habla», Bitchute, :55 segunda marca)

Entonces, ¿la vacuna suprime el sistema inmunológico?

Sí, lo hace, y el autor Alex Berenson proporcionó evidencia de esto recientemente en un artículo que publicó en Substack. Aquí hay un extracto:

«… el gobierno británico… admitió hoy, en su informe más reciente de vigilancia de vacunas, que:

«Los niveles de anticuerpos N parecen ser más bajos en las personas que adquieren la infección después de dos dosis de vacunación». (Página 23)

¿Qué significa esto?…

Lo que los británicos están diciendo es que ahora están descubriendo que la vacuna interfiere con la capacidad innata de su cuerpo después de la infección para producir anticuerpos no solo contra la proteína espiga sino contra otras piezas del virus.

Esto significa que las personas vacunadas serán mucho más vulnerables a las mutaciones en la proteína espiga INCLUSO DESPUÉS DE HABER SIDO INFECTADAS Y RECUPERADAS UNA VEZ

… probablemente sea aún más evidencia de que las vacunas pueden interferir con el desarrollo de una inmunidad robusta a largo plazo después de la infección». («URGENTE: Las vacunas Covid le impedirán adquirir inmunidad completa INCLUSO SI ESTÁ INFECTADO Y SE RECUPERA», Alex Berenson, Substack)

Las observaciones de Berenson cuadran con la investigación que fue compilada a principios de año por científicos de los Países Bajos y Alemania que:

«…advirtió que el … La vacuna (COVID-19) induce una reprogramación compleja de las respuestas inmunes innatas que deben considerarse en el desarrollo y uso de vacunas basadas en ARNm… el equipo de investigación del Centro Médico de la Universidad de Radboud y Erasmus MC en los Países Bajos… mostró que la vacuna alteró la producción de citoquinas inflamatorias por parte de las células inmunes innatas después de la estimulación con estímulos específicos (SARS-CoV-2) e inespecíficos.

Después de la vacunación, las células inmunes innatas tuvieron una respuesta reducida al receptor tipo toll 4 (TLR4), TLR7 y TLR8, todos ligandos que desempeñan un papel importante en la respuesta inmune a la infección viral. un área inexplorada es si la vacunación BNT162b2 tiene efectos a largo plazo sobre las respuestas inmunes innatas 

Esto podría ser muy relevante en COVID-19, en el que la inflamación desregulada juega un papel importante en la patogénesis y la gravedad de la enfermedad», escribe el equipo. «Múltiples estudios han demostrado que las respuestas inmunes innatas a largo plazo pueden aumentar (inmunidad entrenada) o regularse a la baja (tolerancia inmune innata) después de ciertas vacunas o infecciones». (La investigación sugiere que la vacuna Pfizer-BioNTech COVID-19 reprograma las respuestas inmunes innatas, nueva red médica)

El hallazgo de Berenson también se alinea con la investigación de vanguardia que muestra que la proteína espiga «impide en gran medida la inmunidad adaptativa» al evitar que el ADN repare las células dañadas. El documento sugiere que la proteína espiga de hecho «impacta en el núcleo de la célula, donde almacenamos nuestro ADN, nuestro material genético central». Aquí hay más del desglose de Berenson del documento:

«…. nuestras células tienen mecanismos para reparar su propio ADN.

Pero, al menos en los experimentos que estos dos científicos realizaron, la proteína espiga parecía interferir con nuestras propias proteínas de reparación del ADN: «Mecánicamente, descubrimos que la proteína espiga se localiza en el núcleo e inhibe la reparación del daño del ADN al impedir el reclutamiento clave de la proteína de reparación del ADN BRCA1 y 53BP1 en el sitio del daño».

Para ser claros, los científicos NO probaron que la proteína espiga estuviera causando estos problemas en personas, o incluso animales … Sin embargo, en un momento en que los países avanzados que tienen altas tasas de vacunación de ARNm (y ADN / AAV) están viendo hospitales inusualmente llenos y tasas de mortalidad más altas de lo normal, son aún más motivo de preocupación. Como explicaron los

autores: «Nuestros hallazgos revelan un mecanismo molecular potencial por el cual la proteína espiga podría impedir la inmunidad adaptativa y subrayar los posibles efectos secundarios de las vacunas basadas en espigas de longitud completa». («URGENTE: Artículo preocupante sobre el impacto de la proteína espiga en el ADN y la reparación del ADN», Alex Berenson, Substack)

En pocas palabras: si la vacuna de hecho inhibe la respuesta inmune innata del cuerpo, entonces las personas se enferman mucho más por las infecciones estacionales que se propagan rutinariamente a través de la población. Su camino hacia la recuperación también será mucho más difícil.

Pero más bien que se trata del ángulo de inmunidad, pasemos a la investigación del Dr. Charles Hoffe, quien fue el primer médico en proporcionar pruebas sólidas de que las vacunas generan coágulos sanguíneos al desencadenar una respuesta inmune en la que el cuerpo ataca la capa delgada de células que recubren las paredes de los vasos sanguíneos. Hoffe encontró que el 62% de sus pacientes que habían sido vacunados dieron positivo para coágulos de sangre en una prueba de dímero D. Naturalmente, estaba alarmado por lo que encontró, particularmente porque la vacuna «estaba causando eventos neurológicos graves, e incluso la muerte. Cuando planteó sus preocupaciones al Colegio de Médicos de Columbia Británica, inmediatamente implementaron una orden de mordaza y lo reprendieron en un intento de intimidarlo y silenciarlo».

Hoffe ha sido entrevistado varias veces y siempre proporciona un relato detallado y fascinante de sus hallazgos. En una entrevista reciente, predijo que algunos vacunados que sufren de problemas relacionados con coágulos probablemente morirían en solo tres años. Esto es lo que dijo:

«… una vez que bloquea un número significativo de vasos sanguíneos a los pulmones, el corazón debe bombear a una resistencia mucho mayor para que la sangre pase a través de los pulmones. Eso causa una afección llamada hipertensión de la arteria pulmonar, que es la presión arterial alta en los pulmones porque muchos de los vasos sanguíneos de los pulmones están bloqueados. Y lo aterrador de esto es que las personas con hipertensión arterial pulmonar generalmente mueren de insuficiencia cardíaca del lado derecho en tres años … Y no solo el panorama a largo plazo es muy sombrío, sino que con cada disparo sucesivo, el daño agregará y agregará y agregará. Va a ser acumulativo porque cada vez se dañan más los capilares». («Shock: El médico advierte que la mayoría de los pacientes vacunados podrían tener daño cardíaco permanente, algunos pueden morir dentro de tres años «Daño cardíaco permanente, algunos pueden morir dentro de tres años», infowars; Minuto 6:10)

Una vez más, no hay discrepancia entre el análisis de Whelan, Bridle y Hoffe. Y aunque el foco de su atención puede variar ligeramente, sus conclusiones son las mismas. Estas inyecciones experimentales plantean graves riesgos para cualquier persona que se permita ser inoculada.

Ahora vea cuán similar es el análisis de Hoffe a la Dra. Rochagne Kilian, quien era médica de la sala de emergencias en el hospital GBHS hasta que renunció en protesta. Este es un video particularmente importante, ya que describe los síntomas «extraños» y las condiciones extremadamente raras que ahora se presentan en las salas de emergencia en todas partes después de la vacunación masiva de millones de personas con la «vacuna contra la muerte por veneno». (Transcribí el video yo mismo, por lo que podría haber errores).

Dr. Rochagné Kilian – Hace sonar el silbato sobre las vacunas Covid-19 y los niveles de dímero dímero D

«Lo que estaba viendo en mi departamento de urgencias, especialmente en los últimos 8 a 9 meses, está relacionado con los niveles de dímero dímero. Utilizamos D-Dimers específicamente relacionados con embolias pulmonares, así como trombosis venosa profunda. D-Dimer detecta cualquier trombosis (coágulos) en el cuerpo, pero no le da un diagnóstico, le da una base para ir más allá y hacer una ecografía y una tomografía computarizada para confirmar o negar la presencia de una embolia pulmonar o trombosis venosa profunda.

La primera parte de 2020 fue probablemente la más lenta en el departamento de emergencias, pero cuando entramos en 2021 y comenzó el despliegue de la vacunación, terminamos viendo un aumento en el accidente cerebrovascular, los ataques isquémicos transitorios y las presentaciones similares a los accidentes cerebrovasculares. (Hubo) definitivamente un número significativamente mayor de esas personas que entraron. Terminé haciendo pruebas de dímero D en estas personas y nunca antes en mi experiencia clínica había visto dímeros D y la cantidad de personas con dímeros D positivos superiores a 2,000, superiores a 3,000 y superiores a 5,000. Mi experiencia clínica me dijo que era necesario ir a buscar un coágulo grande en sus piernas o en sus pulmones. Y terminé haciendo una tomografía computarizada a estas personas. La mayoría de ellos, y diré que casi todos, tenían escáneres negativos que comenzaron a hacerme pensar que si no había un coágulo significativo en sus pulmones, pero mi dímero D era mucho más alto de lo que solía ver, podría no estar concentrado en un coágulo. Pero que se trata de múltiples micro-trombos extendidos por todo el cuerpo, y eso es tan fácil de pasar por alto porque la tomografía computarizada no lo va a recoger.

«Estas personas que ingresaron a la ER eran todas personas desde aproximadamente una semana hasta cuatro meses después de recibir sus 2ª inyecciones. Hay ciertos factores que pueden influir en una prueba de dímero D que puede darle una sensación de un nivel más alto de lo que se esperaría en el cuerpo. Dicho esto, los pacientes en los que estaba haciendo pruebas de Dímero D no tenían un nivel de tal vez una lectura positiva de 500 o 400. Eran más de 3500, más de 5000 ng/ml. Por lo tanto, esos son significativamente positivos sin ninguna prueba de tener una embolia pulmonar. Si estaba viendo altos niveles de dímero D sin un diagnóstico definido, necesitaba hacer más preguntas.

