La narrativa «segura y efectiva» se está desmoronando (COVID)

Por Steve Kirsch

Aquí está mi lista de casi 100 indicadores de que la narrativa «segura y efectiva» se está desmoronando.

Es una lista devastadora.

Y por alguna razón, nadie quiere verificarme.

Le tomará 42 minutos leer todo lo que es demasiado largo para la mayoría de las personas, así que siéntase libre de elegir lo que lee para tener una idea de la lista completa.

Este es un artículo de «fregadero de cocina» que enumera algunos de los mejores ejemplos que muestran que la narrativa se está desmoronando.

Siéntase libre de crear obras derivadas de esta lista (p. ej., elija su conjunto de argumentos más convincentes).

  1. El director anterior de los CDC está hablando ahora sobre la mala conducta . “Estoy muy decepcionado con la comunidad científica liderada por [los Institutos Nacionales de Salud] que realmente se han esforzado desde el principio para tratar de minimizar a cualquiera de nosotros que tenga una hipótesis diferente”, dijo.
  2. Las personas dentro de los CDC, la FDA y los NIH están disgustadas con lo que está sucediendo. Esta es la mejor evidencia del progreso. Los números están aumentando, no disminuyendo. Lea este artículo: Los expertos en salud están renunciando en masa a los NIH y los CDC porque les avergüenza la «mala ciencia», incluida la vacunación de niños menores de 5 años para «hacer que sus consejos sean aceptables para la Casa Blanca», afirman los médicos , este artículo de The Defender , y este artículo :Imagen
  3. Las muertes por vacunas ahora son simplemente demasiado masivas para seguir escondiéndolas/explicándolas:
    1. Cuatro médicos en Ontario murieron justo después de la cuarta dosis . Este es un evento del Cisne Negro. Estos están sucediendo en todas partes, por supuesto, pero están siendo enterrados. También habría sido enterrado en Ontario, pero alguien armó el patrón. Tenga en cuenta que esto no está en ningún medio de comunicación principal.
    2. Ver » Abre los ojos. Esto está pasando en todas partes «. El subtítulo dice: Retroceso por las muertes en Escocia e Italia; Wayne Allan Root ha perdido a 33 amigos, todos «vacunados», por muerte o enfermedad en los últimos 18 meses; y la presentadora de televisión Kate McCann se desploma, ¡en vivo!
    3. Exceso de muertes no relacionadas con Covid: ¿por qué están aumentando? Los expertos piden una investigación a medida que aumentan las tasas de mortalidad en Inglaterra y Gales a pesar de la caída en las muertes por coronavirus
    4. El exceso de muertes está en aumento, pero no debido a CovidLos datos de la Oficina de Estadísticas Nacionales llevan a los expertos en salud a pedir una investigación urgente sobre qué está causando el exceso de mortalidad
    5. Inglaterra: exceso de muertes en aumento, pero NO debido a COVID: los expertos piden investigación
    6. ¡También está sucediendo en Irlanda! ¿Cómo pueden explotar las enfermedades cardíacas en los niños solo después de que se implementen las vacunas para niños ? Los expertos están desconcertados en cuanto a qué podría estar causando un aumento repentino de enfermedades cardíacas en los niños que está ocurriendo solo en lugares que han implementado las vacunas contra el COVID para niños. Por alguna razón, ya no les sucede a los niños en Uruguay (tal vez el juez que detuvo el programa de vacunas podría tener algo que ver con eso).
    7. Causas desconocidas es ahora la principal causa de muerte en Alberta, Canadá . No era así antes de que se lanzaran las vacunas. Los expertos descartan eso como «oh, eso es porque las personas que han tenido COVID son más susceptibles de morir». Pero, ¿por qué serían más susceptibles de morir por causas DESCONOCIDAS ? ¿ Y por qué solo los vacunados mueren por causas desconocidas?? Y si esto se debe a la infección por COVID, ¿cómo es que no está sucediendo en ningún país con una baja tasa de vacunación de COVID? ¿Y cómo explican los expertos los extraños coágulos de sangre que solo se encuentran en las personas vacunadas? La prensa todavía se olvida de hacer estas preguntas críticas. Pero al menos los principales medios de comunicación están cubriendo la misteriosa causa de las muertes. Es un comienzo. Pero están permitiendo explicaciones de «agitar la mano» cuando los «expertos» simplemente están inventando estas cosas sin datos que las respalden. Cualquier “experto” que hable con los pacientes sabe que los efectos secundarios de la vacuna son mucho mayores que los del COVID. Entonces, ¿cómo es que nuestro “experto” ni siquiera considera la vacuna como una posibilidad? Vemos los titulares casi a diario ahora de celebridades que mueren «inesperadamente» por causas «desconocidas», por lo que esta «nueva» categoría que es la número 1 ya no debería ser una sorpresa. Y les garantizo que les está pasando a montones de personas «menos conocidas» también: esas personas no generan los titulares. Pero, ¿alguna vez en su vida ha leído sobre tantas causas de muerte “inesperadas”? Recibí dos que me enviaron hoy: Busi Lurayi (36 años murió repentinamente) y el rapero Tumi Tladi (30 años, murió mientras dormía). Dos en un día, ambas celebridades internacionales de Sudáfrica?!?! ¿Cuáles son las posibilidades de que eso suceda al azar?:
    8. Los embalsamadores están viendo coágulos de sangre en más del 50 % de los pacientes que nunca habían visto en sus carreras . No es causado por COVID porque solo comenzó después del lanzamiento de la vacuna y los coágulos solo se encuentran en pacientes vacunados. Entonces, ¿cómo explican eso los expertos?
    9. Hubo un aumento del 163% en las reclamaciones de seguros de vida en Lincoln National , pero ese artículo no tuvo en cuenta que hubo una fusión (por lo que también aumentaron las primas). Son la quinta compañía de seguros más grande de los Estados Unidos. El número correcto en el que centrarse es el índice de siniestralidad que aumentó en toda la industria. La tasa de siniestralidad es en lo que hay que centrarse. En el cuarto trimestre de 2021, toda la industria experimentó un aumento del 40 % con respecto al índice de siniestralidad de 2019 y se estabilizó a alrededor del 20-25 % en el primer trimestre. Escuché que todavía hay un cambio de mezcla en el segundo trimestre de mayor a joven y que el exceso de mortalidad se ha reducido un poco. Eso no es COVID. COVID no mata en ningún lugar cerca de esa cantidad de personas. ¡Estamos viendo al asesino más grande de la historia y nadie puede descubrir qué es! Mira este video. Nunca verás una historia sobre esto en los principales medios de comunicación; lo ignoran. Tenga en cuenta que parte del aumento de siniestros se debe a aumentos de primas (adición de nuevos clientes).
    10. Mire el video aquí del CEO de OneAmerica, Scott Davison . Los verificadores de hechos afirman que todas estas muertes en exceso se deben a COVID y tratamientos médicos diferidos. Pero las personas de 18 a 64 años rara vez mueren de COVID, por lo que no puede ser COVID. Y si pospuso la atención médica, esto debería aumentar lentamente con el tiempo y comenzar a disminuir a medida que las personas regresaran a la oficina. Debería pinchar así. Así que las explicaciones no encajan. Y no explican los cientos de anomalías descritas aquí y en mi artículo de difusión de información errónea . Si todas las muertes se deben a esas dos causas, ¿por qué mis encuestas realizadas por empresas encuestadoras profesionales muestran constantemente que mueren tantas personas por COVID como por la vacuna?
    11. Las compañías de seguros de vida en países de todo el mundo están reportando cifras récord de exceso de muertes. Estas no son «fluctuaciones estadísticas». Todas las muertes son causadas por una gran intervención que está afectando la salud de millones de personas. Y es todo nuevo. Nada como esto sucedió antes de 2021. Nada de esta magnitud NUNCA ha sucedido en su historia (que se remonta a más de 100 años).
    12. Nadie responderá ninguna de las preguntas que publiqué en mi artículo sobre cómo detener la desinformación . Cuanto más dure esto, más sospechosas se volverán las personas.
    13. Las muertes de GoFundMe por accidentes cerebrovasculares y otras causas inusuales en jóvenes están por las nubes. Un lector escribió: “Escuché en mi radio local acerca de un go fund me para una señora que estaba atrapada en Tasmania porque tuvo un derrame cerebral masivo en las vacaciones, así que decidí buscar la cantidad de páginas de GoFundMe para jóvenes y niños . que han tenido ataques fue alucinante , también un montón de páginas de reacciones adversas a la vax”.
  4. ¿Cómo es posible que los fabricantes de ataúdes para niños vean repentinamente un aumento del 400 % en la demanda justo después de que se anuncien las vacunas para niños? Se supone que sucede lo contrario: una caída dramática en el negocio. En cambio, es al revés. ¿Cómo van a explicar ESE? No pueden, por lo que nunca será cubierto por los principales medios de comunicación. Lea la historia de Etana Hecht sobre uno de los mayores fabricantes de ataúdes de América del Norte que informó un aumento del 400 % en ataúdes de tamaño infantil desde diciembre de 2021 este artículo, «PEDIDOS SIN PRECEDENTES de ATAÚDES PARA NIÑOS » . Se compran a granel por primera vez .después de 30 años de estar en el negocio. ¿Podría ser una coincidencia? La historia dice que todos los directores de funerarias ven la conexión… todos los directores de funerarias saben que la vacuna está matando a los niños, pero no se les permite hablar de eso, ya que sería malo para los negocios ser antivacunas. El gobierno cubre el costo de la vacuna, pero no compensa a nadie por la pérdida de su hijo o incluso los costos del funeral. Así de cariñoso es nuestro gobierno.
  5. Incluso John Campbell, que está a favor de las vacunas , admite que un número preocupante de muertes excesivas inexplicables no solo está ocurriendo en el Reino Unido: está ocurriendo en todo el mundo . Solo escucha los primeros 30 segundos de este video . Por supuesto, los CDC no están investigando nada a pesar de que las compañías de seguros de vida estadounidenses informan muertes fuera de lo común. El CDC NUNCA va a investigar esto. Es más grande que el COVID y saben muy bien lo que es. Es por eso que NO van a investigar y The NY Times NUNCA los va a culpar por esto. Después de todo, es solo la mayor causa médica de muerte en nuestra historia.
  6. El cambio general en la causa de muerte de respiratoria a cardíaca es imposible de ignorar y no se puede explicar si las vacunas son «seguras y efectivas». Un amigo mío que vive en Massachusetts se dio cuenta de esto después de que hizo una solicitud de FOIA para los registros de defunción en Massachusetts. Observó las causas de muerte codificadas por ICD-10 y notó que las causas de muerte cambiaron principalmente de «códigos J» (respiratorias debido a COVID) a «códigos I» (circulatorias debido a la vacuna) . Ahora nos enteramos de que sucedió exactamente lo mismo en el Reino Unido en 2021 según las cifras oficiales del gobierno del Reino Unido.. Este es un efecto enorme y debe haber una causa, pero las autoridades sanitarias simplemente están desconcertadas y no pueden explicarlo (porque no se les permite culpar a la vacuna ya que eso haría quedar mal a todos). Es seguro decir que tal cambio nunca ha ocurrido antes en la historia. Claramente, algo nuevo sucedió a partir de 2021 que afectó a un gran número de personas en todo el mundo. Me pregunto qué podría haber sido eso. Las autoridades sanitarias simplemente no pueden encontrar nada nuevo en 2021.
  7. Las lesiones por vacunas de los niños pequeños que ahora tienen convulsiones no se pueden explicar. Esto ahora es una ocurrencia regular para que los niños de 2 y 3 años tengan convulsiones. Solo ocurre en niños vacunados y, con mayor frecuencia, entre 2 y 5 días después de la vacunación con la vacuna COVID. Los médicos no pueden informar estos eventos públicamente (no pueden compartir en las redes sociales ni hablar con la prensa), por lo que cada médico piensa que es simplemente un evento «único» que SOLO les está sucediendo a ellos. Si a los médicos se les permitiera hablar en público, se darían cuenta del patrón masivo. Por eso los hospitales amordazan a los médicos: para que nadie se entere. Tenemos múltiples informes de estos de enfermeras directamente de enfermeras que tienen miedo de que sus cuentas de redes sociales estén siendo monitoreadas. A los padres se les dice que es solo «mala suerte» y los padres creen lo que les dicen.
  8. Los países están empezando a darse cuenta de que las tasas de natalidad están cayendo y que hay más mortinatos. Suecia, Reino Unido, Alemania, etc. Ver mi artículo sobre tasas de natalidad .¡Superar! Nada que ver aquí, amigos.
  9. Las muertes y lesiones están ocurriendo a la vista de todos sin una explicación plausible para todas las coincidencias. Todos los eventos solo les suceden a las personas vacunadas, pero debido a que la prensa nunca menciona el estado de vacunación de las personas que «mueren inesperadamente», el público nunca se da cuenta del patrón:
    1. Piensa en todos los conciertos de rock que han sido suspendidos o cancelados por razones médicas. Justin Bieber, Santana,… Brett Michaels. Nunca dan la causa como la vacuna, así que tienen que inventar algo ( Santana ) o simplemente negarse a revelarlo ( Michaels ). Alguien me envió una lista de otros cuatro conciertos que fueron cancelados en los últimos meses. Esto no es gente normal. Pero la mayoría de la gente nunca asiste a conciertos de rock en diferentes partes del país, por lo que nunca se dan cuenta. Además, Santana canceló seis próximos conciertos para recuperarse de la deshidratación. Todos los médicos con los que hablé dijeron que eso no tiene sentido. En el peor de los casos, recibiría fluidos intravenosos y volvería a la normalidad en unas pocas horas. Así que la explicación no encaja. Pero otras celebridades están hablando sobre sus lesiones por vacunas, comoEric Clapton , pero no están bien publicitados (el video de Clapton tiene solo 66,000 visitas al 11 de julio de 2022).
    2. Consulte este artículo sobre músicos de rock que resultaron heridos después de recibir un pinchazo.
    3. ¿Cómo pueden abandonar tantos ciclistas del Tour de Francia vacunados? Nunca hemos visto esto antes. No tiene precedentes. Sólo les ocurre a los ciclistas vacunados. Sin investigaciones. Todo el mundo está desconcertado en cuanto a la causa.
    4. Piense en todas las muertes de celebridades en 2021 y 2022. Estas nunca se ocultan; no pueden ser Lo que nunca mencionan es el número total de muertes inesperadas y nunca mencionan el estado de vacunación de los fallecidos. Pero no pueden ocultar el número total. Esta es una buena manera de rastrear si el exceso de muertes está aumentando o disminuyendo porque el gobierno no puede falsear estos números porque están a la vista.
    5. Los jóvenes prácticamente nunca mueren mientras duermen. Cuando ves que esto sucede una y otra vez, no es un accidente. Cuando ves que les sucede a las celebridades, es aún más notable e imposible de encubrir, como la muerte de Dani Hampson, quien murió mientras dormía el día de su boda. No solo fue la muerte de una celebridad, sino también la muerte de una «persona joven que murió mientras dormía», un cisne negro. Muchos estadounidenses se dan cuenta de lo que está pasando. Puedes ver esto mirando los comentarios de Twitter.
    6. Los atletas mueren a plena vista a una tasa 22 veces mayor que la normal . Hoy, el exdefensor de la NHL, Bryan Marchment, murió “inesperadamente”. Pero pocas personas están rastreando esto, por lo que no tienen idea de que las tasas son mucho más altas. Parece un poco extraño. Atribuyen causas realmente extrañas a estas muertes como morir por “golpe de calor accidental” en su propia casa . Lo consulté con una enfermera. Esto nunca sucede. Pero vamos a ver mucho de esto ahora.
    7. Incluso los conductores jóvenes de UPS, como Estegan Chavez, Jr., de 24 años, mueren mientras entregan paquetes que no son tan exigentes físicamente. Y si consulta con cualquier conductor de UPS, mantienen sus camiones abiertos de par en par, lo que hace que sea prácticamente imposible morir por un golpe de calor. Y estas son solo las muertes de las que escuchas.
    8. Los pilotos están teniendo eventos a un ritmo sin precedentes, pero las aerolíneas se niegan a evaluar a los pilotos por problemas cardíacos. Cuando el capitán de American Airlines, Bob Snow, tuvo un problema cardíaco justo después de aterrizar , ni siquiera recibió una llamada del director general de American Airlines. La FAA no requerirá una evaluación piloto. Ellos saben exactamente lo que encontrarían. Entonces miran para otro lado y no dicen nada y fingen que estos eventos nunca sucedieron. Los pilotos lo saben. Cualquier miembro del público con un cerebro en funcionamiento puede resolver esto. Pero asumimos que la FAA es honesta y hará lo correcto. Gran error. La FAA fue notificada oficialmentey no han hecho absolutamente nada al respecto. Simplemente lo ignoraron como si nunca hubiera sucedido. El Congreso está haciendo lo mismo: no están responsabilizando a la FAA porque saben que los haría quedar mal. Todo el mundo confía en que nadie se entere nunca. Después de todo, encubrieron el hecho de que el gobierno de EE. UU. creó el virus en primer lugar, por lo que el razonamiento es que pueden encubrir todos los eventos cardíacos y muertes de pilotos.
    9. Las encuestas ( como esta ) muestran consistentemente que menos del 50% de los estadounidenses están dispuestos a recibir más inyecciones de la vacuna. La mayor parte de Estados Unidos está al tanto, aunque ninguna de las personas de los medios lo esté. Como resultado, el gobierno está desechando decenas de millones de dosis de vacunas debido a la demanda insuficiente (razón por la cual Peter Marks, de la FDA, dijo que haría cualquier cosa menos debatir con la oposición para reducir la vacilación de las vacunas. Así que, básicamente, literalmente estamos desechando miles de millones de dólares de dinero de los contribuyentesproducir un producto que nadie quiere. ¿Hay alguien en el Congreso quejándose del despilfarro del gobierno?: No. Ni una sola persona. ¿Alguien en los principales medios de comunicación está señalando que es estúpido pedir un producto que nadie quiere? No. Nadie en los principales medios de comunicación va a publicar un artículo de opinión como ese. Todos simplemente siguen adelante como si nada estuviera mal.
    10. Los amigos jóvenes sanos de People están teniendo problemas médicos a un ritmo sin precedentes (aunque no todos se dan cuenta de esto). Por ejemplo, hoy supe que uno de los empleados de nuestro club de campo (obligado a vacunar) que yo conocía murió de un derrame cerebral a los 52 años. Un joven candidato para el Senado de los EE. UU., John Fetterman , sufrió un derrame cerebral después de su vacunación. Puede que nunca se recupere.
    11. Cada vez que hacemos encuestas de audiencia, cada audiencia siempre informa una tasa de muerte comparable o en exceso por la vacuna frente a COVID. Entonces, incluso si no lo ve usted mismo, las encuestas de audiencia en vivo son muy convincentes ya que no hay «sesgo» en estas encuestas en vivo. Nadie, excepto los «difusores de información errónea» como yo, está dispuesto a hacer las encuestas por alguna razón.
  10. Las encuestas de usuarios realizadas por firmas de encuestas profesionales de terceros muestran consistentemente que las vacunas han matado a más personas que COVID . El NY Times 60 Minutos, etc. todos se niegan a hacer las encuestas ellos mismos. No quieren que nadie lo sepa. Nuestro próximo paso es utilizar una organización de encuestas de renombre para promover este resultado, de modo que no provenga de los «antivacunas». Esa encuesta debería ser imposible de ignorar para cualquiera. Nunca hemos realizado una sola encuesta que muestre que todo está bien y que las vacunas son perfectamente seguras. Es por eso que los principales medios de comunicación nunca harán estas encuestas. Pero la mayoría de la gente no se da cuenta de que deliberadamente no están haciendo estas encuestas. Sin embargo, puede ser difícil para nosotros hacer esto. Ha habido encuestas mucho menos devastadoras realizadas por las grandes firmas de encuestas y se niegan a permitir que se utilicen los resultados cuando descubrieron que estaban en contra de la narrativa. La razón es simple: sería malo para los negocios publicar una encuesta de este tipo porque todos dejarían de usarlos porque son «malvados». Es por eso que el público nunca ve encuestas sobre la seguridad de las vacunas: los medios no las encargarán y los encuestadores no las harán. ¡Agradecemos que se demuestre que estamos equivocados en esto!
  11. Los mandatos se están desvaneciendo a pesar de que las tasas de COVID están aumentando. Por ejemplo, vea esta historia sobre lo que está sucediendo en partes de Australia donde se están retractando de sus recomendaciones anteriores sin disculparse en absoluto:
    1. Mandatos de vacunas que desaparecen: ninguna disculpa de nuestros funcionarios de salud pública que alguna vez fueron tan entusiastas
  12. La evidencia muestra que COVID se creó en un biolaboratorio financiado por el gobierno de EE. UU. Esa es la evaluación directa del presidente de la comisión independiente encargada de investigar la causa. El profesor Jeffrey Sachs fue responsable de la investigación independiente de Lancet. Él dijo: “Presidí la comisión de The Lancet durante 2 años sobre Covid. Estoy bastante convencido de que salió de un laboratorio de biotecnología de los Estados Unidos”. Nunca encontrará esa declaración en ningún lugar de los principales medios de comunicación estadounidenses. ¿Cómo podría no estar cubierto? Pero en este video , también dijo que no hay absolutamente ningún interés en aprender más , no de ningún país en todo el mundo. Eso te dice todo lo que necesitas saber. ¿Cómo puede no haber interés en aprender más? La única forma en que no puede haber interés en aprender más es si el gobierno de EE.UU. lo hizo . Consulte este artículo en Science que intenta hacer que Sachs parezca el villano: «Las peleas por la promesa de confidencialidad y los conflictos de intereses destrozaron la investigación del origen de COVID-19: los ex miembros del grupo de trabajo de The Lancet desafían por qué el economista Jeffrey Sachs disolvió el esfuerzo «. Sachs se da cuenta de que Daszak está en conflicto y Daszak no producirá documentos que muestren un conflicto. ¡Así que el panel se pone del lado de Daszak! Es completamente sorprendente que casi todo el panel esté en conflicto y corrupto. Sachs emerge como el héroe aquí. Pide una mayor investigación por parte de una comisión imparcial .debido a la evidencia irrefutable de un contrato que “supuestamente” nunca fue financiado. Nadie lo acepta porque tiene razón; lo que quieren es una investigación corrupta solamente. El contrato encaja como anillo al dedo en el origen del COVID y la defensa de Daszak es que la obra “no estaba financiada. Por lo tanto, el trabajo no se hizo. Simple. Pero no es tan simple como eso (como señala el artículo ). Parece muy claro que Daszak está mintiendo. Verifiqué dos veces con un ex empleado de EcoHealth Alliance que estaba en condiciones de saberlo. Él fue inequívoco. Tienes que tener datos para obtener financiación en estas propuestas. La conclusión es que no se debe confiar en Peter Daszak ya que él está involucrado. Hay más, pero lo dejaremos así por ahora.
  13. Las lesiones por vacunas ahora se compensan en otros países con grandes pagos , pero no en Estados Unidos. No le hemos pagado un centavo a nadie, a pesar de los miles de solicitantes (la mayoría sabe que es inútil presentar una solicitud y no se molesta). Entonces, ¿cómo pueden las vacunas dañar a las personas fuera de los Estados Unidos, pero no dañar a nadie que haya recibido una inyección dentro de los Estados Unidos? Eso es simplemente imposible si no hay un encubrimiento del gobierno. No existe una supervisión de terceros del programa de compensación de vacunas en Estados Unidos y nadie en el Congreso (excepto el senador Ron Johnson) piensa que los pagos cero a los millones de estadounidenses que murieron, quedaron discapacitados o lesionados es un problema.
  14. Nuestras encuestas muestran consistentemente que más de 1 millón de estadounidenses han resultado lesionados o discapacitados tan severamente por las vacunas que no pueden trabajar, pero el Congreso cree que una compensación de $0 es apropiada. Vea este análisis esta historia esta historia los datos de la encuesta en este artículo .
  15. Las investigaciones más extensas jamás realizadas sobre una muerte, 14 meses de investigación intensiva, han demostrado que las vacunas matan a las personas. Jack Last, de 27 años, de Stowmarket, fue vacunado el 30 de marzo de 2021 y murió días después. Se necesitaron 14 meses de investigación para determinar que la vacuna lo mató .
  16. Ed Dowd fue entrevistado por The Defender and the CHD Roundtable e hizo los siguientes puntos:1. Las reclamaciones de vida grupales provienen de un grupo demográfico más joven y empleado que no muere ni por COVID ni por suicidio2. Este grupo, en su mayoría de la generación del milenio, alimentó «una guerra de Vietnam silenciosa» en términos de conteo de cadáveres (61,000 en 2021, no se indica cuántas compañías de seguros contaron)3. La conexión con los disparos se demuestra mediante las gráficas de “palo de hockey” de muertes versus tiempo claramente marcadas por mandatos y refuerzos: la pistola humeante4. Los directores ejecutivos que ordenaron los disparos son reacios a publicar su responsabilidad por matar a sus empleados.5. La catástrofe financiera llevará estos datos a las noticias principales tarde o temprano
    . 6. Ed estaba trabajando directamente con actuarios y ejecutivos de seguros contando específicamente las reclamaciones de vida grupales, no solo las muertes entre la población general. Las tasas exponenciales de cambio marcadas por las fechas de lanzamiento de la vacuna, las implementaciones obligatorias y los refuerzos apuntan a la inferencia de la vacuna para estas muertes informadas de esta manera. El argumento es difícil de rebatir. «Pistola humeante», como él dice. Estos son datos duros de la industria de seguros: dinero pagado. Es por eso que esto es tan impresionante y al grano.7. No hay respuesta de ningún verificador de datos al respecto.
  17. Los ex médicos muy respetados como la Dra. Naureen Shaikh en Sausalito han visto suficiente y ahora están dispuestos a salir del clóset y hablar sobre las lesiones por vacunas, aunque signifique el final de su carrera en medicina.
  18. Los artículos escritos por científicos respetados como Peter Doshi son criticados por personas que se niegan a rendir cuentas públicamente por sus comentarios. Lea este artículo del profesor Norman Fenton que resume los argumentos falsos que se han hecho para difamar a estos científicos que dicen la verdad, » Respuesta al video de Susan Oliver «Antivaxxers engañados por p-hacking y comparación de manzanas con naranjas «. Casi definitivamente, el “documento de Doshi” no se publicará por las razones explicadas en este artículo por Phil Harper . Susan Oliver, que es notablemente inepta, no tendrá una discusión con Fenton y es bastante obvio quién está difundiendo la información errónea para cualquiera que dedique tiempo a esto. En lugar de desafiar a Fenton, Susan produce un segundo video . susanaresumió su opinión sobre el artículo en este tuit (que incluía el enlace al video) que fue retuiteado por personas como el Prof. Sir David Spiegelhalter (un experto mundialmente reconocido en probabilidad y riesgo) y el Prof. Peter Hansen (Econometrista, Científico de Datos y Latene Profesor Distinguido de Economía en la UNC, Chapel Hill). Hansen y Spiegelhalter también se niegan a hablar con Fenton. A Fenton le ENCANTARÍA chatear con cualquiera de estas personas en una conversación grabada para poder hacerles preguntas clave, pero todos tienen miedo de ser desafiados: simplemente arrojan piedras y luego se esconden . Así es como funciona la “ciencia” hoy en día.
  19. Aunque no se publicarán estudios clave que destruyan la narrativa del gobierno (como se señaló en el punto anterior), los científicos lograron publicar más de 1250 artículos en revistas médicas sobre eventos adversos graves causados ​​por las vacunas contra el COVID .
  20. Dos adolescentes mueren mientras dormían en diferentes estados días después de la vacunación y el documento concluye que las muertes fueron causadas por la vacuna. Está publicado en una revista médica revisada por pares . No hay cobertura de esto en los principales medios de EE.UU. Lo mejor que pudimos encontrar es este informe sobre NTD News . Lea los comentarios en ese tweet que incluyen: “La mamá de mi amigo se despertó aterrorizada, sin poder respirar. Su esposo estaba a su lado y llamó al 911, pero ella se fue por un paro cardíaco. Ella tomó un refuerzo la mañana antes de que esto sucediera.. Duele especialmente pensar que un niño, solo, pasó por esto. Me arranca el corazón”. Los principales medios de comunicación de EE. UU. seguirán ignorando todas estas muertes para que, cuando les sucedan, la gente piense que es solo su «mala suerte», pero estas historias se están filtrando en medios alternativos.
  21. El experto en vacunas más respetado del mundo, el Dr. Paul Offit, admitió públicamente en un video de YouTube que todo el proceso de revisión externa de la FDA es una completa farsa . La FDA no revisa los datos, le entregan al comité cientos de páginas justo antes de la reunión (sabiendo que de esa manera el comité no puede revisarlas) y luego los acosan para que aprueben las vacunas sin ningún dato de eficacia. Offit admitió que si hubiera una opción de «diablos no» para su voto, eso es lo que habría hecho. Efectivamente, dijo que los demás en el comité están descerebrados porque no había datos de eficacia para justificar la aprobación: estos miembros del comité básicamente votan «sí» porque eso es lo que se espera que hagan y quieren permanecer en el comité. El gobierno ordena el medicamento incluso antes de pedirle al panel de la FDA que revise los datos, lo que demuestra que todo el «proceso de revisión» es una completa farsa. El propio Offit aún no se ha dado cuenta de que las vacunas no son seguras. No tendrá esa discusión con nadie de nuestro lado. Sin embargo, Paul Offit ignora por completo el hecho de que si no hay muertes, no puedes salvar ninguna vida. Por ejemplo, sabemos por los datos de muertes de Massachusetts que no hubo muertes en 2020 y 2021 para las edades de 5 a 11 años (solo hubo una muerte codificada como muerte por COVID, pero contactamos a la familia y descubrimos que no era cierto). Entonces, ¿cómo es que hay un «problema»? Nadie quiere hablar de eso. Ni siquiera saben que no hubo muertes en un estado grande como Massachusetts.
  22. Los padres se están volviendo sabios con el esquema. Solo el 1,3 % de los niños elegibles menores de 5 años han recibido una o dos dosis de una vacuna, según datos de los CDC (consulte este artículo de La Gran Época para obtener detalles sobre el fracaso de los CDC para engañar a los padres para inyectar a sus hijos).
  23. Pierre Kory me dijo que un médico convencional que conoce le admitió confidencialmente que las actitudes están cambiando ahora. Los médicos ahora se dan cuenta de que les han mentido, pero nadie tiene el coraje de hablar al respecto ya que perderían su licencia. Así que se callan. Pero la mayoría sabe que las vacunas están matando y lesionando a personas de todas las edades.
  24. Una de mis amigas enfermeras dijo que cuando un niño tuvo un incidente cardíaco recientemente, todo el departamento de trauma pensó en «lesión por vacuna» tan pronto como escucharon que había un adolescente con un problema cardíaco. Sin embargo, ninguno de los miembros del departamento de trauma reconocerá nada de esto públicamente porque saben que serán despedidos por admitir la verdad.
  25. Los médicos ahora están dispuestos a reunirse con miembros del Congreso e informarles sobre lo que está sucediendo. Por ejemplo, ahora tengo 25 médicos en California dispuestos a arriesgar sus carreras para hablarles a los miembros del Congreso en California. Estos médicos trabajan en hospitales de todo California. No es local.
  26. Los funcionarios de salud pública ahora están dispuestos a ser entrevistados por mí. Tengo uno para el lunes 11 de julio. ¿Puedes creerlo? ¡Un funcionario de salud pública que responderá mis preguntas! no puedo esperar
  27. Alex Berenson se reencarnó en Twitter . Twitter admite que lo eliminaron por error (después de que le dijeron a Alex que habían revisado «cuidadosamente» sus tweets y los encontraron problemáticos). Todos los demás en Twitter Heaven extrañaremos tener a Alex cerca.
  28. Un documental de la BBC no puede obtener una simple estadística de vacunación correcta (el porcentaje de no vacunados). Pero para su crédito, lo corrigieron después de que el profesor Fenton señalara el error . ¡Eso es progreso porque muestra que la verdad realmente está comenzando a importar ahora! Susan Oliver es mucho peor que la presentadora del programa de la BBC, Hannah Fry. Ninguno de ellos va a debatir nunca con Norman Fenton. Nadie lo hará.
  29. La revista Science admitió tácitamente que ya no están haciendo ciencia. Solicitamos que pidan una corrección o retractación de un documento obviamente defectuoso . La solicitud fue realizada por un profesor británico muy respetado, Norman Fenton. ¡Lo ignoraron! En resumen, la ciencia basura está bien para su revista. Realmente creo que deberían cambiar el nombre de su revista a «Ciencia basura», ya que eso sería más preciso. Pero está claro que no les importa la precisión. Puede estar seguro de que se quedarán callados sobre este papel basura. Así es como funciona la “ciencia” hoy en día.
  30. Hablé con el director ejecutivo de un hospital cerca de mí. Tan pronto como le envié información sobre el peligro de la vacuna y le sugerí que podría ser un líder mundial al ser el primer director general de un hospital en admitir la verdad, dejó de hablarme. Así que en realidad promete que incluso me respondió a pesar de que ya no lo hace. Ninguno de ellos quiere ser el primero. Todos quieren conservar sus puestos de trabajo. Tu vida no es importante para ellos.
  31. De hecho, conseguí que un reportero del San Jose Mercury News respondiera a un correo electrónico que envié. En realidad todavía estamos conversando. Chico, eso es lo primero.
  32. Los verificadores de datos ahora me tienen miedo. ¿Por qué? Porque me hice inteligente y ahora insisto en grabar todas las conversaciones. Ahora todos se niegan a hablar conmigo. Porque la verdad no es su enfoque. Escucha esta grabación. Después de hacer esta grabación, ningún verificador de datos se puso en contacto conmigo. Y sí, fue una grabación legal; ellos no discuten eso. Aquí está la historia y un enlace a la grabación . Ahora, ningún verificador de hechos me hablará ni me debatirá sobre los hechos. Maldito.
  33. El público de los EE. UU. NO puede saber qué hay dentro de las vacunas COVID. Una FOIA al gobierno británico confirmó que «la composición cuantitativa completa de todas las vacunas COVID-19 está exenta de la divulgación de la FOI». En Uruguay, un juez ordenó suspender las vacunas hasta que se revele el contenido . Aquí una historia con más detalles sobre la situación en Uruguay. Sin embargo, en los EE. UU., está perfectamente bien exigir la vacunación de los estadounidenses con sustancias que las personas no pueden conocer. Las personas que hacen el mandato ni siquiera saben lo que hay dentro de la vacuna. Ellos también están completamente despistados. Así es como funciona. Después de todo, es importante que el público (y las autoridades que ordenan) NO conozcan la verdadera composición porque si la supieran, nadie la tomaría. Por eso hay que mantenerlo en secreto. ¿Consíguelo? Es por tu propio bien. Básicamente tenemos que confiar en las compañías farmacéuticas, aunque tengan un historial de fraude y productos defectuosos. Después de todo, si no puedes confiar en Pfizer, ¿en quién puedes confiar? ¿No te hace querer confiar en ellos?
  34. Estamos aprendiendo de enormes conflictos de intereses con pagos de hasta $400 millones otorgados a personas desconocidas dentro del gobierno de los EE. UU. Sabemos que Fauci es uno de los destinatarios porque se negó a responder esa pregunta cuando el senador Rand Paul le preguntó. No se nos permite conocer ninguno de estos detalles porque se considera confidencial. En otras palabras, no sería de interés público que se conozcan los conflictos de intereses por alguna razón. Mire este video a los 7 minutos y 30 segundos desde el comienzo. La respuesta de la FOIA está redactada como puede ver. El senador Rand Paul quiere saber. El resto del Congreso: piensan que es mejor que esto se oculte al pueblo estadounidense.
  35. Aumentan los ahogamientos. Una fuente de datos de ahogamiento se encuentra en las muertes en la zona de surf de la NOAA :2015 542016 662017 732018 802019 932020 932021 1292021 aumentó 39%El aumento más alto año tras año antes de 2021 fue del 22 %.2021 fue un 51% más alto que el promedio de 7 años .Los corazones más débiles no pueden manejar la natación estresante. ¿Preguntarse por qué?
  36. Los datos de mortalidad por todas las causas posteriores a la comercialización son el estándar de oro para una vacuna. Tenemos eso en el Reino Unido que lo rastreó. Subió hasta 6 veces según los datos de la ONS del Reino Unido . Pero nuestro propio CDC no puede encontrar ninguna señal aquí, a pesar de que los números de muerte de VAERS y los números de muerte de Medicare están fuera de los gráficos. Cuando el CDC analizó los datos de muertes de VAERS (el artículo de Hannah Rosenblum VAERS publicado en The Lancet) dijeron que ninguna de las muertes en exceso fue causada por las vacunas, pero nunca dijeron qué causó las muertes. ¿Por qué nadie en la comunidad médica o la prensa quería saber la causa real del número sin precedentes de muertes en exceso? Las muertes fueron 50 veces mayores de lo normal y ninguna otra vacuna tiene un aumento en las tasas de mortalidad, solo esta. ¿Por qué los CDC no querrían saber por qué? ¿Y por qué Martha Sharan me prohíbe hablar con los autores? Se supone que los CDC ayudan a detener la desinformación. Extendí la mano para encontrar la razón «correcta» de las muertes y su respuesta fue no hablar conmigo. Eso no ayuda a corregir la “desinformación”. Solo quiero saber qué causó todas las muertes en exceso que solo ocurrieron por las vacunas COVID. es mucho para preguntar? Nadie más está haciendo la pregunta, pero es una pregunta importante que hacer.
  37. Las tasas de embolia pulmonar eran más de 1000 veces lo normal y lo sabíamos en enero de 2021 . Como muestra el artículo, los datos estaban a la vista de todos. Entonces, ¿cómo podría esto no haber activado una señal de seguridad? Ahora es el 12 de julio de 2022 y, hasta la fecha, los CDC nunca han reconocido que la vacuna podría desencadenar una embolia pulmonar. ¿Cómo es eso posible? ¿Es una de las señales de seguridad más grandes, obvias y serias que se activa en VAERS? La respuesta es simple: las personas de los CDC y la FDA no están monitoreando el sistema VAERS. Están mirando para otro lado.
  38. El CDC no está publicando ningún dato de su base de datos BEST. Sí, así es como se llama en realidad. No puedes inventar eso. Pero debido a que los datos no son de apoyo, nunca nos muestran. Se mantiene bajo llave y candado. Nadie llega a mirarlo. Uno pensaría que si la vacuna funciona como se anuncia, nos estarían mostrando los datos. El hecho de que no nos muestren los MEJORES datos… eso tiene que ser muy preocupante para cualquier persona con un cerebro funcional.
  39. No muestran al público los datos de mortalidad por todas las causas de Medicare. ¿Sabía que está en su punto más alto desde que lanzaron las vacunas? Por supuesto, no lo sabe porque los CDC no divulgarán esos datos y la prensa no les preguntará al respecto. La única razón por la que lo sé es porque un empleado honesto del HHS me avisó (sí, en realidad encontramos a un informante que está furioso por el encubrimiento).
  40. Los datos de la ONS del Reino Unido muestran que la mortalidad por todas las causas aumenta enormemente después de cada vacunación . Si no es la vacuna la que causa esto, entonces, ¿qué lo está causando? Es un efecto ENORME: hasta un aumento de hasta 6 veces en la mortalidad por todas las causas después de recibir cada vacuna en comparación con los no vacunados en grupos de edad similares. Nadie explicará esto en cámara. Todos son tímidos ante la cámara. Nadie se atreve a desafiar al profesor Norman Fenton en esto. El CDC cree que sucede lo contrario, que la vacuna te hace casi inmortal, lo que reduce el riesgo de muerte a niveles absurdamente bajos . Alguien te está mintiendo. Puedo garantizarle con seguridad que los CDC están mintiendo porque las tasas de mortalidad por todas las causas son tan bajas en el estudio VSD de los CDC que la vacuna incluso evita que usted muera en accidentes.
  41. Existe un potencial muy real de que la vacuna pueda integrarse en el ADN de una persona de forma permanente. Ver Estudio de Suecia muestra que COVID Jab puede modificar el ADN, abre puertas para nuevas demandas . La vacuna podría estar modificando permanentemente su ADN y no para mejor. Dijeron que esto no podía suceder, pero ahora es una posibilidad real y pronto tendremos confirmación si esto está sucediendo en las personas. Mientras tanto, «¿te sientes afortunado?» Esa es la pregunta que los CDC deberían hacerle a las personas antes de vacunarse. Todos deben ser advertidos sobre esto antes de recibir la inyección. Eso será un verdadero consentimiento informado. En cambio, las personas se mantienen en la oscuridad. Nadie que reciba la inyección tiene idea. ¿Es esa realmente la forma en que hacemos medicina en Estados Unidos para mantener a la gente en la oscuridad de esta manera?
  42. ¿Cómo explicarán todas las enfermedades cardíacas repentinas que ahora ocurren en los niños que solo les ocurren a los niños vacunados y que solo comenzaron a ocurrir después de que se implementaron las vacunas?
  43. Hice que los médicos revisaran más de 600 informes de muertes por vacunas. Descubrieron que 3 murieron a causa de la enfermedad de Creutzfeldt-Jakob (CJD), que es extremadamente frecuente: ocurre naturalmente en 1 de cada 1 millón de personas. Nadie puede explicar la tasa del 0,5% observada aquí. Eso es 5.000 veces lo normal. No sucedió por casualidad y lo único que estas personas tenían en común es que comenzó justo después de la vacuna contra el COVID. ¿Cómo puede una vacuna segura causar ECJ? Respuesta: una vacuna segura no puede. Una vacuna insegura puede. Ningún verificador de hechos tocará eso. Para obtener más información, consulte la sección CJD de » Mi última encuesta «.
  44. Desafortunadamente, la comunidad médica todavía está unida en que la censura de artículos en las principales revistas médicas está bien cuando entra en conflicto con la narrativa política. Por lo tanto, a todos les parece bien que artículos como el artículo de Rose sobre las tasas de miocarditis después de las vacunas COVID , que fue retirado por el editor porque no les gustó la conclusión. Todavía no hay nadie que se pronuncie en contra de Elsevier por censurar la ciencia sin ética. Ni una sola persona del lado pro-vax piensa que censurar la ciencia está mal. Es sorprendente porque es tan objetivamente poco ético. Nadie puede defender esto pero todos guardan silencio.
  45. Hubo fraude en el juicio de Pfizer. He documentado más de una docena de problemas que serían «difíciles de explicar» si no hubiera fraude, incluidos algunos que son imposibles de explicar si no hubiera fraude. Nadie quiere explicarlos. Pero ahora tenemos algo incluso mejor que mis acusaciones de fraude: una admisión de Pfizer en el Tribunal Federal de que defraudaron a la FDA. Consulte Pfizer pide a la corte que desestime la demanda de un denunciante porque el gobierno estaba al tanto del fraude . La prensa convencional no lo cubrirá, así que nadie lo sabrá.
  46. Haití no vacunó a sus ciudadanos. La tasa actual de vax es del 1,4 %; sin embargo, el país tiene una de las tasas de mortalidad por COVID más bajas del mundo. ¿Cómo es eso posible?
  47. Han admitido que nadie defenderá las políticas de los CDC o la FDA en cámara . Hicimos una convocatoria abierta para que alguien hiciera esto y no hubo respuestas. Promueven la narrativa solo cuando están seguros de que no serán cuestionados con cosas inconvenientes como evidencia y hechos.
  48. Nadie ha podido responder una sola pregunta en mi lista de más de 100 preguntas.
  49. El jefe de vacunas de la FDA, Peter Marks, ha dicho que hará cualquier cosa para ayudar a reducir las dudas sobre las vacunas, EXCEPTO debatir con cualquier científico calificado que tenga puntos de vista opuestos . Sin embargo, debatir con la oposición es la forma más efectiva para que el Dr. Marks logre su objetivo. Entonces, ¿por qué no lo está haciendo? Simple. Él no tiene los hechos de su lado.
  50. Un artículo publicado en una revista revisada por pares dice que los «propagadores de información errónea» (incluido yo mismo) están diciendo la verdad . Finalmente.
  51. Estamos viendo médicos como Andy Bostom escribiendo un artículo de opinión mordaz sobre la Universidad de Brown, donde trabaja en el encubrimiento de un estudiante que murió de miocarditis después de una vacunación forzada. Así que los médicos armados con los hechos ahora están dispuestos a sacrificar sus carreras para decir la verdad.
  52. La gente está empezando a darse cuenta del bajo riesgo-beneficio de las vacunas. Nuestras últimas encuestas dan el mismo número estimado de muertes por la vacuna que los datos de VAERS (y otras 10 fuentes) : 500,000 en este momento. Pero la cantidad estimada de vidas de COVID salvadas según el ensayo clínico es de 1 en 22,000, lo que significa alrededor de 10,000 vidas salvadas. Así que hemos matado a 500.000 personas para quizás salvar a 10.000 personas. Eso es tonto. Nadie me debatirá sobre los números. Incluso ofrecí $ 1 millón a cualquiera que pudiera refutar nuestras estimaciones y mostrarnos los números correctos. Sin tomadores.
  53. Los hogares de ancianos como Palo Alto Commons no pueden esconderse en las sombras para siempre. Mi artículo relata que 6 residentes recibieron la inyección allí y los 6 murieron dentro de las 5 semanas posteriores a la inyección mientras dormían , aunque la mayoría estaban perfectamente saludables. ¿Cómo pueden morir 6 de cada 6? En la tercera edad es donde se encuentra el mayor beneficio vs riesgo. Es un delito grave presentar un informe VAERS falso (y no hay ningún incentivo para ir a la cárcel aquí para el reportero) y Palo Alto Commons no dice nada, tratando de esconderse falsamente detrás de HIPAA.
  54. La «ciencia» detrás de usar una máscara ahora está completamente reventada gracias a que el profesor Jason Abaluck accedió a que nuestros expertos impugnaran su artículo . Pero la mitad de las personas todavía usan máscaras en los aeropuertos, por lo que el mensaje no se difunde. Pero al menos hemos reventado por completo la justificación científica de las máscaras. Se fue. Vea mi artículo sobre pedirle a Science que se retracte del estudio en el que se basaba la comunidad médica. No responderán y no podrían responder ya que no hay excusa para no retractarse del artículo. Consulte también Las máscaras no funcionan .
  55. Todavía intentan que las mascarillas funcionen como este estudio: School Masking Policies and Secondary SARS-CoV-2 Transmission Pero el comentario de Prasad y Hoeg destruye su estudio.
  56. El CDC tuvo que cambiar la definición de «vacuna» porque las vacunas contra el COVID no eran vacunas.
  57. Los números simplemente no están funcionando para los promotores de la vacuna. En NSW, Australia, la tasa de vacunación es del 96,7% . Eso significa que si las vacunas reducen el riesgo de hospitalización en un 90 %, entonces el 25 % de las personas en el hospital no deberían estar vacunadas. Eso es lo que dicen las matemáticas. Entonces, ¿por qué no hay personas no vacunadas que se enfermen?
  58. He escrito casi 1000 artículos sobre problemas con la vacuna en mi subpila. Otra excelente subpila de historias de lesiones por vacunas es stopmandatoryvaccination . Estas historias son difíciles de explicar si las vacunas son seguras y efectivas.
  59. ¿Sabías que la probabilidad de ser contagiado por alguien con COVID es proporcional a su carga viral? Probablemente no porque los CDC nunca te dijeron eso. ¿Quieres saber por qué los CDC nunca te dijeron eso? Es porque la carga viral de las personas vacunadas es la misma que la de las personas no vacunadas. Consulte este documento, el aislamiento de 4000 SARS-CoV-2 muestra que la contagiosidad está asociada con la carga viral, no con la vacuna o el estado sintomático . Su estado de vacunación no tiene nada que ver con su contagiosidad. Así que vacunarse para proteger a los demás es una tontería. Lo que significa que los mandatos de vacunación son tontos. Pero, ¿cuándo la ciencia ha tenido algo que ver con la política de salud pública? A la gente se le dice que se calle y haga lo que se le dice. Y la mayoría de la gente lo compra.
  60. ¿Alguna vez te has preguntado por qué, con evidencia como esta, nadie en la comunidad médica dice nada? Es porque todo está controlado por el gobierno y si haces enojar al gobierno, estás fuera del negocio, por eso. Recibí esta nota del director ejecutivo de un gran hospital que básicamente dice que los hospitales son solo peones y no pueden hablar ni arriesgarse a sufrir represalias por parte del gobierno y tengo que convencer a la FDA de que están equivocados. En resumen, dice que no podemos ganar porque la FDA no tiene responsabilidad ante nadie. Esto es lo que escribió después de que le pregunté si él y su hospital dirían la verdad sobre lo que está sucediendo dentro de los hospitales con todas las lesiones y muertes por vacunas: “Con respecto a mi participación, debo declinar respetuosamente. Los hospitales se rigen en gran medida por los departamentos de salud del condado local y las regulaciones del gobierno federal, por lo tanto, estoy seguro de que puede comprender que no puedo serle útil para promover su posición. Estoy feliz de escuchar, pero no puedo tomar una posición sobre este tema”. Es por eso que algunas personas han sugerido queusamos médicos y enfermeras jubilados (contra los que no se pueden tomar represalias) para convencer al público (ya que el público confía en los médicos y enfermeras) , especialmente si esos médicos y enfermeras se jubilaron por lo que estaban viendo. Pero también podemos usar documentos en la práctica actual oscureciendo su rostro/voz en la cámara.
  61. Parece que ya no hay ningún científico que trabaje en la seguridad de las vacunas en los CDC. Envié cientos de correos electrónicos internos de los CDC (todas las personas que trabajan en las vacunas COVID) preguntando si alguien consideraría evidencia que vaya en contra de la narrativa. No hay respuestas. Un verdadero científico siempre está abierto a nuevos datos y a encontrar la verdad. Así que los “científicos” de los CDC no son científicos; son “propagandistas”. Si encuentra a alguien que trabaje en los CDC que esté dispuesto a considerar evidencia que va en contra de la narrativa, hágamelo saber. Pero es probable que sean despedidos instantáneamente si consideran que los CDC podrían estar equivocados.
  62. Los datos muestran que usar una máscara aumenta la probabilidad de muerte si contrae COVID . Esto es lo contrario de lo que nos están diciendo.
  63. Simplemente hay demasiadas anécdotas de Cisnes Negros para ignorar. Por ejemplo, este Cisne Negro no debería existir solo con una población de mil millones de personas (si crees en la narrativa), pero estas historias son muy comunes. He escuchado historias de muertes múltiples dentro de una familia después de la vacuna. Son tan comunes que ya no les sigo la pista. Por ejemplo, este es uno que recibí ayer de una enfermera de la UCI que perdió a su prometido por la vacuna y cuyo hermano casi muere a causa de la vacuna, pero tuvo suerte y ahora tiene un ICD implantado probablemente por el resto de su vida:
  64. Tengo nombres y contactos familiares de 253 personas que muy probablemente hayan muerto por la vacuna . Eso no debería ser posible para una vacuna segura y efectiva. Es una gran bandera roja.
  65. Tengo una lista de 1,000 personas lesionadas por vacunas (esa es la opinión pública con la información de contacto redactada para que pueda leer las historias de terror). Pero los CDC dicen que las lesiones por vacunas son raras. Pero, ¿cómo es posible que estas personas tengan más de 80 síntomas que son comunes a los vacunados y solo desarrollen esos síntomas después de la vacuna y no antes de la vacuna? Entonces, ¿cómo puede haber grupos de Facebook de 250,000 personas lesionadas por la vacuna COVID? Facebook elimina estos grupos cuando crecen a cualquier tamaño, por lo que las personas nunca se darán cuenta de cuán grande es el problema. Estos grupos tienen que hablar en “código” para evitar ser detectados y eliminados por Facebook.
  66. ¿Sabía que los funcionarios de salud pública están ahí para proteger a las compañías farmacéuticas y no al público? Consulte estos correos electrónicos de uno de los principales funcionarios de salud pública de Canadá (Bonnie Henry) . Y tenga en cuenta las técnicas que utilizan todos los buenos funcionarios de salud pública para ocultar la verdad al público (ver 3:00 en el video ). Hay muchos otros problemas señalados en el video y luego comienza a mostrar los correos electrónicos reales alrededor de las 10:00 en el video. Verás que la prioridad es la mensajería pública para no implicar a la vacuna en la muerte y no hay interés en evaluar la causalidad.
  67. La Colaboración de Brighton se utiliza para las definiciones de eventos adversos, pero ahora está controlada por CEPI, que está controlada por las compañías farmacéuticas. Entonces, las compañías farmacéuticas pueden redefinir las definiciones de eventos adversos. Y lo hacen. Que conveniente. ¿Y pensaste que todo esto era objetivo, en el nivel? De ninguna manera. Vea este video a las 17:00 para obtener una explicación de los conflictos de interés. Un médico en Canadá me escribió después de enterarse de esto: “Sí, el video fue muy interesante . En particular, su uso de los criterios de Brighton que explica por qué no estamos detectando una señal de seguridad aquí en Canadá. Creo que vale la pena desarrollarlo más”.
  68. Robert Malone hace un trabajo brillante al describir los conflictos de intereses y cómo se juega el juego en su discurso de 15 minutos en este foro de seguridad de vacunas en el MIT el 16 de mayo que patrociné . Comience a mirar a las 5:26 (son cinco horas y 26 minutos de video). Es excelente. Aquí está la reseña del evento del MIT .
  69. Las muertes de bebés están siendo reportadas en la prensa en Israel , pero aquí están siendo suprimidas. Es solo cuestión de tiempo antes de que esto se extienda a Europa y eventualmente sea imposible de ignorar en los EE. UU. Ese mismo artículo habla de que las compañías farmacéuticas tienen “listas negras” de médicos que buscan silenciar porque criticaron la droga. Esto es del testimonio de la corte. También habla de la vacuna para ganado de Pfizer (PregSure BVD) que mató al 15% de las vacas. Pasaron 4 años antes de que se retirara del mercado en 2010. Está ocurriendo nuevamente, esta vez en las personas (aunque con una tasa de mortalidad de solo el 0,2 % para las personas).
  70. Tengo todos los registros de defunción en Nuevo México para 2020. ¿Adivina qué? Cuando observa los códigos ICD-10 de los registros de defunción, encontrará que solo hubo alrededor de 330 muertes verdaderas por COVID, no 2,000. Entonces, 5 de cada 6 muertes por COVID fueron simplemente «con COVID» y no «por COVID». Nuevo México tiene una población de 2 millones y mueren 2 millones al año, por lo que estamos viendo un aumento total de ACM del 1,5 % por COVID en 2020 , ¡¿ y eso se consideró una emergencia y una pandemia?! Eso es ridículo. Entonces, el punto es que exageraron la percepción publicitando cualquier muerte por COVID, y luego la respaldaron con números inflados para crear la percepción de una emergencia. NADIE irá a la cámara conmigo para disputar esto.
  71. El CDC admitió en una solicitud de FOIA que no comenzaron a observar las señales de seguridad en VAERS hasta abril de 2021 . El programa de vacunación comenzó en 2020. ¿Por qué esperaron? La respuesta es obvia: no les importa encontrar señales de seguridad. ¿Por qué el público no está horrorizado por esto? ¡Simple! Porque los principales medios de comunicación no le dirán al público que los CDC no monitorearon los datos de seguridad.
  72. La negación de los acontecimientos adversos es impresionante. Hubo grupos de Facebook con más de 250,000 personas lesionadas por vacunas que fueron eliminadas. Personalmente tengo una lista de 1.000 heridos por vacunas. Entonces, cuando le pregunté a un panel de científicos del MIT si creían en los CDC que dicen que no han encontrado ningún vínculo entre las vacunas COVID y las vacunas lesionadas, el 100% de los panelistas dijeron «sí, creen que los CDC le están diciendo a los verdad.» ¡Incluso me atacaron personalmente por hacer la pregunta! Todo está en video. Puedes verlo a las 4:56:00 . Es asombroso que haya tal lavado de cerebro.
  73. Me ofrecí a pagar personalmente los costos médicos de cualquier aerolínea estadounidense dispuesta a evaluar a todos sus pilotos para detectar problemas cardíacos . Sin tomadores. ¿Qué te dice eso? De hecho, si lee el artículo, señala que si las vacunas fueran realmente seguras, Moderna y Pfizer estarían ofreciendo montones de dinero a las aerolíneas para evaluar a todos sus pilotos que, si dicen la verdad, PROBARÍAN que sus vacunas no lo son. No causará problemas cardíacos. Pero ellos no están haciendo eso. ¿Por que no?
  74. Si las vacunas son tan seguras, ¿cómo puede haber un aumento del 25% en los eventos de emergencia cardíaca ? Si no fue la vacuna, ¿cuál fue la causa?
  75. Los médicos ahora se dan cuenta de que las vacunas están causando lesiones masivas. No pasará mucho tiempo para que caiga el otro zapato porque esto ahora se está haciendo público con artículos como este donde cinco médicos diferentes admitieron que las lesiones fueron causadas por la vacuna, pero ninguno de los cinco médicos lo admitirá públicamente . Este es un gran progreso. Al principio, estarías bateando 0 de 5 en privado. Ahora es 5 de 5. El cambio de 0% a 100% es un avance importante. Además, el hecho de que esto se haya informado en los principales medios de comunicación también es un excelente progreso. Eso nunca hubiera sucedido antes.
  76. Nunca hemos tenido una vacuna en la que los datos muestren que los beneficios superan el riesgo. Si existiera tal vacuna, las vacunas contra el COVID estarían en el último lugar de la contienda, ya que los eventos adversos de la vacuna contra el COVID son más que todas las demás vacunas en los 30 años de historia de VAERS combinadas. Sería difícil para alguien argumentar que esta es la primera vacuna segura.
  77. Cada vez es más conocido, gracias al libro de RFK, que los CDC cancelaron deliberadamente el proyecto ESP:VAERS, lo que habría aumentado enormemente la sensibilidad del sistema VAERS a eventos adversos . El proyecto fue cancelado porque demostró que todas las vacunas no eran seguras. Eso fue políticamente imposible, por lo que tuvieron que cancelar el proyecto. Es por eso que tenemos un sistema de notificación de eventos adversos tan poco convincente en los EE. UU. en la actualidad.
  78. El fraude por parte de las revistas está siendo expuesto. Por ejemplo, este estudio fraudulento publicado en Frontiers in Medicine exageró las muertes pediátricas. Fenton usó tasas CFR e IFR bien establecidas para demostrar su punto (para los menores de 20 años, la IFR debe ser inferior a 1 en 37 000). La revista se negó a comentar sobre el análisis de Fenton.
  79. El profesor Norman Fenton ha expuesto que los datos del gobierno del Reino Unido sobre la seguridad y eficacia de las vacunas son fraudulentos . Esa tabla deja al descubierto cuán corrupto ha sido el gobierno del Reino Unido al manipular los datos. Ahora se ha demostrado que todas las afirmaciones que ha hecho el gobierno sobre la eficacia y la seguridad de las vacunas son falsas . Nadie quiere hablar de eso. La censura es la técnica que utilizan para contrarrestar esto ya que no tienen datos.
  80. Los números de la ONS del Reino Unido muestran que es mucho más probable que la vacuna lo mate que lo ayude para las edades de 10 a 14 años. Vea mi artículo que muestra que incluso cuando manipulan los números, ¡la señal de muerte de los niños es demasiado difícil de ocultar !
  81. En el Reino Unido, los niños que morían en el hospital eran enviados directamente a la cremación . Hubo un gran número de muertes que fueron encubiertas y pedidos masivos de ataúdes para bebés .
  82. La gente se está despertando y notando que los recién nacidos australianos no tienen respuestas inmunitarias contra virus comunes como la influenza . Esto está sucediendo ahora, después de que la mayoría de las madres hayan sido vacunadas contra el COVID. Claramente no fue causado por COVID porque recién estamos viendo esto ahora. Puede tomar un tiempo para que las personas descubran que esto se debe a las vacunas «seguras y efectivas». Una vez más, nadie me debatirá esto frente a la cámara. Esto, junto con el aumento del 400 % en la demanda de ataúdes para niños, debería hacer que toda persona pensante presione el botón de pausa .
  83. Hay demasiadas personas hablando ahora, diciendo lo mismo . ¿Cómo podrían estos antivacunas estar tan unidos en su oposición? No hay coordinación entre ellos, pero están diciendo lo mismo.
  84. Demasiadas personas murieron en solo 7 días en el Reino Unido para ser consideradas normales.
  85. Acaba de salir a la luz que Moderna se coludió con la FDA para eludir las pruebas de seguridad normales .
  86. Los médicos que están siendo censurados se están defendiendo en los tribunales:ImagenImagen
  87. Los paramédicos dicen que están viendo más heridos por vacunas que casos de COVID . ¿Cómo es eso posible para una vacuna que es 100% segura? ¿Cómo alguien explica esto?
  88. Ahora sabemos que Israel mantuvo las muertes de niños fuera de la vista del público para que la vacuna pareciera segura .
  89. Podríamos poner fin a la pandemia al instante si un país rompiera filas e implementara las mejores prácticas para la atención ambulatoria y hospitalaria . Esto podría suceder en cualquier momento.
  90. Ni una sola persona que apoya la narrativa falsa ha estado de acuerdo con la solicitud del profesor Vinay Prasad de la UCSF para una discusión abierta. En el momento en que esto cambie, será una gran grieta en la presa. Pero por ahora, han estado dando vueltas al 100% y nadie rompe filas. El artículo de opinión de Prasad se tituló » Los científicos que expresan diferentes puntos de vista sobre el covid-19 deben ser escuchados, no demonizados «. Apareció hace más de dos años y, hasta la fecha, no ha habido ni una sola discusión abierta.
  91. Más y más personas cayendo a plena vista. Es muy difícil ignorar esto: una enfermedad repentina detiene el espectáculo en Hungría (Sir Tom Jones), Madrid (Jane Birkin) y Dresde (Aida); los mejores atletas tienen que abandonar el Tour de Francia y el US Open; y dos llamadas cercanas, en Israel y Turquía y
  92. Médicos de Nueva Zelanda se han reunido para pedir a la policía que investigue las muertes por la vacuna . Hay una larga lista de muertes en ese artículo que no se puede explicar (demasiados cisnes negros).
  93. La tasa de enfermedad priónica posterior a la vacunación es demasiado alta para ser normal: 0,5 % en nuestra muestra de muertes por vacunas . Un estudio en Francia mostró que sucede justo después de la vacunación . No hay forma de que alguien explique eso si las vacunas son seguras.
  94. El gobierno alemán admitió que una tasa de 1 de cada 5000 inyecciones causa efectos secundarios graves el 20 de julio de 2022. Hemos administrado 600 millones de dosis en los EE. UU., lo que representa 120 000 lesiones graves causadas por las vacunas.
  95. Las estadísticas oficiales del gobierno canadiense muestran que las vacunas pueden aumentar el riesgo de muerte por COVID en un 50% ; las personas vacunadas pero no vacunadas tenían un 50 por ciento más de probabilidades de ser hospitalizadas o morir de covid que las personas no vacunadas. Eso es realmente sorprendente porque las vacunas no solo lo ayudan a morir de COVID, sino que también matan a un gran número de personas que no tienen COVID y estaban perfectamente sanas. Los datos de Manitoba parecen marcar la primera vez que una agencia gubernamental realmente ha encontrado un mayor riesgo de muerte por COVID en personas vacunadas.
  96. Robert Malone no se anda con rodeos cuando describe las causas de la pandemia . Básicamente, nuestro gobierno confió en las personas y organizaciones equivocadas. Simple como eso. Pueden pasar años antes de que lo descubran, pero al menos está todo sobre la mesa.
  97. Este artículo muestra que las vacunas tienen un impacto severo en la salud reproductiva, el ensayo de Paxlovid se detuvo por falta de eficacia en pacientes de riesgo estándar, no hubo diferencias claras entre el uso de máscaras médicas/quirúrgicas en comparación con los respiradores N95/P2 en trabajadores de la salud cuando se usa en atención de rutina para reducir la infección viral respiratoria. El CDC nos mintió sobre todo esto.
  98. La gente está empezando a darse cuenta de que nuestra ética médica antes era baja. Ahora son aún más bajos .