Un estudio dijo que nunca ignore los niveles extremadamente elevados del dímero D. Son específicos para enfermedades graves, incluyendo trombosis venosa, sepsis y / o cáncer. Incluso si el dímero D fuertemente elevado es un hallazgo aparentemente solitario, se debe mantener la sospecha clínica de enfermedad subyacente grave.

Hubo dos afecciones que destacaron y la primera fue la coagulación intravascular diseminada también conocida como CID. El segundo es el síndrome antifosfolípido. Ambas condiciones están relacionadas con una anormalidad en el inicio o la retroalimentación de la vía de coagulación, así como la trombosis o el ciclo de trombosis donde se descomponen los coágulos. La CID es una situación grave a veces potencialmente mortal en la que las proteínas en la sangre involucradas en la coagulación de la sangre se vuelven hiperactivas. Es una cascada que es difícil de detener una vez que ha alcanzado un cierto nivel. Hay ciertas condiciones que desencadenan dic; sepsis significativa, virus subyacentes, traumatismos, cirugía mayor, embarazo y parto. Y menos común causa reacción tóxica a medicamentos, reacción a transfusiones de sangre y trasplantes de órganos. Así que hubo una conexión con los productos intravasculares y una posible CID.

La mayoría de los casos de CID se diagnostican rápida y repentinamente, que es la presentación aguda. Pero hay casos en los que se desarrolla gradualmente, ocurriendo durante un período de tiempo más largo. Esto se conoce como una forma crónica de DIC y yo iría tan lejos como para decir una forma subaguda de DIC que es muy fácil de pasar por alto. La coagulación y el sangrado simultáneos pueden ocurrir con la CID crónica. La parte sangrante viene en sangre en la orina, dolores de cabeza y otros síntomas asociados con hemorragias cerebrales, moretones, inflamación de rojo, pequeños puntos en las extremidades, sangrado en los sitios de las heridas y sangrado de la mucosa. lo que significa sangrado de las encías y la nariz. Definitivamente vi un aumento en las hemorragias nasales y el sangrado de los sitios de heridas anteriores. úlceras, así como erupciones cutáneas que no se podían explicar. Los síntomas y signos de coagulación de la sangre fueron síntomas como dolores en el pecho, ataques cardíacos, accidentes cerebrovasculares, AIOS y dolores de cabeza relacionados con el sangrado o no. Así como síntomas relacionados con la insuficiencia renal, debido a la coagulación de esos vasos sanguíneos más pequeños que van a los riñones. El síndrome antifosfolípido es un tipo de afección muy similar. Pero la base del síndrome antifosfolípido es un trastorno autoinmune que significa que el sistema inmunitario del cuerpo produce proteínas, conocidas como anticuerpos, que atacan por error a su propio cuerpo o tejidos. Eso le da a la piel el efecto en cascada del trastorno de la coagulación, pero está relacionado con un desencadenante autoinmune. Básicamente, se presentó exactamente de la misma manera; presión arterial alta que estaba viendo mucho; primer diagnóstico de presión arterial alta, ataques cardíacos, accidentes cerebrovasculares, AIOS, problemas de válvulas cardíacas, dolores de cabeza o migrañas repetidos, pérdida de la visión, problemas de equilibrio y movilidad, dificultad para concentrarse o pensar con claridad,

El oyente astuto comenzaría a formarse una imagen de lo que nos han dicho sobre Covid-19, y hay trabajos de investigación que conectan Covid 19 con una enfermedad vascular subyacente. Uno de ellos fue un estudio llamado «Covid 19; desentrañando la progresión clínica del arma biológica virtualmente perfecta de la naturaleza».

«El SARS-Cov-2, que se presenta como síndrome covid-19, no era una base respiratoria, sino una base vascular subyacente. que tuvo ciertas fases de incubación, fase pulmonar, fase proinflamatoria, (que una vez más entra en un proceso de inflamación citotóxica) luego pasa a una fase prototrombina. El Covid-19 es una enfermedad trombótica. implicaciones para la prevención, la terapia antitrombótica y el seguimiento…..

Este cuadro nos muestra ciertos factores de riesgo, anomalías homeostáticas, así como resultados clínicos. Indica un aumento de los niveles de dímero D. También menciona el tromboembolismo venoso, el infarto de miocardio y la coagulación intravascular diseminada que está relacionada con los mecanismos postulados de la coagulación, así como la partenogénesis de la trombosis en Covid-19 …

Comencé a hacer la pregunta, si somos capaces de detectar ciertas conexiones entre las anomalías vasculares y el Covid-19, y basamos nuestro tratamiento propuesto en la proteína espiga, que incluye las inyecciones de Pfizer y Moderna, ¿no deberíamos estar buscando efectos secundarios o complicaciones similares de esa misma inyección?

Si estamos exigiendo ciertos tratamientos, necesitamos hacer la debida diligencia para asegurarnos de cuáles son los efectos secundarios y las complicaciones, especialmente en un momento en que no ha habido estudios a largo plazo». Y eso es lo que me llevó a centrarme en los dímeros D». («Dr Rochagné Kilian – Blows the Whistle on Covid-19 Vaccines and D-Dimer Levels«, Bitchute)

La declaración de Kilian debe leerse una y otra vez. Es la descripción más detallada que tenemos de las misteriosas y profundamente siniestras maquinaciones de un arma biológica diseñada en laboratorio que, en efecto, vuelve los sistemas vascular e inmunológico contra la persona que fue vacunada. La coagulación intravascular diseminada y el síndrome antifosfolípido son nombres que son completamente desconocidos para el pueblo estadounidense, y sin embargo, estas condiciones extrañas ahora son responsables de un número creciente de pacientes que experimentan sangrado, coagulación, dolores de cabeza, erupciones cutáneas, moretones, presión arterial alta e inflamación. Y, en casos más extremos, dolores en el pecho, ataques cardíacos, accidentes cerebrovasculares, problemas de válvulas cardíacas y hemorragias cerebrales. Uno solo puede adivinar cómo los medios de comunicación tratarán de encubrir estas condiciones extraordinariamente raras y potencialmente mortales.

Cuando Kilian pregunta:

«Si somos capaces de detectar ciertas conexiones entre las anomalías vasculares y el Covid-19… ¿No deberíamos estar buscando efectos secundarios o complicaciones similares de esa misma inyección?»

¡Bingo! Si la proteína espiga producida por las vacunas inflige el mismo daño interno que el Covid-19, ¿no deberían los médicos esperar ver los mismos síntomas?

Sí, deberían. Y si los síntomas son los mismos, entonces hay una buena probabilidad de que las lesiones inducidas por la vacuna se diagnostiquen erróneamente como Covid-19.

Piensa en eso por un minuto. Ese sería el escenario perfecto para los gerentes de la pandemia y sus patrocinadores multimillonarios a quienes les encantaría ver la inminente montaña de carnicería atribuida al virus menguante en lugar de a su propia vacuna de muerte por veneno.

Y ese es el genio malvado de la estrategia globalista; para extraer las huellas dactilares de la pistola humeante antes de que los investigadores lleguen a la escena del crimen.

La cantidad de planificación que debe haber entrado en esta estafa, es simplemente impresionante.

Fuente: https://www.unz.com/runz/lethal-injection-frontline-e-r-doctor-gives-chilling-account-of-unusual-vaccine-induced-illness/

¿Qué sucede cuando las vacunas comienzan a ser contraproducentes?

Hay mucha gente por ahí que está preocupada por la aparición de alguna nueva variante del SARS-COV2 que evada las vacunas. Además, hay personas que sugieren que esto no es motivo de preocupación: simplemente encontraremos una nueva vacuna contra esta nueva variante. Pero tengo la impresión de que a todo el mundo parece que le falta algo.

«Si aparece una nueva variante que evade las vacunas, simplemente desplegaremos una nueva vacuna contra esa cepa» es una mala línea de razonamiento, porque no hay una sola forma particular de evadir nuestra respuesta de anticuerpos, hay numerosas. Lo que estamos presenciando es que cada nueva subesta de Delta está evolucionando a su manera única, para replicarse en nuestros cuerpos a pesar de la presencia de nuestros anticuerpos.

Si está esperando un momento en el que anuncien que «se ha detectado una nueva cepa en Manchester que es totalmente resistente a las vacunas y pronto reemplazará a todas las demás cepas», entonces eso probablemente no sucederá. Más bien, va a ser más de lo habitual. Con cada bit de información publicada, encontrará que cada vez más personas vacunadas sufren infecciones irruptivas y hospitalización.

De hecho, con la evidencia disponible para nosotros ahora, podemos decir que las vacunas no han logrado proteger al grupo demográfico exacto que se suponía que debían proteger: los ancianos. Los ancianos vacunados siguen teniendo menos probabilidades de morir per cápita que los ancianos no vacunados en el futuro previsible, simplemente porque menos del 10% de las personas mayores en Europa occidental que permanecen sin vacunar generalmente tienen una salud más pobre: son principalmente minorías étnicas y personas que viven en la pobreza o el aislamiento.

Podemos observar la mortalidad acumulada no COVID en ancianos británicos para ver qué está pasando:


Si observa esto, notará que los ancianos vacunados mayores de 70 años tienen aproximadamente un 55% menos de probabilidades de morir que los ancianos no vacunados, por causas no COVID. Y aquí tienes la tabla más reciente de las tasas de mortalidad por COVID para las personas mayores:

Para el grupo de más de 80 años en particular, queda claro que el riesgo de muerte no COVID muestra un patrón idéntico al riesgo de muerte por COVID. Mientras ese siga siendo el caso, las autoridades nunca tendrán que admitir que las vacunas fallaron: aún podrán señalar algún gráfico que dice que los ancianos vacunados tienen un 50% más o menos de probabilidades de muerte en comparación con aquellos que no fueron vacunados.

Con las medidas de intimidación que se están tomando actualmente contra las personas no vacunadas, están eliminando a las últimas personas sanas del grupo demográfico no vacunado: si no puedes salir a un pub o un restaurante y no puedes mantener un trabajo sin ser vacunado, ¿qué tipo de personas se ven obligadas a vacunarse? Personas no vacunadas con una vida social activa y saludable, que trabajan en un trabajo regular.

El tipo de personas que no se verán obligadas a pasar por estas medidas para vacunarse son las personas que están desempleadas debido a enfermedades crónicas u otros factores y las personas mayores no vacunadas que viven en aislamiento social. En otras palabras: estas medidas eliminan a las personas sanas del grupo demográfico no vacunado. Esto asegura que los números continuarán mostrando que las vacunas lo «protegen», incluso cuando no lo hacen.

No debe esperar ver algún tipo de actualización del gobierno en la que eventualmente admitan que las personas no vacunadas ahora tienen un menor riesgo de morir por el virus que las personas vacunadas: las medidas que están tomando tienen el efecto de dejar solo un pequeño grupo de personas no vacunadas que naturalmente tienen un riesgo muy alto de morir por este virus debido a su mala salud.

¿Por qué harían eso? ¿Por qué ahora están obligando repentinamente a los jóvenes sanos a tomar estas vacunas? Bueno, aquí hay una posible explicación. Míralo de esta manera: Imagina que tus políticos realmente creyeran que la crisis terminaría después de vacunar a todos los ancianos. Comenzaron a vacunar a las personas inicialmente, detuvieron el programa de vacunación varias veces porque muchas personas murieron repentinamente después de recibir las vacunas, pero luego continuaron los programas de todos modos porque no tenían alternativa y pensaron que sacrificar algunas vidas para poner fin a la pandemia vale la pena el costo.

Pero luego queda claro que las vacunas no resuelven el problema, porque la inmunidad no dura. Peor aún, a partir de los datos de exceso de mortalidad queda claro que las personas están muriendo a causa de las vacunas. Eres un político. Cometiste un terrible error. Entonces, ¿qué haces a continuación? ¿Admite que cometió el peor error de salud pública de la historia, o comienza a tratar de descubrir cómo encubrir el problema? Todas estas medidas que obligan a los adultos sanos de bajo riesgo con una vida social activa y un empleo estable a tomar esta vacuna aseguran que las únicas personas no vacunadas que quedan sean las personas en la demografía de alto riesgo. Este es un efecto secundario casual realmente conveniente para su gobierno, o simplemente están tratando activamente de ocultar lo que realmente está sucediendo. Si quisieran confundir activamente los datos, no podrían estar haciendo un mejor trabajo del que están haciendo actualmente.

Sin embargo, cuando observa el exceso de mortalidad total en la población en un momento dado (el número que es muy difícil de manipular para ellos) en comparación con un año antes, notará que nada ha cambiado sustancialmente para mejor. Como ejemplo, aquí está el exceso de mortalidad en los Países Bajos:

Normalmente, un invierno mortal es seguido por un invierno suave, pero ahora vemos que está sucediendo exactamente lo mismo que el invierno pasado. Lo que te van a decir después de que termine la ola de invierno es: «seguro que se ve básicamente igual que el invierno pasado, ¡pero imagínate cuánto más mortal habría sido si no hubiéramos vacunado a todos»!

Lo que ha sucedido aquí en Europa es lo siguiente. Al principio fuimos testigos de la aparición de un nuevo virus. Casi ninguno de nosotros tenía inmunidad real contra él y el virus ya estaba prácticamente optimizado para infectar a seres humanos ingenuos. Para cuando entramos en invierno, muchas personas tenían cierto grado de inmunidad y comenzaron a surgir diferentes variantes como Alpha, todas las cuales cambiaron de diferentes maneras para sobrevivir a nuestras diversas respuestas inmunes a este virus.

Luego, eventualmente, comenzamos a implementar vacunas. Esto llevó a un aumento repentino masivo de la inmunidad. El virus comenzó a extinguirse. Casi todas las variantes desaparecieron, con la excepción de una, que tenía una ventaja única sobre todas las demás. Como han demostrado los científicos japoneses, Delta tenía la capacidad única de hacer uso de nuestra respuesta de anticuerpos a la región NTD. Si estás esperando una «mejora dependiente de anticuerpos», bueno, ya está aquí. Simplemente no se ve como esperabas que se viera.

Esta capacidad de hacer uso de nuestros anticuerpos contra la región NTD de la proteína Spike parece ser la razón principal por la que Delta logró reemplazar a todas las demás cepas. También parece ser la razón por la que es mucho más infeccioso. El despliegue de las vacunas representó un evento de selección masiva, que hizo que una variante creciera dominante a costa de todas las demás variantes.

La gente te dirá «bueno, las vacunas no son tan efectivas como habían prometido, debido a una nueva variante» como si estas dos fueran ocurrencias separadas. Esta es la mentira de la omisión: ¿Por qué esta nueva variante se convirtió repentinamente en dominante? La respuesta es: Debido a estas vacunas. La respuesta inmune de los seres humanos es lo que impone una presión selectiva sobre este virus. Cuanto más se parece nuestra respuesta inmune a la de otras personas, más forzamos la presión selectiva sobre este virus en una dirección particular. A través de las vacunas, que homogeneizan nuestra respuesta inmune contra una versión particular de la proteína espiga, creamos el tipo de condiciones en las que las versiones del virus que se parecen a Delta comienzan a prosperar a expensas de otras cepas del virus.

Y esa es la etapa a la que hemos llegado ahora. En todo el mundo occidental, diferentes cepas descendientes de Delta están en una carrera por acumular diferentes mutaciones que superen nuestra respuesta inmune humana contra la proteína espiga. Es poco probable que veas que una cepa en particular tenga una ventaja muy fuerte contra otras cepas ahora y elimine a las demás. La fruta de bajo costo ya ha sido cosechada por el virus en forma de Delta convirtiéndose en dominante. Ahora se trata de adquirir diferentes mutaciones, cada una con una leve ventaja.

Lo que va a parecer es que en toda Europa Occidental, gradualmente se va a ver que el porcentaje de personas vacunadas en los hospitales se acerca a la marca del 80-90%. Es muy poco probable que se mueva por encima del 90% de las hospitalizaciones, porque el 7% no vacunado más o menos de los ancianos tienen una salud mucho más pobre que los ancianos vacunados. Pero si no supiera nada mejor y se despertara de un coma y mirara las estadísticas de mortalidad, dudaría de que se hubiera implementado una vacuna.

Desafortunadamente, por varias razones, las vacunas permiten una situación que no habría existido si hubiéramos construido inmunidad natural. Hay una serie de razones para esperar que el virus crezca más mortal en los próximos meses, en comparación con la ola de invierno anterior:

-La inmunidad natural es muy diversa. El sistema inmunológico de una persona se centrará en la proteína Nucleocápside, el sistema inmunológico de otra persona se centrará en la proteína Spike o en una de las otras proteínas. La inmunidad natural también se desarrolla contra diferentes variantes, mientras que la inmunidad artificial se desarrolla contra una proteína espiga que es idéntica en todos los que reciben estas vacunas. Debido a que la inmunidad natural es diversa, los cambios sutiles en el virus no pueden causar el tipo de beneficio de aptitud física que puede causar en condiciones de inmunidad artificial generalizada contra una versión específica de la proteína Spike.

Como todo el mundo tiene una respuesta inmune muy similar, llegamos a una situación en la que el virus puede usar activamente nuestra respuesta inmune para su propio beneficio, a través de la mejora dependiente de anticuerpos. Tales mutaciones que permiten la mejora dependiente de anticuerpos generalmente solo tienen una ventaja de aptitud si casi todos tienen estos anticuerpos. Ya existe un grado de mejora dependiente de anticuerpos, porque casi todos los anticuerpos inducidos por las vacunas contra la región NTD son utilizados por las cepas Delta actualmente dominantes en su beneficio.


La campaña de vacunación dificulta el desarrollo de la inmunidad completa, ya que la respuesta inmune normal a las proteínas más allá de la proteína Spike se previene debido al pecado antigénico original. Esto hace que las infecciones repetidas sean más probables. La evidencia de que esto ya sucede se puede ver en el hecho de que los británicos vacunados tienen tasas de casos más altas que los británicos no vacunados. También se puede ver en el hecho de que los niveles de ARN en las aguas residuales escocesas y holandesas ahora superan los niveles observados durante el pico de invierno.

Entonces, ¿cómo va a terminar este experimento? Los adultos sanos no vacunados se infectan con el virus con el tiempo y desarrollan una inmunidad duradera genuina. Después de un año más o menos, serás vulnerable a la reinfección, pero estas reinfecciones son más leves, como un resfriado común normal. La razón principal por la que este virus se comportó de manera diferente a otros virus corona en adultos es porque teníamos menos inmunidad a este virus.

Los adultos vacunados están al principio protegidos, pero la inmunidad es temporal, ya que se basa en una respuesta en la sangre, centrada únicamente en una versión antigua de la proteína espiga. Esto conduce gradualmente a la siguiente etapa de la pandemia, donde el virus no tiene a nadie más que infectar, excepto a las personas vacunadas con inmunidad menguante. Esto es inevitable, porque casi todas las personas no vacunadas desarrollarán inmunidad esterilizante eventualmente.