Actualizaré esta lista con el tiempo, pero esa es la lista que se me viene a la cabeza sobre lo que está pasando. Por lo que puedo ver, todo el impulso se está moviendo en nuestra dirección.

Como siempre, consulte los comentarios a continuación para obtener información adicional de mis lectores. Sólo estoy contando una parte de la historia. Hay más de 1000 comentarios que deberías leer además de mi artículo.

1350 comentarios más…

STEVE KIRSCH

Fuente: https://stevekirsch.substack.com/p/the-safe-and-effective-narrative

Experto advierte que 700 millones morirán por inyecciones de COVID para 2028 – Apagón de los medios

Por Sean Adl Tabatabai

Un destacado médico advirtió que las inyecciones de Covid se están utilizando como una forma de genocidio en toda la población y predijo que más de 700 millones de personas podrían morir para el año 2028.

En una entrevista reciente (publicada a continuación) con Greg Hunter, el Doctor David Martin presenta evidencia de que las inyecciones de COVID-19 no son vacunas reales sino armas biológicas.

En marzo de 2022, Martin presentó una demanda federal contra el presidente Biden, el Departamento de Salud y Servicios Humanos y los Centros de Servicios de Medicare y Medicaid alegando que las inyecciones de COVID-19 convierten el cuerpo en una fábrica de armas biológicas, fabricando proteína de punta. 2

Uncanceled.news informa: “Y no solo no seremos demandados por, ya sabes, ninguna difamación o información errónea, sino que en realidad estamos responsabilizando penalmente a las personas por su terrorismo doméstico, sus crímenes contra la humanidad y la historia del armamentismo del coronavirus que se remonta a 1998”, dice Martin. 3

SARS-CoV-2 ha estado en proceso durante décadas

Martin ha estado en el negocio del seguimiento de solicitudes y aprobaciones de patentes desde 1998. Su empresa, M-Cam International Innovation Risk Management, es el suscriptor de activos intangibles utilizados en finanzas más grande del mundo en 168 países. M-Cam también ha monitoreado las violaciones de los tratados de armas biológicas y químicas en nombre del gobierno de los EE. UU., luego del susto del ántrax en septiembre de 2001.4

Según Martin, hay más de 4.000 patentes relacionadas con el coronavirus del SARS. Su compañía también ha realizado una revisión exhaustiva de la financiación de la investigación relacionada con la manipulación de coronavirus que dio lugar al SARS como subclado de la familia de coronavirus beta.

Gran parte de la investigación fue financiada por los Institutos Nacionales de Alergias y Enfermedades Infecciosas (NIAID) bajo la dirección del Dr. Anthony Fauci. 5  Martín explicó: 6

“Creo que es importante que sus oyentes y espectadores recuerden que fue en 1999 cuando Anthony Fauci y Ralph Baric de la Universidad de Carolina del Norte en Chapel Hill decidieron comenzar a armar el coronavirus que patentaron en 2002, y escucharon esa fecha correctamente, eso es un año. antes del brote de SARS en China.

La primera vez que patentaron lo que llamaron una ‘quimera defectuosa de replicación infecciosa’ del coronavirus. Y vamos a desempacar lo que eso significa.

Infeccioso significa que en realidad es más letal para el objetivo. La replicación defectuosa significa que su daño es principalmente para el objetivo y no para la familia, los amigos, la comunidad o cualquier otra cosa del objetivo. Y en 2002, la Universidad de Carolina del Norte, Chapel Hill, patentó la quimera de coronavirus infeccioso defectuoso en la replicación, que luego se convirtió en la primera instancia de SARS.

Y se perfeccionó en 2013 a 2016 durante la moratoria de ganancia de función, donde la Universidad de Carolina del Norte Chapel Hill recibió una exención de la moratoria de ganancia de función para que pudieran continuar armando el virus hasta el punto en que en 2016, Ralph Baric publicó un artículo en el que decía que el virus uno del Instituto de Virología de Wuhan, el coronavirus, estaba «preparado para la emergencia humana», por lo que lo sabían todo el tiempo.

Ya sabes, sabían que era un arma biológica desde 2005. Sabían que era eficaz para eliminar poblaciones, dañar a las poblaciones, intimidar y coaccionar a las poblaciones. Y lo hicieron todo muy intencionalmente con el propósito de destruir a la humanidad”.

Las vacunas contra el COVID-19 son un ‘acto de bioterrorismo’

Según Martin, la proteína espiga que fabrican las inyecciones de COVID-19 es una simulación por computadora de una quimera de la proteína espiga del coronavirus. “De hecho, no es una vacuna contra el coronavirus. Es una instrucción de proteína de pico para hacer que el cuerpo humano produzca una toxina, y esa toxina ha sido programada como un agente biológico conocido de preocupación con respecto a las armas biológicas durante la última década y media”, dijo. 7

En lugar de ser una medida de salud pública como se promovió ampliamente, las inyecciones de COVID-19 son un acto de armas biológicas y bioterrorismo. Martin compartió que en 2015, el Dr. Peter Daszak, jefe de EcoHealth Alliance que canalizó dólares de investigación del NIAID al Instituto de Virología de Wuhan para la investigación del coronavirus, declaró: 8

“Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-coronavirus. Un impulsor clave son los medios y la economía seguirá el bombo publicitario. Necesitamos usar esa exageración a nuestro favor, para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso”.

Daszak, a quien Martin se refiere como “el lavador de dinero en jefe”, “en realidad declaró que todo este ejercicio fue una campaña de terror doméstico para lograr que el público aceptara la plataforma de vacuna universal utilizando un arma biológica conocida. Y esas son sus propias palabras, no mi interpretación”, dijo Martin. 9

Martin: 100 millones pueden morir debido a vacunas COVID

Tanto las vacunas contra el COVID-19 de Pfizer como las de Moderna contienen secuencias de ácido nucleico que no son parte de la naturaleza y no se han introducido previamente en el cuerpo humano. Esto equivale a un experimento de ingeniería genética que no pasó por estudios en animales ni ensayos clínicos.

Sin embargo, ya hay personas que mueren a causa de las inyecciones y, afirma Martin, “muchas más morirán” debido a problemas como coágulos de sangre, daño al sistema cardiovascular y problemas con la función hepática, renal y pulmonar. 10

También se prevé una avalancha de casos de cáncer reproductivo y relacionados con las inyecciones. “El hecho es que una enorme cantidad de personas que se inyectan ya llevan las semillas de su propia muerte”, dijo Martin. 11  En cuanto a cuántos pueden morir, Martin cree que los números pueden haber sido revelados en 2011, cuando la Organización Mundial de la Salud anunció su «década de vacunación»: 12

“Basado en su propia estimación de 2011, y… esta es una estimación escalofriante, pero tenemos que publicarla… Cuando la Fundación Bill y Melinda Gates, los CDC de China, Jeremy Farrar Wellcome Trust y otros publicaron La Década de la Vacunación para la Organización Mundial de la Salud en 2011, su objetivo declarado era una reducción de la población del 15% de la población mundial.

Ponga eso en perspectiva, eso es alrededor de 700 millones de personas muertas… y eso pondría a la participación de EE. UU. en eso ciertamente como una proporción de la población inyectada en algún lugar entre 75 y 100 millones de personas».

Cuando se le preguntó en qué período de tiempo podrían morir estas personas, Martin sugirió que «hay muchas razones económicas por las que la gente espera que sea entre ahora y 2028». 13  Esto se debe a “una pequeña falla en el horizonte”: la falta de liquidez proyectada de los programas de Seguro Social, Medicare y Medicaid para 2028.

“Entonces, cuantas menos personas reciban Seguro Social, Medicare y Medicaid, mejor”, dijo Martin. «No es sorprendente que probablemente sea una de las motivaciones que llevaron a la recomendación de que las personas mayores de 65 años fueran las primeras en inyectarse». 14  Otras poblaciones en riesgo son los cuidadores, incluidos los proveedores de atención médica, y otros miembros de la fuerza laboral que se vieron obligados a inyectarse, como los pilotos.

“¿Por qué de repente se cancelan (en USA) 700 vuelos al día porque, supuestamente, las aerolíneas no tienen pilotos? … el sucio secreto … hay muchos pilotos que tienen problemas microvasculares y problemas de coagulación, y eso los mantiene fuera de la cabina, que es un buen lugar para no tenerlos si van a arrojar un coágulo por un derrame cerebral o un ataque al corazón”,  dijo Martin.

“Pero el problema es que vamos a comenzar a ver exactamente el mismo fenómeno en la industria de la atención médica y a una escala mucho mayor, lo que significa que ahora tenemos, además del problema de la morbilidad y mortalidad reales, lo que significa que las personas se enferman. y gente muriendo.

De hecho, tenemos ese objetivo en la industria del cuidado de la salud en grande, lo que significa que vamos a tener médicos y enfermeras que estarán entre los enfermos y los muertos. Y eso significa que los enfermos y los moribundos tampoco reciben atención”. 15

Por qué las vacunas COVID pueden cambiar su ADN

Los medios de comunicación y los funcionarios de salud pública han enfatizado que las vacunas contra el COVID-19 no alteran el ADN. Sin embargo, Martin llama la atención sobre una subvención poco conocida de la Fundación Nacional de Ciencias, conocida como sistemas químicos darwinianos, 16  que involucró la investigación para incorporar ARNm en genomas específicos. Según Martín: 17

“Moderna se inició… gracias a una subvención de 10 años de la Fundación Nacional de Ciencias. Y esa subvención se llamó sistemas químicos darwinianos… el proyecto que dio origen a la propia empresa Moderna fue un proyecto en el que estaban averiguando específicamente cómo hacer que el ARNm se escribiera en el genoma de cualquier objetivo que persiguieran.

Se desconoce por completo cuáles serán los efectos a corto o largo plazo del análogo de proteína de pico que se encuentra dentro de las personas que recibieron inyecciones de COVID-19. Pero con respecto a la alteración del genoma, Martin afirma que los datos muestran que el ARNm tiene la capacidad de escribir en el ADN de los humanos, y “como tal, los efectos a largo plazo no van a ser meramente sintomáticos. Los efectos a largo plazo serán que el genoma humano de los individuos inyectados se verá alterado”. 18

El fraude elimina el escudo de responsabilidad de las grandes farmacéuticas

El ataque de ántrax de 2001, que surgió de la investigación médica y de defensa, condujo a la aprobación de la Ley PREP, que eliminó la responsabilidad de los fabricantes de contramedidas médicas de emergencia.

Esto significa que mientras EE. UU. esté en estado de emergencia, cosas como las «vacunas» contra el COVID-19 están permitidas bajo autorización de uso de emergencia. Y mientras la autorización de uso de emergencia esté vigente, los fabricantes de estas terapias génicas experimentales no son financieramente responsables de ningún daño que resulte de su uso.

Es decir, siempre que sean «vacunas». Si estas inyecciones NO son vacunas, entonces el escudo de responsabilidad desaparece, porque no existe un escudo de responsabilidad para una contramedida de emergencia médica que es la terapia génica. Además, las demandas que pueden probar que las empresas cometieron fraude también anularán el escudo de responsabilidad. Martín afirma: 19

“Una de las cosas convenientes de la Ley PREP es que el escudo de inmunidad de responsabilidad en realidad es tan bueno como la ausencia de fraude. Porque si hubo fraude en la promulgación de los eventos, lo que condujo a una autorización de uso de emergencia, entonces todo el escudo de inmunidad se eliminó.

Entonces, la razón por la que es tan importante que las conversaciones como la que estamos teniendo realmente se promuevan y avancen es porque las compañías farmacéuticas, y esto incluye a Pfizer, Moderna y J&J, saben que están perpetuando un fraude. Lo bueno de esto es que cuando se establece el fraude, el 100 % de la responsabilidad vuelve a ellos.

… cuando un fraude fue la base de un fraude, entonces en realidad tenemos una serie de otros remedios legales que le permiten levantar ese velo. Entonces, al final, no hay duda… y es bastante evidente en base a los datos actuales de mortalidad y morbilidad dado el hecho de que cuando se trata de armas biológicas y bioterrorismo, cada cargo conlleva una multa de $100 millones. Eso es lo que nos da el estatuto federal.

La sanción por terrorismo doméstico corporativo, cuando tienes $ 100 millones por cuenta de responsabilidades emergentes, esa es una amenaza existencial que lleva a una compañía como Pfizer o lleva a una compañía como Moderna fuera de existencia. Y eso es por lo que estamos trabajando todos los días”.

Si desea seguir el progreso de los casos legales en curso que buscan exponer la verdad, que una organización criminal busca obtener el control de la población mundial a través de la creación de armas biológicas patentadas comercializadas como nuevos virus e inyecciones, puede encontrar todo los detalles en ProsecuteNow.io, un sitio web compilado por Martin y sus colegas. 20

https://rumble.com/embed/v17qics/?pub=13m19j

Fuente: https://newspunch.com/expert-warns-100-million-will-die-from-covid-jabs-by-2028-media-blackout/

Los principales medios de comunicación informan de una larga lista de causas de coágulos y ataques cardíacos, pero no incluyen las vacunas contra el COVID-19

Publicado por Yudi Sherman

Cambio climático, soledad, palear en la nieve. incluidos en factores de riesgo fatal

Los principales medios de comunicación informan una larga lista de causas de coágulos sanguíneos y ataques cardíacos, pero no incluyen las vacunas contra el COVID-19

Los medios corporativos agregaron hoy la cafeína a la lista de cosas que pueden causar coágulos de sangre. 

“Coágulos de sangre: la bebida favorita de la nación podría hacer que su sangre se vuelva pegajosa, lo que aumenta el riesgo”, informó el Daily Express el lunes. La razón explicada en el artículo es que la cafeína puede provocar deshidratación, lo que luego puede hacer que la sangre se vuelva «pegajosa», lo que puede provocar un coágulo de sangre. 

El titular aparece una semana después de que el medio de comunicación informara que las malas posiciones para dormir también pueden causar coágulos de sangre. 

“Coágulos de sangre: ¿Cómo duermes? Una posición puede aumentar el riesgo de trombosis venosa profunda”, informó el Daily Express la semana pasada.  

Si bien los hallazgos del estudio han demostrado que las vacunas contra el COVID-19 causan coágulos de sangre, no han aparecido en la lista de causas de coágulos de sangre de los medios. 

Los medios también mantienen una lista de varias causas de eventos cardíacos. Aunque un estudio revisado por pares muestra que los eventos cardíacos han aumentado un 25 % debido a las vacunas contra el COVID-19, la vacuna tampoco está en esta lista. 

“Su salario, código postal y padres afectan su riesgo de enfermedad cardíaca”, advirtió The Conversation Sunday, una publicación que respalda en gran medida la vacuna COVID-19. 

“Advertencia urgente para los jardineros ya que el suelo ‘aumenta el riesgo de enfermedades cardíacas mortales’”, informó The Sun la semana pasada. 

Saltarse el desayuno también es un factor de riesgo. 

“Por qué saltarse el desayuno puede aumentar el riesgo de sufrir un ataque al corazón”, advirtió The Mirror. 