Una vez que haya muchas personas con inmunidad inducida por la vacuna menguante en comparación con las personas no vacunadas que aún son susceptibles a la infección, puede ocurrir una selección adicional para la mejora dependiente de anticuerpos y la evasión de anticuerpos. Las mutaciones que habrían tenido un efecto negativo en la condición física cuando todavía había muchos jóvenes no vacunados para infectar ahora comenzarán a tener una ventaja de transmisión en la población general y serán seleccionadas.

Este es el punto al que hemos llegado ahora: no quedan suficientes personas susceptibles no vacunadas en la población, para forzar una presión selectiva suficiente contra la propagación de nuevas mutaciones de ADE y evasión de anticuerpos. El virus ahora se está propagando de una persona vacunada a la siguiente persona vacunada de forma continua. Estas son las circunstancias bajo las cuales el virus cambia para evadir la respuesta inmune inducida por la vacuna. Tales nuevos cambios no ocurren cuando el virus se propaga de una persona no vacunada a una persona vacunada, ¡porque esos cambios no mejoran la replicación en la persona no vacunada!

Este proceso solo comienza realmente una vez que la mayoría de la población ha sido vacunada y un número significativo de personas móviles con muchos contactos han comenzado a desarrollar una inmunidad menguante. Este proceso lleva un tiempo, porque el virus tarda en pasar por este filtro selectivo: tarda unos días en pasar de una persona a otra. Este proceso conduce lentamente a una situación en la que comenzará a ver un aumento en las personas mayores vacunadas hospitalizadas debido a Covid.

He realizado el siguiente gráfico, para ilustrar cómo funciona el proceso:

Si entiendes esto, entonces entiendes que lo que te están diciendo es exactamente al revés: las personas no vacunadas no son un peligro para las personas vacunadas. Las personas vacunadas dependen de un gran reservorio de personas no vacunadas, para que las vacunas sigan siendo efectivas. Esta es, por ejemplo, la razón por la que la vacuna parecía altamente efectiva en los Estados del Sur de Estados Unidos este verano, pero parece altamente ineficaz en Escocia.

Para que las personas vacunadas permanezcan a salvo de este virus, serán necesarias campañas de migración masiva: las personas vacunadas tendrán que propagarse entre las personas no vacunadas. Mientras las personas vacunadas solo interactúen con otras personas vacunadas, la selección natural provocará la propagación de variantes de este virus que evadan su respuesta inmune. Cambiar su respuesta inmune a una respuesta inmune más efectiva es muy difícil y con cada refuerzo que reciban se volverá más difícil.

Una vez que queda claro que las vacunas están fallando, esto lleva a sus responsables políticos al siguiente gran dilema: aumentar o no impulsar.

-Si decides no impulsar, te enfrentas al mismo tipo de situación que vimos el invierno pasado o peor. Las vacunas no serán efectivas y los hospitales no podrán lidiar con la carga de los pacientes, porque los hospitales tienen poco personal y tratan de tratar a los pacientes cuyo tratamiento se retrasó.

-Si decides aumentar, simplemente pateas la lata por el pasillo hasta el próximo invierno. Cada vez que inyectas a alguien con la misma versión antigua de la proteína Spike, el sistema inmunológico aprende a acercarse más a esta versión de la proteína Spike, a expensas de su capacidad para ajustarse a cualquier variante novedosa que surja. Parece funcionar bien a corto plazo, como lo demuestra Israel, pero no es una solución sostenible, porque obstaculiza el sistema inmunológico en su capacidad de adaptarse a la inevitable evolución de este virus.

Además de esto, parece haber una ventana de dos semanas después de la inyección durante la cual tiene un mayor riesgo de infectarse, porque muchos de sus glóbulos blancos se mueven a la ubicación de la inyección en su brazo. Por lo tanto, una campaña de refuerzo masivo puede causar un aumento adicional en las infecciones.

Lo que ha sucedido es lo siguiente: un nuevo virus saltó a la población humana, contra la cual teníamos muy poca inmunidad preexistente. Es el tipo de virus contra el que nuestros cuerpos no desarrollan una respuesta inmune duradera, porque es el tipo de virus que puede usar tales anticuerpos para su propio beneficio cuando muta.

Normalmente los seres humanos desarrollarían una respuesta inmune muy diversa, en respuesta a las diversas variantes que circularán en la población a lo largo del tiempo. Debido a esta respuesta inmune diversa, sería imposible que las pequeñas mutaciones conduzcan a un aumento dramático en la evasión inmune.

Debido a las vacunas, la respuesta inmune de todos ahora se ve muy similar. Esto tiene el efecto de permitir que las mutaciones simples causen efectos dramáticos. Nunca antes habíamos tenido una situación como esta en la historia. Es a través del desarrollo gradual de diversa inmunidad que los virus normalmente se vuelven endémicos. Ahora interferimos con este proceso y estamos a punto de descubrir las consecuencias.

Si vives en una nación de Europa Occidental, ahora puedes esperar aproximadamente la siguiente línea de eventos para proceder:

Las infecciones y hospitalizaciones aumentarán a medida que el clima empeore y la protección inducida por la vacuna disminuya.

Los políticos enfatizarán inicialmente que la mayoría de los pacientes no están vacunados. Eventualmente, esta narrativa progresa a «todavía es más probable que termine hospitalizado si no está vacunado», ya que los pacientes completamente vacunados se convierten en la mayoría. Entonces probablemente redoblan la presión y deciden apresurar los refuerzos, mientras insisten en que la vacuna aún lo protege adecuadamente.

Los medios de comunicación y los políticos insistirán en que todo esto se debe a las personas que permanecen sin vacunar, incluso cuando la evidencia comienza a demostrar que las vacunas no hacen una diferencia sustancial, siempre y cuando se ajusten a los factores de confusión demográfica (lo que generalmente se niegan a hacer, prefieren mostrarle los números brutos). Se implementarán nuevas medidas dirigidas a los no vacunados, pero estas medidas no tendrán un impacto significativo en la ola invernal. En todo caso, aislar a los no vacunados de los vacunados facilita que las mutaciones resistentes a las vacunas se vuelvan dominantes.

Países como los Países Bajos, donde los políticos fueron lo suficientemente tontos como para creer genuinamente que estas vacunas serían el final de este lío, estarán en grandes problemas. Eventualmente, se ven obligados a abandonar su negación e implementar un nuevo confinamiento que afecta a las personas vacunadas y no vacunadas por igual. Los confinamientos se utilizan para ganar tiempo, para desplegar nuevos refuerzos para los ancianos e impulsar la vacunación de los niños. Sin embargo, la vacunación de los niños es la forma más efectiva posible de crear variantes de evasión inmune, porque los niños no vacunados son un baluarte de la selección natural contra las mutaciones que evaden la vacuna. Cuantos más niños vacunamos, más aceleramos la catástrofe que está a punto de suceder.

Después de un invierno horrible con un exceso de mortalidad que excede el invierno anterior, las hospitalizaciones finalmente disminuyen nuevamente. Pero el problema no ha desaparecido.

-Los diferentes descendientes circulantes de Delta continúan divergiendo entre sí. Otras variantes como Beta también pueden aparecer en Europa. Esto ahora prohíbe el despliegue de una nueva vacuna efectiva contra Delta, porque estas cepas están evolucionando en direcciones exactamente opuestas a la versión de Wuhan. El virus ahora desarrollará tal variación que ya no es posible implementar una vacuna efectiva.

-Mientras que la diversidad genética del virus habrá aumentado, la diversidad de nuestra respuesta inmune contra el virus habrá disminuido. La mayoría de los adultos se habrán inyectado tres o incluso cuatro veces, con una versión de Wuhan de la proteína espiga. Con cada vez que se le inyectan estas vacunas, su sistema inmunológico se ve obligado a centrar más de su respuesta en esta versión de Wuhan de la proteína espiga, a expensas de la capacidad de su sistema inmunológico para responder a todas las demás partes del virus y todas las demás variantes que evolucionan con el tiempo.

Los políticos se darán cuenta de que las viejas vacunas ya no funcionarán para el próximo invierno, pero no son inmunólogos y esperan que simplemente se pueda idear una nueva vacuna una vez que los descendientes de Delta hayan evolucionado para ya no verse afectados por esta vacuna. Sin embargo, esto no es posible por dos razones:

1. A medida que aumenta la diversidad genética, se vuelve imposible predecir por qué cepa se verá afectada una región o individuo en particular, por lo que se vuelve difícil optimizar la vacuna.

2. Debido al pecado antigénico original, la primera exposición limita la capacidad de ajustarse a las exposiciones posteriores. La respuesta a las exposiciones posteriores será moldeada por la primera exposición. En términos generales, la vacunación con nuevas cepas simplemente recuerda la respuesta de la vacunación con cepas viejas, en lugar de crear una nueva respuesta.

Debido a que no será posible usar vacunas efectivas, el invierno de 2022 a 2023 conduce a una ola masiva de muertes diferente a todo lo que hemos visto hasta ahora.

Nunca antes habíamos hecho algo así en la historia de la humanidad. Hemos inyectado a toda la población con «vacunas», que hacen que sea un poco más difícil que este virus se replique en el cuerpo de una persona, pero aún así permiten que una persona se infecte y lo transmita. Así es como se genera una explosión en nuevas variantes.


Lo que es importante entender es que las vacunas también sirven como un trampolín evolutivo: las mutaciones intermedias que nunca podrían haber sobrevivido el tiempo suficiente para desarrollar más mutaciones ahora pueden sobrevivir en este nuevo entorno de inmunidad inducida por vacunas artificiales. Recuerde, las personas no están desarrollando la amplia inmunidad esterilizante natural que involucra casi todas las proteínas del virus en sus membranas mucosas, que les prohíbe infectarse. Tal inmunidad impide que sus cuerpos sirvan como campos de entrenamiento para que el virus evolucione aún más.

No, están desarrollando inmunidad en la sangre, en lugar de en las membranas mucosas del tracto respiratorio superior, en lugar de en las membranas mucosas del tracto respiratorio superior. Así es como se genera una explosión de variantes, con cambios en la proteína espiga. Variantes que pueden saltar a otras especies animales donde pueden evolucionar aún más. Variantes que evolucionan para hacer uso de su respuesta de anticuerpos. Las variantes con todo tipo de ventajas ahora pueden evolucionar, porque las personas con inmunidad inducida por la vacuna menguante contra la proteína Spike son un trampolín evolutivo perfecto.

Uno de los factores necesarios para que nuestra especie alcance densidades de población tan altas como las que hemos alcanzado hoy en día es la diversidad de nuestra respuesta inmune de persona a persona:

Los loci MHC son algunos de los loci codificantes más variables genéticamente en mamíferos, y los loci HLA humanos no son excepciones. A pesar del hecho de que la población humana pasó por una constricción varias veces durante su historia que fue capaz de arreglar muchos loci, los loci HLA parecen haber sobrevivido a tal constricción con una gran variación. [20] De los 9 loci mencionados anteriormente, la mayoría retuvo una docena o más de grupos de alelos para cada locus, una variación mucho más conservada que la gran mayoría de los loci humanos. Esto es consistente con un coeficiente de selección heterocigoto o de equilibrio para estos loci. Además, algunos loci HLA se encuentran entre las regiones codificantes de más rápida evolución en el genoma humano. Se ha observado un mecanismo de diversificación en el estudio de tribus amazónicas de América del Sur que parecen haber sufrido una intensa conversión de genes entre alelos variables y loci dentro de cada clase de genes HLA.[21] Con menos frecuencia, se han observado recombinaciones productivas de mayor alcance a través de genes HLA que producen genes quiméricos.

Si tuviéramos genes HLA con muy poca diversidad, todos tendríamos una respuesta inmune muy similar a los patógenos. La falta de diversidad en sus genes HLA es uno de los factores que hicieron que los nativos americanos fueran tan vulnerables a los virus introducidos por los colonizadores europeos: estos virus podrían propagarse en un entorno de respuesta inmune homogénea, lo que permitió que estos virus evolucionaran para hacer un uso óptimo de ese entorno en particular.

Si tuviéramos genes HLA con poca diversidad, los patógenos desarrollarían variantes que superarían esa respuesta inmune en particular. La diversidad de nuestra respuesta inmune prohíbe que esto suceda: cualquier cambio en particular no puede ayudar mucho a un patógeno, cuando todos responden al patógeno de una manera diferente.

Con las vacunas basadas en picos, hemos hecho exactamente lo peor que podría hacer: homogeneizamos la respuesta inmune humana a un nuevo virus que se está volviendo rápidamente más diverso genéticamente. Esto es algo de lo que llegaremos a arrepentirnos, porque estaremos lidiando con las consecuencias de ese error en forma de inmunidad deteriorada contra este virus durante décadas. Con cada nuevo refuerzo que inyectamos a las personas, homogeneizamos la respuesta inmune nuevamente y hacemos que sea aún más difícil para el sistema inmunológico responder a las nuevas variantes que surgirán.

Los desarrolladores de vacunas no están muy preocupados por lo que sucede cuando su campaña de vacunas falla, porque nunca antes habían visto una situación en la que una vacuna desplegada a cientos de millones de personas haya fallado. Las vacunas que fracasaron y empeoraron la enfermedad (ver Dengue en Filipinas y Virus Respiratorio Sincitial en los Estados Unidos) siempre fallaron durante los primeros ensayos, en los que solo un par de miles de personas como máximo fueron inyectadas con la vacuna. Esta es la primera vez en la historia que le sucede a cientos de millones de personas simultáneamente.

Sin embargo, la realidad es la siguiente: cuando se inyecta a cientos de millones de personas con una vacuna que se supone que los protege contra una nueva enfermedad infecciosa, pero la vacuna no los protege y las personas vacunadas aún pueden propagar este virus debido al fracaso de la vacuna, se están creando las condiciones exactas en las que el virus crecerá mucho más mortal.

Pero espera, ¿cómo es esto posible? ¿No tiene este virus una tasa de mortalidad por infección de ~ 0.2%? ¿El 99.8% de las personas no sobreviven a una infección por coronavirus? Sí, eso solía ser cierto, antes de que comenzáramos nuestra campaña de vacunación masiva y el virus comenzara a evolucionar en respuesta a nuestros errores. La realidad es ahora que estamos viendo que las infecciones irruptivas son muy graves.


Las personas vacunadas que se infectan ahora tienen un 9% de probabilidades de necesitar ser hospitalizadas en los Estados Unidos. Parte de esto se debe al hecho de que las infecciones irruptivas ocurren principalmente en personas mayores, pero también es producto del hecho de que las vacunas prohíben el desarrollo de una respuesta inmune efectiva.

Las infecciones irruptivas son más graves que las infecciones antes de que tuviéramos vacunas. Estas infecciones irruptivas se volverán más comunes con el tiempo. Sin embargo, lo más importante es que podemos esperar que las infecciones innovadoras comiencen a ser más graves con el tiempo, porque ya no tenemos suficientes personas susceptibles no vacunadas cuyos cuerpos imponen una presión selectiva negativa contra las mutaciones de proteína espiga de anticuerpos / ADE. Por lo tanto, la carga sobre los hospitales aumentará y, en última instancia, llegará al punto en que los hospitales ya no puedan hacer frente a todos los pacientes, lo que llevará a un mayor aumento de la mortalidad.

Necesitamos que los jóvenes sanos permanezcan sin vacunar, no solo para proteger a las personas vacunadas e imponer una presión selectiva contra las mutaciones de la proteína espiga ADE evadidos de anticuerpos/ ADE, sino por la siguiente razón:

¡Los jóvenes sanos no vacunados son los únicos que pueden revelar lo que sucedió!

Si casi no quedan jóvenes sanos no vacunados en países donde la mayoría de las personas recibieron estas vacunas, será difícil probar lo que hicieron: le dieron a la gente una vacuna que empeoró la pandemia. Mientras queden muchos jóvenes sanos no vacunados, será obvio a partir de las estadísticas y de las propias interacciones sociales cotidianas de las personas que los jóvenes sanos no vacunados no están sufriendo los efectos de este virus.

Sin suficientes jóvenes sanos no vacunados, será más fácil para los gobiernos pretender que estas nuevas olas mortales fueron simplemente un producto de alguna nueva variante más mortal que evolucionó espontáneamente, completamente sin relación con la campaña de vacunación.

Lo importante es entender que nada de esto era necesario. Realmente no tenía que ser así. Hubiera sido muy sencillo abordar esta situación, para políticos competentes.

Hágase las siguientes preguntas: ¿Por qué Suecia está bien, sin ningún confinamiento? Japón, el país con la población más envejecida del planeta, tiene 18.000 muertes por COVID, tantas como los Países Bajos. ¿Cómo escapó el África subsahariana de esta plaga?

Es realmente muy simple. Realmente no tienes que ser un genio para descubrir esto. Estos políticos y científicos podrían haber sido aclamados como héroes, si hubieran hecho las cosas muy simples que el tipo promedio en la calle ya descubrió:

-Asegúrese de que todos reciban suficiente vitamina D y vitamina K2.

-Fomentar una dieta y un estilo de vida saludables.

-Animar a los jóvenes a infectarse y volverse inmunes.

No voy a discutir todos los detalles específicos con respecto a la nutrición, pero debería quedar claro para cualquiera que mire la evidencia de que conocemos varios nutrientes que reducen enormemente el riesgo de enfermedades graves. Sin embargo, a los políticos no parece importarles esto: quieren una solución fácil de alta tecnología que sea consistente, confiable y fácil de forzar a las personas.

Los seres humanos pueden elegir someterse a las demandas de su cuerpo. El cuerpo anhela ciertos nutrientes, a cambio nos entrega la inmunidad que necesitamos para sobrevivir en este mundo. Por otro lado, la respuesta que elegimos fue el transhumanismo ordenado por el gobierno: forzamos a nuestros cuerpos a cambiar, engañamos a las células de nuestro cuerpo para que comenzaran a expresar material genético extraño: ARNm encapsulado en lípidos y ADN de una vacuna vectora de adenovirus.

Esto ahora es contraproducente. La naturaleza se niega a plegarse a nuestra voluntad y el resultado de este experimento fallido será la muerte en masa.

Fuente: https://www.rintrah.nl/what-happens-when-the-vaccines-start-to-backfire/


Hay valientes, héroes en todas las profesiones de esta guerra, el autor de esta maravillosa viñeta, el australiano Michael Leunig, fue DESPEDIDO por publicarla. Es tan GRAVE que esto ocurra que hasta el más creyente covidicio y/o covidiota debería empezar a rebelarse contra ella. La tiranía globalizadora.


Dra. Rubik, COVID-19 y exposición a RADIACIÓN inalámbrica

Desde el año 2014 la Doctora Rubik, catedrática de biofísica y fundadora y directora del Institute for Frontier Science, ha estado investigando los efectos que tiene la radiación de los teléfonos móviles en las células humanas. Ella ha descubierto que la sangre cambia negativamente por la radiación inalámbrica. En lugar de fluir libremente la sangre en los capilares, se forman coágulos y la sangre se vuelve pegajosa; por ejemplo, llevar una mochila con un móvil 4G de 45 minutos cambia la fluidez de la sangre. Las personas mayores de 40 años mostraron peores síntomas que las personas más jóvenes. A largo plazo, este tipo de radiación contribuye a problemas cardiovasculares con ataques cardíacos y accidentes cerebrovasculares como resultado.