“ La soledad puede aumentar el riesgo de enfermedad cardíaca en un 27 por ciento en mujeres mayores”, informó el Washington Post. 

“Infertilidad, insuficiencia cardíaca y enfermedad renal: ¿Cómo afecta el cambio climático al cuerpo humano?” escribió Euronews . 

“ La exposición a cualquier luz durante el sueño [está] relacionada con la obesidad [y otros] problemas de salud graves [un] estudio encuentra”, dijo CNN , explicando que quedarse dormido frente al televisor puede aumentar la frecuencia cardíaca. 

Pero, de nuevo, también puede hacerlo la actividad física. 

“ La actividad física puede aumentar el riesgo de ataque al corazón, sugiere un estudio”, afirmó The Irish Times. 

También puede hacerlo el sonido de un avión. 

“ El sonido de un avión volando por la noche podría ser lo último que escuche, ya que un estudio encuentra que el ruido puede desencadenar un ataque al corazón en dos horas”, informó el Daily Mail. 

“¿Eres demasiado viejo para palear en la nieve ? Si tiene más de 45 años, tenga cuidado con los ataques al corazón, dice el médico”, según USA Today. 

En mayo, The Lakewood Scoop informó un extraño aumento de ataques cardíacos y accidentes cerebrovasculares en hombres jóvenes; y aunque el sitio publicó un video con muchos profesionales médicos que instan a los hombres jóvenes a «hacerse la prueba», no especificaron para qué. 

“Debido a un aumento reciente en la ocurrencia de ataques cardíacos repentinos en hombres jóvenes de Lakewood de entre 30 y 40 años, e incluso entre 20 y 20 años, Lev Rochel Bikur Cholim realizará un examen de salud crítico para hombres el domingo…” 

Y así…

Fuente: https://americasfrontlinenews.com/post/mainstream-media-report-long-list-of-blood-clot-heart-attack-causes

Experto en genómica censurado por preocupaciones sobre la estabilidad de la vacuna

El artículo del científico genómico que trató de comparar las diferencias entre la vacuna y la proteína de pico del virus fue censurado después de una revisión por pares favorable.

Kevin McKernan  tiene una licenciatura en ciencias con formación en farmacología, toxicología e ingeniería biomédica. Anteriormente estuvo involucrado en el Proyecto del Genoma Humano y ha sido pionero en el trabajo en los campos de la secuenciación del genoma durante 30 años.  

Recientemente, se asoció con el renombrado disidente de COVID Peter McCullough y Anthony Kyriakopoulos para escribir un artículo titulado Diferencias en la vacuna y el ARNm derivado de la replicación del SARS-CoV-2: Implicaciones para la biología celular y la enfermedad futura . Buscaron la publicación en la editorial de acceso abierto, Hindawi.   

McKernan se refiere a esta «vacuna» como una tecnología familiar, ya que las modificaciones del ARNm que se incluyen en las vacunas son similares a las que usó en los secuenciadores de ADN.

“Las bases [de ADN] en las vacunas de ARNm no son las mismas que las bases que están en el virus. No solo son diferentes en la secuencia debido a la optimización de codones, sino que también son diferentes porque incluyen un nucleótido químicamente diferente conocido como N1-metilpseudoridina”, dice.

“Es una base que no tiene mucha fidelidad”, continúa McKernan, lo que significa que “es un poco descuidado con lo que se empareja”.

Esto significa que cuando la célula intenta leer el ARNm, existe la posibilidad de que cometa muchos errores, que es lo que los autores querían investigar en el artículo que, «lamentablemente, nos llevó en la dirección de que no hay muchos de datos por ahí”, dice McKernan mientras reitera la aterradora constatación de que falta información pública sobre “qué ARNm hay en estos viales y en qué se convierten realmente cuando le pides a las células humanas que los expresen”.

Mientras discutía las diferencias en la proteína de pico de la vacuna versus el virus, una distinción clave es cómo el virus ingresa al cuerpo, McKernan me dijo que “El virus ingresa a su conducto nasal y se replica [allí] tardando de 5 a 7 días en alcanzar su punto máximo antes de se aclara La inyección te proporciona ~40 billones de ARNm en una sola inyección que tiene un nucleótido modificado que hace que sea muy difícil que tu cuerpo lo elimine”, explica McKernan.

“En términos generales, desea que la cantidad de antígeno sea la más pequeña posible para impulsar la respuesta inmunitaria, particularmente si se demuestra que el antígeno en sí tiene algún tipo de patogenicidad, no desea presentarle al paciente demasiado de eso”, señalando que “ La proteína Spike no es tan inocua como nos hicieron creer”.

McKernan se remite a un artículo de Cheng et al que clasifica la proteína del pico del SARS-CoV-2 como un superantígeno. “Tiene una gran similitud con un arma biológica. Es una secuencia corta y hay mucha controversia con ese término, así que quiero ser muy claro aquí: tomar una subporción de la secuencia puede crear una tormenta de citoquinas». 

Ahora que la inmunidad de la población está aumentando, el documento destaca aún más la preocupación en torno a las poblaciones con ARNm y el virus simultáneamente. “¿Esas moléculas interactúan de alguna manera? no lo sabemos Tenemos que considerar la biología del ARNm y el virus: ¿pueden las dos moléculas interactuar y recombinarse y generar variantes? Es una incógnita que debe ser considerada”.

El documento ahora está en proceso de revisión por pares después de dos revisiones favorables. El consejo editorial se desvía hacia un reclamo de «revisión de integridad de la investigación». McKernan, como científico bien publicado , se refiere a esto como una barrera periodística, y nunca había visto este tipo de proceso retrasado durante meses. 

“Ahora estamos pasando a inyectar a los niños estas cosas y cada día que nos demoramos en sacar a la luz cualquier crítica o posible revisión de esto, solo crea más incertidumbre para las personas”.

Al compartir sus pensamientos finales, McKernan resume sus preocupaciones de manera articulada.

“Este [producto] de ARNm entrará en sus células y creará el fármaco y solo están teorizando sobre lo que va a crear. No han demostrado públicamente qué es el ARNm desde el punto de vista de la secuenciación donde vemos las lecturas sin procesar y vemos la tasa de error en la producción de vacunas… estos ARNm no se reproducen fielmente. Así que tenemos una prodroga, que está produciendo una [otra] droga y la droga no se conoce y no se ha caracterizado y se inyecta a miles de millones de personas con cero responsabilidad. Esto nunca ha sucedido antes en la medicina”.

Fuente: https://www.rebelnews.com/genomics_expert_censored_over_concerns_about_vaccine_stability

Justicia uruguaya pide al gobierno y a Pfizer aclarar componentes de vacunas anticovid

Por Jim Hoft

Según un fallo reciente de un juez uruguayo, el gobierno y la farmacéutica Pfizer deben proporcionar toda la información que tengan sobre la composición bioquímica de la vacuna contra el COVID, incluida cualquier evidencia de “óxido de grafeno” o “elementos nanotecnológicos”, así como pruebas de la eficacia y seguridad de la vacuna.

El juez del Tribunal de lo Contencioso Administrativo (TCA) Alejandro Recarey dictó la orden en respuesta a un pedido de suspensión de vacunación de niños a partir de 5 años en Uruguay.

De acuerdo con la orden judicial difundida el sábado, el juez Alejandro Recarey ordenó a Presidencia, Secretaría de Salud Pública, Administración Estatal de Servicios de Salud (ASSE) y Pfizer presentar toda la información sobre las vacunas contra el Covid-19 en un plazo de 48 horas, informó El Observador . .

“El miércoles a las 9:00 am se realizará una audiencia donde deberán comparecer representantes de todas las dependencias y de la empresa ”, agregó el medio.

Más de France 24 (traducido):

Según la decisión, el Ejecutivo y el laboratorio estadounidense deberán aportar documentación sobre la composición de las vacunas, incluida la posible presencia de “óxido de grafeno” o “elementos nanotecnológicos”.

También se solicitan datos que demuestren la “inocuidad” de “la sustancia llamada ARN mensajero” y que prueben con estudios de la agencia estadounidense de Estados Unidos, la FDA, “el carácter experimental” de las vacunas.

El magistrado pide a las autoridades “explicar si se han estudiado terapias alternativas anticovid-19” y “si no, aclarar por qué no se exploraron estas soluciones”, según el documento.

Los contratos firmados entre el gobierno y Pfizer también están sujetos a escrutinio para ver si contienen cláusulas “de indemnización civil o de impunidad penal para los proveedores respecto a la ocurrencia de posibles efectos adversos”, entre otros detalles.

La decisión judicial también exige explicaciones sobre si se han realizado estudios “con el objetivo de explicar el notorio aumento de muertes por covid-19 a partir de marzo de 2021 en relación con el año anterior”.

“Muy especialmente, se instruirá a Pfizer para que manifieste en el plazo de 48 horas -con aportación de datos documentales en su caso- si la empresa ha admitido (…) la constatación de efectos adversos de vacunas contra el denominado Covid-19. En general, y también en detalle respecto a la población infantil”, dice el documento.

Fuente: https://www.thegatewaypundit.com/2022/07/pfizer-ordered-uruguayan-judge-report-composition-covid-19-vaccines-including-presence-graphene-oxide-nanotechnological-elements/

https://www.france24.com/es/minuto-a-minuto/20220703-justicia-uruguaya-pide-al-gobierno-y-a-pfizer-aclarar-componentes-de-vacunas-anticovid

https://www.elobservador.com.uy/nota/juez-intimo-al-gobierno-y-a-pfizer-a-que-presenten-en-48-horas-toda-la-informacion-sobre-las-vacunas-contra-el-covid-19-20227219938

Los efectos devastadores de la vacuna COVID-19 confirmados: nos mintieron: Fin del juego, ganamos. Steve Kirsch

Por Steve Kirsch

Una de mis encuestas tenía una señal fuerte. Así que hice que una firma de encuestas de terceros lo hiciera frente a una audiencia neutral. Los resultados son devastadores. Muestra que nos mintieron. Gran momento. No hay otra forma de girarlo.

Ahora tengo una pregunta de encuesta que, cuando se prueba con una audiencia neutral, da una señal muy fuerte. Resulta que la mayoría de la gente piensa que las vacunas contra el COVID han matado a más personas en solo un año y medio que las más de 70 vacunas combinadas en los últimos 32 años. Cuanto menos vacunado esté, más probabilidades tendrá de notar esto. Si ha tenido cuatro dosis, estaba casi empatado.

Aquí está la tabla dinámica de los resultados de Pollfish para que pueda ver los votos frente al estado de la vacuna:

Aquí están los datos subyacentes para que pueda verificar el resultado. Y aquí está el resumen en PDF que proporcionaron.

Lo que esto significa es que hemos ganado. No hay manera de defender esto.

A menos que me haya perdido algo, están totalmente jodidos. Simplemente no hay forma de «girar esto» a su favor. Esta encuesta es simple de replicar y destruye por completo la narrativa «segura y efectiva» porque no hay forma de «girar» los resultados a su favor. es devastador

El CDC argumentaría: “Le está pidiendo al público que emita un juicio no profesional sobre la causalidad. En el CDC no hemos determinado ningún vínculo causal. ¡Todas estas muertes son simplemente coincidencias!”

¡Los verificadores de hechos estarán de acuerdo con ellos!

Está bien.

Simplemente explique por qué hay más de 1,7 veces más «coincidencias» con las vacunas contra el COVID que con las más de 70 vacunas en los últimos 32 años . Alegrame el dia. Respalde con datos reales que demuestren su punto, no con un argumento de mano.

O muéstrame tu encuesta. Y explique por qué, en los 18 meses que la vacuna ha estado en el mercado, nunca buscó encontrar la tasa de incidencia de eventos adversos y muertes en una encuesta proactiva en lugar de quedarse sentado con un sistema de vigilancia pasiva. ¿Y explícanos por qué nunca revelaste a nadie los datos de mortalidad de Medicare? ¿Cuál fue la razón para mantener eso en secreto? Explícanos eso.

Lamentablemente, la prensa simplemente aceptará cualquier argumento de los CDC, sin importar cuán idiota sea. Así lo defenderán. Nunca harán las preguntas en mi párrafo anterior.

Así que aún no ha terminado, pero nos estamos acercando.

Confirmación de la encuesta en el sistema VAERS

Esto no es una casualidad.

El sistema VAERS esencialmente está emitiendo la misma señal de seguridad con una proporción que es bastante cercana a lo que encontró nuestra encuesta.

Resulta que el 69% de todas las muertes en VAERS (limitándonos solo a las muertes en EE. UU.) son por las vacunas COVID.

Entonces, esto significa que las vacunas COVID han matado a 2,3 veces más personas que las más de 70 vacunas en los últimos 32 años.

¿Cómo explicas eso? No puede ser un informe excesivo de las muertes de fondo porque el perfil de eventos adversos de las muertes por COVID no coincide con las «causas naturales». Así que estos estúpidos argumentos de agitar las manos no funcionan.

Aquí están las consultas que utilicé y los resultados.

Muertes solo por las vacunas COVID, limitadas a los estados de EE. UU. Hay más de 2,3 veces más muertes por las vacunas COVID que por todas las demás vacunas juntas desde el inicio del sistema VAERS hace 32 años. Esa es una tasa de muertes impresionante.

Muertes por TODAS las vacunas mayores de 32 años solo en los estados de EE. UU.

Otras encuestas preocupantes para la narrativa dominante

La encuesta anterior es solo el comienzo.

La validación de audiencia neutral de las siguientes encuestas también llegará en breve.

Lesiones

Las vacunas están dañando a más personas que el COVID. Los protocolos de tratamiento hospitalario son el #2. ¿Por qué no podemos dejar que los médicos sean médicos?

La vacuna COVID es la mayor fuente de lesiones, seguida de los protocolos hospitalarios COVID, seguida por el propio virus en último lugar. Las «curas» dictadas por el gobierno tienen muchas más probabilidades de lesionarlo que el virus mismo.

Fallecidos

El gran asesino: la vacuna. Los protocolos de tratamiento hospitalario son el #2. ¿Por qué no podemos dejar que los médicos sean médicos?

La vacuna COVID es la principal causa de muerte, seguida de los protocolos hospitalarios COVID, seguida por el virus en sí mismo en último lugar. Las «curas» dictadas por el gobierno tienen muchas más probabilidades de matarlo que el virus mismo.

Tasas de miocarditis

Los médicos dicen que la miocarditis por COVID es mayor que por la vacuna. Aunque cosa divertida…. No pude encontrar ningún cardiólogo que haya visto más tasas de miocarditis antes de que se implementaran las vacunas. Parece que no estoy solo.

La presentación “El elefante en la habitación” tiene más ejemplos

¿Quieres más pruebas de que te han engañado? Echa un vistazo a mi conjunto de diapositivas Elefante en la habitación y descubrirás muy rápidamente por qué nadie quiere hablar sobre el elefante en la habitación: que los CDC, la comunidad médica, el Congreso, los funcionarios de salud estatales y locales, los principales medios de comunicación y las principales redes sociales las compañías son responsables de matar a más de 500,000 estadounidenses al incitarlos a tomar una vacuna que era mucho más probable que los matara que los salvara.

Ninguna de las intervenciones fue necesaria. Tuvimos un protocolo de tratamiento temprano efectivo en marzo de 2020 , pero los NIH y los CDC lo ignoraron y aún lo hacen hasta el día de hoy. No hay muertes ni COVID de largo recorrido si a las personas se les da ese protocolo. Más de 10.000 personas fueron tratadas sin muerte ni hospitalización si el paciente inicia el tratamiento inmediatamente después de los primeros síntomas. La razón por la que se ignora es simple: Tony Fauci dice que tales protocolos no funcionan, aunque sí lo hacen. No es que miraron el protocolo y lo rechazaron. Es como si nunca hubieran mirado el protocolo.

También entenderás por qué nadie quiere debatirme.

Resumen

Esta encuesta es demoledora porque se confirma con una audiencia neutral. La encuesta y varias más ahora serán repetidas por una firma encuestadora de fama internacional.

Así que ya sabes quién va a ganar la partida: la verdad.

Y ahora es sólo cuestión de tiempo. Será divertido ver a la gente tratar de atacarme mientras tanto.

Mi consejo para ellos es simple: si te encuentras en un hoyo, deja de cavar.

Siguiente paso: espera a que el nuevo encuestador famoso publique esta encuesta y varias otras. Son muy respetados.

Fuente: https://www.globalresearch.ca/impacts-covid-19-vaccine-game-over-we-won-steve-kirsch/5782830

El confinamiento de Shanghái. Visto desde otro ángulo

Por Peter Koenig

Mientras que casi todo el mundo critica a China y la acusa de abusos contra los derechos humanos por encerrar a los 26 millones de ciudadanos de Shanghai, cuando solo se detectaron unos 26.000 casos positivos de «Covid-19». A primera vista, eso parece anormal, o incluso una gran exageración. A primera vista.

Pero veamos de nuevo.

¿Recuerdas el brote de SARS (Severe Acute Respiratory Syndrome) de 2002 a 2004?

Infectó a unas 8.000 personas y causó 774 muertes. Con mucho, la mayoría de los casos y de las muertes se encontraron en China continental y Hong Kong, algunos en Taiwán e incluso unos pocos en Japón, Estados Unidos y, aparentemente, en más de 20 países de todo el mundo.

Lo que es notable es que todos los «casos» eran personas con el genoma chino. En otras palabras, el virus atacó específicamente a la «raza china», es decir, fue hecho a medida para atacar a China y sus ciudadanos.

«Casualmente», unos años antes, en 1999 y 2000, el gobierno chino detectó a cientos de «científicos» occidentales, generalmente de Harvard y otros institutos y laboratorios de aprendizaje de renombre occidental, recolectando muestras de ADN de personas en las zonas rurales de China, principalmente en las provincias del noroeste de China.

Estos «científicos» contrataron a ciudadanos chinos para que les ayudaran a recolectar muestras de sangre en regiones aisladas a cambio de un pago. Los occidentales fueron, por supuesto, expulsados, una vez detectados. Sin embargo, demasiado tarde. Ya habían sacado de contrabando de China miles de muestras de ADN tomadas de chinos nativos. Vea esto.

Estas muestras servirían más tarde para diseñar un coronavirus especial dirigido al genoma chino. El brote de SARS resultante de 2002-2004 en China fue una prueba, para mal por venir.

¿Recuerdas también el Evento 201 que tuvo lugar en Nueva York el 18 de octubre de 2019? patrocinado por la Fundación Bill y Melinda Gates, el Foro Económico Mundial (WEF) y el Centro Johns Hopkins para la Seguridad de la Salud, que también fue el anfitrión del evento.

Durante este evento, todos los actores mundiales importantes, como el Banco Mundial, el FMI, la ONU y muchos de los organismos especializados de las Naciones Unidas, incluidos UNICEF y, por supuesto, la OMS, así como las principales instituciones bancarias y financieras, los principales institutos de salud de los Estados Unidos, como los CDC, la FDA e incluso los CDC de China, e incluso muchos más, participaron en esta simulación de escritorio, que iba a producir en todo el mundo más de 60 millones de muertes en el lapso de aproximadamente dos a tres años. Vea esto.

Como las autoridades chinas eran muy conscientes del virus genéticamente dirigido, estaban alertas cuando el SARS-Cov-2 golpeó Wuhan a principios de 2020. Su reacción fue lógica, inmediata y severa. Cerraron no solo Wuhan (pop. 11 millones) a la vez, sino una gran parte, unos 50 millones de personas, de la provincia de Hubei, de la cual Wuhan es la capital. Posteriormente, más áreas dentro de China, donde se detectó el SARS-Cov-2, fueron bloqueadas. Significó el comienzo de la tolerancia cero para lo que más tarde fue convenientemente renombrado por la OMS como Covid-19. También recuerde que el Covid-19, alias SARS-Cov-2, nunca fue aislado ni identificado como un nuevo virus.

Conociendo los antecedentes de los virus diseñados genéticamente o por raza, la reacción de China para proteger a sus ciudadanos fue lógica e inmediata. De hecho, con esta política, China dominó la enfermedad en gran medida en unos seis a ocho meses. Durante esos duros confinamientos, alrededor del 80% del complejo industrial chino quedó paralizado. Pero a finales de 2020, la mayoría de los aparatos de producción, fábricas, líneas navieras y producción agrícola chinos estaban zumbando de nuevo, y de nuevo en la corriente.

Esta es una de las principales razones por las que el crecimiento económico chino apenas sufrió durante este nuevo brote de covid. De hecho, frente a la proyección del FMI de un crecimiento del 1,2% en 2021, y la propia proyección china de una expansión económica del 3,5% en 2021, el crecimiento real chino en 2021 se registró como del 5,5%. Este crecimiento y el potencial de exportación resultante han ayudado a muchos países, especialmente en el continente asiático, a reducir sus pérdidas inducidas por covid y a hacer avanzar sus economías.

Desde la revolución comunista del presidente Mao Zedong en 1949, China fue una espina persistente en los ojos capitalistas occidentales. A medida que China se ha convertido gradualmente en una superpotencia, tanto económica como estratégicamente hablando, los ataques y las sanciones occidentales contra China también han crecido. No importa cuán ilegal sea, contra el derecho internacional y contra los derechos humanos -liderados por Estados Unidos, Occidente está imponiendo implacablemente sanciones económicas a China- y, por supuesto, también al aliado más cercano de China, Rusia.

A pesar de estas sanciones, China pronto, dentro de los próximos 3 a 4 años, si no antes, superará a la economía estadounidense. De hecho, cuando se mide de acuerdo con los únicos indicadores económicos reales, a saber, el factor PPA (Paridad de Poder Adquisitivo, es decir, el valor de los bienes que una moneda puede comprar), China ha superado a los Estados Unidos hace ya varios años.

China es una cadena de suministro de piezas vitales de producción provisional y / o de producción de uso final, Occidente necesita hacer que sus bienes de consumo funcionen y los consumidores felices. Rusia, por otro lado, suministra la mayoría de las materias primas disponibles en su vasto territorio para producir estos bienes que Occidente codicia.

Tanto China como Rusia son económica y estratégicamente cruciales para Occidente. También son aliados cercanos. Representan una amenaza para la supremacía occidental. Occidente no tolera esto, ya que la dominación está en los genes de Occidente. Basta con mirar hacia atrás a mil años de colonias occidentales en el Sur Global.

En lugar de buscar acuerdos de cooperación con estos socios vitales, Occidente busca dominarlos y aniquilarlos, con sanciones y con guerra física. La principal institución de guerra de Occidente, la OTAN, no pierde el ritmo para amenazar e intentar intimidar a Rusia y China, invadiendo las fronteras de estos dos aliados, así como jugando su poderío militar en maniobras armadas cercanas a sus fronteras. No es de extrañar que China se haya unido recientemente a Rusia para oponerse a una mayor expansión de la OTAN, a medida que los dos países se acercan frente a la presión occidental.

*

Ahora viene la guerra de Ucrania con Rusia, de la cual la expansión de la OTAN es solo una de las razones. A estas alturas, la mayor parte del mundo sabe, incluso la corriente principal ya no lo oculta, que el entonces secretario de Estado de los Estados Unidos, James Baker III, y los aliados europeos de Washington prometieron en la capitulación de la Unión Soviética en 1991, el entonces presidente soviético / ruso Mikhail Gorbachev, no mover a la OTAN una pulgada más al este de Berlín.

Esta fue una promesa hecha a cambio de permitir que Alemania se reuniera con Alemania Oriental e integrara Berlín Oriental en Berlín Occidental, rehaciendo la ciudad combinada de Berlín nuevamente la capital de Alemania.

Como todos sabemos, esta promesa se ha roto miserablemente. En 1991 la OTAN contaba con 16 países miembros, de los cuales 2 en las Américas (Estados Unidos y Canadá) y 14 en Europa. Hoy, unos 30 años después, la OTAN cuenta con 30 miembros. Los 14 nuevos están en Europa, muchos de los cuales se acercan cada vez más a las fronteras de Rusia. Ucrania fue el siguiente candidato de la OTAN. Esto, Rusia no podía tolerarlo.

Imagínese, Rusia o China construyeran bases militares en México o América Central, cómo reaccionaría Estados Unidos. Tenemos un ejemplo lívido de la crisis de Bahía de Cochinos de 1961, cuando el entonces presidente estadounidense JFK y el presidente ruso Nikita Khrushchev evitaron una guerra nuclear potencialmente destructiva, a través de negociaciones en una reunión en Viena.

Las preocupaciones del presidente Putin hoy son más que comprensibles, y explican parcialmente su intervención en Ucrania. Esto no justifica una guerra de ninguna manera, sino que explica parcialmente la reacción de Rusia.

Conectando los puntos con el confinamiento de Shanghai

Sin embargo, posiblemente una razón aún más importante que la amenaza de la OTAN para la intervención del presidente Putin en Ucrania son los biolaboratorios de tipo bélico de 20 a 30 (grado 3) financiados por Estados Unidos en Ucrania. Fueron construidos durante los últimos 20 años, la mayoría de ellos después del golpe de Maidan instigado por Occidente en febrero de 2014 que condujo al estado actual de las cosas con Ucrania, y entre Ucrania y Rusia.

Por razones de seguridad nacional, Rusia tiene que controlar y posiblemente destruir estos laboratorios mortales. Para ello, era necesaria una intervención. El momento de las agresiones occidentales para desencadenar la intervención rusa, especialmente los asesinatos de civiles de los batallones nazis Azov en la región separatista de Donbas, no es una coincidencia. En 8 años transcurridos desde el golpe de Maidan, se registraron 14.000 muertes de civiles, de las cuales aproximadamente un tercio son niños. Se ajusta a la narrativa del Reinicio Global del WEF que apunta a la dominación global de la población mundial total, todos los 193 países miembros de la ONU, a través de muchos medios.

Todo esto es parte de la infame Agenda 2030 de la ONU. El comienzo fue la falsa guerra del miedo al Covid, bajando el sistema inmunológico de las personas y la voluntad de resistir; por lo tanto, llevándolos como una oveja oída a las llamadas cámaras vaxx, donde se les inyectó lo que la narrativa de la mentira llama vacunas anti-covid-19, cuando en realidad son jabs de prueba de ARNm (modificadores del ADN).

Diferentes viales de vacunas producidos en Occidente contienen diferentes composiciones bioquímicas, incluido el óxido de grafeno para facilitar eventualmente las manipulaciones cerebrales electromagnéticas, coincidiendo con el sueño de Klaus Schwab y su 4ª Revolución Industrial donde, en última instancia, el resto del mundo sobreviviente estaría completamente digitalizado.

Según Mike Yeadon, ex vicepresidente y jefe de ciencia de Pfizer, estas vacunas falsas reducen aún más el sistema inmunológico de los humanos. El primer pinchazo en aproximadamente un 30%, el segundo en otro 30% y el tercer jab, el llamado booster (refuerzo), en otro 20%. Eso deja intacto alrededor del 20% del sistema autoinmune de hombres y mujeres. En otras palabras, dentro de uno a tres años de ser vacunadas, las personas podrían morir de una variedad de enfermedades, incluidos cánceres agresivos y diferentes tipos de dolencias cardíacas que serían difíciles de rastrear hasta los vacunas. Como ejemplos vemos esto, las vacunas Covid para esterilizar a las mujeres y este Covid vacunas para incluir ingredientes del VIH.

¿Y si el 4º y 5º y así sucesivamente son los «impulsores»: todos programados?, ¿se soltarán e impondrán a la humanidad en los próximos 7 u 8 años hasta la finalización de la Agenda 2030 de la ONU?

Además, la constante narrativa vaxx adoctrinada por los medios de comunicación occidentales deja a muchas personas, hoy todavía como mayoría, en un estado de disonancia cognitiva; es decir, no pueden admitir que les hayan mentido a sí mismos su gobierno, que supuestamente eligieron y pagaron con sus impuestos para protegerlos. Tal traición es demasiado para creer y admitirse a sí mismos. La cábala oscura detrás de este plan y detrás de la tiránica Agenda 2030 de la ONU lo sabe. Eso hace que sea aún más difícil despertar a la gente y llevarla a una oposición solidaria.

Volver a los laboratorios de virus de Ucrania

Estos biolaboratorios de tipo bélico de grado 3 son capaces de producir virus específicos del genoma que pueden dirigirse para atacar diferentes genomas rusos y personas de ADN chino, así como otros, si se programan en consecuencia. Numerosas pruebas de este tipo de virus hechos a medida se han llevado a cabo durante las últimas dos o tres décadas. No menos importante el brote de ébola en África occidental (2014-2016), que afecta principalmente a Guinea, Sierra Leona y Liberia, el epicentro del brote. Durante la duración de esta epidemia de ébola, hubo 28.616 casos sospechosos, probables y confirmados de estos tres países y 11.310 muertes, lo que llevó a una horrenda tasa de muertes por caso de alrededor del 40%. Compare esto con la llamada tasa de mortalidad por Covid-19 de alrededor de 0.07 a 0.1%; una incidencia similar a la de la gripe.

¿Quién sabe si un ébola dirigido al genoma o cualquier otro virus mortal está o estaba siendo producido en laboratorio en uno de los biolaboratorios financiados por Estados Unidos, que las fuerzas rusas «intervinieron» para destruir por el bien de la humanidad?

Por supuesto, no hay garantía de que ninguno de esos gérmenes mortales y diezmadores de la población de la guerra biológica haya «escapado» o haya sido liberado antes de la intervención rusa, en línea con el Gran Reinicio y Bill Gates predijo un nuevo y mucho más peligroso brote epidémico.

Una advertencia similar sobre un posible brote de Marburgo (hemorragia interna similar al ébola) fue hecha a principios de este año por el primer ministro francés, Jean Castex, cuando advirtió que las elecciones francesas a principios de abril de 2022 podrían tener que posponerse … no sucedió, hasta ahora. Pero quién sabe, si tal brote puede ocurrir y cuándo.

¿Y quiénes serían los principales objetivos de tales virus? – ¿China y Rusia?

Si bien no hay evidencia concreta de un ataque biológico, ¿tal vez la «tolerancia cero al covid» de China, y el cierre total de Shanghai, ahora se entiende mejor?

Nosotros, el pueblo, en solidaridad unos con otros, dentro y con todas las naciones, debemos hacer todo lo posible para derribar esta «agenda oscura» y traer la Luz, incluso si requiere sacrificio temporal. – Al final, ten cuidado, la Luz vence a la oscuridad.

*

Peter Koenig es analista geopolítico y ex economista principal del Banco Mundial y la Organización Mundial de la Salud (OMS), donde ha trabajado durante más de 30 años en agua y medio ambiente en todo el mundo. Da conferencias en universidades de estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea y es autor de Implosion – An Economic Thriller about War, Environmental Destruction and Corporate Greed; y coautor del libro de Cynthia McKinney «When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis» (Clarity Press – 1 de noviembre de 2020)

Peter es investigador asociado del Centro de Investigación sobre la Globalización (CRG).

También es miembro senior no residente del Instituto Chongyang de la Universidad Renmin, Beijing.

Fuente: https://www.globalresearch.ca/shanghai-lockdown-seen-from-another-angle/5778124?utm_campaign=magnet&utm_source=article_page&utm_medium=related_articles

Las crisis ambientales invisibles que destruyen a la humanidad

Por Ryan Matters

En la parte 1 de esta serie, analizamos un reciente documento de política de Rockefeller que pide un cambio transformador en la producción de alimentos y cómo eso se relaciona con la nueva agenda alimentaria.

En la parte 2, examinamos la historia turbia de la agroindustria moderna y algunas de las élites e instituciones ricas que promueven cultivos genéticamente modificados y tecnologías peligrosas de impulsores genéticos.

En la parte 3, examinaremos las crisis ambientales reales que afectan a la humanidad todos los días, pero ignoradas por muchos de los llamados activistas y «filántropos». Empezando por…

ALIMENTOS AGOTADOS EN NUTRIENTES

Durante décadas, estimados científicos y pensadores nos han advertido sobre el impacto de la mala nutrición en la salud. Entre ellos se encuentran Sir Robert McCarrison, el Dr. Lawrence Plaskett, Weston Price y el dos veces ganador del Premio Nobel, el Dr. Linus Pauling.

A lo largo de los años, sus advertencias han sido ignoradas, subvertidas o desacreditadas. Basta con echar un vistazo a los principales medios de comunicación para encontrar afirmaciones como «los suplementos vitamínicos no son más que orina cara».

A esto se suma el hecho de que los médicos (incluso aquellos que se especializan en el intestino) reciben poca o ninguna educación en nutrición. Como se indica en la introducción a A Physician’s Handbook on Orthomolecular Medicine[1]:

Existe un amplio espectro de opiniones inexpertas desinformadas sobre la importancia práctica de una nutrición de calidad en nuestra vida diaria».

Eso fue escrito en 1977 y, lamentablemente, parece que sigue siendo cierto hasta el día de hoy.

En 2002, investigadores de la Escuela de Medicina de Harvard publicaron un artículo titulado Vitaminas para la prevención de enfermedades crónicas.

Aunque sus hallazgos pueden haber sido obvios para los profesionales ortomoleculares décadas antes, sus conclusiones no fueron menos importantes, reconociendo el hecho de que la mayoría de las personas no consumen una cantidad óptima de todas las vitaminas solo con la dieta, y (aunque con cautela) abogando por el uso de suplementos vitamínicos para todos los adultos.

Aún más importante, los investigadores reconocieron los efectos generalizados en la salud de la ingesta subóptima de vitaminas (incluso por encima de los requisitos estándar):

… La ingesta insuficiente de vitaminas es aparentemente una causa de enfermedades crónicas. La evidencia reciente ha demostrado que los niveles subóptimos de vitaminas, incluso muy por encima de los que causan síndromes de deficiencia, son factores de riesgo para enfermedades crónicas como las enfermedades cardiovasculares, el cáncer y la osteoporosis. Una gran proporción de la población general aparentemente está en mayor riesgo por esta razón».

A pesar de hallazgos importantes como estos, rara vez se toman medidas para garantizar que las personas obtengan cantidades adecuadas de nutrientes. Por ejemplo, parece que cientos de miles de muertes podrían haberse evitado solo en el Reino Unido, si el gobierno hubiera actuado sobre la evidencia convincente de los beneficios del ácido fólico.

El ácido fólico reduce los niveles de homocisteína, un aminoácido que está relacionado con ataques cardíacos y accidentes cerebrovasculares. Los niveles subóptimos de ácido fólico también pueden causar defectos del tubo neural y contribuir a la displasia cervical, el cáncer, la osteoporosis y la depresión mental.

La cantidad diaria recomendada de la mayoría de los nutrientes es posiblemente demasiado baja, sin tener en cuenta los beneficios de una ingesta óptima. Además, tener un requisito para cada persona no tiene en cuenta la singularidad de cada individuo.

La vitamina D ha estado en los medios de comunicación recientemente debido a investigaciones que indican que es eficaz en el tratamiento de «Covid-19». Sin embargo, la importancia de la vitamina D, no solo para prevenir enfermedades respiratorias, sino para tratar una variedad de enfermedades crónicas, se conoce desde hace al menos 20 años. A pesar de esto, la deficiencia de vitamina D sigue siendo generalizada.

Según los investigadores Vásquez, Cannell y Manso:

La deficiencia / insuficiencia de vitamina D es una epidemia en el mundo desarrollado que hasta ahora ha recibido una atención insuficiente de los médicos a pesar de la documentación de su prevalencia, consecuencias y el imperativo de la suplementación diaria a niveles superiores a las recomendaciones inadecuadas actuales de 200-600 UI «.

La razón de esto es doble; En primer lugar, los médicos están trabajando desde una comprensión obsoleta, viendo la vitamina D como nada más que un nutriente óseo (la investigación indica que este claramente no es el caso).

Y en segundo lugar, las pruebas de laboratorio que miden los niveles de vitamina D se establecen demasiado bajas, subestimando el requisito fisiológico de niveles más altos de vitamina D.

La gravedad de la deficiencia de vitamina D (una deficiencia que puede corregirse fácilmente a través de la suplementación o la educación sobre la importancia de la exposición al sol), ha llevado a algunos investigadores a cuestionar la ética de no tratar un problema tan generalizado.

Dada la profundidad y amplitud de la investigación revisada por pares que documenta la frecuencia y las consecuencias de la hipovitaminosis D, la falta de diagnóstico y tratamiento de este trastorno es éticamente cuestionable (particularmente en mujeres embarazadas) y es inconsistente con la prestación de atención médica de calidad basada en la ciencia».

Al igual que con la vitamina D, a pesar de la voluminosa investigación que muestra sus enormes beneficios, la deficiencia de magnesio todavía está muy extendida. Aunque rara vez se nos educa sobre la importancia de este mineral, el magnesio es esencial para la mayoría de los procesos corporales y los niveles subóptimos pueden resultar en una amplia gama de síntomas desagradables (y a veces fatales).

La importancia del magnesio se explica en un artículo titulado Magnesio en la prevención y la terapia,

El magnesio es el cuarto mineral más abundante en el cuerpo. Ha sido reconocido como un cofactor para más de 300 reacciones enzimáticas, donde es crucial para el metabolismo del trifosfato de adenosina (ATP). El magnesio es necesario para la síntesis de ADN y ARN, la reproducción y la síntesis de proteínas».

Los niveles bajos de magnesio se han asociado con una serie de enfermedades crónicas, como la enfermedad de Alzheimer, la resistencia a la insulina y la diabetes mellitus tipo 2, la hipertensión, las enfermedades cardiovasculares (por ejemplo, accidente cerebrovascular), las migrañas y el trastorno por déficit de atención con hiperactividad (TDAH).

En su esclarecedor libro El milagro del magnesio[2], la Dra. Carolyn Dean dedica más de 600 páginas a la importancia de este mineral raramente mencionado. También destaca el vínculo importante, aunque a menudo pasado por alto, entre la deficiencia de magnesio y la enfermedad mental.

Las personas no tienen ansiedad, ataques de pánico o depresión porque tienen una deficiencia de Valium o Prozac. Nuestros cuerpos no requieren estas sustancias para los procesos metabólicos esenciales. Sin embargo, podemos desarrollar una miríada de síntomas psicológicos debido a una deficiencia de magnesio, un nutriente que nuestros cuerpos requieren».

Según el Dr. Dean, las granjas comerciales no logran reponer el suelo agotado, y el magnesio que queda no puede ser absorbido por las plantas debido a los fertilizantes de potasio altos o los residuos de pesticidas. La investigación ha demostrado que el glifosato, por ejemplo, se une con el magnesio, evitando la absorción.

Como resultado, las raíces de muchas deficiencias de nutrientes se remontan al suelo en el que se cultiva gran parte de nuestros alimentos.

La revista Life Extension comparó las tablas de alimentos del USDA desde 1963 hasta la actualidad y encontró una caída sorprendente en el contenido de nutrientes. Algunas vitaminas han disminuido hasta en un 40%.

Por ejemplo, la cantidad de vitamina A en las manzanas ha disminuido de 90 mg a solo 53 mg. La cantidad de potasio y magnesio en la col rizada ha disminuido de 400 mg a 170 mg y de 57 mg a 9 mg respectivamente.

Una tendencia similar se observa en prácticamente todas las demás verduras y frutas, lo que indica que las frutas y verduras están perdiendo su contenido de nutrientes a un ritmo rápido. Más preocupante es el hecho de que el USDA (Departamento de Agricultura de los Estados Unidos) se niega a actuar. Cuando Organic Gardening Magazine se puso en contacto con el Servicio de Investigación Agrícola del USDA preguntando si les preocupaba que los estadounidenses no estuvieran recibiendo los nutrientes adecuados, respondieron con indiferencia.