El método se basa en estudios bibliográficos de informes de investigación en curso sobre la fisiopatología desarrollados a través de Covid-19 en 2020 (MD Robert R. Brown), y en más de 250 informes de investigación revisados por pares de 1969-2020 sobre posibles efectos biológicos de radiofrecuencia por radiación, radiación inalámbrica. etc , en exposición a células tanto experimentales como humanas.

Se han realizado estudios a largo plazo con una conexión militar en Rusia desde 1969 y fueron traducidos por la CIA e ingresados en sus archivos como información técnica de defensa a principios de la década de 2000. La doctora Rubik estudió estos informes, pero también los informes de investigación de la sociedad civil, por ejemplo, sobre trabajadores que se enfermaron cuando se instalaron o estuvieron expuestos a Radiación electromagnética.

Los estudios de los informes de investigación de Rubik y Brown se analizaron por separado. Luego se comparó la fisiopatología del Covid-19 con la exposición a Radiación a nivel celular, encontrando y organizando cinco categorías: cambios sanguíneos y vasculares, estrés oxidativo, sistema inmunológico, aumento de los niveles de calcio y arritmias cardíacas.

La presentación clínica del Covid-19 varía mucho con una amplia gama de manifestaciones, que van desde síntomas leves: dolor de garganta, dolor de cabeza, fiebre, secreción nasal, tos, dolor articular leve, dolor de estómago, pérdida del gusto y el olfato … a otros más severos como dificultad para respirar, fiebre alta y gran cansancio.

En un gran estudio, el 80% mostró síntomas leves o ninguno, mientras que especialmente la población anciana y aquellos con enfermedades subyacentes como presión arterial alta, diabetes y obesidad tienen un mayor riesgo de enfermedad grave.

El síndrome de dificultad respiratoria aguda (SDRA) puede ocurrir rápidamente y causar dificultad respiratoria severa cuando las células endoteliales en las paredes internas de los vasos sanguíneos y las células epiteliales en las paredes internas de las vías respiratorias pierden su vida útil y el líquido rico en proteínas se filtra a los sacos de aire adyacentes.

El Covid-19 puede causar hipoxia, niveles insuficientes de oxígeno, que se han visto en hasta un 80% de los pacientes con dificultad respiratoria en la unidad de cuidados intensivos, según un informe escrito por el Doctor Gattinoni a finales de 2020. Se ha observado una disminución de la oxigenación y niveles elevados de dióxido de carbono en la sangre de los pacientes, aunque la etiología de estos hallazgos sigue sin estar clara. En radiografías y tomografías computarizadas en pacientes con Covid-19, se ha observado daño oxidativo masivo en los pulmones.

Este estrés celular indica una etiología, la causa de la enfermedad, más de naturaleza bioquímica que de virus (Dr. Cavezzi et al, 2020). Debido a que la propagación del virus puede adherirse a las células que contienen un receptor ACE-2 (enzima convertidora de angiotensina 2), la enfermedad puede propagarse y dañar órganos y tejidos blandos en todo el cuerpo, incluidos: pulmones, corazón, intestinos, riñones, grasa, testículos y ovarios. La enfermedad puede aumentar una inflamación sistemática y producir una condición de hipercoagulabilidad, es decir, una condición en la que la sangre se coagula. Sin el uso de anticoagulantes, esto puede ser fatal. (Dr. Bikdeli et al, 2020)

Los organismos son seres electroquímicos y ante una radiación de baja frecuencia de sistemas de comunicación inalámbricos como antenas de teléfonos móviles, estaciones base, WiFi, teléfonos móviles, etc. pueden interferir con muchas funciones fisiológicas, desde niveles moleculares hasta celulares, fisiológicos, conductuales y psicológicos.

Varios estudios muestran efectos nocivos para la salud que incluyen riesgo de cáncer, cambios endocrinos, aumento de la producción de radicales libres, daño al ADN, cambios en el sistema reproductivo, errores de aprendizaje y memoria y trastornos neurológicos.

La literatura científica revisada por pares en todo el mundo, que cubre más de 5,000 estudios, ha documentado evidencia de efectos biológicos dañinos de la exposición a radiación electromagnética, incluidas las frecuencias de la tecnología 5G, durante décadas. La mayoría son encuestas estadounidenses. Se han realizado estudios que abarcan solo unas pocas semanas o menos y se han realizado muy pocos estudios a largo plazo en animales y seres humanos.

Estudios a largo plazo que duraron meses realizados en animales de experimentación en la Unión Soviética y Europa del Este entre 1969 y 1970. Las enfermedades por exposición a Radiación se han documentado desde el uso temprano del radar y los científicos rusos hablan de «enfermedad de las ondas de radio». Estos estudios rusos muestran un impacto biológico significativo incluso a niveles de exposición 100 veces inferiores a 1 mW/cm cuadrado.

Se producen un fenómeno durante la exposición prolongada a baja frecuencia sorprendente:

La sangre se coagula y se vuelve pegajosa, causando una coagulación vascular, es decir, la sangre no fluye con tanta libertad. Disminuye la oxigenación de los órganos internos, incluido el cerebro.

La siguiente tabla muestra los síntomas comunes del Covid-19 y los correspondientes efectos biológicos adversos de la exposición a Radiación electromagnética. Estos efectos se delimitan en la tabla en las cinco categorías de cambios sanguíneos y vasculares; estrés oxidativo; sistema inmunitario; aumento de los niveles de calcio (Ca2+), arritmias cardíacas, pero se debe enfatizar que estos tienen efectos superpuestos. Algunos ejemplos son la coagulación y la inflamación de la sangre. El estrés oxidativo está implicado en los cambios morfológicos de los eritrocitos, así como en la hipercoagulación, la inflamación y el daño orgánico.

La neumonía que se produce en relación con el Covid-19 no es del tipo de nuestra ‘vieja neumonía’ clásica, dice Beverly Rubik. No, se caracterizan porque la sangre se vuelve «pegajosa y coagula». La sangre fluye mal. Las células sanguíneas no son capaces de absorber el oxígeno adecuadamente, se produce una neumonía y el paciente puede morir por asfixia si no se toman medidas rápidas.

Por lo tanto, el Covid-19 no es solo una enfermedad viral, sino también una enfermedad de la sangre. El corazón también tiene receptores especiales a los que el SARS-CoV 2 se une con arritmias como resultado.

Beverly Rubik cree que las redes 5G deberían desmantelarse de inmediato por el bien de nuestra salud, pero en cambio se están expandiendo cada vez más. Se ampliarán las estaciones base y se instalarán pequeñas antenas en los tejados de cada bloque, lo que cambiará todo nuestro planeta. Además de las muertes de insectos y aves, todas las infecciones virales futuras se verán agravadas por la Radiación electromagnética que abre los canales de iones de calcio en las células y deja entrar el virus.

Más de 100.000 satélites orbitarán en el espacio para cubrir la tecnología 5G. Todo el planeta tierra está rodeado de microfrecuencias como la del 5G. Todo el campo electromagnético alrededor de la Tierra cambiará y afectará tanto al Covid-19 como a otros virus futuros.

Entrando en el informe de investigación publicado, se puede hacer el siguiente resumen:

La política de salud pública sobre el COVID-19 se ha centrado en el virus SARS-CoV-2 y sus efectos en la salud humana, mientras que los factores ambientales han sido en gran parte ignorados. Al considerar la tríada epidemiológica (agente-huésped-medio ambiente) aplicable a todas las enfermedades, investigamos una posible factor ambiental en la pandemia COVID-19: radiofrecuencia ambiental y Radiación de los sistemas de comunicación inalámbricos, incluidas las microondas y ondas milimétricas.

El COVID-19 apareció en Wuhan, [China] poco después de la implementación de la tecnología 5G en toda la ciudad (quinta generación de radiación inalámbrica), y difundirse globalmente, demostrando una correlación estadística entre comunidades con antenas 5G ya instaladas. En este estudio, se examina la revisión de la literatura científica sobre los efectos biológicos perjudiciales de la radiofrecuencia y la radiación (RFR) e se identificó varias formas en las que la RFR puede ser el factor que contribuye al COVID-19 como cofactor ambiental tóxico.

Concluimos que la RFR y, en particular la tecnología 5G, ha exacerbado la prevalencia y gravedad de COVID-19 al debilitar la inmunidad del huésped y aumentando la virulencia del SARS-CoV-2:

– causando cambios morfológicos en los eritrocitos, incluidos los equinocitos y formación de rouleaux que puede estar contribuyendo a la hipercoagulación;

– perjudicando la microcirculación y reducir los niveles de hemoglobina y eritrocitos por exacerbación de la hipoxia;

– amplificando la disfunción del sistema inmunológico, que incluye inmunosupresión, autoinmunidad e hiperinflamación;

– aumentando estrés oxidativo celular y la producción de radicales libres que exacerban la lesión vascular y daño de órganos;

– aumentando el Ca 2+ intracelular esencial para la entrada, replicación y liberación de virus, además de promover la propagación por vías inflamatorias;

– empeorando las arritmias cardíacas y sus trastornos.

En resumen, la RFR es un factor de estrés ambiental omnipresente que contribuye a los resultados de salud adversos del COVID-19.

Invocamos el principio de precaución y recomendamos encarecidamente una moratoria sobre el 5G y toda su infraestructura inalámbrica en este momento crucial para ayudar a mitigar la pandemia, y para preservar la salud pública hasta que los estándares de seguridad gubernamentales para RFR la exposición basada en investigaciones actuales y futuras se definan y empleen adecuadamente, recomienda encarecidamente el equipo de investigación de este nuevo trabajo científico.

Cuando el SARS-CoV-2 infecta por primera vez el cuerpo humano, ataca las células que recubren la nariz, la garganta y las vías respiratorias superiores, albergando un receptor ACE-2. Una vez que el virus gana acceso a una célula a través de su proteína de pico, convierte la célula en una máquina de autorreplicación. En respuesta al COVID-19 como infección, tanto una inmunidad innata sistémica inmediata presenta una respuesta adaptativa retrasada que se ha demostrado que ocurre (Dr. Cao, 2020). El virus también puede causar una desregulación de la respuesta inmune, particularmente en la disminución de la producción de linfocitos T (Dr. Qin et al. ,2020). Los casos severos tienden a tener linfocitos más bajos, recuentos más altos de leucocitos y neutrófilos proporciones de linfocitos, así como porcentajes más bajos de monocitos, eosinófilos y basófilos (Dr. Qin et al. , 2020).

La exposición a RFR no térmica de bajo nivel conduce al aumento de cálcio Ca 2+ intracelular a través de la activación de voltaje-canales de calcio regulados (Dr. Martin Pall, 2013), que se considera ser uno de los principales mecanismos de acción de la RFR sobre los organismos. El Ca 2+ intracelular también es esencial para la entrada, replicación y liberación de virus, y ha sido informado que los virus secuestran los canales de calcio y aumentar el Ca 2+ intracelular (Dr. Chen et al., 2019). Incluso aunque no se han reportado pruebas directas, hay evidencia indirecta de que el aumento de Ca 2+ intracelular puede ser involucrado en COVID-19. En un estudio reciente, ancianos pacientes hospitalizados con COVID-19 tratados con calcio bloqueadores de canales (BCC amlodipino o nifedipino) tuvieron más probabilidades de sobrevivir y menos probabilidades de requerir intubación o ventilación mecánica que los controles (Dr. Solaimanzadeh, 2020). Además, los fármacos CCB limitan fuertemente la entrada y la infección del SARS-CoV-2 en células pulmonares epiteliales cultivadas (Dr. Straus et al., 2020).

En esta interesante entrevista, la Dra. Bervely Rubik nos explica que nuestro entorno global se está inundando con nuevas formas y frecuencias de radiación electromagnética, así como con nuevos productos químicos. «Somos como ranas que se calientan lentamente en una olla de agua», explicó. Pero, con el tiempo, estos cambios ambientales están afectando la salud pública y, en particular, la salud mental. Ella sostiene que el cuerpo humano es tanto químico como electromagnético, al igual que las entidades subatómicas pueden ser tanto partículas como ondas.

Concluimos que la RFR y, en particular, la tecnología 5G, que implica la densificación del 4G, ha exacerbado la Pandemia del COVID-19 al debilitar la inmunidad del huésped y aumentando la virulencia del SARS-CoV-2 al causar cambios morfológicos en los eritrocitos que incluyen formación de equinocitos y rouleaux que puede contribuir a la hipercoagulación; perjudicial microcirculación y reducción de eritrocitos y niveles de hemoglobina que exacerban la hipoxia; amplificando disfunción inmunológica, incluida la inmunosupresión, la autoinmunidad e hiperinflamación; aumentando el estrés oxidativo celular y la producción de libre radicales que exacerban la lesión vascular y el daño orgánico; aumentar el Ca 2+ intracelular, esencial para la entrada, replicación y lanzamiento, además de promover vías proinflamatorias; empeoramiento del corazón arritmias y trastornos cardíacos.

En resumen, la radiación inalámbrica de comunicación es un medio ambiente omnipresente, estresante, y la evidencia presentada aquí sugiere que es un factor que contribuyó a la pandemia de COVID-19.Este es el primer artículo científico que documenta un enlace entre la RFR emitida por comunicación inalámbrica y dispositivos y COVID-19. Trabajadores de la salud y los formuladores de políticas deben considerar la RFR como un cofactor que agrava la pandemia de COVID-19. Los métodos para reducir la exposición a RFR deben ser proporcionados a todos los pacientes y la población en general.

(Fuentes: https://plataforma.quieroauditoriaenergetica.org/); (Astillas de realidad)

¿Podrían las vacunas contra el ARNm alterar permanentemente el ADN? La ciencia reciente sugiere que podrían.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might.

Por Equipo de Defensa de la Salud Infantil

La investigación sobre el ARN SARS-CoV-2 realizada por científicos de Harvard y el MIT tiene implicaciones sobre cómo las vacunas contra el ARNM podrían alterar permanentemente el ADN genómico, según Doug Corrigan, Ph.D., un biólogo bioquímico-molecular que dice que se necesita más investigación.

Durante el año pasado, sería casi imposible para los estadounidenses no darse cuenta de la decisión de los medios de comunicación de hacer de las vacunas la narrativa dominante de COVID, apresurada a hacerlo incluso antes de que ocurrieran muertes atribuidas al coronavirus.

La cobertura inclinada de los medios de comunicación ha proporcionado un impulso particularmente fructífero de las relaciones públicas para las vacunas con ARN mensajero (ARNM), décadas en desarrollo pero nunca aprobadas para uso humano, ayudando a acercar la tecnología experimental a la línea de meta regulatoria.

En circunstancias ordinarias, el cuerpo produce («transcribes») ARNm a partir del ADN en el núcleo de una célula. A continuación, el ARNM viaja fuera del núcleo hacia el citoplasma, donde proporciona instrucciones sobre qué proteínas hacer.

En comparación, las vacunas contra el ARNM envían su carga útil de ARNm sintetizada químicamente (incluida con instrucciones de fabricación de proteínas de pico) directamente al citoplasma.

Según los Centros para el Control y la Prevención de Enfermedades (CDC) y la mayoría de los científicos de vacunas contra el ARNM, el dinero se detiene allí: las vacunas contra el ARNM «no afectan ni interactúan con nuestro ADN de ninguna manera», dicen los CDC. Los CDC afirman primero que el ARNM no puede entrar en el núcleo de la célula (donde reside el ADN), y segundo, que la célula , al estilo Misión Imposible, «se deshace del ARNm poco después de que termine de usar las instrucciones».

Una preimpresión de diciembre sobre el SARS-CoV-2, por científicos del Instituto Tecnológico de Harvard y Massachusetts (MIT), produjo hallazgos sobre coronavirus salvajes que plantean preguntas sobre cómo funciona el ARN viral.

Los científicos llevaron a cabo el análisis porque estaban «perplejos por el hecho de que hay un número respetable de personas que están dio positivo para COVID-19 por PCR mucho después de que la infección se había ido».

Sus hallazgos clave fueron los siguientes: los RNAs SARS-CoV-2 «pueden ser transcritos inversamente en células humanas», «estas secuencias de ADN se pueden integrar en el genoma celular y posteriormente ser transcritas» (un fenómeno llamado «integración retro») y hay vías celulares viables para explicar cómo sucede esto.

Según el doctor en bioquímica y biólogo molecular Dr. Doug Corrigan,estos importantes hallazgos (que van en contra del «dogma biológico actual») pertenecen a la categoría de «Cosas que estábamos absolutamente e inequívocamente seguros de que no podían suceder lo que realmente sucedió».

Los hallazgos de los investigadores de Harvard y el MIT también pusieron las suposiciones de los CDC sobre las vacunas contra el ARNM en terreno más inestable, según Corrigan. De hecho, un mes antes de que apareciera la preimpresión Harvard-MIT, Corrigan ya había escrito un blog en el que se esbozaban posibles mecanismos y vías por las que las vacunas contra el ARNM podían producir el fenómeno idéntico.

En una segunda entrada de blog, escrita después de que la preimpresión salió a la bolsa, Corrigan enfatizó que los hallazgos de Harvard-MIT sobre el ARN coronavirus tienen implicaciones importantes para las vacunas contra el ARNM, un hecho que describe como «el gran elefante en la habitación». Aunque no afirma que el ARN de la vacuna necesariamente se comportará de la misma manera que el ARN coronavirus , es decir, alterando permanentemente el ADN genómico, Corrigan cree que la posibilidad existe y merece un escrutinio estrecho.

En opinión de Corrigan, la contribución de la preimpresión es que «valida que esto es al menos plausible, y muy probablemente probable».

transcripción inversa

Como la frase «transcripción inversa» implica, la vía de ADN a ARNm no siempre es una calle de un solo sentido. Las enzimas llamadas transcriptasas inversas también pueden convertir el ARN en ADN, permitiendo que esta última se integre en el ADN en el núcleo celular.

Tampoco es poco frecuente la transcripción inversa. Los genetistas informan que «más del 40% de los genomas de mamíferos comprenden los productos de la transcripción inversa».

La evidencia preliminar citada por los investigadores de Harvard-MIT indica que las enzimas transcriptasa inversas endógenas pueden facilitar la transcripción inversa de los ANR coronavirus y desencadenar su integración en el genoma humano.

Los autores sugieren que si bien las consecuencias clínicas requieren más estudio, los efectos perjudiciales son una posibilidad distinta y, dependiendo de los «sitios de inserción en el genoma humano» de los fragmentos virales integrados y del estado de salud subyacente de un individuo, podrían incluir «una respuesta inmune más grave … como una ‘tormenta de citoquinas’ o reacciones autoinmunes».

En 2012, un estudio sugirió que la integración del genoma viral podría «conducir a consecuencias drásticas para la célula huésped, incluyendo la alteración genética, la mutagénesis insertal y la muerte celular».

Corrigan hace un punto de decir que las vías hipotizadas para facilitar la retro-integración del ARN viral – o vacuna – en el ADN «no son desconocidas para las personas que entienden la biología molecular a un nivel más profundo».

Aun así, la discusión de la preimpresión sobre la transcripción inversa y la integración del genoma provocó una vorágine de comentarios negativos de lectores reacios a repensar el dogma biológico, algunos de los cuales incluso abogaron por la retractación (aunque las preimpresiones son, por definición, inéditas) con el argumento de que «teóricos de la conspiración … llevará este documento a la «prueba» de que las vacunas contra el ARNM pueden, de hecho, alterar su código genético».