El USDA aparentemente no está preocupado y no está interesado en el drenaje de vitaminas, a pesar de su mandato de garantizar alimentos seguros de alta calidad. En su carta a Organic Gardening, johnson dijo que el contenido nutricional de los productos no es tan importante como cosas como la apariencia y el gran rendimiento.

Para que uno no piense que el agotamiento de nutrientes es una crisis reservada para los estadounidenses, se ha encontrado que lo mismo es cierto en el Reino Unido.

El experto en minerales y miembro de la Sociedad Geológica, David Thomas, analizó la 6ª edición de The Composition of Foods de McCance y Widdowson y encontró una severa caída en el contenido de nutrientes en la mayoría de los alimentos en el Reino Unido en los últimos 60 años. Según Thomas,

McCance & Widdowson proporcionan los registros históricos más detallados y sofisticados de los valores nutricionales de los alimentos disponibles para cualquier nación en todo el mundo».

Esto hace que los hallazgos de su estudio sean aún más alarmantes. El estudio de Thomas tampoco se limita a las frutas y verduras. Su análisis ha revelado una caída drástica en el contenido de nutrientes (especialmente minerales esenciales) en casi todos los grupos de alimentos (esto incluye la carne y los productos lácteos).

En los últimos 60 años ha habido cambios fundamentales en la calidad y cantidad de alimentos disponibles para nosotros como nación. El carácter, el método de cultivo, la preparación, la fuente y la presentación final de los alimentos básicos han cambiado significativamente en la medida en que los oligoelementos y el contenido de micronutrientes se han agotado gravemente».

La principal crítica a la investigación de Thomas es que los métodos analíticos eran menos precisos en el pasado y, por lo tanto, no es válido comparar el contenido de nutrientes. Sin embargo, esto parece ser una afirmación falsa, ya que los propios McCance y Widdowson sostienen que, aunque los métodos analíticos utilizados en el pasado ahora se consideran «primitivos», no eran menos precisos que los métodos de análisis más modernos[3].

La segunda crítica es que las variedades de cultivos han cambiado a lo largo de los años, lo que hace que cualquier comparación similar no tenga sentido. Sin embargo, este argumento también falla, ya que, incluso si las variedades de cultivos han cambiado, esto no cambia el hecho de que el valor nutritivo de la dieta de la persona promedio ha disminuido sustancialmente.

Thomas resume la gravedad de esta crisis de nutrientes en la conclusión de su artículo de 2007:

Qué dilema nos hemos encontrado. La investigación de todo el mundo ha demostrado la realidad de la pérdida de micronutrientes de nuestros alimentos y proporciona evidencia de que las deficiencias de micronutrientes socavan significativamente nuestra salud, contribuyendo a enfermedades fisiológicas y psicológicas crónicas en personas de todas las edades».

SUSTANCIAS QUÍMICAS DISRUPTORAS ENDOCRINAS

La industria manufacturera es responsable de emitir cantidades masivas de productos químicos tóxicos al medio ambiente y los efectos de muchos de estos son completamente desconocidos.

La Oficina de Seguridad Química y Protección contra la Contaminación (OCSPP) de la EPA es la organización responsable de proteger a las personas de los riesgos de la exposición a pesticidas y productos químicos tóxicos. El OCSPP realiza pruebas para evaluar los niveles de tolerancia de varios productos químicos y decide sobre los niveles máximos de residuos de plaguicidas permitidos en los alimentos.

Sin embargo, como John Kepner de BeyondPesticides.com argumenta acertadamente,

Las exposiciones a pesticidas en el mundo real no son incidentes aislados. Más bien, son una serie de incidentes marcados por combinaciones de exposiciones».

Continúa diciendo que,

Los científicos han argumentado durante años que las exposiciones tóxicas a los pesticidas deben medirse como ocurrirían normalmente, en combinación entre sí. Sin embargo, la ley federal actual no requiere este tipo de pruebas de pesticidas en el mercado, excepto en casos muy limitados».

Sorprendentemente, según la American Chemical Society (ACS),

Nadie, ni siquiera la Agencia de Protección del Medio Ambiente, sabe cuántos productos químicos se utilizan hoy en día».

Si la EPA ni siquiera sabe cuántos productos químicos están en uso hoy en día, ¿cómo pueden evaluar sus efectos en la salud de las personas? La respuesta es que no pueden. Y las razones de esto se derivan de los sistemas regulatorios existentes de la EPA, que se establecen para servir a los intereses corporativos sobre la salud de la población.

Esto es esbozado extensamente por Dawn Lester y David Parker en su libro What Really Make You Ill[4]:

Los sistemas regulatorios existentes… favorecer cada vez más a la industria sobre el consumidor; permiten la rápida liberación de productos en el mercado, pero implican muchas dificultades para la eliminación de productos después del descubrimiento de cualquier efecto adverso».

Como si los sistemas regulatorios fallidos no fueran lo suficientemente malos, los denunciantes dentro de la EPA han revelado recientemente la enorme presión ejercida sobre los científicos dentro de la agencia para minimizar o eliminar la evidencia que apunta a posibles efectos adversos de varios productos químicos. Algunos de estos efectos adversos incluyen trastornos neurológicos, defectos de nacimiento y cáncer.

Según The Intercept:

En varias ocasiones, la información sobre los peligros se eliminó de las evaluaciones de la agencia sin informar o solicitar el consentimiento de los científicos que los escribieron. Algunos de estos casos llevaron a la EPA a retener información crítica del público sobre exposiciones químicas potencialmente peligrosas».

Algunos de estos productos químicos pueden alterar el sistema endocrino. El sistema endocrino es lo que regula todos los procesos biológicos del cuerpo. Esto incluye el desarrollo del cerebro y el sistema nervioso, el funcionamiento del sistema reproductivo, los niveles de azúcar en la sangre y mucho más.

El sistema endocrino se basa en mantener un fino equilibrio de diferentes hormonas, algunas de las cuales solo están presentes en pequeñas cantidades. «La dosis hace el veneno» sigue siendo el dogma aceptado con respecto a la seguridad o toxicidad de la mayoría de los productos químicos.

Sin embargo, décadas de investigación sobre los efectos de los productos químicos disruptores endocrinos (EDC) han demostrado que esta teoría es incorrecta. De hecho, los EDC pueden tener efectos a dosis bajas que no se predicen a dosis más altas.

Aún más alarmante es el hecho de que, durante muchos años, no han existido pruebas para evaluar los productos químicos en busca de posibles efectos de alteración endocrina. Como resultado, ninguno de los muchos miles de productos químicos en uso hoy en día ha sido examinado para tales efectos. Según un artículo de 2003 del Dr. Theo Colborn,

La lista está creciendo de disruptores endocrinos conocidos que tienen una amplia gama de mecanismos de acción que pueden interferir con el desarrollo del cerebro».

Durante casi tres décadas, la Dra. Theo Colborn se dedicó a estudiar los efectos nocivos de los productos químicos disruptores endocrinos en la vida biológica y el medio ambiente.

En 2003, el Dr. Colborn fundó The Endocrine Disruption Exchange (TEDX), una organización sin fines de lucro que, durante 16 años, buscó «reducir la producción y el uso de productos químicos que interfieren con la función hormonal saludable».

Su investigación fue impulsada, en parte, por la explosión relativamente reciente de muchas enfermedades relacionadas con el sistema endocrino, incluidos los trastornos autoinmunes, el autismo, el asma, la diabetes, la enfermedad de la tiroides, el TDAH y algunas formas de cáncer. Actualizada por última vez en septiembre de 2018, la lista TEDX de disruptores endocrinos conocidos incluye unos 1.482 productos químicos.

Aunque aparentemente es un pequeño porcentaje de todos los productos químicos en uso, esta lista solo incluye aquellos productos químicos que han mostrado signos de alteración endocrina en la investigación científica.

Como se indicó anteriormente, la gran mayoría de los productos químicos no han sido probados para tales propiedades. Por lo tanto, podemos estar razonablemente seguros de que el número real de sustancias químicas disruptoras endocrinas en nuestro entorno es mucho mayor.

Gran parte de los hallazgos del Dr. Colborn se repiten en la investigación de Joseph Thornton, un investigador del Instituto de la Tierra de la Universidad de Columbia que se especializa en los efectos devastadores de la contaminación por organoclorados.

Los organoclorados son moléculas orgánicas que contienen al menos un átomo de cloro unido covalentemente. Un ejemplo de un organoclorado bien conocido es el DDT, un pesticida altamente tóxico utilizado ampliamente durante las décadas de 1940 y 1950.

En su libro, Pandora’s Poison[5], Thornton escribe que:

La producción de cloro gas a partir de la sal prepara el escenario para la producción intencional y accidental de una gran cantidad de nuevos productos químicos que interrumpen los sistemas naturales en su nivel más fundamental. La práctica de la química del cloro ha desatado una serie de consecuencias químicas y ecológicas no deseadas que nuestras tecnologías más sofisticadas no son capaces de prevenir».

Muchos organoclorados resisten la degradación natural y pueden acumularse en el medio ambiente. Algunos, como la dioxina, no se descomponen en absoluto y permanecerán en el medio ambiente casi indefinidamente.

Esto es increíblemente preocupante teniendo en cuenta que los organoclorados se liberan en el medio ambiente en inmensas cantidades (¡la industria del cloro produce alrededor de 40 millones de toneladas de gas cloro cada año!).

Como explica Thornton, muchos organoclorados son más solubles en grasa que en agua. Esto lleva a que se acumulen en los tejidos grasos de los organismos vivos, especialmente aquellos cerca de la parte superior de la cadena alimentaria (es decir, los humanos). Según Thornton,

Las especies altas en la cadena alimentaria, como los humanos, sirven como reservorios vivos donde estos contaminantes se acumulan en concentraciones cada vez más altas».

Debido a su larga vida útil, los organoclorados viajan sobre las corrientes de viento, formando un manto global de contaminación atmosférica con graves consecuencias para la salud y el bienestar humanos.

El libro de Thornton describe cómo la producción de productos químicos tóxicos se ha convertido en uno de los «problemas ambientales más insidiosos de nuestro tiempo», contribuyendo a la infertilidad, la supresión inmune, el cáncer y los trastornos del desarrollo.

Como se mencionó anteriormente, los disruptores endocrinos pueden afectar el desarrollo fetal del sistema reproductivo, lo que a veces puede conducir al hermafroditismo. De hecho, la investigación ha encontrado que un número creciente de niños nacen con «variación intersexual» (es decir, genitales ambiguos).

En su libro, Revolve: Man’s Scientific Rise to Godhood[6], Aaron Franz plantea la inquietante posibilidad de que la contaminación ambiental generalizada con EDC pueda ser un acto deliberado, uno dirigido a promover el objetivo transhumanista de crear un hombre andrógino.

Tanto la fuerza masculina como la femenina han sido blanco de destrucción. No solo se han confundido nuestros roles de género, sino que también hemos sido bombardeados químicamente. Se nos ha librado una guerra química para destruir nuestro género biológico».

Como explica Franz en su libro, los transhumanistas se toman muy en serio la necesidad de trascender el género, un concepto al que los investigadores se refieren como «posgénero». Los transhumanistas ven el género como algo que nos limita y buscan ir más allá utilizando medios tecnológicos.

Otro contaminante ambiental que puede afectar el sistema endocrino es la radiación electromagnética.

RADIACIÓN ELECTROMAGNÉTICA

En respuesta al despliegue planificado de la cobertura 5G en la UE y los Estados Unidos en 2018, Martin Pall (profesor emérito de Bioquímica y Ciencias Médicas Básicas en la Universidad Estatal de Washington), compiló un informe detallado, que describe ocho efectos fisiopatológicos probables que se observarían como resultado de una mayor exposición a la radiación electromagnética.

Estos efectos incluyen efectos neurológicos, alteración endocrina, estrés oxidativo, mutaciones en el ADN, reducción de la fertilidad y cáncer. El profesor Pall resumió sus pensamientos sobre el despliegue de 5G llamándolo «la idea más estúpida que alguien haya tenido en la historia del mundo».

La preocupación por el 5G se debió en parte al hecho de que la nueva tecnología no se sometió a una sola prueba de seguridad. Las preocupaciones en torno al aumento de la exposición a la radiación electromagnética están bien fundadas, teniendo en cuenta la amplia evidencia que tenemos para sugerir que dicha exposición causa daño biológico.

De hecho, el profesor Pall estima que hay más de 14.000 estudios científicos revisados por pares que muestran efectos adversos de los CEM a niveles por debajo de las directrices de seguridad[7].

Los estudios ya han demostrado que la radiación del teléfono móvil por sí sola puede reducir el recuento de espermatozoides y la motilidad en los hombres. Un metaanálisis de 2017 encontró una disminución alarmante en el recuento de espermatozoides entre los hombres en naciones tecnológicamente avanzadas.

Los investigadores escriben que «se necesita urgentemente investigación sobre las causas de esta disminución continua». Sin embargo, si la causa emana de una tecnología promovida por una de las industrias más ricas y poderosas del mundo, es poco probable que se realicen más investigaciones.

Los estudios han demostrado que los CEM pueden causar estrés oxidativo. Se plantea la hipótesis de que esto a su vez puede conducir a la aparición de una variedad de trastornos neuropsiquiátricos, algunos de los cuales han visto una prevalencia creciente en nuestra sociedad moderna. Esto incluye insomnio, fatiga, dolores de cabeza, depresión, ansiedad, irritabilidad o, lo que es peor, autismo.

Otro efecto conocido de la exposición a los CEM es un mayor riesgo de cáncer. Un estudio de 25 millones de dólares realizado por el Programa Toxicológico Nacional (NTP) encontró un aumento en la incidencia de cáncer cerebral y cardíaco en animales expuestos a CEM por debajo de las pautas de «seguridad» de ICNIRP.

Eventualmente, incluso la Agencia Internacional para la Investigación del Cáncer (una rama de la Organización Mundial de la Salud) se vio obligada a clasificar los campos electromagnéticos de radiofrecuencia como «posiblemente cancerígenos para los humanos».

La investigación sugiere que los CEM también están contribuyendo a la disminución de las poblaciones de insectos y aves en todo el mundo. En su esclarecedor libro, The Invisible Rainbow[8], Arthur Firstenberg documenta el rápido declive de muchas especies de insectos y aves, incluido el humilde gorrión doméstico.

Un estudio realizado por el zoólogo Sainudeen Pattazhy en Kerala, India, durante 2008 y 2009 encontró que los gorriones domésticos estaban prácticamente extintos allí. La conclusión de Pattazhy es la misma que la de Balmori: las torres celulares están dejando a los gorriones sin lugar para vivir».

Luego cita a Pattazhy de la siguiente manera:

La penetración continua de la radiación electromagnética a través del cuerpo de las aves afecta su sistema nervioso y sus habilidades de navegación. Se vuelven incapaces de navegar y alimentarse. Se encuentra que las aves que anidan cerca de las torres abandonan el nido en una semana».

Las poblaciones de abejas también están disminuyendo en ciertas áreas del mundo. Si bien la razón de esto puede ser multifacética, la investigación sugiere que una de las causas puede ser la radiación electromagnética.

Un artículo de 2019 publicado en Science of The Total Environment encontró que la exposición crónica al campo electromagnético de radiofrecuencia (RF-EMF) redujo significativamente la eclosión de las reinas de las abejas melíferas. Otros estudios han encontrado cambios de comportamiento perturbadores en las abejas expuestas a los CEM.

A pesar de toda esta evidencia que apunta a un daño biológico, poco se ha hecho para reducir la exposición de las personas a la radiación dañina de RF. Esta crisis ambiental cada vez más grave podría haberse evitado si las autoridades hubieran puesto en marcha medidas de seguridad adecuadas.

Sin embargo, al igual que con big pharma y big agribusiness, Big Wireless es una industria multimillonaria que pone las ganancias y el control por encima de lo que es ética y moralmente correcto.

En un artículo de 2018, Paul Héroux PhD, profesor de toxicología electromagnética en la Universidad McGill, explica la corrupción que acecha dentro de los organismos reguladores que establecen y supervisan las pautas de seguridad para la radiación de RF.

… Conscientes del enorme potencial de este mercado [es decir, la industria inalámbrica], los ingenieros lograron que estas radiaciones se caracterizaran como inofensivas, a través de 50 años de esfuerzos sostenidos, infiltrándose y monopolizando los comités de estandarización».

Las llamadas «directrices de seguridad» son establecidas por la Comisión Internacional de Protección contra la Radiación No Ionizante (ICNIRP), una organización que afirma que su objetivo es «proteger a las personas y al medio ambiente contra los efectos adversos de la radiación no ionizante (NIR)».

Sin embargo, en un informe titulado The International Commission on Non-Ionizing Radiation Protection: Conflicts of interest, corporate capture and the push for 5G por Klaus Buchner y Michèle Rivasi, llegan a una conclusión bastante diferente con respecto a la naturaleza de la ICNIRP.

IcNIRP se presenta, y es descrito por la Comisión Europea y en los medios de comunicación, como una comisión internacional independiente que da consejos basados en evidencia científica. Creemos que hay varias razones para cuestionar esta (auto)imagen».

Un hallazgo importante de Buchner y Rivasi es que la mayoría de los científicos de la ICNIRP han completado o están realizando investigaciones financiadas (al menos en parte) por la industria.

También encontraron que las nuevas pautas de seguridad de RF publicadas por la ICNIRP en 2020 fueron el resultado de la cooperación con el IEEE (Instituto de Ingenieros Eléctricos y Electrónicos) y el ICES (Comité Internacional de Seguridad Electromagnética), dos organizaciones que trabajan en estrecha colaboración con grandes compañías de telecomunicaciones.

En 2014, la OMS lanzó un borrador de una monografía sobre los campos de RF y la salud para comentarios públicos. Sin embargo, 5 de los 6 miembros del Grupo Básico a cargo del proyecto estaban afiliados a la ICNIRP, un conflicto de intereses flagrante.

Un artículo de 2017 describe una reunión posterior en la OMS donde los funcionarios mostraron poco interés en colaborar con científicos que fueron invitados a presentar evidencia sobre los efectos adversos para la salud de los CEM.

El artículo concluye de la siguiente manera:

En vista de los enormes intereses económicos incorporados en las directrices de la ICNIRP, y los vínculos de varios de sus miembros expertos con la industria, sin duda se trata de un gran conflicto de intereses que socavará seriamente no sólo la credibilidad de la Monografía sobre la radiación de RF, sino también la credibilidad de la OMS como protectora de la salud mundial».

La creciente densidad de la radiación electromagnética en el suelo se compara con el inminente bombardeo desde el espacio. En su boletín de enero de 2022, Arthur Firstenberg contabiliza el número de satélites de órbita baja operativos, aprobados y propuestos, llegando a la sorprendente cifra de 441.449 satélites.

En este total se incluyen más de 40.000 satélites SpaceX (casi 12.000 de los cuales ya han sido aprobados), planeados para formar parte de la red «Starlink» de Elon Musk, proporcionando acceso 5G en todo el mundo. Firstenberg escribe que,

Mientras que la atención de un mundo aterrorizado se ha centrado en un virus, y mientras que la preocupación por la radiación se ha centrado en 5G en el suelo, el asalto a los cielos ha alcanzado proporciones astronómicas».

Han surgido informes que afirman que la FCC, al otorgar permiso a Musk para lanzar tantos satélites, violó la Ley de Política Ambiental Nacional (NEPA), al no evaluar el impacto ambiental del despliegue de tantos satélites en órbita terrestre baja.

Según Firstenberg, el impacto ambiental será catastrófico. Es bien sabido que las emisiones de los lanzamientos de cohetes dañan la capa de ozono, pero lo que más preocupa a Firstenberg es el efecto sobre la ionosfera.

A lo que todo el mundo está completamente ciego es al efecto de toda la radiación de los satélites en la ionosfera y, en consecuencia, en la fuerza vital de cada ser vivo. El circuito que es generado por la ionosfera y que fluye perpetuamente entre el cielo Yang (positivo) y la tierra Yin (negativa). El circuito que nos conecta con la tierra y el cielo y que fluye a través de nuestros meridianos dándonos vida y salud. Un circuito que no debe contaminarse con frecuencias emitidas por cien mil satélites, algunos de cuyos haces tendrán una potencia efectiva de hasta diez millones de vatios. Eso es pura locura, y hasta ahora nadie está prestando atención».

LA CRISIS CLIMÁTICA: NO ES LO QUE PIENSAS

Si bien se pone mucho énfasis en la necesidad de reducir las emisiones de gases de efecto invernadero, y miles de millones de dólares se canalizan a fondos climáticos turbios, parece que ninguno de los «élites» globales tiene interés en combatir las crisis mencionadas anteriormente.

Debemos preguntarnos: ¿qué se está haciendo para reponer el contenido de nutrientes de nuestros alimentos? ¿Qué medidas están tomando las agencias de protección ambiental para prohibir los productos químicos tóxicos y eliminar los organoclorados de la atmósfera? ¿Qué se está haciendo para reducir nuestra exposición a la radiación electromagnética dañina y establecer métodos de comunicación más seguros?

No se equivoquen, las verdaderas crisis ambientales no se mencionan en la Cumbre del G20, no se informa de ellas en los principales medios de comunicación y no nos las resolverán los gobiernos, los banqueros, los filántropos o los tecnócratas.

Puedes leer la primera parte aquí y la segunda parte aquí.

***

Ryan Matters es un escritor y libre pensador de Sudáfrica. Después de un período de enfermedad que cambió su vida, comenzó a cuestionar la medicina convencional, la ciencia y el verdadero significado de lo que es estar vivo. Algunos de sus escritos se pueden encontrar en newbraveworld.org, también puedes seguirlo en Twitter y Gab.

REFERENCIAS:-

[1] Roger J. Williams y Dwight K. Kalita. Manual del médico sobre medicina ortomolecular. 1977.[volver]

[2] Carolyn Dean, M.D, N.D. El milagro del magnesio. 2003.[volver]

[3] Food Standards Agency (2002) McCance y Widdowson’s The Composition of Foods, Sexta edición resumida. Cambridge: Real Sociedad de Química. (véase el prólogo de la 5ª edición). [volver]

[4] Dawn Lester, David Parker. Lo que realmente te enferma: por qué todo lo que pensabas que te daba noticias sobre la enfermedad está mal. 2019.[volver]

[5] Joseph Thornton. El veneno de Pandora: cloro, salud y una nueva estrategia ambiental. 2001.[volver]

[6] Aaron Franz. Revolve: El ascenso científico del hombre a la divinidad. 2012.[volver]

[7] Entrevista con Martin L. Pall, PhD, «How Wireless Causes Harm». Cumbre 5G. 2019.[volver]

[8] Arthur Firstenberg. El arco iris invisible, una historia de electricidad y vida. 2017.[volver]

Fuente: https://off-guardian.org/2022/02/16/the-unseen-environmental-crises-destroying-humanity/

El Dr. Luc Montagnier y las próximas revoluciones en biofísica óptica

IN MEMORIAM

Por Matthew Ehret-Kump

El 8 de febrero de 2022, el virólogo ganador del Premio Nobel, el Dr. Luc Montagnier, falleció.

Desde los primeros momentos de la aparición de COVID-19, Montagnier fue calumniado y ridiculizado por sus desafíos a las suposiciones subyacentes de las causas y remedios de la enfermedad a pesar de las constantes hondas y flechas del estado profundo que buscaba cerrar la puerta a toda discusión tan peligrosa.

Más importante que las afirmaciones de Montagnier sobre los orígenes de laboratorio de una enfermedad (que parece tener más que ver con causas bacteriológicas que virales), se encuentran en un dominio pasado por alto de la biofísica óptica que el buen científico revolucionó por completo durante los últimos 15 años de su fructífera vida.

Es este aspecto menos comprendido, pero infinitamente más importante, de la contribución de Montagnier al conocimiento humano el que ha caído bajo el radar de demasiados analistas y ciudadanos, por el que creo que querría ser recordado.

¿Qué es la biofísica óptica y qué descubrió Montagnier?

La biofísica óptica es el estudio de las propiedades electromagnéticas de la física de la vida. Esto significa prestar atención a las emisiones de luz y las frecuencias de absorción de las células, el ADN y las moléculas de materia orgánica, cómo estas interactúan con el agua (que constituyen más del 75% de un cuerpo humano) y moderadas por la matriz anidada de campos magnéticos ubicados en el nivel cuántico y que se extienden hasta el nivel galáctico.

Para no descartar la naturaleza bioquímica de la vida que es hegemónica en el ámbito de las ciencias de la salud, el biofísico óptico pregunta: ¿cuál de estos es PRIMARIO en el crecimiento, la replicación y la división del trabajo de células individuales o especies enteras de organismos? ¿Son los atributos químicos de la materia viva o las propiedades electromagnéticas?

Permítanme explicar un poco más la paradoja.

Hay aproximadamente 40 billones de células altamente diferenciadas en el cuerpo humano promedio, cada una de las cuales realiza funciones muy específicas y requiere un inmenso campo de coherencia e intercomunicación. Cada segundo mueren aproximadamente 10 millones de esas células, para ser reemplazadas por 10 millones de nuevas células que nacen. Muchas de esas células están formadas por bacterias, y gran parte del ADN y el ARN dentro de esas células está formado por virus (en su mayoría inactivos), pero que pueden activarse / desactivarse mediante una variedad de métodos tanto químicos como electromagnéticos.

Aquí está la gran pregunta:

¿CÓMO podría este complejo sistema ser mantenido solo por procesos químicos, ya sea en el transcurso de un día, mes o toda una vida útil?

La simple física del movimiento de las enzimas que transportan información en el cuerpo de un lugar a otro simplemente no se acerca a tener en cuenta la coordinación de la información requerida entre todas las partes. Aquí es donde entra en juego la investigación de Montagnier.

Después de ganar el Premio Nobel de 2008, el Dr. Montagnier publicó un artículo revolucionario pero herético de 2010 llamado «Ondas de ADN y agua» que tomó por asalto a la comunidad médica. En este artículo, Montagnier demostró cómo la radiación electromagnética de baja frecuencia dentro de la parte de ondas de radio del espectro se emitía desde el ADN bacteriano y viral y cómo dicha luz era capaz de organizar el agua y transmitir información. Los resultados de sus experimentos se mostraron maravillosamente en este video de 8 minutos:

Usando un dispositivo de fotoamplificación inventado por el Dr. Jacques Benveniste en la década de 1980 para capturar las emisiones de luz ultra bajas de las células, Montagnier filtró todas las partículas de ADN bacteriano de un tubo de agua y descubrió que las soluciones post-filtradas que no contenían partículas materiales continuaban emitiendo ondas de frecuencia ultra baja. Esto se volvió más fascinante cuando Montagnier demostró que bajo condiciones específicas de un campo de fondo de 7 Hz (lo mismo que la resonancia de Schumann que ocurre naturalmente entre la superficie de la tierra y la ionosfera), el tubo de agua no emisor que nunca había recibido material orgánico podría ser inducido a emitir frecuencias cuando se coloca muy cerca del tubo emisor. Aún más interesante es que cuando las proteínas base, los nucleótidos y los polímeros (bloques de construcción del ADN) se pusieron en el agua pura, ¡se formaron clones casi perfectos del ADN original!

El Dr. Montagnier y su equipo plantearon la hipótesis de que la única forma de que esto sucediera era si el modelo del ADN se imprimía de alguna manera en la estructura misma del agua, lo que resultaba en una forma de «memoria del agua» que había sido iniciada anteriormente por el inmunólogo Jacques Benveniste (1935-2004), cuyos resultados se muestran en este increíble documental de 2014 «Memoria del agua».

Así como Benveniste sufrió una de las cacerías de brujas más feas de los tiempos modernos (dirigida en gran medida por la revista Nature en 1988), el premio Nobel de Montagnier no lo protegió de un destino similar al que una campaña internacional de calumnias lo ha seguido en los últimos 10 años de su vida. Cerca de 40 premios Nobel han firmado una petición denunciando a Montagnier por su herejía y el gran científico se vio obligado incluso a huir de Europa para escapar de lo que describió como una cultura de «terror intelectual». En respuesta a esta calumnia, Montagnier declaró a la revista LaCroix:

«Estoy acostumbrado a los ataques de estos académicos que son solo burócratas jubilados, cerrados a toda innovación. Tengo las pruebas científicas de lo que digo».

Al describir los mayores desafíos para avanzar en esta investigación, Montagnier declaró:

«Hemos optado por trabajar con el sector privado porque no podrían provenir fondos de instituciones públicas. El caso Benveniste ha hecho que cualquiera que se interese por la memoria del agua sea considerado… Quiero decir que huele a azufre. Es el infierno».

La larga ola de descubrimientos (y el choque de dos ciencias)

La lucha de Montagnier es simplemente una sombra de un choque mucho más grande dentro de la propia ciencia occidental. Si bien muchas personas piensan de manera simplista que hay una rama singular de la ciencia desde Galileo hasta Descartes y Newton hasta el presente, la realidad tras una inspección más cercana nos muestra que en realidad hay dos paradigmas opuestos, uno de los cuales ha sido oscurecido sistemáticamente por la caza de brujas por motivos políticos desde incluso antes de los días del Club X de Huxley y la fundación de la revista Nature en 1869.

Dado que esta lucha a menudo se pasa por alto, se deben decir algunas palabras aquí y ahora.

En oposición a la tradición materialista que ha intentado imponer «causas materiales» a los fenómenos naturales, la escuela más potente de biofísica óptica encarnada por Montagnier fue puesta en marcha nada menos que por Louis Pasteur. Mucho antes de que surgiera la controversia Beschamp-Pasteur, y mucho antes de realizar trabajos sobre pasteurización, el trabajo científico temprano de Pasteur fue moldeado por descubrimientos sobre las propiedades ópticas de la materia viva y los fenómenos de la vida. En resumen, durante su temprano período creativamente potente, Pasteur descubrió que las soluciones que tenían material orgánico disuelto dentro de ellas tenían la increíble propiedad de girar la luz polarizada hacia la «izquierda», mientras que las soluciones líquidas desprovistas de material orgánico no tenían esa capacidad.

En una carta de 1870, Pasteur describió su visión cosmológica de la propiedad disimétrica de la vida a un amigo Jules Raulin diciendo:

«Ustedes saben que yo creo que hay una influencia disimétrica cósmica que preside constante y naturalmente sobre la organización molecular de principios inmediatamente esenciales para la vida; y que, como consecuencia de ello, las especies de los tres reinos, por su estructura, por su forma, por la disposición de sus tejidos, tienen una relación definida con los movimientos del universo. Para muchas de esas especies, si no para todas, el Sol es el primum movens de la nutrición; pero creo en otra influencia que afectaría a toda la organización [geometría], pues sería la causa de la disimetría molecular propia de los componentes químicos de la vida. Quiero por experimento captar algunas indicaciones sobre la naturaleza de esta gran influencia disimétrica cósmica. Debe, puede ser electricidad, magnetismo …»

Esta propiedad «zurda» a la vida todavía confunde a los astrobiólogos más de un siglo después.

Con la misteriosa muerte en 1906 de Pierre Curie, que había avanzado en la investigación de Pasteur, y cuando la Primera Guerra Mundial descarriló este curso de investigación (muchas de las mentes jóvenes más brillantes de Europa fueron enviadas a una picadora de carne de cuatro años de guerra de trincheras), la batuta fue abandonada en Europa, solo para ser retomada por dos científicos ruso-ucranianos que trabajaron juntos estrechamente en la Universidad de Crimea: Vladimir Vernadsky (padre de la ciencia atómica rusa y fundador de la escuela de biogeoquímica 1863-1945) y su amigo Alexander Gurwitsch (1874-1954).

Vernadsky revive la visión de Pasteur

Vernadsky utilizó ampliamente el trabajo de Pasteur en su propia construcción de la biosfera y siempre señaló que las propiedades electromagnéticas de la vida eran la fuerza impulsora de la bioquímica. Yendo más lejos que nadie vivo para definir los mecanismos de la biosfera, Vernadsky explicó que el verdadero científico no debe comenzar con organismos individuales y «trabajar de abajo hacia arriba» como muchos darwinianos radicales eran propensos a hacer, sino más bien comenzar, como Louis Pasteur lo había hecho de antemano, con la galaxia y una conciencia de la fuerza impulsora de las radiaciones electromagnéticas / cósmicas que dan forma al flujo dirigido de la evolución biosférica.

En su libro de 1926 la Biosfera, Vernadsky comenzó su descripción de la biosfera con las siguientes observaciones:

«La biosfera puede ser considerada como una región de transformadores que convierten las radiaciones cósmicas en energía activa en formas eléctricas, químicas, mecánicas, térmicas y de otro tipo. Las radiaciones de todas las estrellas entran en la biosfera, pero captamos y percibimos sólo una parte insignificante del total. No se puede dudar de la existencia de radiación originada en las regiones más distantes del cosmos. Las estrellas y las nebulosas emiten constantemente radiaciones específicas, y todo sugiere que la radiación penetrante descubierta en las regiones superiores de la atmósfera por Hess se origina más allá de los límites del sistema solar, tal vez en la Vía Láctea, en nebulosas o en estrellas».

Radiación mitogénica de Alexander Gurwitsch

Vernadsky utilizó ampliamente el trabajo de Pasteur en su propia construcción de la biosfera y siempre señaló que las propiedades electromagnéticas de la vida eran la fuerza impulsora de la bioquímica. Mientras Vernadsky pasaba su vida centrándose en los macroestados de la biosfera y cómo interactuaba con la litosfera y la noosfera (los dominios anidados de la no vida, la vida y la razón creativa) organizados dentro de matrices anidadas de campos magnéticos que moderaban el flujo de radiación cósmica a través del universo, su colega Gurwitsch se centró en la intersección de la luz y los campos magnéticos dentro de los microestados de las células vivas.

Al describir su descubrimiento en un estudio de 2011 sobre la biorradiación cósmica, el investigador Cody Jones describió la visión básica de Gurwitsch:

«Gurwitsch desarrolló tres niveles anidados de estructuras de campo, dispuestas de acuerdo con la complejidad y la extensión espacial, que van desde lo molecular (constelaciones moleculares), a lo celular (relaciones entre células), a los niveles organísmicos (los diferentes órganos y sistemas que constituyen un solo organismo). Cada campo anidado podría describirse en términos de diferentes mecanismos en cuanto a cómo avanzaba la morfología para cualquier estructura en particular, sin embargo, todos estaban unificados hacia la realización de un estado futuro definido de existencia».

Gurwitsch revolucionó por primera vez las ciencias de la vida al dar forma a un elegante experimento que demostró que las células emiten ráfagas débiles de luz ultravioleta a medida que pasan por la mitosis. Para probar su teoría, Gurwitsch estableció dos raíces de cebolla que crecían en direcciones perpendiculares y descubrió que las tasas más altas de emisiones de luz que ocurrían en la punta más nueva de las raíces indujeron un crecimiento celular del 30-40% cuando se acercaban a una raíz de cebolla más vieja. Aunque no existieron instrumentos lo suficientemente sensibles como para captar estas frecuencias ultra débiles durante su vida, Gurwitsch demostró que la luz del espectro ultravioleta debe generarse a partir de nuevas células separando las raíces de cebolla viejas y nuevas por varios tipos de lentes que bloqueaban diferentes partes del espectro y descubrió que solo cuando la luz UV estaba bloqueada el efecto del aumento del crecimiento celular del 30% llegaba a su fin. Gurwitsch llamó a esto «Radiación mitogénica».

Alexander Gurwitsch y su experimento original de raíz de cebolla. Dos cebollas (Z1 y Z2) crecen perpendicularmente con el punto W que representa el punto de intersección de la raíz más joven emitida por Z1 y la raíz más vieja de Z2 separadas por una lente de cuarzo que bloquea las emisiones de emisiones ultravioletas de Z1 a Z2.

Si bien Gurwitsch fue condenado al ostracismo por el establecimiento científico durante su vida, surgieron tecnologías entre la comunidad astrofísica en la década de 1950 que permitieron a los científicos medir frecuencias de luz extremadamente débiles en el rango de la radiación mitogénica de Gurwitsch (obviamente útil para captar señales débiles de otras galaxias en el espacio profundo). Cuando equipos de astrónomos italianos aplicaron sus equipos a material orgánico, el descubrimiento de Gurwitsch se verificó experimentalmente por primera vez.

Uno hubiera pensado que tal descubrimiento habría revolucionado toda la biología, la medicina y las ciencias de la vida en el acto, sin embargo, después de un breve aumento en el interés, el descubrimiento pronto fue olvidado y relegado a una característica secundaria «insignificante» de la vida que no tenía ningún papel causal que desempeñar en ninguna de las mecánicas o el comportamiento de la actividad orgánica. Los materialistas y reduccionistas que deseaban mantener que toda la vida era simplemente la suma de partes ganaron el día.

Luego, otro biofísico llamado Fritz-Albert Popp apareció en escena.

Los descubrimientos biofotónicos de Fritz Popp

Durante la década de 1970, Popp era un investigador del cáncer que trataba de averiguar por qué solo uno de los dos isómeros de Benzpyrene causaba cáncer. Un isómero a veces se conoce como una configuración de imagen especular de una molécula que es químicamente idéntica, pero cuyas propiedades pueden diferir enormemente. Bajo la lógica materialista/reduccionista, no había ninguna razón por la cual un isómero (Benzpireno 3,4) que se encuentra en los cigarrillos y el alquitrán induciría el crecimiento del cáncer en el tejido pulmonar, mientras que otro isómero (Benzpireno 1,2) sería completamente benigno.

Después de descubrir el trabajo de Gurwitsch, el Dr. Popp comenzó a medir las emisiones de luz ultra débiles de las moléculas de benceno y sus efectos sobre el crecimiento celular en los tejidos hepáticos y descubrió que las propiedades extremadamente altas de absorción / emisión de luz de Benzpyrene 3,4 eran la causa de la falta de armonía de la regulación celular. Medir la actividad de los fotones del crecimiento de células hepáticas cancerosas frente a las sanas es una forma sorprendente de ver claramente que el crecimiento canceroso coincide con las emisiones exponenciales de fotones, mientras que las emisiones de fotones hepáticos sanos son muy estables.

En el transcurso de su vida altamente productiva, el Dr. Popp descubrió que estas emisiones de luz ocurrían en diferentes longitudes de onda de acuerdo con los tipos de células, la función y la especie. Cuando Popp acercó dos muestras biológicas, las cosas se volvieron adicionalmente interesantes ya que el «ritmo» de sus emisiones de fotones se sincronizaba maravillosamente cuando estaban cerca y no estaban sincronizadas cuando se separaban. Esto fue esbozado en su artículo Sobre la coherencia de los biofotones.

Al describir la aplicación clínica de estos descubrimientos, el Dr. Popp declaró:

«La luz puede iniciar, o detener, reacciones similares a cascadas en las células, y ese daño celular genético puede ser virtualmente reparado, en cuestión de horas, por débiles haces de luz. Todavía estamos en el umbral de comprender completamente la compleja relación entre la luz y la vida, pero ahora podemos decir, enfáticamente, que la función de todo nuestro metabolismo depende de la luz».

Los descubrimientos de Popp amplifican los del gran científico ruso A.B. Burlakov, quien descubrió que las emisiones de luz ultra débiles que emanan de dos juegos de huevos de pescado fertilizados separados por un vaso demostraron un poderoso efecto armonizador. Si un conjunto de huevos fuera más viejo, entonces los huevos más jóvenes madurarían y se desarrollarían mucho más rápido si se acercaran. Sin embargo, si la diferencia de edad entre los dos conjuntos fuera demasiado grande, entonces el científico descubrió que el conjunto más joven vería una mayor tasa de muerte, deformidades y retraso del desarrollo.