Los lectores más reflexivos estuvieron de acuerdo con Corrigan en que el documento plantea preguntas importantes. Por ejemplo, un lector declaró que falta evidencia confirmatoria «para mostrar que la proteína de pico sólo se expresa por un corto período de tiempo (digamos 1-3 días) después de la vacunación», y agregó: «Creemos que este es el caso, pero no hay evidencia para eso».

De hecho, el tiempo que el ARNm sintético de las vacunas —y por lo tanto las instrucciones para que las células sigan fabricando proteína de espiga— persisten dentro de las células es una pregunta abierta.

Normalmente, el ARN es una molécula «notoriamente frágil» e inestable. Según los científicos, «esta fragilidad es cierta en el ARNm de cualquier ser vivo, ya sea que pertenezca a una planta, bacterias, virus o humanos».

Pero el ARN sintético en las vacunas COVID es una historia diferente. De hecho, el paso que finalmente permitió a los científicos y fabricantes de vacunas resolver su impasse de la vacuna contra el ARNM de décadas fue cuando descubrieron cómo modificar químicamente el ARNM para aumentar su estabilidad y longevidad, es decir, producir ARN «que se queda en la célula mucho más tiempo que el ARN viral, o incluso arneses que nuestra célula normalmente produce para la producción normal de proteínas».

Nadie sabe lo que está haciendo el ARNm sintético mientras está «dando vueltas», pero Corrigan especula que su mayor longevidad aumenta la probabilidad de que «se convierta en ADN».

Además, debido a que el ARNM de la vacuna también está diseñado para ser más eficiente al traducirse en proteínas, «los efectos negativos podrían ser más frecuentes y más pronunciados con la vacuna en comparación con el virus natural».

Señales de dólar

Corrigan reconoce que algunas personas pueden rechazar sus advertencias, diciendo: «Si el virus es capaz de lograr esto, entonces ¿por qué debería importarme si la vacuna hace lo mismo?»

Tiene una respuesta lista y convincente:

«Hay una gran diferencia entre el escenario en el que las personas al azar, y sin darse cuenta, tienen su genética en mono porque estaban expuestas al coronavirus, y el escenario en el que vacunamos deliberadamente a miles de millones de personas mientras les decimos que esto no está sucediendo».

Lamentablemente, la actitud predominante parece ser que la «carrera para vacunar al público» justifica la asunción de estos riesgos adicionales.

A mediados de noviembre, después de que el Jerusalem Post dijera a los lectores que «cuando el mundo comience a inocularse con estas vacunas completamente nuevas y revolucionarias, no sabrá prácticamente nada sobre sus efectos a largo plazo», un director de hospital israelí argumentó que no vale la pena esperar dos años más para eliminar los «riesgos únicos y desconocidos» o los posibles efectos a largo plazo de las vacunas contra el ARNM.

En los Estados Unidos, el entusiasmo por la tecnología de ARNm es igualmente sin restricciones. Apenas unos días después de que los CDC publicaran datos actualizados que mostraban que más de 2.200 muertes de personas que habían recibido las vacunas contra el ARNm Pfizer o Moderna habían sido reportadas a partir del 26 de marzo, The Atlantic elogió la tecnología, sugiriendo que la «ingeniosa» tecnología sintética de ARNM detrás de las vacunas COVID de Pfizer y Moderna representaba un «avance» que podría «cambiar el mundo».

En lugar de descartar la perspectiva de la integración retro del ADN extranjero como una «teoría de la conspiración», los científicos deberían estar llevando a cabo estudios con el ARNm vacunado para evaluar los riesgos reales.

Por ejemplo, Corrigan cree que si bien los datos in vitro en líneas celulares humanas (una de las fuentes de datos examinadas por los investigadores de Harvard-MIT) ofrecen resultados «herméticos», todavía hay una necesidad de demostrar concluyentemente la alteración genómica de la vida real a través de «PCR, secuenciación de ADN o Blot del Sur … ADN genómico purificado de pacientes con COVID-19″ y individuos vacunados.

Sin embargo, en lugar de abordar estas brechas de investigación, las empresas están salivando sobre el potencial de utilizar el ARNm editado por humanos para «comandar nuestra maquinaria celular» y «hacer casi cualquier proteína bajo el sol».

Un comunicado de prensa del 10 de marzo en el que se pronunciaban las vacunas contra el ARNM, los claros ganadores de la carrera vacunal COVID-19 señalaron que todas las principales compañías farmacéuticas están ahora «probando la tecnología [mRNA] mediante la celebración de acuerdos de licencia y/o colaboración con empresas de ARN bien establecidas».

En viejos dibujos animados de Disney, los espectadores a menudo presenciaban al tío rico del Pato Donald, Scrooge McDuck, «ojos abultados [se convierten] en signos de dólares de máquinas tragamonedas de Las Vegas de gran tamaño» al contemplar oportunidades para aumentar su ya inmensa riqueza.

A juzgar por la disposición de los ejecutivos de las compañías farmacéuticas a pasar por alto los riesgos a largo plazo y posiblemente multigeneracionales de las vacunas contra el ARNM, deben estar igualmente atraídos por visiones de signo de dólar de una interminable cartera de productos de ARNm «plug and play».

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might. • Children’s Health Defense

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

«Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas».

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: «¿Esta vacuna alterará permanentemente mi ADN?» La segunda pregunta es: «Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?»

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína «Spike». Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está «vacunado» porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es «neutralizado» y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser «transcrito» en el ADN. En nuestras células se encuentran enzimas llamadas «transcriptasas inversas». Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados «retrovirus». El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las «reglas» se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas «reglas» que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral «bare» es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como «yo» en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> «Es una vacuna contra el coronavirus una bomba de tiempo de marca.»

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

«No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos». Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

«Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje». Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

«Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica».

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines «hacer-bueno» -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

«Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

«Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas».
(«Esterilización masiva»: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?«, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

«No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo». («Esterilización masiva»: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente «La Tierra necesita menos gente, dicen los científicos»:

«Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el «problema del co2clima». … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

«Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática», escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. «Debe «estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social», escriben. («La Tierra necesita menos gente, dicen los científicos», Bloomberg)

Forbes publicó un artículo similar titulado «Más de 11.000 científicos declaran una emergencia climática». Aquí hay un clip corto:

«Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…». («Más de 11.000 científicos declaran una emergencia climática», Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

«Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de «contarla como es». Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…» («Advertencia de científicos mundiales de una emergencia climática» )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de «cero emisiones» de las élites y los «filántropos» autoanutados.»)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una «emergencia climática» que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de «poderes de crisis» especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una «vacuna a base de nanopartículas». En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

«El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos». («Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19»NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: «En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba «seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas».

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para «posible lista para uso de emergencia», lo que significa que podría implementarse más rápido en los países en desarrollo». (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa «Segunda Ola») nunca han excedido el promedio de 5 años de «muertes excesivas», que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la «Segunda Ola» como tonterías no científicas. Esto es lo que dice:

«Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una «segunda ola»y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una «segunda ola» en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una «segunda ola» este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una «segunda ola» y que el primer ministro había advertido, el 27 de abril, de una «segunda ola». Los profesores advirtió a cualquiera que hiciera predicciones seguras de una «segunda» y una «tercera ola» de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una «segunda ola» y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.» («El PCR pseudo-epidemia falsa «, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero «había un plan para uno», es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a «centros de pruebas masivas» de propiedad privada que reemplazaron a «científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) «» «principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas». Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una «pseudoequipción de falso positivo PCR». Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

«En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.» Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: «¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de «casos» diarios y una «segunda ola» sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?»

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

«Un «caso» es una prueba positiva de PCR. No hay síntomas involucrados. Un «ingreso COVID-19» a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una «muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.»

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como «Covid». ¿Entiendes? Yeadon resume este pañuelo en una frase:

«Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.» (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR «que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.»)

Según Yeadon y su equipo de investigadores independientes:

«La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los «casos» reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la «ondulación secundaria» … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.» («The PCR False Positive Pseudo-Epidemic» Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

«Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

«La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes», dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…»Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario», concluyó Briand». («Una mirada más cercana a las muertes de EE.UU. debido a COVID-19»JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.


Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el «escepticismo» o la «vacilación» como una «amenaza para la seguridad nacional». No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría«inteligencia militar para buscar y erradicar lo que El Times llama «militantes antivacunas» y «contenido propagandístico» relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. («El Gran Reinicio»). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

«No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que «alrededor del 30% de la población tenía inmunidad previa», y si uno incluye a algunos niños pequeños que son «resistentes», el 40%, y si bien considera que la tasa de infección está «en algún lugar [de unos 20 a 30 por ciento», esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, «esa población ya no puede soportar un brote creciente de enfermedad», y por lo tanto el virus «disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal». («Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente»LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son «toda la rabia».

«La formación de los llamados «anticuerpos no neutralizantes» puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, «salvaje» después de la vacunación.»

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.» («That Was Quick», Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden«desencadenar una reacción inmunitaria» que «resultará en infertilidad». (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser«potencialmente mortal».
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa «seguro». Todo lo contrario. La FDA es «capturada» de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta «clase de parásitos» ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.»

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.»

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.»

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de «información de secuencia» porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible «aislar» un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos «infectaron» varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.»

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este «virus» secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

«No observamos ninguna liberación del virus del lado basolateral de la cultura HAE».

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de «origen desconocido».

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.»

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba «ahí». Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

«Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas»

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.»

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado».

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.»

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.»

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.»

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del «virus». Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, «esta afirmación sugiere que cada prueba debe ser positiva», (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

«Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.»

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada «basura», ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

«Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.»

La definición legal de una conspiración es:

«Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo»

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada «nueva normalidad», que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos «esperando en las alas» en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.