Este modo de pensar sobre la vida hace que la mente del científico se acerque a la vida de una manera más común con un músico que sintoniza su instrumento con una orquesta o un director que sostiene múltiples ondas de sonido en su mente simultáneamente como una idea musical completa que es mayor que simplemente la suma de sus partes. Es un modo de pensar mucho más natural y efectivo que el enfoque materialista / reduccionista hoy dominante en la mayoría de las universidades occidentales que trata al organismo como una máquina y al todo como una suma de partes químicas.

Un barrido más completo de estos descubrimientos se presentó en una conferencia de 2020 presentada por este autor, que se puede ver en su totalidad aquí:

Lanzando la investigación de Montagnier bajo una nueva luz

Volviendo una vez más a Luc Montagnier con un renovado aprecio por la ola más larga de tradición científica que él forma parte de amplificar, podemos apreciar algunas de las conclusiones que ha extraído de las propiedades a menudo ignoradas pero completamente verificables de las ondas de luz, el agua estructurada, las bacterias y el ADN que pueden hacernos redefinir nuestra comprensión de la «vida». «enfermedad» y «medicina» para siempre. Este ejercicio posiblemente nos hará apreciar la importancia de un programa internacional de choque en la investigación de biofísica óptica y la terapia de ondas de luz / interferencia para tratar enfermedades que afectan a la humanidad, incluida COVID-19.

En una entrevista de 2011, el Dr. Montagnier recapituló las consecuencias de sus descubrimientos:

«La existencia de una señal armónica que emana del ADN puede ayudar a resolver preguntas de larga data sobre el desarrollo celular, por ejemplo, cómo el embrión es capaz de hacer sus múltiples transformaciones, como si estuviera guiado por un campo externo. Si el ADN puede comunicar su información esencial al agua por radiofrecuencia, entonces existirán estructuras no materiales dentro del ambiente acuoso del organismo vivo, algunas de ellas ocultando señales de enfermedad y otras involucradas en el desarrollo saludable del organismo».

Con estas ideas en mente, Montagnier ha descubierto que muchas de las frecuencias de emisiones EM de una amplia variedad de ADN microbiano también se encuentran en los plasmas sanguíneos de pacientes que sufren de influenza A, hepatitis C e incluso muchas enfermedades neurológicas que no se consideran comúnmente influenciadas por bacterias, como el Parkinson, la esclerosis múltiple, la artritis reumatoide y el Alzheimer. ¡En los últimos años, los equipos de Montagnier incluso encontraron ciertas señales en los plasmas sanguíneos de personas con autismo y varias variedades de cánceres!

Más de una docena de médicos franceses han tomado las ideas de Montagnier lo suficientemente en serio como para recetar antibióticos para tratar el autismo en el transcurso de seis años y, en oposición a las teorías convencionales, han descubierto que entre 240 pacientes tratados, ¡4 de cada 5 vieron sus síntomas retroceder dramáticamente o desaparecer por completo!

Estos resultados implican una vez más que ciertas especies difíciles de detectar de microbios emisores de luz están más cerca de la causa de estos males de lo que la industria farmacéutica moderna quisiera admitir.

Un nuevo dominio de pensamiento: por qué las grandes farmacéuticas deberían tener miedo

Como demostró el experimento filmado de 2014, Montagnier fue aún más lejos para demostrar que las frecuencias de las emisiones de onda dentro de un filtrado ubicado en un laboratorio francés se pueden registrar y enviar por correo electrónico a otro laboratorio en Italia, donde esa misma grabación armónica se infundió en tubos de agua no emisora, ¡lo que hace que los tubos italianos comiencen a emitir señales lentamente! ¡Estas frecuencias de ADN pudieron estructurar los tubos de agua italianos de la fuente principal a mil millas de distancia, lo que resultó en una réplica exacta del ADN del 98%!

De pie como estamos, en la cúspide de tantos avances emocionantes en la ciencia médica, deberíamos preguntarnos: ¿qué podrían significar estos resultados para el complejo industrial farmacéutico multimillonario que se basa en mantener al mundo encerrado en una práctica de medicamentos químicos y vacunas?

Hablando de este punto, Montagnier declaró:

«El día que admitamos que las señales pueden tener efectos tangibles, las usaremos. A partir de ese momento podremos tratar a los pacientes con ondas. Por lo tanto, es un nuevo dominio de la medicina que la gente teme, por supuesto. Especialmente la industria farmacéutica… algún día podremos tratar los cánceres usando ondas de frecuencia».

El amigo y colaborador de Montagnier, Marc Henry, profesor de Química y Mecánica Cuántica en la Universidad de Estrasburgo, declaró:

«Si tratamos con frecuencias y no con medicamentos, se vuelve extremadamente rentable en cuanto a la cantidad de dinero gastado. Gastamos mucho dinero para encontrar las frecuencias, pero una vez que se han encontrado, no cuesta nada tratarlas».

Ya sea que se produzca en un laboratorio como afirma Montagnier o que haya aparecido naturalmente como afirma nature Magazine, Bill Gates y el Dr. Fauci, el hecho es que la actual pandemia de coronavirus ha acelerado un colapso del sistema financiero mundial y ha obligado a los líderes del mundo a discutir la realidad de un nuevo paradigma necesario y un nuevo orden económico mundial. Queda por ver si ese nuevo sistema será impulsado por los cárteles farmacéuticos y los financieros que dirigen la política de salud global o si será impulsado por los estados nacionales que dan forma a los términos de ese nuevo sistema en torno a las necesidades humanas.

Si los estados nacionales logran permanecer en el asiento del conductor de este nuevo sistema, entonces tendrá que ser impulsado por ciertos principios fundamentales de la atención médica para todos, la reforma de la práctica científica y una reforma política / económica más amplia en la que el carácter sagrado de la vida humana se coloca por encima de todas las consideraciones de ganancia monetaria. En este sentido, tales programas de choque en proyectos a largo plazo en ciencia espacial, defensa de asteroides y desarrollo lunar / marte serán tan necesarios en el dominio astrofísico como los programas de choque en energía de fusión serán en el dominio atómico. Uniendo ambos mundos, es el dominio de las ciencias de la vida que cruza las propiedades electromagnéticas de los átomos, las células y el ADN con las propiedades electromagnéticas a gran escala de la Tierra, el Sol y la galaxia en su conjunto.

Fuente: https://www.globalresearch.ca/

https://www.globalresearch.ca/memorial-dr-luc-montagnier-coming-revolutions-optical-biophysics/5770096

Ahora la gente está muriendo por la vacuna

Por PAUL CRAIG ROBERTS

OneAmerica es una gran compañía de seguros de vida en Indianápolis. El director ejecutivo, Scott Davison, acaba de anunciar que, a juzgar por las afirmaciones políticas, los estadounidenses en edad de trabajar están muriendo repentinamente en números sin precedentes. Informa que todas las compañías de seguros de vida están experimentando un aumento del 40% en la tasa de mortalidad. «Solo para darle una idea de lo malo que es eso, una catástrofe de tres sigma o una de uno en 200 años sería un aumento del 10% con respecto a la pandemia. Así que el 40% es simplemente inaudito». Estas no son muertes por Covid. Son muertes por afecciones causadas por la vacuna.

Brian Tabor, presidente de la Asociación de Hospitales de Indiana, informa un enorme aumento correspondiente en el número de casos hospitalarios, no por Covid sino por todo tipo de cosas, cosas que se sabe que son riesgos de la vacuna.

Es decir, el extraordinario aumento de muertes y hospitalizaciones se asocia a las vacunas contra el Covid.

Durante el último año y tal vez más tiempo he informado de los hallazgos y predicciones de los mejores científicos médicos que no están en las nóminas de Big Pharma o Fauci. Los hallazgos de estos científicos han sido suprimidos por Fauci y los presstitutes. En pocas palabras, la vacuna socava el sistema inmunológico humano y lo convierte en un arma contra su propio cuerpo. El resultado son ataques cardíacos y la gama de efectos adversos ahora asociados con la vacuna. Un exasperado y enojado Dr. Sucharit Bhakdi explica el proceso aquí:

https://www.globalresearch.ca/video-dr-sucharit-bhakdi-these-vaccines-are-killing-the-young-and-the-old-they-are-killing-our-children/5765866

Varios expertos han concluido que un gran porcentaje de los vacunados van a experimentar discapacidad y muerte. Como explica el Dr. Bhakdi, no le sucede a todos de inmediato. Algunos experimentan muerte o discapacidad inmediatamente, algunos un mes después, algunos un año después y algunos durante más tiempo.

Según tengo entendido, la tasa de mortalidad y discapacidad de las personas vacunadas contra el Covid aumentará con el tiempo. Si el proceso es rápido, una consecuencia podría ser el colapso social. Si el proceso es lento, entonces las poblaciones más vacunadas experimentarían una disminución numérica.

Claramente, la campaña de vacunación fue un gran error, o una operación intencional de control de la población. Pero ahora que se sabe que hay más peligro en la vacuna que en el virus, toda vacunación debe detenerse.

La censura de expertos médicos de renombre debe detenerse para que podamos escapar de la propaganda de marketing y llegar a una comprensión de la verdadera situación.

El Covid no fue mortal, excepto para las personas no tratadas con comorbilidades. La variante actual, Omicron, parece ser más leve que el resfriado común, y como la vacuna no protege contra ninguno de los dos, su uso es completamente irresponsable. La humanidad pagará el costo de las vacunas de ARNm en las próximas décadas.

Fuente: https://www.unz.com/proberts/now-people-are-dying-from-the-vaccine/

El exceso de mortalidad en España que desconcierta a los expertos ¿Si no es culpa del coronavirus, qué es?

España registra un desconcertante exceso de mortalidad que cuadruplica los fallecimientos por covid

Inyección letal: Doctores dan escalofriantes relatos de enfermedades inusuales inducidas por las vacunas Covid. (Por favor, ¡despierten!)

MIKE WHITNEY / https://www.unz.com/

«Los estadounidenses están muertos de miedo… La gente está saliendo del trabajo, no porque quieran perder sus trabajos, ¡pero no quieren morir por la vacuna! … Dicen: ‘Escucha, no quiero morir. Esa es la razón por la que no estoy tomando la vacuna». Así de claro». Dr. Peter McCullough

Un informe en el U.K. Telegraph explica cómo la vacuna Covid-19 ha llevado a un fuerte aumento en el exceso de muertes. Aquí hay un extracto del artículo:

«Casi 10.000 personas más de lo habitual han muerto en los últimos cuatro meses por razones no Covid, ya que los expertos pidieron una investigación urgente del gobierno sobre si las muertes eran prevenibles…

Las últimas cifras de la Oficina de Estadísticas Nacionales mostraron que Inglaterra y Gales registraron 20.823 muertes más que el promedio de cinco años en las últimas 18 semanas. Solo 11.531 muertes involucraron Covid». («La alarma crece a medida que las morgues se llenan con miles de muertes adicionales no Covid», UK Telegraph)

La mortalidad está aumentando porque más personas están muriendo. Y más personas están muriendo porque más personas han sido vacunadas. Existe un vínculo entre el aumento de la mortalidad y la vacuna contra el Covid-19. Naturalmente, los medios de comunicación quieren trasladar la responsabilidad de las muertes a «tratamientos retrasados» y «la falta de atención prevenible». Pero esto es solo una distracción. La causa principal de muerte es la inyección de un patógeno tóxico en el torrente sanguíneo de aproximadamente el 70% de la población. Eso es lo que está causando la coagulación, el sangrado, las embolias pulmonares, los ataques cardíacos, los accidentes cerebrovasculares y las muertes prematuras. Es la vacuna. Aquí hay más

«Las cifras semanales para la semana que terminó el 5 de noviembre mostraron que hubo 1.659 muertes más de lo que normalmente se esperaría en esta época del año. De ellos, 700 no fueron causados por Covid.

Es probable que el exceso crezca a medida que se registren más muertes en las próximas semanas.

Los datos de la Agencia de Seguridad Sanitaria del Reino Unido muestran que ha habido miles de muertes más que el promedio de cinco años en insuficiencia cardíaca, enfermedades cardíacas, afecciones circulatorias y diabetes desde el verano.

El número de muertes en hogares particulares también está un 40,9 por ciento por encima del promedio de cinco años, con 964 muertes en exceso registradas en la semana más reciente, que se extiende hasta el 5 de noviembre. («La alarma crece a medida que las morgues se llenan con miles de muertes adicionales no Covid», UK Telegraph)

El repentino aumento de la mortalidad no es un error sin sentido en el radar. Es una señal de alerta que indica una ruptura significativa en la tendencia de cinco años. Algo ha ido terriblemente mal. Se suponía que la vacunación masiva reduciría el número de casos, hospitalizaciones y muertes. En cambio, las muertes continúan aumentando.

¿Por qué?

La respuesta a esa pregunta se puede encontrar en los propios datos. Como admite el autor, ha habido un fuerte aumento en la insuficiencia cardíaca, las enfermedades cardíacas, las afecciones circulatorias y los accidentes cerebrovasculares. (La diabetes es el valor atípico) Estas son precisamente las dolencias que uno esperaría ver si uno acabara de inyectar a millones de personas con un biológico generador de coágulos que desencadena una respuesta inmune violenta que ataca el revestimiento interno de los vasos sanguíneos infligiendo un daño severo a la infraestructura crítica del cuerpo. Entonces, sí, la mortalidad por todas las causas ha aumentado, y es seguro que subirá aún más a medida que más personas se vacunen y sucumban gradualmente a los efectos (frecuentemente) tardíos de un brebaje híbrido que es la piedra angular de un plan maligno para reducir drásticamente la población mundial. Echa un vistazo a esta tabla seguida de un breve comentario de la patóloga de diagnóstico, la Dra. Claire Craig:

Dra. Clare Craig @ClareCraigPath

«Desde el verano ha habido el doble de muertes por covid, pero siete veces más muertes en exceso que el año pasado».

Y aquí hay otro anuncio de Craig:

«Si comienzas en la semana 22 y sumas todas las muertes desde entonces para cada año, entonces algo muy anormal está sucediendo este año entre los hombres de 15 a 19 años».

Por lo tanto, no solo están muriendo más personas, sino que la demografía se ha desplazado hacia abajo a medida que las personas cada vez más jóvenes se ven atraídas al vórtice de la vacuna. En pocas palabras, el número de jóvenes que mueren por un paro cardíaco infligido por la vacuna y miocarditis continúa aumentando sin un final a la vista.

No es sorprendente que la mortalidad por todas las causas sea mayor entre los vacunados que entre los no vacunados, lo que, una vez más, hace que sea más fácil rastrear el problema hasta su raíz, una «vacuna contra la muerte por veneno» citotóxica que suprime el sistema inmunológico innato, daña los órganos vitales y afeita años de la vida de las personas normales y sanas.

Tal vez, haya visto uno de los muchos videos cortos de atletas jóvenes en forma que de repente han caído muertos en el campo de juego o han sido llevados al hospital poco después de recibir la inyección. Si no, aquí hay un enlace a dos de ellos. (Los atletas colapsan después de la vacunación: Ver aquí y aquí)

Según Las noticias israelíes en tiempo real, ha habido un «aumento del 500% en las muertes de jugadores en 2021 … ¡Desde diciembre, 183 atletas y entrenadores profesionales se han derrumbado repentinamente! ¡108 de ellos murieron!»

«Aumento del 500% en las muertes» de atletas?!? ¿Qué vamos a hacer con esto?

Para empezar; la vacuna contra el Covid-19 no es un medicamento. Es el componente esencial en el plan elitista para el exterminio a escala industrial. Está diseñado para infligir lesiones físicas graves a las personas que lo toman. Es impactante que las personas estén tan profundamente en negación que no pueden ver lo que está sucediendo justo ante sus ojos. (Por favor, miren los videoclips de los atletas. Estas son las personas más acondicionadas del planeta y, sin embargo, están siendo golpeadas por la sustancia misteriosa de la vacuna). Así es como el médico sudafricano Shankara Chetty lo resumió en un video reciente publicado en Bitchute:

«El patógeno que está causando todas las muertes por la enfermedad es la proteína espiga. Y la proteína espiga es lo que se supone que la vacuna debe hacer en su cuerpo. … La proteína espiga es uno de los venenos más artificiales que el hombre ha hecho. Y, el objetivo de esta toxina, es matar a miles de millones de personas sin que nadie se dé cuenta. Así que es un veneno con una agenda». («El médico sudafricano Dr. Shankara Chetty habla sobre «El plan más grande», Bitchute)

Ahí está en pocas palabras. Y Chetty no es el único que vincula la vacuna a la agenda de las élites globalistas que planean usar la cobertura de una pandemia para implementar su esquema de «gestión de la población». El ex vicepresidente de Pfizer, Mike Yeadon, ofreció una opinión similar hace unos días en su sitio web. Él dijo:

«Estamos en medio del programa de despoblación más grande que el mundo haya visto, donde la mayoría de la humanidad está actuando como idiotas útiles para él y para su propia desaparición».

De hecho, y hemos tratado de proporcionar la mayor cantidad de información posible sobre el agente biológico que se está utilizando para perseguir esta agenda maligna, la proteína espiga. En los primeros informes, transmitimos la investigación del Dr. Patrick Whelan, quien comprendió el peligro de la proteína espiga antes que nadie. Aquí hay un breve resumen de su análisis de una carta que presentó a la FDA el 8 de diciembre de 2020:

«Me preocupa la posibilidad de que las nuevas vacunas destinadas a crear inmunidad contra la proteína espiga del SARS-CoV-2 tengan el potencial de causar lesiones microvasculares en el cerebro, el corazón, el hígado y los riñones de una manera que actualmente no parece evaluarse en los ensayos de seguridad de estos medicamentos potenciales.

… Meinhardt et al…. muestran que la proteína espiga en las células endoteliales cerebrales se asocia con la formación de microtrombos (coágulos)… En otras palabras, las proteínas virales parecen causar daño tisular sin replicar activamente el virus. La vacuna de Pfizer/BioNTech (BNT162b2) está compuesta por un ARNm que produce una proteína espiga de longitud completa anclada a la membrana. Los estudios en ratones sugieren que una forma no autenticada de la proteína S1 como esta puede causar una microvasculopatía en los tejidos que expresan mucho receptor ACE2.

… parece que la proteína espiga viral … es también uno de los agentes clave que causan el daño a órganos distantes que pueden incluir el cerebro, el corazón, los pulmones y los riñones. Antes de que cualquiera de estas vacunas sea aprobada para su uso generalizado en humanos, es importante evaluar en sujetos vacunados los efectos de la vacunación en el corazón. Tan importante como es detener rápidamente la propagación del virus inmunizando a la población, sería mucho peor si cientos de millones de personas sufrieran daños duraderos o incluso permanentes en su microvasculatura cerebral o cardíaca como resultado de no apreciar a corto plazo un efecto no deseado de las vacunas basadas en proteínas de espiga de longitud completa en estos otros órganos. («La FDA se encoge de hombros ante la terrible advertencia sobre la proteína espiga letal», Truth in the Age of Covid)

Desde el principio, los reguladores gubernamentales y sus aliados en el establecimiento de la salud pública han ignorado (o censurado) las advertencias de médicos e investigadores capaces. También despidieron al inmunólogo y vacunólogo de carrera, el Dr. Byram Bridle, quien fue el primero en su profesión en identificar la proteína espiga como «un agente causal específico de la enfermedad»; «un patógeno». Aquí está Bridle:

«‘Hemos sabido durante mucho tiempo que la proteína espiga es patógena … Es una toxina. Puede causar daño en nuestro cuerpo si está en circulación. Ahora, tenemos evidencia clara de que… la vacuna en sí, más la proteína, entra en circulación sanguínea».

Una vez que eso sucede, la proteína espiga puede combinarse con receptores en las plaquetas sanguíneas y con células que recubren nuestros vasos sanguíneos. Es por eso que, paradójicamente, puede causar tanto coagulación de la sangre como sangrado. «Y, por supuesto, el corazón está involucrado, como parte del sistema cardiovascular … Es por eso que estamos viendo problemas cardíacos. La proteína también puede cruzar la barrera hematoencefálica y causar daño neurológico.

«En resumen,… cometimos un gran error. No nos dimos cuenta hasta ahora. No nos dimos cuenta de que al vacunar a las personas las estamos inoculando inadvertidamente con una toxina». … («Científico de vacunas: ‘Hemos cometido un gran error'», Mujer conservadora)

Una vez más, tenemos a un inmunólogo de gran consideración, con más de 3 décadas de experiencia en su haber, que ofreció su investigación informada y basada en la evidencia sobre un tema que debería haber sido de gran interés para los reguladores que estaban tomando decisiones sobre la seguridad a largo plazo del medicamento experimental que estaban imponiendo a millones de personas en todo el país. Pero no había interés en absoluto. A pesar del hecho de que la ciencia apoyó sus conclusiones, Bridle fue brutalmente atacado, censurado, arrastrado por el barro y obligado a abandonar su lugar de trabajo.

¿Por qué?

Porque sacó las mismas conclusiones que el Dr. Patrick Whelan. Realmente no hay una diferencia sustantiva entre los dos, excepto que los comentarios de Bridle atrajeron más atención en los medios de comunicación, lo que lo convirtió en una mayor amenaza para la estrategia de «vacunación universal». Ese fue su verdadero crimen; descubrió la verdad y puso sus hallazgos a disposición del público, básicamente alertándolos sobre los peligros del «disparo de muerte por veneno». Por eso fue aplastado.

Desde entonces, Bridle ha hecho otras afirmaciones que deberían preocupar a cualquier persona cuyo cáncer pueda estar en remisión. Esto es lo que dijo en una entrevista reciente:

«Lo que he visto demasiado es gente que tenía cánceres que estaban en remisión, o que estaban siendo bien controlados; sus cánceres se han salido completamente de control después de recibir esta vacuna. Y sabemos que la vacuna causa una caída en el número de células T, y esas células T son parte de nuestro sistema inmunológico y son parte de las armas críticas que nuestro sistema inmunológico tiene para combatir las células cancerosas; así que hay un mecanismo potencial allí. Todo lo que puedo decir es que he tenido demasiadas personas que me contactan con estos informes para que me sienta cómodo. Diría que esa es mi mayor preocupación de seguridad más reciente, y también es la que va a ser la más poco informada en la base de datos adversa, porque si alguien ha tenido cáncer antes de la vacuna, no hay forma de que los funcionarios de salud pública lo vinculen con la vacuna». («Dr Byram Bridle habla», Bitchute, :55 segunda marca)

Entonces, ¿la vacuna suprime el sistema inmunológico?

Sí, lo hace, y el autor Alex Berenson proporcionó evidencia de esto recientemente en un artículo que publicó en Substack. Aquí hay un extracto:

«… el gobierno británico… admitió hoy, en su informe más reciente de vigilancia de vacunas, que:

«Los niveles de anticuerpos N parecen ser más bajos en las personas que adquieren la infección después de dos dosis de vacunación». (Página 23)

¿Qué significa esto?…

Lo que los británicos están diciendo es que ahora están descubriendo que la vacuna interfiere con la capacidad innata de su cuerpo después de la infección para producir anticuerpos no solo contra la proteína espiga sino contra otras piezas del virus.

Esto significa que las personas vacunadas serán mucho más vulnerables a las mutaciones en la proteína espiga INCLUSO DESPUÉS DE HABER SIDO INFECTADAS Y RECUPERADAS UNA VEZ

… probablemente sea aún más evidencia de que las vacunas pueden interferir con el desarrollo de una inmunidad robusta a largo plazo después de la infección». («URGENTE: Las vacunas Covid le impedirán adquirir inmunidad completa INCLUSO SI ESTÁ INFECTADO Y SE RECUPERA», Alex Berenson, Substack)

Las observaciones de Berenson cuadran con la investigación que fue compilada a principios de año por científicos de los Países Bajos y Alemania que:

«…advirtió que el … La vacuna (COVID-19) induce una reprogramación compleja de las respuestas inmunes innatas que deben considerarse en el desarrollo y uso de vacunas basadas en ARNm… el equipo de investigación del Centro Médico de la Universidad de Radboud y Erasmus MC en los Países Bajos… mostró que la vacuna alteró la producción de citoquinas inflamatorias por parte de las células inmunes innatas después de la estimulación con estímulos específicos (SARS-CoV-2) e inespecíficos.

Después de la vacunación, las células inmunes innatas tuvieron una respuesta reducida al receptor tipo toll 4 (TLR4), TLR7 y TLR8, todos ligandos que desempeñan un papel importante en la respuesta inmune a la infección viral. un área inexplorada es si la vacunación BNT162b2 tiene efectos a largo plazo sobre las respuestas inmunes innatas 

Esto podría ser muy relevante en COVID-19, en el que la inflamación desregulada juega un papel importante en la patogénesis y la gravedad de la enfermedad», escribe el equipo. «Múltiples estudios han demostrado que las respuestas inmunes innatas a largo plazo pueden aumentar (inmunidad entrenada) o regularse a la baja (tolerancia inmune innata) después de ciertas vacunas o infecciones». (La investigación sugiere que la vacuna Pfizer-BioNTech COVID-19 reprograma las respuestas inmunes innatas, nueva red médica)

El hallazgo de Berenson también se alinea con la investigación de vanguardia que muestra que la proteína espiga «impide en gran medida la inmunidad adaptativa» al evitar que el ADN repare las células dañadas. El documento sugiere que la proteína espiga de hecho «impacta en el núcleo de la célula, donde almacenamos nuestro ADN, nuestro material genético central». Aquí hay más del desglose de Berenson del documento:

«…. nuestras células tienen mecanismos para reparar su propio ADN.

Pero, al menos en los experimentos que estos dos científicos realizaron, la proteína espiga parecía interferir con nuestras propias proteínas de reparación del ADN: «Mecánicamente, descubrimos que la proteína espiga se localiza en el núcleo e inhibe la reparación del daño del ADN al impedir el reclutamiento clave de la proteína de reparación del ADN BRCA1 y 53BP1 en el sitio del daño».

Para ser claros, los científicos NO probaron que la proteína espiga estuviera causando estos problemas en personas, o incluso animales … Sin embargo, en un momento en que los países avanzados que tienen altas tasas de vacunación de ARNm (y ADN / AAV) están viendo hospitales inusualmente llenos y tasas de mortalidad más altas de lo normal, son aún más motivo de preocupación. Como explicaron los

autores: «Nuestros hallazgos revelan un mecanismo molecular potencial por el cual la proteína espiga podría impedir la inmunidad adaptativa y subrayar los posibles efectos secundarios de las vacunas basadas en espigas de longitud completa». («URGENTE: Artículo preocupante sobre el impacto de la proteína espiga en el ADN y la reparación del ADN», Alex Berenson, Substack)

En pocas palabras: si la vacuna de hecho inhibe la respuesta inmune innata del cuerpo, entonces las personas se enferman mucho más por las infecciones estacionales que se propagan rutinariamente a través de la población. Su camino hacia la recuperación también será mucho más difícil.

Pero más bien que se trata del ángulo de inmunidad, pasemos a la investigación del Dr. Charles Hoffe, quien fue el primer médico en proporcionar pruebas sólidas de que las vacunas generan coágulos sanguíneos al desencadenar una respuesta inmune en la que el cuerpo ataca la capa delgada de células que recubren las paredes de los vasos sanguíneos. Hoffe encontró que el 62% de sus pacientes que habían sido vacunados dieron positivo para coágulos de sangre en una prueba de dímero D. Naturalmente, estaba alarmado por lo que encontró, particularmente porque la vacuna «estaba causando eventos neurológicos graves, e incluso la muerte. Cuando planteó sus preocupaciones al Colegio de Médicos de Columbia Británica, inmediatamente implementaron una orden de mordaza y lo reprendieron en un intento de intimidarlo y silenciarlo».

Hoffe ha sido entrevistado varias veces y siempre proporciona un relato detallado y fascinante de sus hallazgos. En una entrevista reciente, predijo que algunos vacunados que sufren de problemas relacionados con coágulos probablemente morirían en solo tres años. Esto es lo que dijo:

«… una vez que bloquea un número significativo de vasos sanguíneos a los pulmones, el corazón debe bombear a una resistencia mucho mayor para que la sangre pase a través de los pulmones. Eso causa una afección llamada hipertensión de la arteria pulmonar, que es la presión arterial alta en los pulmones porque muchos de los vasos sanguíneos de los pulmones están bloqueados. Y lo aterrador de esto es que las personas con hipertensión arterial pulmonar generalmente mueren de insuficiencia cardíaca del lado derecho en tres años … Y no solo el panorama a largo plazo es muy sombrío, sino que con cada disparo sucesivo, el daño agregará y agregará y agregará. Va a ser acumulativo porque cada vez se dañan más los capilares». («Shock: El médico advierte que la mayoría de los pacientes vacunados podrían tener daño cardíaco permanente, algunos pueden morir dentro de tres años «Daño cardíaco permanente, algunos pueden morir dentro de tres años», infowars; Minuto 6:10)

Una vez más, no hay discrepancia entre el análisis de Whelan, Bridle y Hoffe. Y aunque el foco de su atención puede variar ligeramente, sus conclusiones son las mismas. Estas inyecciones experimentales plantean graves riesgos para cualquier persona que se permita ser inoculada.

Ahora vea cuán similar es el análisis de Hoffe a la Dra. Rochagne Kilian, quien era médica de la sala de emergencias en el hospital GBHS hasta que renunció en protesta. Este es un video particularmente importante, ya que describe los síntomas «extraños» y las condiciones extremadamente raras que ahora se presentan en las salas de emergencia en todas partes después de la vacunación masiva de millones de personas con la «vacuna contra la muerte por veneno». (Transcribí el video yo mismo, por lo que podría haber errores).

Dr. Rochagné Kilian – Hace sonar el silbato sobre las vacunas Covid-19 y los niveles de dímero dímero D

«Lo que estaba viendo en mi departamento de urgencias, especialmente en los últimos 8 a 9 meses, está relacionado con los niveles de dímero dímero. Utilizamos D-Dimers específicamente relacionados con embolias pulmonares, así como trombosis venosa profunda. D-Dimer detecta cualquier trombosis (coágulos) en el cuerpo, pero no le da un diagnóstico, le da una base para ir más allá y hacer una ecografía y una tomografía computarizada para confirmar o negar la presencia de una embolia pulmonar o trombosis venosa profunda.

La primera parte de 2020 fue probablemente la más lenta en el departamento de emergencias, pero cuando entramos en 2021 y comenzó el despliegue de la vacunación, terminamos viendo un aumento en el accidente cerebrovascular, los ataques isquémicos transitorios y las presentaciones similares a los accidentes cerebrovasculares. (Hubo) definitivamente un número significativamente mayor de esas personas que entraron. Terminé haciendo pruebas de dímero D en estas personas y nunca antes en mi experiencia clínica había visto dímeros D y la cantidad de personas con dímeros D positivos superiores a 2,000, superiores a 3,000 y superiores a 5,000. Mi experiencia clínica me dijo que era necesario ir a buscar un coágulo grande en sus piernas o en sus pulmones. Y terminé haciendo una tomografía computarizada a estas personas. La mayoría de ellos, y diré que casi todos, tenían escáneres negativos que comenzaron a hacerme pensar que si no había un coágulo significativo en sus pulmones, pero mi dímero D era mucho más alto de lo que solía ver, podría no estar concentrado en un coágulo. Pero que se trata de múltiples micro-trombos extendidos por todo el cuerpo, y eso es tan fácil de pasar por alto porque la tomografía computarizada no lo va a recoger.

«Estas personas que ingresaron a la ER eran todas personas desde aproximadamente una semana hasta cuatro meses después de recibir sus 2ª inyecciones. Hay ciertos factores que pueden influir en una prueba de dímero D que puede darle una sensación de un nivel más alto de lo que se esperaría en el cuerpo. Dicho esto, los pacientes en los que estaba haciendo pruebas de Dímero D no tenían un nivel de tal vez una lectura positiva de 500 o 400. Eran más de 3500, más de 5000 ng/ml. Por lo tanto, esos son significativamente positivos sin ninguna prueba de tener una embolia pulmonar. Si estaba viendo altos niveles de dímero D sin un diagnóstico definido, necesitaba hacer más preguntas.

Un estudio dijo que nunca ignore los niveles extremadamente elevados del dímero D. Son específicos para enfermedades graves, incluyendo trombosis venosa, sepsis y / o cáncer. Incluso si el dímero D fuertemente elevado es un hallazgo aparentemente solitario, se debe mantener la sospecha clínica de enfermedad subyacente grave.

Hubo dos afecciones que destacaron y la primera fue la coagulación intravascular diseminada también conocida como CID. El segundo es el síndrome antifosfolípido. Ambas condiciones están relacionadas con una anormalidad en el inicio o la retroalimentación de la vía de coagulación, así como la trombosis o el ciclo de trombosis donde se descomponen los coágulos. La CID es una situación grave a veces potencialmente mortal en la que las proteínas en la sangre involucradas en la coagulación de la sangre se vuelven hiperactivas. Es una cascada que es difícil de detener una vez que ha alcanzado un cierto nivel. Hay ciertas condiciones que desencadenan dic; sepsis significativa, virus subyacentes, traumatismos, cirugía mayor, embarazo y parto. Y menos común causa reacción tóxica a medicamentos, reacción a transfusiones de sangre y trasplantes de órganos. Así que hubo una conexión con los productos intravasculares y una posible CID.

La mayoría de los casos de CID se diagnostican rápida y repentinamente, que es la presentación aguda. Pero hay casos en los que se desarrolla gradualmente, ocurriendo durante un período de tiempo más largo. Esto se conoce como una forma crónica de DIC y yo iría tan lejos como para decir una forma subaguda de DIC que es muy fácil de pasar por alto. La coagulación y el sangrado simultáneos pueden ocurrir con la CID crónica. La parte sangrante viene en sangre en la orina, dolores de cabeza y otros síntomas asociados con hemorragias cerebrales, moretones, inflamación de rojo, pequeños puntos en las extremidades, sangrado en los sitios de las heridas y sangrado de la mucosa. lo que significa sangrado de las encías y la nariz. Definitivamente vi un aumento en las hemorragias nasales y el sangrado de los sitios de heridas anteriores. úlceras, así como erupciones cutáneas que no se podían explicar. Los síntomas y signos de coagulación de la sangre fueron síntomas como dolores en el pecho, ataques cardíacos, accidentes cerebrovasculares, AIOS y dolores de cabeza relacionados con el sangrado o no. Así como síntomas relacionados con la insuficiencia renal, debido a la coagulación de esos vasos sanguíneos más pequeños que van a los riñones. El síndrome antifosfolípido es un tipo de afección muy similar. Pero la base del síndrome antifosfolípido es un trastorno autoinmune que significa que el sistema inmunitario del cuerpo produce proteínas, conocidas como anticuerpos, que atacan por error a su propio cuerpo o tejidos. Eso le da a la piel el efecto en cascada del trastorno de la coagulación, pero está relacionado con un desencadenante autoinmune. Básicamente, se presentó exactamente de la misma manera; presión arterial alta que estaba viendo mucho; primer diagnóstico de presión arterial alta, ataques cardíacos, accidentes cerebrovasculares, AIOS, problemas de válvulas cardíacas, dolores de cabeza o migrañas repetidos, pérdida de la visión, problemas de equilibrio y movilidad, dificultad para concentrarse o pensar con claridad,

El oyente astuto comenzaría a formarse una imagen de lo que nos han dicho sobre Covid-19, y hay trabajos de investigación que conectan Covid 19 con una enfermedad vascular subyacente. Uno de ellos fue un estudio llamado «Covid 19; desentrañando la progresión clínica del arma biológica virtualmente perfecta de la naturaleza».

«El SARS-Cov-2, que se presenta como síndrome covid-19, no era una base respiratoria, sino una base vascular subyacente. que tuvo ciertas fases de incubación, fase pulmonar, fase proinflamatoria, (que una vez más entra en un proceso de inflamación citotóxica) luego pasa a una fase prototrombina. El Covid-19 es una enfermedad trombótica. implicaciones para la prevención, la terapia antitrombótica y el seguimiento…..

Este cuadro nos muestra ciertos factores de riesgo, anomalías homeostáticas, así como resultados clínicos. Indica un aumento de los niveles de dímero D. También menciona el tromboembolismo venoso, el infarto de miocardio y la coagulación intravascular diseminada que está relacionada con los mecanismos postulados de la coagulación, así como la partenogénesis de la trombosis en Covid-19 …

Comencé a hacer la pregunta, si somos capaces de detectar ciertas conexiones entre las anomalías vasculares y el Covid-19, y basamos nuestro tratamiento propuesto en la proteína espiga, que incluye las inyecciones de Pfizer y Moderna, ¿no deberíamos estar buscando efectos secundarios o complicaciones similares de esa misma inyección?

Si estamos exigiendo ciertos tratamientos, necesitamos hacer la debida diligencia para asegurarnos de cuáles son los efectos secundarios y las complicaciones, especialmente en un momento en que no ha habido estudios a largo plazo». Y eso es lo que me llevó a centrarme en los dímeros D». («Dr Rochagné Kilian – Blows the Whistle on Covid-19 Vaccines and D-Dimer Levels«, Bitchute)

La declaración de Kilian debe leerse una y otra vez. Es la descripción más detallada que tenemos de las misteriosas y profundamente siniestras maquinaciones de un arma biológica diseñada en laboratorio que, en efecto, vuelve los sistemas vascular e inmunológico contra la persona que fue vacunada. La coagulación intravascular diseminada y el síndrome antifosfolípido son nombres que son completamente desconocidos para el pueblo estadounidense, y sin embargo, estas condiciones extrañas ahora son responsables de un número creciente de pacientes que experimentan sangrado, coagulación, dolores de cabeza, erupciones cutáneas, moretones, presión arterial alta e inflamación. Y, en casos más extremos, dolores en el pecho, ataques cardíacos, accidentes cerebrovasculares, problemas de válvulas cardíacas y hemorragias cerebrales. Uno solo puede adivinar cómo los medios de comunicación tratarán de encubrir estas condiciones extraordinariamente raras y potencialmente mortales.

Cuando Kilian pregunta:

«Si somos capaces de detectar ciertas conexiones entre las anomalías vasculares y el Covid-19… ¿No deberíamos estar buscando efectos secundarios o complicaciones similares de esa misma inyección?»

¡Bingo! Si la proteína espiga producida por las vacunas inflige el mismo daño interno que el Covid-19, ¿no deberían los médicos esperar ver los mismos síntomas?

Sí, deberían. Y si los síntomas son los mismos, entonces hay una buena probabilidad de que las lesiones inducidas por la vacuna se diagnostiquen erróneamente como Covid-19.

Piensa en eso por un minuto. Ese sería el escenario perfecto para los gerentes de la pandemia y sus patrocinadores multimillonarios a quienes les encantaría ver la inminente montaña de carnicería atribuida al virus menguante en lugar de a su propia vacuna de muerte por veneno.

Y ese es el genio malvado de la estrategia globalista; para extraer las huellas dactilares de la pistola humeante antes de que los investigadores lleguen a la escena del crimen.

La cantidad de planificación que debe haber entrado en esta estafa, es simplemente impresionante.

Fuente: https://www.unz.com/runz/lethal-injection-frontline-e-r-doctor-gives-chilling-account-of-unusual-vaccine-induced-illness/

¿Qué sucede cuando las vacunas comienzan a ser contraproducentes?

Hay mucha gente por ahí que está preocupada por la aparición de alguna nueva variante del SARS-COV2 que evada las vacunas. Además, hay personas que sugieren que esto no es motivo de preocupación: simplemente encontraremos una nueva vacuna contra esta nueva variante. Pero tengo la impresión de que a todo el mundo parece que le falta algo.

«Si aparece una nueva variante que evade las vacunas, simplemente desplegaremos una nueva vacuna contra esa cepa» es una mala línea de razonamiento, porque no hay una sola forma particular de evadir nuestra respuesta de anticuerpos, hay numerosas. Lo que estamos presenciando es que cada nueva subesta de Delta está evolucionando a su manera única, para replicarse en nuestros cuerpos a pesar de la presencia de nuestros anticuerpos.

Si está esperando un momento en el que anuncien que «se ha detectado una nueva cepa en Manchester que es totalmente resistente a las vacunas y pronto reemplazará a todas las demás cepas», entonces eso probablemente no sucederá. Más bien, va a ser más de lo habitual. Con cada bit de información publicada, encontrará que cada vez más personas vacunadas sufren infecciones irruptivas y hospitalización.

De hecho, con la evidencia disponible para nosotros ahora, podemos decir que las vacunas no han logrado proteger al grupo demográfico exacto que se suponía que debían proteger: los ancianos. Los ancianos vacunados siguen teniendo menos probabilidades de morir per cápita que los ancianos no vacunados en el futuro previsible, simplemente porque menos del 10% de las personas mayores en Europa occidental que permanecen sin vacunar generalmente tienen una salud más pobre: son principalmente minorías étnicas y personas que viven en la pobreza o el aislamiento.

Podemos observar la mortalidad acumulada no COVID en ancianos británicos para ver qué está pasando:

Imagen

Si observa esto, notará que los ancianos vacunados mayores de 70 años tienen aproximadamente un 55% menos de probabilidades de morir que los ancianos no vacunados, por causas no COVID. Y aquí tienes la tabla más reciente de las tasas de mortalidad por COVID para las personas mayores:

Para el grupo de más de 80 años en particular, queda claro que el riesgo de muerte no COVID muestra un patrón idéntico al riesgo de muerte por COVID. Mientras ese siga siendo el caso, las autoridades nunca tendrán que admitir que las vacunas fallaron: aún podrán señalar algún gráfico que dice que los ancianos vacunados tienen un 50% más o menos de probabilidades de muerte en comparación con aquellos que no fueron vacunados.

Con las medidas de intimidación que se están tomando actualmente contra las personas no vacunadas, están eliminando a las últimas personas sanas del grupo demográfico no vacunado: si no puedes salir a un pub o un restaurante y no puedes mantener un trabajo sin ser vacunado, ¿qué tipo de personas se ven obligadas a vacunarse? Personas no vacunadas con una vida social activa y saludable, que trabajan en un trabajo regular.

El tipo de personas que no se verán obligadas a pasar por estas medidas para vacunarse son las personas que están desempleadas debido a enfermedades crónicas u otros factores y las personas mayores no vacunadas que viven en aislamiento social. En otras palabras: estas medidas eliminan a las personas sanas del grupo demográfico no vacunado. Esto asegura que los números continuarán mostrando que las vacunas lo «protegen», incluso cuando no lo hacen.

No debe esperar ver algún tipo de actualización del gobierno en la que eventualmente admitan que las personas no vacunadas ahora tienen un menor riesgo de morir por el virus que las personas vacunadas: las medidas que están tomando tienen el efecto de dejar solo un pequeño grupo de personas no vacunadas que naturalmente tienen un riesgo muy alto de morir por este virus debido a su mala salud.

¿Por qué harían eso? ¿Por qué ahora están obligando repentinamente a los jóvenes sanos a tomar estas vacunas? Bueno, aquí hay una posible explicación. Míralo de esta manera: Imagina que tus políticos realmente creyeran que la crisis terminaría después de vacunar a todos los ancianos. Comenzaron a vacunar a las personas inicialmente, detuvieron el programa de vacunación varias veces porque muchas personas murieron repentinamente después de recibir las vacunas, pero luego continuaron los programas de todos modos porque no tenían alternativa y pensaron que sacrificar algunas vidas para poner fin a la pandemia vale la pena el costo.

Pero luego queda claro que las vacunas no resuelven el problema, porque la inmunidad no dura. Peor aún, a partir de los datos de exceso de mortalidad queda claro que las personas están muriendo a causa de las vacunas. Eres un político. Cometiste un terrible error. Entonces, ¿qué haces a continuación? ¿Admite que cometió el peor error de salud pública de la historia, o comienza a tratar de descubrir cómo encubrir el problema? Todas estas medidas que obligan a los adultos sanos de bajo riesgo con una vida social activa y un empleo estable a tomar esta vacuna aseguran que las únicas personas no vacunadas que quedan sean las personas en la demografía de alto riesgo. Este es un efecto secundario casual realmente conveniente para su gobierno, o simplemente están tratando activamente de ocultar lo que realmente está sucediendo. Si quisieran confundir activamente los datos, no podrían estar haciendo un mejor trabajo del que están haciendo actualmente.

Sin embargo, cuando observa el exceso de mortalidad total en la población en un momento dado (el número que es muy difícil de manipular para ellos) en comparación con un año antes, notará que nada ha cambiado sustancialmente para mejor. Como ejemplo, aquí está el exceso de mortalidad en los Países Bajos:

Normalmente, un invierno mortal es seguido por un invierno suave, pero ahora vemos que está sucediendo exactamente lo mismo que el invierno pasado. Lo que te van a decir después de que termine la ola de invierno es: «seguro que se ve básicamente igual que el invierno pasado, ¡pero imagínate cuánto más mortal habría sido si no hubiéramos vacunado a todos»!

Lo que ha sucedido aquí en Europa es lo siguiente. Al principio fuimos testigos de la aparición de un nuevo virus. Casi ninguno de nosotros tenía inmunidad real contra él y el virus ya estaba prácticamente optimizado para infectar a seres humanos ingenuos. Para cuando entramos en invierno, muchas personas tenían cierto grado de inmunidad y comenzaron a surgir diferentes variantes como Alpha, todas las cuales cambiaron de diferentes maneras para sobrevivir a nuestras diversas respuestas inmunes a este virus.

Luego, eventualmente, comenzamos a implementar vacunas. Esto llevó a un aumento repentino masivo de la inmunidad. El virus comenzó a extinguirse. Casi todas las variantes desaparecieron, con la excepción de una, que tenía una ventaja única sobre todas las demás. Como han demostrado los científicos japoneses, Delta tenía la capacidad única de hacer uso de nuestra respuesta de anticuerpos a la región NTD. Si estás esperando una «mejora dependiente de anticuerpos», bueno, ya está aquí. Simplemente no se ve como esperabas que se viera.

Esta capacidad de hacer uso de nuestros anticuerpos contra la región NTD de la proteína Spike parece ser la razón principal por la que Delta logró reemplazar a todas las demás cepas. También parece ser la razón por la que es mucho más infeccioso. El despliegue de las vacunas representó un evento de selección masiva, que hizo que una variante creciera dominante a costa de todas las demás variantes.

La gente te dirá «bueno, las vacunas no son tan efectivas como habían prometido, debido a una nueva variante» como si estas dos fueran ocurrencias separadas. Esta es la mentira de la omisión: ¿Por qué esta nueva variante se convirtió repentinamente en dominante? La respuesta es: Debido a estas vacunas. La respuesta inmune de los seres humanos es lo que impone una presión selectiva sobre este virus. Cuanto más se parece nuestra respuesta inmune a la de otras personas, más forzamos la presión selectiva sobre este virus en una dirección particular. A través de las vacunas, que homogeneizan nuestra respuesta inmune contra una versión particular de la proteína espiga, creamos el tipo de condiciones en las que las versiones del virus que se parecen a Delta comienzan a prosperar a expensas de otras cepas del virus.

Y esa es la etapa a la que hemos llegado ahora. En todo el mundo occidental, diferentes cepas descendientes de Delta están en una carrera por acumular diferentes mutaciones que superen nuestra respuesta inmune humana contra la proteína espiga. Es poco probable que veas que una cepa en particular tenga una ventaja muy fuerte contra otras cepas ahora y elimine a las demás. La fruta de bajo costo ya ha sido cosechada por el virus en forma de Delta convirtiéndose en dominante. Ahora se trata de adquirir diferentes mutaciones, cada una con una leve ventaja.

Lo que va a parecer es que en toda Europa Occidental, gradualmente se va a ver que el porcentaje de personas vacunadas en los hospitales se acerca a la marca del 80-90%. Es muy poco probable que se mueva por encima del 90% de las hospitalizaciones, porque el 7% no vacunado más o menos de los ancianos tienen una salud mucho más pobre que los ancianos vacunados. Pero si no supiera nada mejor y se despertara de un coma y mirara las estadísticas de mortalidad, dudaría de que se hubiera implementado una vacuna.

Desafortunadamente, por varias razones, las vacunas permiten una situación que no habría existido si hubiéramos construido inmunidad natural. Hay una serie de razones para esperar que el virus crezca más mortal en los próximos meses, en comparación con la ola de invierno anterior:

-La inmunidad natural es muy diversa. El sistema inmunológico de una persona se centrará en la proteína Nucleocápside, el sistema inmunológico de otra persona se centrará en la proteína Spike o en una de las otras proteínas. La inmunidad natural también se desarrolla contra diferentes variantes, mientras que la inmunidad artificial se desarrolla contra una proteína espiga que es idéntica en todos los que reciben estas vacunas. Debido a que la inmunidad natural es diversa, los cambios sutiles en el virus no pueden causar el tipo de beneficio de aptitud física que puede causar en condiciones de inmunidad artificial generalizada contra una versión específica de la proteína Spike.

Como todo el mundo tiene una respuesta inmune muy similar, llegamos a una situación en la que el virus puede usar activamente nuestra respuesta inmune para su propio beneficio, a través de la mejora dependiente de anticuerpos. Tales mutaciones que permiten la mejora dependiente de anticuerpos generalmente solo tienen una ventaja de aptitud si casi todos tienen estos anticuerpos. Ya existe un grado de mejora dependiente de anticuerpos, porque casi todos los anticuerpos inducidos por las vacunas contra la región NTD son utilizados por las cepas Delta actualmente dominantes en su beneficio.

https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-0&features=eyJ0ZndfZXhwZXJpbWVudHNfY29va2llX2V4cGlyYXRpb24iOnsiYnVja2V0IjoxMjA5NjAwLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X2hvcml6b25fdHdlZXRfZW1iZWRfOTU1NSI6eyJidWNrZXQiOiJodGUiLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X3NwYWNlX2NhcmQiOnsiYnVja2V0Ijoib2ZmIiwidmVyc2lvbiI6bnVsbH19&frame=false&hideCard=false&hideThread=false&id=1456312682513063943&lang=en&origin=https%3A%2F%2Fwww.rintrah.nl%2Fwhat-happens-when-the-vaccines-start-to-backfire%2F&sessionId=7c48783e802c4b858d9d3a970a425420a8effeb5&theme=light&widgetsVersion=f001879%3A1634581029404&width=550px

La campaña de vacunación dificulta el desarrollo de la inmunidad completa, ya que la respuesta inmune normal a las proteínas más allá de la proteína Spike se previene debido al pecado antigénico original. Esto hace que las infecciones repetidas sean más probables. La evidencia de que esto ya sucede se puede ver en el hecho de que los británicos vacunados tienen tasas de casos más altas que los británicos no vacunados. También se puede ver en el hecho de que los niveles de ARN en las aguas residuales escocesas y holandesas ahora superan los niveles observados durante el pico de invierno.

Entonces, ¿cómo va a terminar este experimento? Los adultos sanos no vacunados se infectan con el virus con el tiempo y desarrollan una inmunidad duradera genuina. Después de un año más o menos, serás vulnerable a la reinfección, pero estas reinfecciones son más leves, como un resfriado común normal. La razón principal por la que este virus se comportó de manera diferente a otros virus corona en adultos es porque teníamos menos inmunidad a este virus.

Los adultos vacunados están al principio protegidos, pero la inmunidad es temporal, ya que se basa en una respuesta en la sangre, centrada únicamente en una versión antigua de la proteína espiga. Esto conduce gradualmente a la siguiente etapa de la pandemia, donde el virus no tiene a nadie más que infectar, excepto a las personas vacunadas con inmunidad menguante. Esto es inevitable, porque casi todas las personas no vacunadas desarrollarán inmunidad esterilizante eventualmente.

Una vez que haya muchas personas con inmunidad inducida por la vacuna menguante en comparación con las personas no vacunadas que aún son susceptibles a la infección, puede ocurrir una selección adicional para la mejora dependiente de anticuerpos y la evasión de anticuerpos. Las mutaciones que habrían tenido un efecto negativo en la condición física cuando todavía había muchos jóvenes no vacunados para infectar ahora comenzarán a tener una ventaja de transmisión en la población general y serán seleccionadas.

Este es el punto al que hemos llegado ahora: no quedan suficientes personas susceptibles no vacunadas en la población, para forzar una presión selectiva suficiente contra la propagación de nuevas mutaciones de ADE y evasión de anticuerpos. El virus ahora se está propagando de una persona vacunada a la siguiente persona vacunada de forma continua. Estas son las circunstancias bajo las cuales el virus cambia para evadir la respuesta inmune inducida por la vacuna. Tales nuevos cambios no ocurren cuando el virus se propaga de una persona no vacunada a una persona vacunada, ¡porque esos cambios no mejoran la replicación en la persona no vacunada!

Este proceso solo comienza realmente una vez que la mayoría de la población ha sido vacunada y un número significativo de personas móviles con muchos contactos han comenzado a desarrollar una inmunidad menguante. Este proceso lleva un tiempo, porque el virus tarda en pasar por este filtro selectivo: tarda unos días en pasar de una persona a otra. Este proceso conduce lentamente a una situación en la que comenzará a ver un aumento en las personas mayores vacunadas hospitalizadas debido a Covid.

He realizado el siguiente gráfico, para ilustrar cómo funciona el proceso:

Si entiendes esto, entonces entiendes que lo que te están diciendo es exactamente al revés: las personas no vacunadas no son un peligro para las personas vacunadas. Las personas vacunadas dependen de un gran reservorio de personas no vacunadas, para que las vacunas sigan siendo efectivas. Esta es, por ejemplo, la razón por la que la vacuna parecía altamente efectiva en los Estados del Sur de Estados Unidos este verano, pero parece altamente ineficaz en Escocia.

Para que las personas vacunadas permanezcan a salvo de este virus, serán necesarias campañas de migración masiva: las personas vacunadas tendrán que propagarse entre las personas no vacunadas. Mientras las personas vacunadas solo interactúen con otras personas vacunadas, la selección natural provocará la propagación de variantes de este virus que evadan su respuesta inmune. Cambiar su respuesta inmune a una respuesta inmune más efectiva es muy difícil y con cada refuerzo que reciban se volverá más difícil.

Una vez que queda claro que las vacunas están fallando, esto lleva a sus responsables políticos al siguiente gran dilema: aumentar o no impulsar.

-Si decides no impulsar, te enfrentas al mismo tipo de situación que vimos el invierno pasado o peor. Las vacunas no serán efectivas y los hospitales no podrán lidiar con la carga de los pacientes, porque los hospitales tienen poco personal y tratan de tratar a los pacientes cuyo tratamiento se retrasó.

-Si decides aumentar, simplemente pateas la lata por el pasillo hasta el próximo invierno. Cada vez que inyectas a alguien con la misma versión antigua de la proteína Spike, el sistema inmunológico aprende a acercarse más a esta versión de la proteína Spike, a expensas de su capacidad para ajustarse a cualquier variante novedosa que surja. Parece funcionar bien a corto plazo, como lo demuestra Israel, pero no es una solución sostenible, porque obstaculiza el sistema inmunológico en su capacidad de adaptarse a la inevitable evolución de este virus.

Además de esto, parece haber una ventana de dos semanas después de la inyección durante la cual tiene un mayor riesgo de infectarse, porque muchos de sus glóbulos blancos se mueven a la ubicación de la inyección en su brazo. Por lo tanto, una campaña de refuerzo masivo puede causar un aumento adicional en las infecciones.

Lo que ha sucedido es lo siguiente: un nuevo virus saltó a la población humana, contra la cual teníamos muy poca inmunidad preexistente. Es el tipo de virus contra el que nuestros cuerpos no desarrollan una respuesta inmune duradera, porque es el tipo de virus que puede usar tales anticuerpos para su propio beneficio cuando muta.

Normalmente los seres humanos desarrollarían una respuesta inmune muy diversa, en respuesta a las diversas variantes que circularán en la población a lo largo del tiempo. Debido a esta respuesta inmune diversa, sería imposible que las pequeñas mutaciones conduzcan a un aumento dramático en la evasión inmune.

Debido a las vacunas, la respuesta inmune de todos ahora se ve muy similar. Esto tiene el efecto de permitir que las mutaciones simples causen efectos dramáticos. Nunca antes habíamos tenido una situación como esta en la historia. Es a través del desarrollo gradual de diversa inmunidad que los virus normalmente se vuelven endémicos. Ahora interferimos con este proceso y estamos a punto de descubrir las consecuencias.

Si vives en una nación de Europa Occidental, ahora puedes esperar aproximadamente la siguiente línea de eventos para proceder:

Las infecciones y hospitalizaciones aumentarán a medida que el clima empeore y la protección inducida por la vacuna disminuya.

Los políticos enfatizarán inicialmente que la mayoría de los pacientes no están vacunados. Eventualmente, esta narrativa progresa a «todavía es más probable que termine hospitalizado si no está vacunado», ya que los pacientes completamente vacunados se convierten en la mayoría. Entonces probablemente redoblan la presión y deciden apresurar los refuerzos, mientras insisten en que la vacuna aún lo protege adecuadamente.

Los medios de comunicación y los políticos insistirán en que todo esto se debe a las personas que permanecen sin vacunar, incluso cuando la evidencia comienza a demostrar que las vacunas no hacen una diferencia sustancial, siempre y cuando se ajusten a los factores de confusión demográfica (lo que generalmente se niegan a hacer, prefieren mostrarle los números brutos). Se implementarán nuevas medidas dirigidas a los no vacunados, pero estas medidas no tendrán un impacto significativo en la ola invernal. En todo caso, aislar a los no vacunados de los vacunados facilita que las mutaciones resistentes a las vacunas se vuelvan dominantes.

Países como los Países Bajos, donde los políticos fueron lo suficientemente tontos como para creer genuinamente que estas vacunas serían el final de este lío, estarán en grandes problemas. Eventualmente, se ven obligados a abandonar su negación e implementar un nuevo confinamiento que afecta a las personas vacunadas y no vacunadas por igual. Los confinamientos se utilizan para ganar tiempo, para desplegar nuevos refuerzos para los ancianos e impulsar la vacunación de los niños. Sin embargo, la vacunación de los niños es la forma más efectiva posible de crear variantes de evasión inmune, porque los niños no vacunados son un baluarte de la selección natural contra las mutaciones que evaden la vacuna. Cuantos más niños vacunamos, más aceleramos la catástrofe que está a punto de suceder.

Después de un invierno horrible con un exceso de mortalidad que excede el invierno anterior, las hospitalizaciones finalmente disminuyen nuevamente. Pero el problema no ha desaparecido.

-Los diferentes descendientes circulantes de Delta continúan divergiendo entre sí. Otras variantes como Beta también pueden aparecer en Europa. Esto ahora prohíbe el despliegue de una nueva vacuna efectiva contra Delta, porque estas cepas están evolucionando en direcciones exactamente opuestas a la versión de Wuhan. El virus ahora desarrollará tal variación que ya no es posible implementar una vacuna efectiva.

-Mientras que la diversidad genética del virus habrá aumentado, la diversidad de nuestra respuesta inmune contra el virus habrá disminuido. La mayoría de los adultos se habrán inyectado tres o incluso cuatro veces, con una versión de Wuhan de la proteína espiga. Con cada vez que se le inyectan estas vacunas, su sistema inmunológico se ve obligado a centrar más de su respuesta en esta versión de Wuhan de la proteína espiga, a expensas de la capacidad de su sistema inmunológico para responder a todas las demás partes del virus y todas las demás variantes que evolucionan con el tiempo.

Los políticos se darán cuenta de que las viejas vacunas ya no funcionarán para el próximo invierno, pero no son inmunólogos y esperan que simplemente se pueda idear una nueva vacuna una vez que los descendientes de Delta hayan evolucionado para ya no verse afectados por esta vacuna. Sin embargo, esto no es posible por dos razones:

1. A medida que aumenta la diversidad genética, se vuelve imposible predecir por qué cepa se verá afectada una región o individuo en particular, por lo que se vuelve difícil optimizar la vacuna.

2. Debido al pecado antigénico original, la primera exposición limita la capacidad de ajustarse a las exposiciones posteriores. La respuesta a las exposiciones posteriores será moldeada por la primera exposición. En términos generales, la vacunación con nuevas cepas simplemente recuerda la respuesta de la vacunación con cepas viejas, en lugar de crear una nueva respuesta.

Debido a que no será posible usar vacunas efectivas, el invierno de 2022 a 2023 conduce a una ola masiva de muertes diferente a todo lo que hemos visto hasta ahora.

Nunca antes habíamos hecho algo así en la historia de la humanidad. Hemos inyectado a toda la población con «vacunas», que hacen que sea un poco más difícil que este virus se replique en el cuerpo de una persona, pero aún así permiten que una persona se infecte y lo transmita. Así es como se genera una explosión en nuevas variantes.

Imagen

Lo que es importante entender es que las vacunas también sirven como un trampolín evolutivo: las mutaciones intermedias que nunca podrían haber sobrevivido el tiempo suficiente para desarrollar más mutaciones ahora pueden sobrevivir en este nuevo entorno de inmunidad inducida por vacunas artificiales. Recuerde, las personas no están desarrollando la amplia inmunidad esterilizante natural que involucra casi todas las proteínas del virus en sus membranas mucosas, que les prohíbe infectarse. Tal inmunidad impide que sus cuerpos sirvan como campos de entrenamiento para que el virus evolucione aún más.

No, están desarrollando inmunidad en la sangre, en lugar de en las membranas mucosas del tracto respiratorio superior, en lugar de en las membranas mucosas del tracto respiratorio superior. Así es como se genera una explosión de variantes, con cambios en la proteína espiga. Variantes que pueden saltar a otras especies animales donde pueden evolucionar aún más. Variantes que evolucionan para hacer uso de su respuesta de anticuerpos. Las variantes con todo tipo de ventajas ahora pueden evolucionar, porque las personas con inmunidad inducida por la vacuna menguante contra la proteína Spike son un trampolín evolutivo perfecto.

Uno de los factores necesarios para que nuestra especie alcance densidades de población tan altas como las que hemos alcanzado hoy en día es la diversidad de nuestra respuesta inmune de persona a persona:

Los loci MHC son algunos de los loci codificantes más variables genéticamente en mamíferos, y los loci HLA humanos no son excepciones. A pesar del hecho de que la población humana pasó por una constricción varias veces durante su historia que fue capaz de arreglar muchos loci, los loci HLA parecen haber sobrevivido a tal constricción con una gran variación. [20] De los 9 loci mencionados anteriormente, la mayoría retuvo una docena o más de grupos de alelos para cada locus, una variación mucho más conservada que la gran mayoría de los loci humanos. Esto es consistente con un coeficiente de selección heterocigoto o de equilibrio para estos loci. Además, algunos loci HLA se encuentran entre las regiones codificantes de más rápida evolución en el genoma humano. Se ha observado un mecanismo de diversificación en el estudio de tribus amazónicas de América del Sur que parecen haber sufrido una intensa conversión de genes entre alelos variables y loci dentro de cada clase de genes HLA.[21] Con menos frecuencia, se han observado recombinaciones productivas de mayor alcance a través de genes HLA que producen genes quiméricos.

Si tuviéramos genes HLA con muy poca diversidad, todos tendríamos una respuesta inmune muy similar a los patógenos. La falta de diversidad en sus genes HLA es uno de los factores que hicieron que los nativos americanos fueran tan vulnerables a los virus introducidos por los colonizadores europeos: estos virus podrían propagarse en un entorno de respuesta inmune homogénea, lo que permitió que estos virus evolucionaran para hacer un uso óptimo de ese entorno en particular.

Si tuviéramos genes HLA con poca diversidad, los patógenos desarrollarían variantes que superarían esa respuesta inmune en particular. La diversidad de nuestra respuesta inmune prohíbe que esto suceda: cualquier cambio en particular no puede ayudar mucho a un patógeno, cuando todos responden al patógeno de una manera diferente.

Con las vacunas basadas en picos, hemos hecho exactamente lo peor que podría hacer: homogeneizamos la respuesta inmune humana a un nuevo virus que se está volviendo rápidamente más diverso genéticamente. Esto es algo de lo que llegaremos a arrepentirnos, porque estaremos lidiando con las consecuencias de ese error en forma de inmunidad deteriorada contra este virus durante décadas. Con cada nuevo refuerzo que inyectamos a las personas, homogeneizamos la respuesta inmune nuevamente y hacemos que sea aún más difícil para el sistema inmunológico responder a las nuevas variantes que surgirán.

Los desarrolladores de vacunas no están muy preocupados por lo que sucede cuando su campaña de vacunas falla, porque nunca antes habían visto una situación en la que una vacuna desplegada a cientos de millones de personas haya fallado. Las vacunas que fracasaron y empeoraron la enfermedad (ver Dengue en Filipinas y Virus Respiratorio Sincitial en los Estados Unidos) siempre fallaron durante los primeros ensayos, en los que solo un par de miles de personas como máximo fueron inyectadas con la vacuna. Esta es la primera vez en la historia que le sucede a cientos de millones de personas simultáneamente.

Sin embargo, la realidad es la siguiente: cuando se inyecta a cientos de millones de personas con una vacuna que se supone que los protege contra una nueva enfermedad infecciosa, pero la vacuna no los protege y las personas vacunadas aún pueden propagar este virus debido al fracaso de la vacuna, se están creando las condiciones exactas en las que el virus crecerá mucho más mortal.

Pero espera, ¿cómo es esto posible? ¿No tiene este virus una tasa de mortalidad por infección de ~ 0.2%? ¿El 99.8% de las personas no sobreviven a una infección por coronavirus? Sí, eso solía ser cierto, antes de que comenzáramos nuestra campaña de vacunación masiva y el virus comenzara a evolucionar en respuesta a nuestros errores. La realidad es ahora que estamos viendo que las infecciones irruptivas son muy graves.

https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-1&features=eyJ0ZndfZXhwZXJpbWVudHNfY29va2llX2V4cGlyYXRpb24iOnsiYnVja2V0IjoxMjA5NjAwLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X2hvcml6b25fdHdlZXRfZW1iZWRfOTU1NSI6eyJidWNrZXQiOiJodGUiLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X3NwYWNlX2NhcmQiOnsiYnVja2V0Ijoib2ZmIiwidmVyc2lvbiI6bnVsbH19&frame=false&hideCard=false&hideThread=false&id=1458200182407893001&lang=en&origin=https%3A%2F%2Fwww.rintrah.nl%2Fwhat-happens-when-the-vaccines-start-to-backfire%2F&sessionId=7c48783e802c4b858d9d3a970a425420a8effeb5&theme=light&widgetsVersion=f001879%3A1634581029404&width=550px

Las personas vacunadas que se infectan ahora tienen un 9% de probabilidades de necesitar ser hospitalizadas en los Estados Unidos. Parte de esto se debe al hecho de que las infecciones irruptivas ocurren principalmente en personas mayores, pero también es producto del hecho de que las vacunas prohíben el desarrollo de una respuesta inmune efectiva.

Las infecciones irruptivas son más graves que las infecciones antes de que tuviéramos vacunas. Estas infecciones irruptivas se volverán más comunes con el tiempo. Sin embargo, lo más importante es que podemos esperar que las infecciones innovadoras comiencen a ser más graves con el tiempo, porque ya no tenemos suficientes personas susceptibles no vacunadas cuyos cuerpos imponen una presión selectiva negativa contra las mutaciones de proteína espiga de anticuerpos / ADE. Por lo tanto, la carga sobre los hospitales aumentará y, en última instancia, llegará al punto en que los hospitales ya no puedan hacer frente a todos los pacientes, lo que llevará a un mayor aumento de la mortalidad.

Necesitamos que los jóvenes sanos permanezcan sin vacunar, no solo para proteger a las personas vacunadas e imponer una presión selectiva contra las mutaciones de la proteína espiga ADE evadidos de anticuerpos/ ADE, sino por la siguiente razón:

¡Los jóvenes sanos no vacunados son los únicos que pueden revelar lo que sucedió!

Si casi no quedan jóvenes sanos no vacunados en países donde la mayoría de las personas recibieron estas vacunas, será difícil probar lo que hicieron: le dieron a la gente una vacuna que empeoró la pandemia. Mientras queden muchos jóvenes sanos no vacunados, será obvio a partir de las estadísticas y de las propias interacciones sociales cotidianas de las personas que los jóvenes sanos no vacunados no están sufriendo los efectos de este virus.

Sin suficientes jóvenes sanos no vacunados, será más fácil para los gobiernos pretender que estas nuevas olas mortales fueron simplemente un producto de alguna nueva variante más mortal que evolucionó espontáneamente, completamente sin relación con la campaña de vacunación.


Lo importante es entender que nada de esto era necesario. Realmente no tenía que ser así. Hubiera sido muy sencillo abordar esta situación, para políticos competentes.

Hágase las siguientes preguntas: ¿Por qué Suecia está bien, sin ningún confinamiento? Japón, el país con la población más envejecida del planeta, tiene 18.000 muertes por COVID, tantas como los Países Bajos. ¿Cómo escapó el África subsahariana de esta plaga?

Es realmente muy simple. Realmente no tienes que ser un genio para descubrir esto. Estos políticos y científicos podrían haber sido aclamados como héroes, si hubieran hecho las cosas muy simples que el tipo promedio en la calle ya descubrió:

-Asegúrese de que todos reciban suficiente vitamina D y vitamina K2.

-Fomentar una dieta y un estilo de vida saludables.

-Animar a los jóvenes a infectarse y volverse inmunes.

No voy a discutir todos los detalles específicos con respecto a la nutrición, pero debería quedar claro para cualquiera que mire la evidencia de que conocemos varios nutrientes que reducen enormemente el riesgo de enfermedades graves. Sin embargo, a los políticos no parece importarles esto: quieren una solución fácil de alta tecnología que sea consistente, confiable y fácil de forzar a las personas.

Los seres humanos pueden elegir someterse a las demandas de su cuerpo. El cuerpo anhela ciertos nutrientes, a cambio nos entrega la inmunidad que necesitamos para sobrevivir en este mundo. Por otro lado, la respuesta que elegimos fue el transhumanismo ordenado por el gobierno: forzamos a nuestros cuerpos a cambiar, engañamos a las células de nuestro cuerpo para que comenzaran a expresar material genético extraño: ARNm encapsulado en lípidos y ADN de una vacuna vectora de adenovirus.

Esto ahora es contraproducente. La naturaleza se niega a plegarse a nuestra voluntad y el resultado de este experimento fallido será la muerte en masa.

Fuente: https://www.rintrah.nl/what-happens-when-the-vaccines-start-to-backfire/

¡¡¡ESTAMOS EN GUERRA!!!

Hay valientes, héroes en todas las profesiones de esta guerra, el autor de esta maravillosa viñeta, el australiano Michael Leunig, fue DESPEDIDO por publicarla. Es tan GRAVE que esto ocurra que hasta el más creyente covidicio y/o covidiota debería empezar a rebelarse contra ella. La tiranía globalizadora.

https://t.me/Psicosfera

Nanotecnología autoensamblada encontrada en la vacuna de Moderna

Noticias explosivas: Investigadores médicos estadounidenses son testigos de la nanotecnología de óxido de grafeno autoensamblado o AI Syn Bio en la vacuna de Moderna bajo el microscopio.

Por Ramola D.,

Fuente: Informe de Ramola D. con Everyday Concerned Citizen.

En noticias explosivas que apuntan a la presencia muy especulada de nanobots en las vacunas, un investigador médico estadounidense informa que se vieron nanopartículas en movimiento, cambiantes y autoensamblables de posiblemente óxido de grafeno y / o formando polímeros de biología sintética bajo un microscopio óptico en unas pocas gotas de la vacuna moderna de un vial recién abierto de Moderna, con imágenes como las siguientes (desplácese hacia abajo).

El vial se abrió para la administración de una vacuna a una persona, después de lo cual se tomó la muestra para su visualización. La información en torno al investigador y las circunstancias se mantiene anónima actualmente para proteger la fuente. Sin embargo, el investigador quiso compartir la noticia con todos.

Este investigador señala que las motas de óxido de grafeno posiblemente nano parecían autoensamblarse en formas. Las estructuras y motas parecidas a gusanos parecían moverse y también comenzaron a moverse en concierto. La dirección del movimiento observado fue hacia los bordes del vidrio. Los nanobots también parecieron darse cuenta de la visión de los investigadores a través del ocular y parecieron detenerse y luego parecieron acercarse al centro. Se observaron hilos largos o formas parecidas a gusanos, así como formas dentadas agrupadas como se ve en las imágenes de microscopía de La Quinta Columna de óxido de grafeno en las vacunas de Pfizer y AstraZeneca.

Las nano motas y tubos coloreados y grisáceos se observaron con un microscopio compuesto regular y no se agregó nada a las gotas de Moderna. Un investigador testigo también observó los nanobots y filamentos en movimiento bajo el microscopio. Cualquier otra observación o análisis con microscopios más sofisticados se informará aquí para agregar a este informe.

Este investigador afirma que esto es «lo que observé bajo el microscopio, un vial recién abierto de Moderna, nada agregado. Solo fuente de luz y calentado a temperatura ambiente durante dos horas».

Estos nano-gusanos en movimiento son muy similares a las imágenes publicadas a mediados de abril por Mike Adams de Natural News en sus observaciones al microscopio de máscaras, así como a la observación del Dr. T de nano-gusanos en máscaras, publicada en Not On the Beeb videos,así como numerosos investigadores legos que han publicado sus imágenes de iPhone y videos de filamentos en movimiento en máscaras y en hisopos nasales. Ariyana Love informó a principios de abril que se trataba de nanotubos de carbono de hidrogel que se utilizaban en la administración de vacunas en máscaras e hisopos nasales sin consentimiento informado. Karen Kingston, la denunciante de Pfizer que ha revelado redacciones en los documentos de presentación de la EUA de Pfizer, también ha revelado que moderna y Pfizer está utilizando óxido de grafeno en los lípidos PEGilados utilizados para encerrar las partículas de ARNm para la entrada forzada de estas moléculas extrañas de ARNm en las células humanas a través de membranas celulares humanas naturalmente resistentes.

Se sabe que el óxido de grafeno es altamente tóxico y causa coágulos de sangre.

La evidencia del autoensamblaje inteligente de la nanotecnología y el movimiento inteligente de filamentos es un indicador de la biología sintética y la nanobioelectrónica, según varios artículos científicos (algunos enumerados a continuación) publicados en varias revistas, y apunta a la inclusión sigilosa del óxido de grafeno en la vacuna de Moderna para la manipulación electromagnética de células y neuronas a través de la creación de redes neuronales sintéticas en el cuerpo humano y el cerebro. Esta es una clara señal de malversación y la intención de transhumanizar y ciborgizar el cuerpo humano a través de las vacunas COVID.

Hay que recordar que tanto Pfizer como Moderna desarrollaron las vacunas transhumanistas de ARNm para DARPA, en contratos DARPA a partir de 2013. Las conexiones militares de Pfizer y Moderna, así como las conexiones de ARNm con Regina Dugan de DARPA que ahora dirige las empresas Wellcome LEAP y Dan Wattendorf de DARPA ahora en la Fundación Gates se discutieron aquí anteriormente. Las plataformas de diagnóstico y monitoreo «Pandemic Prevention Platforms» y ADEPT de DARPA se basan en la bioingeniería, la manipulación de genes y la biología sintética. Estos programas de adquisición humana prevén un futuro infinito de vacunas de ARNm y control externo del cuerpo humano y el cerebro, que el óxido de grafeno permitiría.

Otra evidencia de óxido de grafeno en las vacunas y en las estelas químicas y la atmósfera se ha discutido aquí:

Evidencia de envenenamiento por óxido de nano grafeno (GO), cuerpo y cerebro: en vacunas COVID y gripe, estelas químicas, agua de lluvia, solución salina, además: La denunciante de Pfizer Karen Kingston confirma GO en PEGylated Lipid Nano en las vacunas de Pfizer y Moderna

Vacuna de la escena del crimen: el óxido de nano grafeno en grandes cantidades ahora se encuentra en Moderna, otras vacunas, también la vacuna contra la gripe sanofi y la solución salina apuntan a que COVID-19 (y todas las variantes profesadas) es grafeno y envenenamiento por 4G / 5G, no un virus

Los hallazgos del óxido de grafeno y las nanopartículas magnéticas en alimentos agrícolas, carne y otras fuentes también se discutieron aquí en el Panel 1 – Actualización del Proyecto de Divulgación de Carnicom de Transparent Media Truth y Ramola D Reports con el Dr. Robert Young, la Dra. Carrie Madej y la Dra. Judy Mikovits.

IMÁGENES DE LA VACUNA DE MODERNA BAJO MICROSCOPIO:

SIMILITUD CON OTRAS IMÁGENES:

Ejemplo de fibra encontrada en la máscara en imágenes de Mike Adams, microscopía de laboratorio de Natural News:

Imagen de Nano-Worm encontrada en Face Mask por el Dr. T.

Imagen de grafeno encontrada en la vacuna contra la gripe Vaxigrip Tetra reportada por La Quinta Columna:

Imágenes de óxido de grafeno encontradas en la vacuna de Pfizer por investigadores de La Quinta Columna y la Universidad de Almería:

Muestreo de artículos que revelan el uso de óxido de grafeno en terapia génica y nanobioelectrónica

Control genéticamente dirigido del sistema neuronal

Entrega eficiente de ARNm con óxido de grafeno-polietilenimina para la generación de células madre pluripotentes inducidas por humanos sin huella.

Modificaciones nano-carrier basadas en grafeno para aplicaciones de administración de genes

Grupo de Nanobioelectrónica y Nanobiosensores de Grafeno/ Instituto Catalán de Nanotecnología

Avance reciente en aplicaciones biomédicas en la superficie de materiales bidimensionales: desde la biodetes hasta la ingeniería de tejidos.

Nanopartículas de grafeno y su influencia en las neuronas

Neurotoxicidad inducida por óxido de grafeno en neurotransmisores, neuronas AFD y comportamiento locomotor en Caenorhabditis elegans

Progreso reciente del óxido de grafeno como potencial portador de la vacuna y adyuvante.

RELACIONADO:

LA VACUNA DE PFIZER BAJO EL MICROSCOPIO MUESTRA UN MOVIMIENTO SIMILAR DE NANOBOTS: Evidencia de apoyo publicada en un video europeo en Telegram y Youtube el 10 de agosto de 2021, que muestra el mismo fenómeno de nanotecnología bioluminiscente y autoensamblada, aglutinándose, moviéndose, formando redes y mostrando una estructura cristalina fractal, muy similar a las redes cristalinas de nanoantenas formadas en la saliva después de la vacuna (como se informa en el informe eslovaco que se publica aquí en Toxinas encontradas en vacunas COVID, máscaras, hisopos):https://www.youtube.com/embed/s8e06KfDWMM?version=3&rel=1&showsearch=0&showinfo=1&iv_load_policy=1&fs=1&hl=en&autohide=2&start=1&wmode=transparent

Siga a Ramola D. en Everyday Concerned Citizen

————————————————————————————-

Nota del editor:

Al final de este video que revela los muchos ingredientes activos en el suero de Pfizer, vemos el rápido crecimiento cristalino de las nanopartículas de óxido de grafeno bajo microscopía. Esta es la nueva red neuronal que los gobiernos quieren dentro de todos. Se logra a través de la autorreplicación del óxido de grafeno, que es una materia programable que establece una red neuronal artificial o «sistema operativo» como lo llama Moderna, en todo su cuerpo.

El óxido de grafeno al ser superconductor permitirá que la red neuronal sintética lo conecte a la red 5G, «Internet de las cosas» y a la IA. Esto es para la subyugación ABSOLUTA de tu mente, cuerpo y alma. Cada alma tiene una firma de frecuencia energética única que no puede ser duplicada. Tu ADN es el modelo de tu alma, cuya energía irradia a través de cada célula de tu cuerpo.

El democidio Covid-19 del cártel farmacéutico es la última violación y esclavitud de la especie humana. Esta tecnología de biohacking está aprovechando el campo energético de tu alma para alimentar su malvado «sistema operativo». Debemos contraatacar o esto puede terminar en la aniquilación total y la esclavitud de la especie humana. Este es un ataque biológico.

Fuente: https://ambassadorlove.wordpress.com/2021/08/17/self-assembling-nanotech-found-in-moderna-vaccine/

Añadido: Japón retira millones de dosis por encontrar «sustancias extrañas» y «anómalas». Si analizaran todos lo lotes, se tendría que suspender la vacunación.

Dr. Robert O. Young: La microscopía electrónica de barrido revela óxido de grafeno en vacunas Covid-19

¡A TODAS LAS AUTORIDADES, POLÍTICOS, MÉDICOS Y CIENTÍFICOS! ¡URGENTE!

Este blog le dedica la primicia de este hallazgo, oculto por Dios sabe quien y en contra de la Humanidad, a Ricardo Delgado, de La Quinta Columna, al Doctor José Luis Sevillano y al Doctor Pablo Campra. Y por supuesto al Doctor Robert O Young, autor del artículo que al ser anglosajón, tiene un escaparate mayor que la investigación española (hace siglos que es así, por desgracia). Dicho esto hay que unir fuerzas para parar esta locura llamada vacunación, que en realidad es un envenenamiento a una escala jamás antes vista, asesinatos en masa que habrá que juzgar con mano de hierro a los culpables de este genocidio desconocido hasta la fecha. Y todo esto no ha hecho más que empezar. También está dedicado a las doctoras Albarracín y Prego y a «Médicos por la verdad» por su negativa a aceptar este hecho probado en aras de no se sabe qué. ¡Y a toda la sociedad!

Autor: Robert O Young DSc, PhD.

¡La microscopia de contraste de fase, la microscopía electrónica de transmisión y barrido y la espectroscopia de rayos X dispersiva de energía revelan los ingredientes de las vacunas CoV-19!

Mis pruebas de microscopía y espectrometría pueden ser duplicadas con los mismos resultados por cualquier Universidad o Laboratorio que tenga un microscopio electrónico de transmisión, campo brillante, campo oscuro y microscopio compuesto de contraste pHase con una cabeza triocular y finalmente un espectrofotometa NanoDropTM 2000 para medir las nanopartículas que se encuentran en las vacunas de Pfizer, Moderna, Astrazeneca y Janssen. ¿A qué esperan?

Abstracto

Actualmente hay cuatro grandes compañías farmacéuticas que fabrican una vacuna contra el SARS-CoV-2 ahora llamada SARS-CoV-19. Estos fabricantes y su vacuna son Pfizer–BioNTech mRNA Vaccine, la Moderna-Lonza mRNA-1273 Vaccine, la Serum Institute Oxford Astrazeneca Vaccine y la Janssen COVID -19 Vaccine, fabricada por Janssen Biotech Inc., una janssen Pharmaceutical Company de Johnson &Johnson, un adenovirus recombinante e incompetente tipo 26 que expresa la proteína espiga SARS-CoV-2. El propósito de estas vacunas es proporcionar inmunidad contra el llamado nuevo coronavirus infeccioso o virus SARS-CoV – 2 ahora llamado SARS-CoV – 19. Estas cuatro compañías farmacéuticas no han proporcionado una divulgación completa de la FDA en su caja de vacunas, inserte una hoja informativa o una etiqueta para muchos de los ingredientes principales y / o menores contenidos en estas vacunas. El propósito de este artículo de investigación es identificar los ingredientes principales y menores específicos contenidos en la vacuna de Pfizer, la vacuna de Moderna, la vacuna de Astrazeneca y la vacuna de Janssen usando varias pruebas anatómicas, fisiológicas y funcionales científicas para cada vacuna SARS-COV-2-10. Como derecho humano, regido bajo la Ley Mundial por el Código de Nuremberg de 1947, la información de ingredientes específicos de la vacuna es crítica y necesaria para que cualquier humano de cualquier país del mundo pueda tomar una decisión informada sobre si dar o no su consentimiento a la inoculación SAR-CoV-2-19. Hemos realizado las pruebas científicas de cada vacuna y hemos identificado varios ingredientes o adyuvantes que no han sido divulgados y que están contenidos en estas cuatro vacunas contra el SARS-CoV – 2 -19. Actualmente, estas vacunas se están administrando a millones de seres humanos en todo el mundo bajo una Autorización de Uso de Emergencia (EUA) emitida por cada país sin la divulgación completa de todos los ingredientes y en algunos casos ordenada por los gobiernos o empleadores en violación de los derechos humanos individuales bajo el Código de Nuremberg de 1947.

Metodología y Técnicas

Se analizaron cuatro «vacunas» que son la Vacuna Pfizer-BioNtech,Moderna-Lonza mRNA-1273, Vaxzevria de Astrazeneca, Janssen de Johnson & Johnson, utilizando diferentes instrumentaciones y protocolos de preparación según nuevos enfoques nanotecnológicos. Esta instrumentación diferente incluye microscopía óptica, microscopía de campo brillante, microscopía de contraste pHase, microscopía de campo oscuro, espectroscopio de absorbancia y fluorescencia UV, microscopía electrónica de barrido, microscopía electrónica de transmisión, espectroscopio dispersivo de energía, difractómetro de rayos X, instrumentos de resonancia magnética nuclear se utilizaron para verificar las morfologías y el contenido de las «vacunas». Para las mediciones de alta tecnología y el cuidado de la investigación, se activaron todos los controles y se adoptaron medidas de referencia con el fin de obtener resultados validados.

Contraste de fase de sangre en vivo y microscopía de campo oscuro

Posteriormente se obtuvieron imágenes de las fracciones acuosas de las vacunas para evaluar visualmente la posible presencia de partículas de carbono o grafeno.

Las observaciones bajo microscopía óptica revelaron una abundancia de objetos laminares 2D transparentes que muestran gran similitud con imágenes de la literatura (Xu et al, 2019), y con imágenes obtenidas del estándar rGO (SIGMA)(Figuras 1, 2 y 3).

Se obtuvieron imágenes de grandes láminas transparentes de tamaño y formas variables, mostrando onduladas y planas, irregulares. Las hojas más pequeñas de formas poligonales, también similares a las escamas descritas en la literatura (Xu et al, 2019) se pueden revelar con pHase Contrast y microscopía de campo oscuro (Figura 3).

Todos estos objetos laminares estaban muy extendidos en la fracción acuosa de la sangre (Figura 1) o en la muestra vacunal (Figuras 2 y 3) y ningún componente descrito por la patente registrada puede asociarse a estas láminas.

En la figura 1 Usted puede ver lo que una bomba de racimo de óxido de grafeno reducido (rGO) se ve como en la sangre humana no manchada vivo después de una inoculación de CoV-19 causando coagulación patológica de la sangre! [1] [2]

La Figura 1 es una micrografía de un grupo de carbono de óxido de grafeno reducido (rGO) visto en la sangre humana no manchada viva con microscopía de contraste pHase a 1500x. Tenga en cuenta que los glóbulos rojos se coagulan en y alrededor del cristal rGO en una condición conocida como Rouleau! Una palabra francesa que significa encadenar.

¿Cuáles son los ingredientes no divulgados contenidos en las vacunas CoV – 19 llamadas Pfizer, Moderna, Astrazeneca y Janssen?

Para responder a esta pregunta, una fracción acuosa de Pfizer, Moderna, Astrazeneca y Janssen se tomaron de cada vil y luego se vieron por separado bajo microscopía de contraste de fase a 100x, 600x hasta 1500x magnificación que muestra partículas reducidas de óxido de grafeno (rGO) que se compararon con micrografías de rGO de Choucair et al, 2009 para identificación y verificación. [3]

Pasos del análisis de fracciones acuosas de vacunas

Las muestras refrigeradas se procesaron en condiciones estériles, utilizando cámara de flujo laminar y artículos de laboratorio esterilizados.

Los pasos para los análisis fueron:

1. Dilución en solución salina fisiológica estéril al 0,9% (0,45 ml + 1,2 ml)

2. Fraccionamiento de polaridad: 1,2 ml de hexano + 120 ul de muestra RD1

3. Extracción de fase acuosa hidrofílica

4. Absorción UV y espectroscopia de fluorescencia

5. Extracción y cuantificación de ARN en la muestra

6. Microscopía electrónica y óptica de fase acuosa

Los ingredientes no divulgados de la «vacuna» de Pfizer

Las micrografías de las Figuras 2 y 3 se obtuvieron utilizando 100X, 600X y 1500X pHase Contrast, Dark Field y Bright Field Optical Microscopy. [3]

A la izquierda de cada micrografía verá las micrografías obtenidas de la fracción acuosa de la vacuna de Pfizer que contiene rGO.

A la derecha de cada micrografía verá una coincidencia de fuentes conocidas que contienen rGO para la validación anatómica.

Las observaciones bajo una microscopía pHase Contrast, Dark-Field y Bright-Field del producto de la vacuna por Pfizer revelaron algunas entidades que pueden ser tiras de grafeno como se ve a continuación en la Figura 3.

La Figura 2 muestra una imagen de fracción acuosa de la muestra de la vacuna de Pfizer (izquierda) y del estándar de óxido de grafeno reducido (rGO) (derecha) (Sigma-777684). Microscopía óptica, 100X

Figura 3 – Imágenes de fracción acuosa que contienen óxido de grafeno reducido de la muestra de la vacuna de Pfizer (izquierda) y el estándar de óxido de grafeno reducido (rGO) sonicado (derecha) (Sigma-777684). Microscopía óptica del contraste del pHase, 600X

La Figura 4 muestra la cápside del liposoma que contiene rGO que Pfizer utiliza para que su producto vehicule el óxido de grafeno uniendo la cápside del liposoma a moléculas específicas del ARNm para conducir el contenido de liposomas de fGO a órganos, glándulas y tejidos específicos, a saber, los ovarios y los testículos, la médula ósea, el corazón y el cerebro. La imagen se obtuvo mediante una preparación SEM-Cryo.

Utilizando microscopía electrónica de transmisión (TEM) observamos una intrincada matriz o malla de láminas de rGO flexibles translúcidas plegadas con una mezcla de aglomeraciones multicapa más oscuras y colores más claros de monocapas desplegadas como se ve en la Figura 5. [3]

La Figura 5 muestra un grupo de nanopartículas de grafeno en una vacuna de Pfizer. Parecen ser agregados.

Las áreas lineales más oscuras de la Figura 5 parecen ser la superposición local de hojas y la disposición local de hojas individuales en paralelo al haz de electrones. [4]

Después de la malla, aparece una alta densidad de formas claras redondeadas y elípticas no identificadas, posiblemente correspondientes a agujeros generados por forzamiento mecánico de la malla rGO durante el tratamiento como se ve en la Figura 6.[ 4]

La Figura 6 muestra una observación de microscopía TEM donde están presentes partículas de óxido de grafeno reducido en una vacuna de Pfizer. La difractometría de rayos X revela su naturaleza de nanopartículas cristalinas basadas en carbono de rGO

Espectroscopia de rayos X dispersiva de energía revela rGO en la vacuna de Pfizer[5] [6] [7]

A continuación, se analizó la fracción líquida de la vacuna de Pfizer para el contenido químico y elemental mediante espectroscopia de rayos X dispersiva de energía(EDS),como se ve en la Figura 6. El espectro EDS mostró la presencia de Carbono, Oxígeno verificando el rGO y Cloruro de Sodio ya que la muestra mostrada en las Figuras 2, 3, 5 y 6 se diluyeron en solución salina.

La Figura 7 muestra un espectro EDS de una «vacuna» de Pfizer bajo una microscopía ESEM junto con una microsonda de rayos X EDS (eje X = KeV, eje Y = Recuentos) que identifica carbono, oxígeno, sodio y cloruro

La cuantificación del ARNm en la vacuna de Pfizer

La cuantificación del ARN en la muestra de Pfizer se realizó con protocolos convencionales (Fisher).

De acuerdo con el software específico de verificación de calibración del espectrofotómetro NanoDropTM 2000 (Thermofisher), el espectro de absorción UV de la fracción acuosa total se correlacionó con 747 ng / ul de sustancias absorbentes desconocidas.

Sin embargo, después de la extracción de ARN con kit comercial (Thermofisher), la cuantificación con sonda de fluorescencia Qbit específica de ARN (Thermofisher) mostró que solo 6t ug / ul podría estar relacionado con la presencia de ARN. El espectro era compatible con el pico de rGO a 270nm.

Según las imágenes microscópicas presentadas aquí, la mayor parte de esta absorbancia podría deberse a láminas similares al grafeno, abundantes en la suspensión de fluidos en la muestra.

Las conclusiones son apoyadas además por la alta fluorescencia de la muestra con el máximo en 340 nanómetro, de acuerdo con los valores máximos para el rGO. Debe recordarse que el ARN no muestra fluorescencia espontánea bajo exposición UV.

Figura 8 – Espectro UV de la fracción acuosa de la muestra de la vacuna de Pfizer. [1] [2] [3] [5] [6]

Pruebas de fluorescencia ultravioleta de la fracción acuosa de Pfizer para el óxido de grafeno reducido (rGO)[5]

Los espectros ultra violetas de absorción y fluorescencia se obtuvieron con el espectrofotómetro de lector multimodo de imágenes celulares Cytation 5 (BioteK). El espectro de absorbancia UV confirmó un pico máximo de 270nm, compatible con la presencia de partículas rGO.

La fluorescencia UV máxima a 340 nm también sugiere la presencia de cantidades significativas de rGO en la muestra (Bano et al, 2019).

Figura 9 – Se obtuvieron espectros de absorción UV y fluorescencia con Cytation 5 Cell Imaging Multi-Mode Reader Spectrophotometer (BioteK). El espectro de absorbancia UV confirmó un pico máximo a 270 nm, compatible con la presencia de rGO. La fluorescencia UV máxima a 340 nm también sugiere la presencia de cantidades significativas de rGO en la muestra (Bano et al, 2019).

Figura 10 – El análisis uv espectroscopia mostró una adsorción debido a la presencia de óxido de grafeno reducido, que se confirma mediante observación bajo microscopía visible ultravioleta.

Las figuras 11 y 12 a continuación muestran una micrografía de diferentes micro y nanopartículas que se han identificado en Pfizer, Moderna, Astrazeneca y Janssen, las llamadas «vacunas» y analizadas bajo un microscopio electrónico de barrido ambiental junto con una microsonda de rayos X de un sistema dispersivo de energía que revela la naturaleza química de las micro y nanopartículas observadas. [5] [6] [7]

La Figura 11 muestra restos de micras afiladas de 20 um de longitud identificados en la llamada «vacuna» de Pfizer que contiene carbono, cromo de oxígeno, azufre, aluminio, cloruro, nitrógeno.

La Figura 12 muestra una particulada de 20 micras de longitud identificada en la llamada «vacuna» de Pfizer. Se compone de carbono, cromo oxígeno, azufre, aluminio, cloruro y nitrógeno.

Las figuras 13 y 14 a continuación muestran una micrografía de diferentes micro y nanopartículas que han sido identificadas en Pfizer, Moderna, Astrazeneca y Janssen, las llamadas «vacunas» y analizadas bajo un microscopio electrónico de barrido ambiental junto con una microsonda de rayos X de un sistema dispersivo de energía que revela la naturaleza química de las micro y nanopartículas observadas.

¿Hay parásitos en las «vacunas» de Pfizer?

Un cuerpo alargado de 50 micras, como se ve en la Figura 13, es una presencia misteriosa y aguda en la vacuna de Pfizer. Aparece y se identifica anatómicamente como un parásito trypanosoma cruzi del cual varias variantes son letales y es una de las muchas causas del síndrome de inmunodeficiencia adquirida o SIDA.[ Atlas of Human Parasitology, 4th Edition, Lawrence Ash y Thomas Orithel, páginas 174 a 178][8]

La Figura 13 muestra un parásito trypanosoma de aproximadamente 20 micras de longitud que se encuentra en la llamada «vacuna» de Pfizer. Se compone de carbono, cromo oxígeno, azufre, aluminio, cloruro y nitrógeno.

Una Micrografía De Microscopía De Contraste De Sangre Viva pHase Del Parásito Trypanosoma cruzi[8]

La Figura 14 identifica una composición de nanopartículas que incluyen carbono, cromo de oxígeno, azufre, aluminio, cloruro y nitrógeno que también se encuentran en las «vacunas» de CoV-19.

Figura 13 Identifica un compuesto de nanopartículas

Las figuras 15 y 16 a continuación muestran una micrografía de diferentes micro y nanopartículas que han sido identificadas y analizadas bajo un microscopio electrónico de barrido ambiental junto con una microsonda de rayos X de un sistema dispersivo de energía que revela la naturaleza química de las micro y nanopartículas observadas.

La partícula blanca de 2 micras de largo se compone de bismuto, carbono, oxígeno, aluminio, sodio, cobre y nitrógeno.

La Figura 15 muestra las partículas nano y micrones identificadas en la «vacuna» de Pfizer. La partícula blanca de 2 micras de largo se compone de bismuto, carbono, oxígeno, aluminio, sodio, cobre y nitrógeno.

La Figura 16 muestra que las partículas blancas de 2 micras encontradas en la llamada «vacuna» de Pfizer están compuestas de bismuto, carbono, oxígeno, aluminio, sodio, cobre y nitrógeno.

Las figuras 17 y 18 muestran la identificación de partículas orgánicas de carbono, oxígeno y nitrógeno con un agregado de nanopartículas incrustadas que incluyen bismuto, titanio, vanadio, hierro, cobre, silicio y aluminio que se encontraron en la llamada «vacuna» de Pfizer.

Figura 17 – muestra un agregado orgánico (Carbono-Oxígeno-Nitrógeno) con nanopartículas incrustadas de bismuto, titanio. vanadio. hierro, cobre, silicio, aluminio incrustado en pfizer «vacuna!»

Figura 18 – muestra un agregado orgánico (Carbono-Oxígeno-Nitrógeno) con nanopartículas incrustadas de bismuto, titanio. vanadio. hierro, cobre, silicio, aluminio incrustado en pfizer «vacuna!»

La «vacuna» de Astrazeneca ingredientes no divulgados

Las figuras 19 y 20 muestran un agregado de ingeniería de hierro, cromo y níquel también conocido como acero inoxidable de micro y nanopartículas incrustadas e identificado en la «vacuna» de Astrazeneca vista bajo microscopía electrónica de transmisión y cuantificado con una microsonda de rayos X de un sistema dispersivo de energía que revela la naturaleza química de las micro y nanopartículas observadas.

Figura 19 – Agregado de ingeniería de hierro, cromo y níquel también conocido como acero inoxidable.

La Figura 20 muestra las partículas de namo cuantificadas en la «vacuna» de Astrazeneca con una microsonda de rayos X de un Sistema Dispersivo de Energía que revela la naturaleza química de las micro y nanopartículas observadas.

Utilizando el instrumento XRF (fluorescencia de rayos X) se utilizó el instrumento para evaluar los adyuvantes de la «vacuna» de Astrazeneca,que identificó las siguientes moléculas de histidina, sacarosa, polietilenglicol (PEG) o alcohol anticongelante y de etileno. Los resultados de esta prueba se pueden ver en la Figura 20. [9]

La inyección de PEG y alcohol de etileno se conocen como cancerígenos y genocotóxicos. [9] PEG fue el único adyuvante declarado en la hoja de datos que enumera los ingredientes de la «vacuna» de Astrazeneca.

Figura 21 Identifica el espectro de adyuvantes de vacunas de AstraZeneca. Se utilizan diferentes colores para las cuatro moléculas identificadas por medio de espectros de referencia. La concentración relativa se calcula en integrales de señales de referencia para moléculas en un espectro cuantitativo adquirido con un ciclo de trabajo de 5 segundos con el T1 calculado más largo fue de 5 segundos.

Los ingredientes no divulgados de la «vacuna» de Janssen

Las figuras 22 y 23 muestran un agregado orgánico-inorgánico identificado en la «vacuna» de Janssen. Las partículas están compuestas de acero inoxidable y se pegan junto con un «pegamento a base de carbono» de óxido de grafeno reducido. [10] Este agregado es altamente magnético y puede desencadenar la coagulación patológica de la sangre y la creación de «El efecto corona» o «El efecto de la proteína spike» a partir de la degeneración de la membrana celular debido a las interacciones con otros dipolos.[ 10] Usted puede ver estas reacciones biológicas o transformaciones celulares en la sangre viva bajo pHase Contraste y Microscopía de Campo Oscuro en las Figuras 24, 25 y 26. [1] [11]

Figura 22 Una agregación de acero inoxidable de carbono, oxígeno, hierro y níquel mantenidos juntos con óxido de grafeno

Figura 23

El efecto corona y el efecto spike protein

¡El «efecto corona» y la «proteína spike» creados endógenamente son causados por el envenenamiento químico y por radiación de óxido de grafeno reducido y radiación de microondas! [11]

Figura 24 «El efecto Corona» y la creación endógena de exosomas debido al envenenamiento químico y por radiación de los fluidos vasculares e intersticiales del intersticio

La Figura 25 muestra «El efecto corona» y el nacimiento endógeno de picos de proteína S1 causados por la radiación y el envenenamiento químico o lo que yo llamo el «efecto de clavar proteínas»

Figura 26 Esta micrografía muestra la creación endógena de la «proteína spike» como una infección y no e infección!

Las figuras 24 y 25 anteriores muestran «El EFECTO CORONA» en los glóbulos rojos con la Figura 26 mostrando «El EFECTO DE LA PROTEÍNA SPIKED» ambos causados por la acidosis descompensada de los fluidos intersticiales y luego vasculares de un estilo de vida ácido y específicamente, la exposición a campos electromagnéticos pulsantes tóxicos a 2.4gHz o más, intoxicación química por los alimentos y el agua ingeridos, la contaminación tóxica del aire ácido, las esteras químicas y para rematar una inoculación química nana cargada de CoV – 19 inoculación! Por favor, compruebe sus sentimientos y falsas creencias en la puerta antes de que usted prematuramente causar daño a sí mismo! [11]

Los ingredientes no divulgados de la «vacuna» de Moderna

Las Figuras 26 y 27 identificaron una entidad mixta de materia orgánica e inorgánica contenida en la «vacuna» de Moderna.

Microscopía electrónica de transmisión y cuantificado con una microsonda de rayos X de un sistema dispersivo de energía reveló la naturaleza química de las micro y nano partículas observadas.

La llamada «vacuna» de Moderna es un sustrato de óxido de grafeno reducido a base de carbono donde se incrustan algunas nanopartículas. Las nanopartículas están compuestas de carbono, nitrógeno, oxígeno, aluminio, cobre, hierro y cloro. [12]

Figura 26 Microscopía Electrónica de Transmisión Revela Un Compuesto De Óxido De Grafeno De Materia Orgánica Y No Orgánica Embebida

Figura 27 Revela Nano Partículas Citotóxicas Embebidos

Las Figuras 27 y 28 muestran un análisis que también se realizó bajo Microscopía Electrónica de Transmisión y se cuantificó con una microsonda de rayos X de un Sistema Dispersivo de Energía y reveló la naturaleza química de las micro y nanopartículas observadas. Muchos cuerpos extraños fueron identificados con una morfología esférica con algunas cavidades en forma de burbuja.

La Figura 29 muestra que están compuestos de carbono, nitrógeno, oxígeno, silicio, plomo, cadmio y selenio. Esta composición de nanopartículas altamente tóxicas son puntos cuánticos de seleniuro de cadmio que son citotóxicos y genotóxicos. [13] [14]

La Figura 27 revela los nano puntos en el óxido de grafeno encontrado en la «vacuna» de Moderna

La Figura 28 revela los nano puntos en el óxido de grafeno encontrado en la «vacuna» de Moderna

Figura 29 Revela El Compuesto Citotóxico y Genotóxico de Nano Partículas En Óxido de Grafeno Encontrado en la «Vacuna» de Moderna

Las figuras 30 y 31 de análisis adicionales de la llamada «vacuna» de Moderna mostraron un simplasto de 100 micras de compuesto de nanopartículas de óxido de grafeno reducido. El rGO está compuesto de carbono y oxígeno con contaminación de nanopartículas de nitrógeno, silicio, fósforo y cloro Cloro. [15]

Figura 30 Microscopía Electrónica de Transmisión Revela Un Gran Compuesto De Symplast De 100 micras De Reduce El Óxido De Grafeno

La Figura 31 revela el complejo de nanopartículas contenido en la «vacuna» de Moderna

Las figuras 32 y 33 muestran entidades oxdie de grafeno reducidas a base de carbono en la «vacuna» de Moderna mezcladas con agregados llenos de nanoparticulados de silicato de aluminio. [16]

Figura 32 Revela Un Complejo De Óxido De Grafeno Y Silicato De Aluminio Usando Microscopía Electrónica De Transmisión

La Figura 33 revela los nanoelementos del óxido de grafeno y el silicato de aluminio contenidos en la «vacuna» de Moderna

Discusión

La pandemia de SARS-CoVid-2-19 indujo a las industrias farmacéuticas a desarrollar nuevos medicamentos que llamaron vacunas.

El mecanismo de acción de estos nuevos fármacos declarado por la industria farmacéutica junto con lo que se informa en la hoja de datos de los productos de la vacuna NO está claro para que los expertos médicos actuales entiendan que esos nuevos medicamentos producidos por Pfizer–BioNTech mRNA Vaccine,la Moderna-Lonza mRNA-1273 Vaccine,la Serum Institute Oxford Astrazeneca Vaccine y la Janssen COVID -19 Vaccine,fabricada por Janssen Biotech Inc., una janssen Pharmaceutical Company de Johnson &Johnson NO son vacunas sino medicamentos nanotecnológicos que funcionan como terapia genética.

El nombre «vacuna» es probable que sea un escamotage (engaño) utilizado por razones burocráticas y tecnocráticas con el fin de recibir una aprobación urgente, ignorando todas las reglas normales necesarias para los nuevos medicamentos, especialmente para aquellos que implican nuevos mecanismos nanotecnológicos que nunca han sido desarrollados ni experimentados por los seres humanos en cualquier lugar, en cualquier momento en la historia del mundo.

Todas estas llamadas «vacunas» están patentadas y, por lo tanto, su contenido real se mantiene en secreto incluso para los compradores, que, por supuesto, están utilizando el dinero de los contribuyentes. Por lo tanto, los consumidores (contribuyentes) no tienen información sobre lo que están recibiendo en sus cuerpos por inoculación. La humanidad se mantiene en la oscuridad en lo que respecta a los procesos tecnológicos de nanopartículas involucrados, sobre los efectos negativos en las células del cuerpo, pero sobre todo sobre el posible efecto de nano-bio-interacción magneticotoxic, citotóxico y genotóxico con la sangre y las células del cuerpo. Este presente estudio a través del análisis directo de las cuatro llamadas «vacunas» mediante instrumentación tecnológica de nanopartículas revela información y la verdad sobre su contenido real.

Los medicamentos de Pfizer, Moderna, Astrazeneca y Janssen NO son «vacunas» sino nanopartículas complejas de óxido de grafeno agregados de nanoelementos variables unidos a ácidos nucleicos genéticamente modificados de ARNm de células animales o vero y células fetales humanas abortadas como se ha visto y descrito anteriormente, y una vez más son altamente magnéticotóxicos, citotóxicos y genotóxicos para las membranas celulares de plantas, insectos, aves, animales y humanos y su genética que ya ha llevado a lesiones graves (estimaciones de más de 500 millones) o eventual muerte (estimaciones de más de 35 millones). [17] [18] a través [52]

Los llamados «expertos» o «sabios médicos» le están diciendo que las vacunas CoV -2 – 19 son la ÚNICA manera de detener la propagación de CoV-19 … incluso cuando no hay evidencia de su existencia! [53]

Que están a salvo , a pesar de la evidencia documentada de lo contrario … [53]

Que son eficaces , a pesar de que millones de personas «de doble golpe» se están enfermando, exponiendo teóricamente un VIRUS INEXISTENTE llamado CoV – 19, y muriendo … [54] ¡de MIEDO o evidencia falsa que parece real!

Que usted debe conseguir al menos dos tiros más «boosters» para vivir «vidas normales»…

Y pronto, te dirán que NO tienes más remedio que cumplir con TODOS sus MANdates incluso cuando los CDC y otros gobiernos, universidades e institutos médicos han admitido por escrito que NO tienen ningún aislamiento «ESTÁNDAR DE ORO» del virus CoV – 2 ahora llamado CoV – 19! [55]

¡NO HAY CORONAVIRUS y NUNCA LO HA SIDO! [55]

Recordar…

¡NO DEJES QUE NADIE TE QUITE TU LIBERTAD DE SALUD!

¡Es TU CUERPO, TU Vida y TU Elección!

El conocimiento es poder. Y es la clave para entender por qué las vacunas experimentales contra el CoV-19 son tan peligrosas, a pesar de la narrativa oficial de los medios corporativos que suprime y censura a cualquiera que se atreva a hablar.

Usted tiene el control de su propia salud. No seas víctima de los gobiernos globales y burócratas que están presionando a todos para que se vacunen. El multimillonario «filántropo» Bill Gates y los activistas multimillonarios de big tech creen que saben lo que es mejor para usted y su familia.

Usted debe ser libre de decidir lo que es correcto para usted. NO dejes que los gobiernos y los empleadores te obliguen a conseguir vaxxed «para su propio bien».

¡Y nunca dejes que la cultura de la cancelación te haga tener demasiado miedo de defender tus derechos!

En palabras del gran médico y científico francés, Antione BeChamp, «no hay nada tan falso que NO contenga un elemento de verdad y así es con la teoría de los gérmenes». ¡En este caso la teoría viral, vacunal y de inmunidad! [54]

Fuente original: https://www.drrobertyoung.com/post/transmission-electron-microscopy-reveals-graphene-oxide-in-cov-19-vaccines

No importa quien diga que el rey está desnudo, si lo está.

El Dr. Hoffe habla sobre los coágulos y trombos en gente vacunada

Dr. Hoffe: «En el 62% de los vacunados hay evidencias de coágulos»

Ha usado la prueba del Dímero D en sus pacientes. El 62% de ellos sufre de estos coágulos, que pueden ser algo gravísimo, porque normalmente afectarán a muchos tejidos que no puede regenerarse más.


https://www.bitchute.com/embed/ChQwQBggc8TL/ (En inglés)

Éstas son algunas de las cosas que dice en el trozo de entrevista que se ve en el vídeo:

«Cuando te inyectan la vacuna Covid en el brazo, ahora ya sabemos que solo el 25% de esa vacuna se queda en el brazo. Y el otro 75% es literalmente recogido por el sistema linfático, que lo introduce en el sistema circulatorio».

[…]

[Para los coágulos que no son detectables a través de TACs o Resonancias magnéticas, sino que son verdaderamente pequeños] «La única manera de saber si este predecible efecto de coagulación está sucediendo, es haciendo esta prueba de sangre llamada del Dímero D. Esta prueba indica si ha habido una coagulación reciente en la sangre. No indica nada más que esto: un coagulación reciente. No indica antiguos coágulos, sino nuevos coágulos en la sangre. Ahora estoy haciendo esta prueba con mis pacientes, encontrando gente que se ha puesto la vacuna en los 7 días anteriores (entre 4 y 7 días antes), y haciéndoles esta prueba llamada el Dímero D. Todavía tengo que ir acumulando más información, pero de lo que llevo visto, en el 62% de ellos hay evidencias de coágulos. Lo que significa que estos coágulos no son raros. Significa que la mayoría de la gente tiene estos coágulos de sangre y no tienen ni idea de que los tienen.

Así, Laura, la cosa más alarmente de todo esto: Hay muchas partes del cuerpo, como el corazón, el cerebro, la médula espinal y los pulmones, que no se pueden regenerar. Cuando estos tejidos están dañados en sus vasos capilares, se quedan dañados para siempre.

Así que yo ahora tengo 6 pacientes con lo que llamamos tolerancia disminuida para el esfuerzo, que significa que se quedan sin aire mucho más fácilmente de lo que solían. Tengo un hombre que solía venir andando a mi consulta cada semana para una inyección para la artritis, que me dice que podía hacer esos 3 kilometros sin problema, pero que ahora a los 400 metros se queda totalmente sin respiración, y esto está siendo así desde hace 5 meses. Basándonos en esta prueba del Dímero D que demuestra que la mayoría de la gente está produciendo coágulos, estas 6 personas con la tolerancia disminuida para el esfuerzo, lo que les ha pasado literlamente es que se les han taponado miles de capilares en los pulmones.

La cosa más terrible no es sólo que estas personas se queden sin aire y no puedan hacer lo que solían hacer, sino que una vez que tienes bloqueado un número significativo de vasos capilares en los pulmones, el corazón tiene que bombear contra una resistencia mucho mayor para hacer llegar la sangre hasta los pulmones. Esto es lo que causa la enfermedad llamada hipertensión pulmonar […] Lo terrible de esto es que las personas con esta enfermedad normalmente mueren de fallo cardiaco en unos 3 años. […] Lo peor está por llegar. Hay muchos tejidos en el cuerpo que no se pueden regenerar […] Como ahora todos estos jóvenes que tienen miocarditis después de vacunarse: ahora tienen un daño permanente. Sea lo leve que sea, no pueden hacer lo que podían hacer antes, porque el músculo del corazón no se regenera. Así que esta es la terrible preocupación. […] Con cada uno de los sucesivos pinchazos, el daño irá aumentando y aumentando. Es un daño acumulado, porque cada vez tendrás más capilares dañados».

Aquí están las entradas más nuevas de Contra el Encierro.

Dr. Hoffe: «En el 62% de los vacunados hay evidencias de coágulos» (En inglés traducido al español). Entrevista en el programada de Laura Lynn a este médico del Canadá perseguido desde que habló en público de los daños de la vacuna en sus pacientes.

Fuente: Contra el encierro de la gente

La Red De Dinero Oscuro E Influencia De Bill Gates

PARTE 1: Conformación Narrativa Filantrópica (The Last American Vagabond)

En los primeros meses de 2020, el magnate de los negocios y multimillonario Bill Gates vio cómo su popularidad se disparaba por las nubes. Según YouGov, el 58 por ciento de los estadounidenses encuestados sobre Gates tenían una opinión positiva de él, es igualmente querido por hombres y mujeres, y tanto los Boomers como los Millennials lo adoran. La popularidad de Gates podría haber aumentado debido a que un documental viral de Netflix sobre su vida se estrenó a finales de 2019. Combine esa prensa positiva con una ola de entrevistas en los medios de comunicación que buscan la guía del hombre que «predijo» la próxima gran pandemia, y listo – Bill Gates es un superhéroe aquí para salvar al planeta de la inminente fatalidad.

Por supuesto, esta visión bastante caricaturesca ignora varios hechos incontrovertibles, y algunas teorías fuertes sobre las verdaderas intenciones de Gates. En primer lugar, los hechos. Bill Gates ha utilizado su inmensa riqueza para ganar influencia y tiempo en los medios de comunicación, difundiendo su mensaje de solucionar problemas de salud global mientras continúa ganando miles de millones. Usando la Fundación Bill y Melinda Gates para repartir subvenciones y donaciones, Gates ha creado una red de organizaciones que deben su presupuesto a la fundación o responden directamente a Gates. Al rastrear las inversiones de la Fundación y las relaciones de Gates, podemos ver que casi todas las personas involucradas en la lucha contra el COVID-19 están vinculadas a Gates o a su fundación por dos grados o menos. Esto le da a Bill Gates y su fundación una influencia indiscutida sobre la respuesta a la pandemia. Igualmente preocupante es el llamado de Gates para el bloqueo global hasta que el mundo entero haya sido vacunado y se le haya dado un certificado digital para probar la inmunidad.

Ahora, las teorías: al escuchar cuidadosamente varios discursos y declaraciones hechas por Gates, queda claro que tiene una inclinación por discutir la reducción del crecimiento de la población. A pesar de que los «verificadores de hechos» afirman que las palabras de Gates han sido sacadas de contexto, sus palabras hablan por sí mismas. Él cree que la población debe reducirse o evitarse que crezca, y cree que esto se puede hacer con vacunas y atención médica.

Mientras tratamos de despegar las capas de acrobacias de relaciones públicas y piezas de calado que adulan a Bill Gates, esperamos ilustrar que el hombre que está siendo apuntalado en el escenario global y vendido a la gente como su salvador, es cualquier cosa menos. A pesar del aparente crecimiento en el apoyo a Bill Gates, también hay evidencia en las redes sociales de que la gente está comenzando a cuestionarlo y desafiar la narrativa del salvador. Este es el primer paso para desentrañar la Red de Dinero Oscuro y Manipulación de Bill Gates.

La influencia global de la Fundación Bill y Melinda Gates

En 1994, según la historia, Bill Gates le pidió a su padre, William Gates Sr., que lo ayudara a «mejorar la salud reproductiva e infantil» fundando y dirigiendo la Fundación William H. Gates. Gates Sr. estuvo de acuerdo y en el año 2000, la Fundación se fusionó con la Gates Learning Foundation para convertirse en la Fundación Bill y Melinda Gates. Según la Fundación, Bill Gates ha donado 36 mil millones de dólares de su riqueza personal a la fundación. Se estima que la Fundación está valorada en $46.8 mil millones.

Durante las últimas dos décadas, la Fundación ha invertido en una serie de empresas y proyectos controvertidos mientras persigue su objetivo de mejorar la salud mundial y el acceso a las vacunas y la atención reproductiva. Todo esto se ha hecho como parte del plan de Gates para remodelar su imagen pública como la de un multimillonario amable y amable cuyo único objetivo es ayudar al mundo. La realidad es mucho más sospechosa.

Tomemos, por ejemplo, el documental de Netflix mencionado anteriormente,Inside Bill’s Brain: Decoding Bill Gates. En lugar de ser una mirada genuina a la vida y la personalidad de Gates, el documental no reconoció los conflictos de intereses que podrían retratar la película – y Bill Gates – bajo una luz diferente. En una reciente investigación explosiva que examina el alcance del dinero de Gates, The Nation señaló que, «en el primer episodio, el director Davis Guggenheim subraya el intelecto expansivo de Gates al entrevistar a Bernie Noe, descrito como un amigo de Gates». Noe continúa diciendo que Gates lee 150 páginas por hora con un 90 por ciento de retención. Sin embargo, The Nation informó: «Guggenheim no le dice a las audiencias que Noe es el director de Lakeside School, una institución privada a la que la Fundación Bill y Melinda Gates ha dado $ 80 millones». Casualmente, esta es la misma escuela a la que asisten los hijos de los Gates.

Por supuesto, el uso de la riqueza de las fundaciones para influir en la cobertura de los medios no es nuevo para Bill Gates. Aunque The Guardian reclama independencia editorial, su sección de Desarrollo Global está financiada en parte por The Gates Foundation. La fundación también ha dado más de $ 9 millones a The Guardian, más de $ 3 millones a NBC Universal, más de $ 4 millones al periódico francés Le Monde, más de $ 4.5 millones a NPR, $ 1 millón a Al-Jazeera y $ 49 millones al programa Media Action de la BBC. A la luz de estas inversiones, es fácil entender cómo Gates pudo organizar rápidamente una gira de conferencias de sus medios de comunicación favoritos.

Los medios de comunicación corporativos no son los únicos beneficiarios de la fundación Gates. También han invertido en tecnologías y compañías controvertidas, como Monsanto, geoingeniería, tecnología 5G y vacunas.

MintPress News informó recientemente sobre cómo la Fundación Gates ayudó al gigante farmacéutico y químico altamente controvertido Monsanto Corporation a «ganar un punto de apoyo más fuerte en África». Mpn también señala que la fundación financió un «ensayo clínicodefectuoso de la vacuna contra el VPH en la India en 2009, donde 23.000 niñas empobrecidas de entre 9 y 15 años estuvieron expuestas a medicamentos potencialmente letales sin siquiera el consentimiento de sus padres, lo que llevó a siete muertes».

En 2010, también se informó que desde 2007, Gates había dado $ 4.5 millones para estudiar métodos de geoingeniería para alterar la estratosfera para reflejar la energía solar, técnicas para filtrar el dióxido de carbono directamente de la atmósfera y el brillo de las nubes del océano. La geoingeniería es la manipulación deliberada a escala masiva del clima con el propósito declarado de reducir el calentamiento en el planeta. The Guardian señaló previamente que Gates da «unasuma no revelada» al defensor de la geoingeniería y profesor de Harvard David Keith. Gates también posee una participación mayoritaria en la compañía de geoingeniería de Keith, Carbon Engineering. El prominente investigador de geoingeniería Ken Caldeira dice que recibe $ 375,000 al año de Gates y trabaja para Intellectual Ventures, una compañía privada de investigación de geoingeniería propiedad parcial de Gates y dirigida por Nathan Myhrvold, ex jefe de tecnología de Microsoft.

La Fundación también ha invertido 10 millones de dólares en el desarrollo de antenas que acelerarán el despliegue de la controvertida tecnología celular de 5ª generación, también conocida como 5G.

Las preocupaciones en torno a la fortuna de Bill Gates y su uso de la Fundación Bill y Melinda Gates para influir en proyectos de mascotas no es la única preocupación expresada por los críticos de la fundación. El más grande – y más inmediato – es que los multimillonarios no electos como Gates están usando sus fortunas para dar forma a las políticas públicas utilizando sus fundaciones filantrópicas. Este método de invertir miles de millones de dólares en forma de donaciones de caridad deducibles de impuestos a compañías privadas está permitiendo a Gates dar forma a la política y las ganancias al mantener acciones en las mismas compañías apoyadas por la Fundación Gates.

Una investigación reciente de The Nation descubrió más de 19,000 subvenciones caritativas de la Fundación Gates en las últimas dos décadas. También encontraron $ 2 mil millones en estas donaciones caritativas deducibles de impuestos a empresas privadas. Las compañías que reciben estas donaciones incluyen GlaxoSmithKline, Unilever, IBM y NBC Universal Media. La Nación señaló que la Fundación Gates ha dado 250 millones de dólares a compañías de medios y «otros grupos para influir en las noticias».

La Nación encontró cerca de $ 250 millones en donaciones caritativas de la Fundación Gates a compañías en las que la fundación tiene acciones y bonos corporativos: Merck, Novartis, GlaxoSmithKline, Vodafone, Sanofi, Ericsson, LG, Medtronic, Teva y numerosas nuevas empresas.

Es posible que vea la declaración anterior y pregunte, «¿cómo puede ser esto legal? ¿No es un conflicto de intereses mantener acciones en una empresa a la que también se dan donaciones libres de impuestos?» El simple hecho es que no hay reglas o leyes en contra de hacer exactamente lo que la Fundación Bill y Melinda Gates están haciendo. Si bien algunos podrían argumentar que el esquema de Bill Gates es brillante – donar su fortuna mediante la formación de una fundación que puede dar donaciones deducibles de impuestos a las empresas que en parte posee y cosechar ganancias, mientras que evitar los impuestos – que le está permitiendo ocultar su dinero en una miríada de maneras. Se ha vuelto casi imposible rastrear cada donación, inversión u otra asociación.

La Nación concluyó, «es difícil ignorar las ocasiones en que sus actividades caritativas parecen servir principalmente a intereses privados, incluidos los suyos, apoyando las escuelas a las que asisten sus hijos, las compañías que su fundación posee en parte y los grupos de interés especial que defienden a los estadounidenses ricos, al tiempo que generan miles de millones de dólares en ahorros fiscales».

Otros hechos notables de la investigación incluyen que la «dotación de $ 50 mil millones de la Fundación Gates ha generado $ 28.5 mil millones en ingresos de inversión en los últimos cinco años», mientras que solo regala $ 23.5 mil millones en subvenciones caritativas. Además, una investigación de 2007 de LA Times encontró que la organización estaba involucrada en préstamos hipotecarios de alto riesgo y hospitales con fines de lucro que, según los informes, realizaron cirugías innecesarias. Según los informes, la Fundación Gates también invierte en compañías de chocolate que utilizan mano de obra infantil.

Sería un error ver a la Fundación Bill y Melinda Gates como un mero recipiente para que un hombre rico esconda su dinero y obtenga ganancias inconmensurables. No, la Fundación es «más que una colección de subvenciones y proyectos», dice el Dr. David McCoy, médico de salud pública e investigador del University College de Londres y asesor del Movimiento por la Salud popular. McCoy dice que la Fundación «opera a través de una red interconectada de organizaciones e individuos en el mundo académico y los sectores de ONG y negocios» que permite a Bill Gates «aprovechar» la influencia» en una especie de «pensamiento grupal».

En la parte 2 de esta investigación examinaremos la miríada de conexiones entre Bill Gates, su fundación y los muchos actores involucrados en la respuesta al COVID-19. También intentaremos responder a la pregunta esencial: ¿Es Bill Gates una fuerza para el bien o una fuerza para el daño?

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 1: Conformación narrativa filantrópica (thelastamericanvagabond.com)

PARTE 2: La Operación COVID-19

Antes de sumergirnos en la actual crisis del COVID-19, se necesita un poco más de información sobre Gates. En la última pieza discutimos la historia de las inversiones de la Fundación Gates. Lo que es importante tener en cuenta es que al usar la Fundación como la organización principal, Gates puede donar e influir en hospitales, universidades, medios de comunicación, gobiernos y organizaciones de salud. La Fundación claramente tiene la capacidad de dar forma a las decisiones tomadas por algunas de las instituciones que financian, incluso cuando estas decisiones van en contra de los deseos de las masas que dicen estar ayudando.

Por ejemplo, en 2017 Independent Science News publicó un informe que detallaba cómo la Fundación Bill y Melinda Gates pagó a la firma de relaciones públicas Emerging Ag $ 1.6 millones para «reclutar a una coalición encubierta de académicos para manipular un proceso de toma de decisiones de la ONU sobre las unidades genéticas». Los correos electrónicos publicados por la Solicitud de la Ley de Libertad de Información revelan que el esfuerzo de reclutamiento de gates fue parte de un plan para «luchar contra los defensores de la moratoria de la impulsión genética». Las unidades genéticas son una controvertida tecnología de extinción genética promovida como una forma de eliminar los mosquitos con malaria, plagas agrícolas y especies invasoras.

En el Convenio de las Naciones Unidas sobre la Diversidad Biológica de 2016, 179 organizaciones internacionales pidieron una moratoria de la ONU sobre las unidades genéticas. Los opositores a esta tecnología también distribuyeron una carta, «Un llamado a la conservación con conciencia: no hay lugar para las unidades genéticas en la conservación», firmada por 30 líderes ambientales que pidieron un «alto a todas las propuestas para el uso de tecnologías de impulso genético, pero especialmente en la conservación». La Fundación Gates está fuertemente invertida en tecnología de conducción genética y no estaba contenta de ver un retroceso diverso y unificado contra la conducción de genes. La Fundación contrató a Emerging Ag , que tiene su propia red de conexiones con Big Pharma y Big Ag , para cerrar los opositores a la conducción de genes. Emerging Ag tuvo éxito y la moratoria fue derribada.

Coincidentemente, en 2016, la Academia Nacional de Ciencias de Estados Unidos publicó un informe sobre la conducción de genes que fue cofinanciado por la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA) y la Fundación Bill y Melinda Gates. DARPA también se invierte en la investigación de la unidad genética. Como señaló The Guardian después de la publicación del informe nas:

«La misma agencia de investigación de defensa estadounidense (DARPA) que pagó por el estudio NAS ha hecho saber que están participando en la investigación y el desarrollo de organismos sintéticos ‘robustos’. Hay buenas razones para estar preocupados».

Además, Jim Thomas, del Grupo ETC, que monitorea el impacto de las tecnologías emergentes y las estrategias corporativas en la biodiversidad, la agricultura y los derechos humanos, dijo a ISN que cree que las unidades genéticas son armas biológicas potenciales que podrían tener un impacto «desastroso» en la vida humana y la seguridad alimentaria. «El hecho de que el desarrollo de la unidad genética ahora esté siendo financiado y estructurado principalmente por el ejército estadounidense plantea preguntas alarmantes sobre todo este campo», declaró.

Independent Science News también señaló:

«Esta tampoco es la primera vez que la Fundación Gates ha utilizado a académicos para influir en la opinión pública y privada sobre las tecnologías de ingeniería genética, como lo demuestra su financiación de la Cornell Alliance for Science«.»

Los correos electrónicos privados obtenidos por Independent Science News se suman a las montañas de evidencia que detallan cómo Gates es capaz de presionar a las organizaciones para que lleven a cabo sus intereses y los de su fundación.

La mafia de la salud global

Bill Gtaes

Teniendo en cuenta estos alarmantes informes sobre la influencia de Gates en la política de salud pública, es importante tomarse un momento para examinar la respuesta actual al COVID-19. Cuando observamos a los actores e instituciones involucradas, ¿vemos la influencia y el dinero de Gates? En caso afirmativo, ¿qué significa esto para la salud pública? ¿La gigantesca influencia y las finanzas de Gates le permitirán dirigir personalmente el curso de la recuperación del COVID-19?

Comencemos por mirar al doctor Anthony S. Fauci, director del Instituto Nacional de Alergias y Enfermedades Infecciosas (NIAID), parte de los Institutos Nacionales de Salud y líder en la lucha contra el COVID-19. Desafortunadamente, cuando se trata de Fauci y el NIAID vemos claramente la influencia de Bill Gates. En 2010, el NIAID y la Fundación Bill y Melinda Gates anunciaron su «Década de colaboración en materia de vacunas», en la que pedían la coordinación entre la «comunidad internacional de vacunas» y la creación de un «Plan de Acción Mundial sobre Vacunas». El Dr. Fauci fue nombrado miembro del Consejo de Liderazgo de la asociación. Del mismo modo, Bill Gates se ha asociado con los NIH durante varios años.

A finales de abril, se conoció la noticia de que el NIAID de Fauci donó un total de 7,4 millones de dólares a la investigación relacionada con el coronavirus de murciélagos. Las inversiones agregaron combustible a la teoría de que covid-19 podría ser un virus de bioingeniería que fue liberado a propósito o accidentalmente desde el Instituto de Virología de Wuhan en Wuhan, China. La noticia de la financiación plantea la pregunta obvia; ¿El dinero de Gates influyó o coronó la investigación del coronavirus del NIAID? El tiempo lo dirá.

Otra jugadora importante con conexiones con Gates es la Dra. Deborah Birx, una médica y diplomática estadounidense que se desempeña como Coordinadora Mundial de Sida de Estados Unidos para los presidentes Barack Obama y Donald Trump desde 2014. Actualmente es la Coordinadora de Respuesta al Coronavirus para el Grupo de Trabajo de la Casa Blanca de la Administración Trump. Birx también forma parte de la Junta Directiva de The Global Fund,una organización a la que la Fundación Bill y Melinda Gates prometió una inversión de 750 millones de dólares en 2012. El Fondo Mundial también cuenta con el miembro de la junta directiva Kieran Daly, director adjunto de Política Global y Promoción de la Fundación Gates.

«La Fundación Bill y Melinda Gates es un socio clave del Fondo Mundial, proporcionando contribuciones en efectivo, participando activamente en su junta directiva y comités, y apoyando los esfuerzos de promoción, comunicación y recaudación de fondos del Fondo Mundial», afirma el Fondo Mundial.

La Universidad Johns Hopkins ha sido un miembro igualmente importante de la respuesta global al COVID-19. Los cálculos de la universidad de las tasas globales de infección y mortalidad se citan comúnmente en los principales medios de comunicación. Sin embargo, una vez más, encontramos que la Fundación Bill y Melinda Gates ha estado invirtiendo en Johns Hopkins durante dos décadas.

Por último, recientemente se informó que la organización conocida como Wellcome Trust se ha asociado con la Fundación Bill y Melinda Gates y MasterCard para «catalizar el trabajo inicial» del Acelerador terapéutico COVID-19. Se supone que la Aceleradora acelerará y evaluará «medicamentos y productos biológicos nuevos y reutilizados para tratar a pacientes con COVID-19 a corto plazo». Lo que no se mencionó es que la Fundación Gates ha sido un «Fideicomisario» del Wellcome Trust durante varios años. Curiosamente, en 2017, Mark Henderson, Director de Comunicaciones de Wellcome Trust participó en un panel llamado «Deep Dive: Preventing Pandemics». El Dr. Anthony Fauci también participó en la mesa redonda.

Uno podría señalar la participación de Fauci y Wellcome Trust en un panel sobre pandemias como perfectamente razonable, después de todo, estos son profesionales que se centran en la salud global. Sin embargo, ignorar que las huellas dactilares de Bill Gates están en toda la industria de la salud global sería un error.

Basado en el historial de la Fundación Gates de contratar empresas de relaciones públicas para cerrar detractores o usar su dinero para influir en las instituciones, uno podría ser perdonado por asumir que la fundación no sería alta en la lista de líderes potenciales para una crisis de salud pública. Desafortunadamente, a partir de mayo de 2020, Bill Gates y su Fundación siguen siendo promovidos como héroes en la lucha contra el COVID-19.

¿Quién dirige la OMS?

Desde el brote de COVID-19, tanto Bill Gates como la Organización Mundial de la Salud han entrado en el centro del escenario mientras el mundo los mira en busca de respuestas. A estas alturas, es bien sabido que la Fundación Bill y Melinda Gates es el principal donante no estatal a la OMS. Estados Unidos ha sido el principal donante estatal, pero eso puede cambiar bajo la administración Trump. Gates también fue la primera persona no estatal en dar un discurso de apertura ante la asamblea general de la OMS.

Según un informe de Politico, la opinión (y el dinero) de Bill Gates tiene tanta influencia en la OMS que los funcionarios lo llaman en privado «el Bill Chill». Dieciséis funcionarios que hablaron bajo condición de anonimato dijeron a Politico que Gates tiene una influencia desmesada en la política de la OMS y pocos se atreven a desafiarlo. «Es tratado como un jefe de Estado, no solo en la OMS, sino también en el G20»,declaró un representante de una ONG con sede en Ginebra.

Las acusaciones de la influencia de Gates fueron secundadas por Foreign Affairs cuando informaron que «pocas iniciativas de política o estándares normativos establecidos por la Organización Mundial de la Salud se anuncian antes de que hayan sido investigadas casual y extraoficialmente por el personal de la Fundación Gates».

El actual Director General de la OMS es Tedros Adhanom, ex Ministro de Salud de Etiopía. Durante su mandato como Ministro de Salud de Etiopía, Tedros colaboró con la Fundación Clinton y la Fundación Bill y Melinda Gates para trabajar en vacunas, entre otras medidas sanitarias. Politico informó que antes de que Tedros fuera seleccionado para el puesto de la OMS en 2017, Gates fue acusado de apoyar a Tedros y usar su influencia para ayudar a ganar la nominación.

Si bien la mayoría de los delegados de los países miembros expresaron su creencia de que Gates tiene buenas intenciones, algunos temían que el dinero de la Fundación Gates provenga de «grandes empresas» y pudiera «servir como un caballo de Troya para que los intereses corporativos socaven el papel de la OMS en el establecimiento de normas y la formulación de políticas de salud».

La conclusión más importante es que las tarifas pagadas por los países miembros de la OMS representan menos de una cuarta parte del presupuesto bienal de 4,5 mil millones de dólares, lo que deja a Gates, los gobiernos y otras fundaciones para llenar el vacío. Estas donaciones se destinan a proyectos específicos y la OMS no puede decidir cómo utilizarlas. En el caso de la Fundación Bill y Melinda Gates, esos fondos suelen destinarse a programas de vacunación.

No importa de qué manera abordes las soluciones que se presentan como respuesta a la pandemia de COVID-19, encontrarás las huellas dactilares de Bill Gates. En repetidas ocasiones ha utilizado su dinero e influencia para obtener ganancias y ganar poder constantemente sin haber sido elegido para un cargo político.

En la parte 3 de esta investigación examinaremos las estrategias que Bill Gates ha pedido en respuesta al COVID-19. También veremos cómo Bill Gates y la familia Rockefeller han ido prediciendo una situación como la que estamos presenciando actualmente. Finalmente, mostraremos cómo esta crisis presenta la oportunidad perfecta para que Gates y sus cohortes obtengan enormes ganancias y se posicionen a la cabeza de un Estado tecnocrático emergente.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 2: La operación COVID-19 (thelastamericanvagabond.com)

PARTE 3: Vigilancia De La Salud, Evento 201 Y La Conexión Rockefeller

Bloqueos, rastreo de contactos, certificados digitales y vacunas

En los últimos cuatro meses Bill Gates ha hecho decenas de apariciones en medios donde ha pedido varias «soluciones» controvertidas al COVID-19. Gates dice que estas propuestas deben implementarse antes de que la sociedad pueda volver a la «normalidad». Desde pedir bloqueos prolongados, vigilancia de la salud (también conocido como rastreo de contactos)certificados digitales.

La ciencia detrás de los cierres ha sido cuestionada en numerosas ocasiones por los expertos en salud. Más recientemente, Michael Levitt, un profesor de la Universidad de Stanford que predijo la trayectoria inicial de la pandemia, declaró que creía que el confinamiento fue un «gran error» y que en realidad pudo haber costado vidas. TLAV también ha expuesto el rastreo de contratos y el llamado a un «ejército» de personas para monitorear al público como una expansión de la vigilancia. Coincidentemente, se informó esta misma semana que la Fundación Gates invirtió recientemente cientos de millones de dólares en compañías tecnológicas como Google, que pueden terminar construyendo la infraestructura de rastreo de contactos.

Lo que Gates describe como «certificados digitales» suena idéntico a lo que algunos llaman «pasaportes de inmunidad», una forma de identificación digital que incluirá los datos de salud de una persona, así como su estado de vacunación. Durante un AMA de Reddit, Gates declaró: «Eventualmente tendremos algunos certificados digitales para mostrar quién se ha recuperado o ha sido probado recientemente o cuando tengamos una vacuna quién la ha recibido». Lo que Gates describe –un certificado digital para demostrar quién ha sido vacunado– suena similar a los recientes llamamientos para que los pasajeros usen pasaportes de inmunidad antes de que se les permita volar.

Sin embargo, las declaraciones y la filantropía de Gates revelan su enfoque principal en la «lucha por la salud global»: la promoción de vacunas para todo el mundo. En lugar de centrarse en el agua potable, el acceso a la vivienda o cualquier otra propuesta para ayudar a los más pobres del mundo, Gates cree que el acceso a las vacunas es más apremiante. Mucho antes del COVID-19, la Fundación Gates ha estado involucrada en la financiación de polémicos esfuerzos de vacunación en África e India.

Un informe de 2015 titulado, Poder filantrópico y desarrollo: ¿Quién da forma a la agenda?, examina la influencia de la filantropía global y proporciona ejemplos de la influencia indebida que Gates y otros pueden ejercer. El informe describe gran parte de lo que describimos en la Parte 1 de esta investigación, incluyendo cómo,«a través de la colocación del personal de la Fundación en los órganos de toma de decisiones de las organizaciones internacionales y las asociaciones mundiales de salud» la Fundación Gates influye y guía la política de salud pública. La Fundación Gates es miembro de la junta directiva no sólo de GAVI, sino también del Fondo Mundial, la Alianza para la Salud de la Madre, el Recién Nacido y el Niño, la Empresa medicamentos para la malaria, la Alianza para lograr la regresión de la malaria, la Alianza contra la Tuberculosis, la Alianza Alto a la Tuberculosis y muchas otras.

La investigación también proporciona detalles sobre las inversiones de Gates en vacunas y sus conexiones con los fabricantes de vacunas. Como se informó en la Parte 2 de esta investigación, en 2010 la Fundación Bill y Melinda Gates lanzó la «Década de las Vacunas» y pidió un «Plan de Acción Mundial de Vacunas». También ayudaron a crear la asociación público-privada conocida como GAVI, o la Alianza Mundial para el Fomento de la Vacunación y la Inmunización.

«La Fundación Gates proporcionó una promesa inicial de cinco años de US$ 750 millones como capital inicial para lanzar esta asociación mundial público-privada en el año 2000 y ha seguido siendo su fuerza impulsora y su mayor donante», señala el informe. «Entre 2000 y 2014, la Fundación Gates aportó el 23 por ciento (US$2.287,94 millones) del financiamiento total de los donantes de alrededor de US$9,9 mil millones».

El informe señaló que los investigadores han criticado a GAVI por seguir un «enfoque gates» sobre los desafíos de salud global, «centrándose en intervenciones de salud verticales específicas de la enfermedad (a través de vacunas), en lugar de enfoques horizontales y holísticos (por ejemplo, el fortalecimiento del sistema de salud)». Además, hay evidencia de que el apoyo de la Fundación Gates a GAVI ha alentado a los fabricantes de vacunas a producir vacunas específicas que resultan en «más de $ 1 mil millones para Pfizer y GlaxoSmithKline (GSK)».

La organización no gubernamental Médicos sin Fronteras (MSF) también ha cuestionado el impacto general de la Alianza GAVI en la asequibilidad de las vacunas, afirmando que «el costo de inmunizar completamente a un niño fue 68 veces más caro en 2014 que en 2001». MSF también pide a GAVI que excluya a las compañías farmacéuticas de su consejo de administración para reducir los conflictos de intereses.

Una de las conclusiones más importantes de la investigación es que la Fundación Gates opera una puerta giratoria entre el personal de la Fundación y las grandes compañías farmacéuticas como Merck y GSK. El informe proporciona varios ejemplos de esta puerta giratoria, incluido Trevor Mundel, el presidente de la División de Salud Global de la Fundación Gates, trabajó anteriormente con Novartis, Pfizer y Parke-Davis. El predecesor de Mundel, Tachi Yamada, había sido ejecutivo y miembro de la junta directiva de GSK. Kim Bush, responsable de las iniciativas de asociación con la atención médica para la Fundación Gates, anteriormente trabajó para Baxter International Healthcare Corporation. Penny Heaton, Directora de Desarrollo de Vacunas en la Fundación Gates desde 2013, trabajó antes para Novartis Vaccines and Diagnostics y para Merck &Co.

La Fundación Gates y las vacunas de ARNm

Otra nota interesante del informe es cómo la Fundación tiene una participación de 52 millones de dólares en el capital de la compañía farmacéutica alemana CureVac. La colaboración está destinada a acelerar el desarrollo de vacunas de ARN mensajero (ARNm) contra diversas enfermedades, incluidos el rotavirus, el VIH y el virus sincitial respiratorio.

La vacuna de ARNm se ha discutido como un candidato potencial para la vacuna contra el COVID-19. Específicamente, la compañía biotecnológica Moderna Therapeutics está liderando el camino para la terapéutica de ARNm y las vacunas potenciales. El programa de vacunación contra el ARN de Moderna ha recibido 100 millones de dólares en fondos de la Fundación Gates. La controvertida vacuna de ARNm de Moderna también fue desarrollada con una donación de 25 millones de dólares de la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA).

Como informó TLAV, Donald Trump también nombró al Dr. Moncef Slaoui , un ex ejecutivo de Big Pharma que hasta hace poco se sentaba en la junta de Moderna , como su «Zar de las Vacunas» para dirigir la «Operación Warp Speed», el esfuerzo de la administración Trump para acelerar una vacuna para fines de 2020. En 2016, Slaoui fue nombrado miembro del Consejo de Administración de Moderna Therapeutics. Renunció al ser nombrado para un cargo en la actual administración estadounidense.

La escritora de TLAV Whitney Webb informó recientemente sobre el papel de Moderna en la lucha contra el COVID-19 y sus conexiones con la Fundación Gates:

«La Coalición para las Innovaciones en Preparación para Epidemias (CEPI, por sus, anunció que financiaría tres programas separados para promover el desarrollo de una vacuna para el nuevo coronavirus responsable del brote actual.

Cepi – que se describe a sí mismo como «una asociación de organizaciones públicas, privadas, filantrópicas y civiles que financiará y coordinará el desarrollo de vacunas contra amenazas de alta prioridad para la salud pública» – fue fundada en 2017 por los gobiernos de Noruega y la India junto con el Foro Económico Mundial y la Fundación Bill y Melinda Gates. Su financiación masiva y sus estrechas conexiones con organizaciones públicas, privadas y sin ánimo de lucro la han posicionado para poder financiar la rápida creación de vacunas y distribuirlas ampliamente.

El reciente anuncio de CEPI reveló que financiaría dos compañías farmacéuticas , Inovio Pharmaceuticals y Moderna Inc., así como la Universidad de Queensland de Australia, que se convirtió en socio de CEPI a principios del año pasado. Cabe destacar que las dos compañías farmacéuticas elegidas tienen estrechos vínculos y/o asociaciones estratégicas con DARPA y están desarrollando vacunas que involucran de manera controvertida material genético y/o edición de genes. La Universidad de Queensland también tiene vínculos con DARPA, pero esos vínculos no están relacionados con la investigación biotecnológica de la universidad, sino con la ingeniería y el desarrollo de misiles«.»

Webb continúa detallando cómo Moderna está trabajando con los NIH de Estados Unidos para desarrollar una vacuna para el nuevo coronavirus y cómo el proyecto será financiado en su totalidad por cepi, que a su vez fue fundada y financiada por la Fundación Bill y Melinda Gates.

No debería sorprender que Bill Gates ahora esté apoyando abiertamente las vacunas de ARN. El desarrollo de estas vacunas —y el esfuerzo general de la Operación Warp Speed— está ignorando los ya inestables protocolos y medidas de seguridad para la fabricación de vacunas. La Operación Warp Speed y los ensayos posteriores en humanos en los que participaron 100.000 voluntarios «comprimirán lo que normalmente son 10 años de desarrollo y pruebas de vacunas en cuestión de meses».

La prisa por conseguir al público una vacuna que no ha sido probada adecuadamente es aún más preocupante teniendo en cuenta las recientes declaraciones de Gates sobre la necesidad de vacunar a toda la población mundial. En un blog en su sitio web, Gate afirma: «El objetivo es elegir una o dos mejores construcciones de vacunas y vacunar a todo el mundo, es decir, 7 mil millones de dosis si es una vacuna de dosis única y 14 mil millones si es una vacuna de dos dosis».

El impulso de Gates para una vacuna obligatoria probablemente tendrá un fuerte impacto en las decisiones de la OMS, los CDC y otras organizaciones de salud globales que financia, influye o de las que es miembro de la junta directiva. La financiación de Gates de un » tatuaje de punto cuántico» que puede almacenar registros de vacunación ha hecho poco para calmar la disidencia y el miedo a sus verdaderas motivaciones.

A pesar de la proclamación de Gates como un héroe que ha salvado millones de vidas, la idea de forzar las vacunas ha provocado una creciente oposición a las vacunas y preocupaciones sobre su seguridad. Ya sea que se trate del denunciante de los CDC, el testimonio del Dr. Andrew Zimmerman sobre la seguridad de las vacunas o simplemente el apoyo a la libertad de elección, las personas de todo el mundo son escépticas de la seguridad de las vacunas y la influencia de las grandes farmacéuticas y no es probable que acepten una vacuna obligatoria en silencio.

La conexión rockefeller, el paso de bloqueo y el evento 201

Bill Gates

A medida que concluimos nuestra investigación sobre Bill Gates y consideramos sus segundas intenciones, es importante hacer un balance de la compañía que mantiene y las filosofías que ha promovido.

El informe, Poder filantrópico y desarrollo: ¿Quién da formaa la agenda? , también proporciona un antecedente importante sobre los orígenes de la filantropía moderna y la capacidad de ese dinero para influir en la salud global, la alimentación y la política agrícola. Los investigadores describen el papel de las dinastías Rockefeller y Carnegie en la creación de la filantropía estadounidense:

«Las raíces de la filantropía moderna se remontan al comienzo del siglo 20 en los Estados Unidos, cuando los magnates de los negocios John D. Rockefeller y Andrew Carnegie establecieron las primeras grandes fundaciones estadounidenses, principalmente como una forma de proteger algunos de sus ingresos de los impuestos, pero también como una forma de obtener prestigio e influencia en los Estados Unidos y los asuntos mundiales.

En 1911 Andrew Carnegie estableció la Carnegie Corporation de Nueva York y le dio una dotación de 125 millones de dólares, convirtiéndola en el mayor fideicomiso filantrópico jamás establecido hasta ese momento. Un año antes, Carnegie, que hizo su fortuna en la industria del acero, fundó el Carnegie Endowment for International Peace, que se convirtió en uno de los principales think tanks de política exterior de EEUU».

Irónicamente, la formación de la Fundación Rockefeller suena inquietantemente similar a la propia historia de Gates de enfrentar acusaciones antimonopolio y de monopolio durante su tiempo en Microsoft y luego fundar la Fundación Bill y Melinda Gates como una forma de reescribir la historia y crear un personaje de héroe alrededor de sí mismo.

«La Fundación Rockefeller se estableció en 1913, dos años después de que la Corte Suprema de los Estados Unidos dictaminara que la Standard Oil Company de John D. Rockefeller era un monopolio ilegal y ordenó que se dividiera en compañías más pequeñas. La disolución de la entonces compañía petrolera más grande del mundo convirtió a su fundador y principal accionista John D. Rockefeller en el hombre más rico del mundo. Con el establecimiento de su fundación, pudo aislar una gran parte de su fortuna de los impuestos sobre la renta y la herencia.«

La filantropía y la evasión fiscal no son los únicos puntos en común entre Bill Gates y los Rockefeller. Según los registros genealógicos, Gates está relacionado con la familia Rockefeller a través de Nelson Rockefeller, un ex vicepresidente de los ESTADOS UNIDOS. Sin embargo, las conexiones van más allá de ser asociadas por parientes lejanos. Tanto la Fundación Rockefeller como la Fundación Gates aparentemente «predijeron» un escenario muy similar al de la pandemia que se desarrolla frente a nuestros ojos.

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates se asoció con el Centro Johns Hopkins para la Seguridad de la Salud y el Foro Económico Mundial en un ejercicio pandémico de alto nivel conocido como Evento 201. Gates es un largo tiempo «Colaborador de agenda» para el WEF y ha donado a Johns Hopkins. El evento 201 simuló cómo respondería el mundo a una pandemia de coronavirus que arrasó el planeta. La simulación imaginó la muerte de 65 millones de personas, los cierres masivos, las cuarentenas, la censura de puntos de vista alternativos bajo el pretexto de combatir la «desinformación», e incluso planteó la idea de arrestar a las personas que cuestionan la narrativa de la pandemia.

Coincidentemente, uno de los jugadores involucrados en el Evento 201 fue el Dr. Michael Ryan, el jefe del equipo de la Organización Mundial de la Salud responsable de la contención internacional y el tratamiento del COVID-19. Ryan llamó a buscar familias para encontrar individuos potencialmente enfermos y aislarlos de sus familias.

La Fundación Rockefeller imaginó un escenario similar en 2010 como parte de su documento,«Escenarios para el futuro de la tecnología y el desarrollointernacional». Este documento incluye un escenario llamado «Lockstep», que describe una pandemia que arrasa el mundo y resulta en un control más autoritario por parte de los gobiernos de los países desarrollados. El documento también describe la respuesta a la pandemia de la siguiente manera:

«Durante la pandemia, los líderes nacionales de todo el mundo exhibieron su autoridad e impusieron reglas y restricciones herméticas, desde el uso obligatorio de mascarillas hasta controles de temperatura corporal en las entradas a espacios comunes como estaciones de tren y supermercados. Incluso después de que la pandemia se desvaneció, este control y supervisión más autoritarios de los ciudadanos y sus actividades se mantuvo e incluso se intensificó».

En el escenario imaginado, la fundación Rockefeller predice que «los escáneres que utilizan tecnología avanzada de resonancia magnética funcional (fMRI) se convierten en la norma en los aeropuertos y otras áreas públicas para detectar comportamientos anormales que pueden indicar «intención antisocial». Curiosamente, la Administración de Seguridad en el Transporte anunció recientemente planes para controlar las temperaturas en los aeropuertos estadounidenses. El documento continúa describiendo cómo, eventualmente, la gente del mundo se cansaría del control y los disturbios civiles comenzarían:

«Para 2025, la gente parecía estar cansándose de tanto control de arriba hacia abajo y dejando que los líderes y las autoridades tomaran decisiones por ellos. Dondequiera que los intereses nacionales chocan con los intereses individuales, hay conflictos. El retroceso esporádico se volvió cada vez más organizado y coordinado, a medida que los jóvenes desafectos y las personas que habían visto cómo su estatus y sus oportunidades se escapaban, principalmente en los países en desarrollo, incitaban a los disturbios civiles».

Si bien podría ser conveniente descartar el Evento 201 y Lock Step como una coincidencia, sería miope ignorarlos teniendo en cuenta que las Fundaciones Gates y Rockefeller están muy involucradas en la financiación de la industria mundial de la salud. Si bien abundan las teorías sobre si la pandemia de COVID-19 fue planeada o diseñada de alguna manera, como para imitar los planes discutidos en el Evento 201 y Lock Step, evidencia dura si actualmente falta. Aun así, no debemos descartarlos por completo.

Reducción de la población a través de la eugenesia

Las dinastías Gates y Rockefeller también están unidas por su interés común en la eugenesia, la ciencia desacreditada que promovió la idea de que las personas de «buen nacimiento» deben ser alentadas a reproducirse, mientras que aquellos con «genes malos» deben ser desalentados de la reproducción o esterilizados por completo. La ciencia fue desarrollada por Francis Galton como una estrategia para mejorar la raza humana. La idea era extremadamente popular en Estados Unidos antes de que los nazis abrazaran la doctrina y la llevara al extremo.

La eugenesia también fue extremadamente popular entre la familia Rockefeller. Un informe del Instituto Hudson señala que «las primeras fundaciones estadounidenses estaban profundamente inmersas en la eugenesia, el esfuerzo por promover la reproducción del ajuste y suprimir la reproducción de los no aptos». El informe afirma que los Rockefeller y otros primeros filántropos estadounidenses creían en la «eugenesia filantrópica», la idea de que podían usar su dinero para crear fundaciones que promovieran la filosofía de la eugenesia.

La Fundación Rockefeller y su familia ayudaron a financiar a los investigadores de los Institutos Kaiser Wilhelm en Alemania que estaban involucrados en los programas de esterilización nazi, financiaron la Oficina de Registros de Eugenesia y muchos otros programas que promovían el control de la población. En 1952, después de que los experimentos de eugenesia nazis fueran ampliamente conocidos, John D. Rockefeller III ayudó a crear el Population Council para promover la eugenesia sin el bagaje del término.

En su libro, Apareciendo por la vida,el padre de Bill Gates, William H. Gates II, escribió sobre su admiración por los Rockefeller y su filantropía:

«Una lección que aprendimos al estudiar y trabajar con los Rockefeller es que para tener éxito en la búsqueda de objetivos audaces se necesitan socios de ideas afines con los que colaborar.

Y aprendimos que tales goles no son premios reclamados por los de corto plazo. Los Rockefellers se quedan con problemas difíciles durante generaciones».

Parece que Gates II era un partidario de la filosofía de eugenesia de Rockefellers, ya que sirvió como jefe de Planned Parenthood durante un tiempo. Planned Parenthood fue financiado en parte por una donación de $1.5 millones del Consejo de Población creado por Rockefeller. Gates II fue precedido en Planned Parenthood por Alan Guttmacher, quien simultáneamente se desempeñó como Director de la Sociedad Americana de Eugenesia.

Este interés en la eugenesia puede haber retrocedido tres generaciones al abuelo de Bill Gates, William H. Gates, ya que la Sociedad Americana de Eugenesia tenía un miembro con el nombre de «William H. Gates» en la década de 1920. El William H. Gates que aparece en la lista de AES fue catalogado como «profesor» y hay un profesor William H. Gates de la Universidad Estatal de Luisiana, pero todavía no hay evidencia de que el abuelo de Gates sea el mismo William H. Gates.

A pesar de todo, la actual familia Gates tiene la costumbre de pasar tiempo alrededor de sus compañeros eugenistas filantrópicos. En diciembre de 2001, William H. Gates recibió la inauguración de las «Medallas Andrew Carnegie de Filantropía» por su trabajo de caridad. Gates Sr. recibió su premio junto a Walter H. y Leonore Annenberg en nombre de la Fundación Annenberg, Brooke Astor, Irene Diamond, David y Laurance S. Rockefeller en nombre de la familia Rockefeller, George Soros y Ted Turner. Aunque Bill Gates no aparece en la foto, la Carnegie Corporation menciona que el mayor Gates estaba representando a la «familia Gates».

Bill Gates
Bill Gates

Más recientemente, en 2010 Bill Gates fue visto con otros multimillonarios en un evento que fue descrito por los medios corporativos como «Se llaman el Buen Club – y quieren salvar al mundo.» The Guardian informó:

«Este es el Buen Club, el nombre dado a la pequeña élite global de filántropos multimillonarios que recientemente celebraron su primera y altamente secreta reunión en el corazón de la ciudad de Nueva York.

Los nombres de algunos de los miembros son figuras familiares: Bill Gates, George Soros, Warren Buffett, Oprah Winfrey, Michael Bloomberg, David Rockefeller y Ted Turner. Pero también hay otros, como los gigantes empresariales Eli y Edythe Broad, que son igualmente ricos pero menos conocidos. En total, sus miembros valen 125 mil millones de dólares».

The Guardian también señala que Rockefeller, Gates y Buffet organizaron la reunión. The Wall Street Journal informó que la reunión se centró en la desaceleración del crecimiento de la población, un eufemismo para la eugenesia. La aparición de Ted Turner tanto en la reunión de 2001 como en la reunión de 2010 no debería ser una sorpresa, ya que también ha sido un defensor vocal del control de la población.

También cabe señalar que a pesar de las negaciones de Bill Gates, también fue socio del depredador sexual Jeffrey Epstein. La escritora de TLAV Whitney Webb documentó previamente la relación y los intentos de ocultarla. Coincidentemente, Epstein también fue expuesto como un defensor de la eugenesia.

¿Se levantará el verdadero Bill Gates?

Ahora que hemos llegado al final de esta investigación sobre las vidas, las finanzas y la historia de Bill Gates, debemos detenernos a reflexionar sobre sus motivaciones. ¿Es Bill Gates el adorable filántropo multimillonario que podría salvar al mundo del COVID-19? ¿Es el financiador de los peligrosos ensayos de vacunas? ¿Está motivado por un deseo de ayudar a la humanidad o está motivado por una filosofía desacreditada o la ciencia de la raza y la eugenesia?
Si vamos a juzgar a un individuo por la empresa que mantiene, por los proyectos que financian y por las palabras que dicen, entonces debería quedar claro que la familia Gates tiene una historia de promoción y apoyo a la eugenesia. Armados con este conocimiento podemos echar un nuevo vistazo a la filantropía de Bill Gates y llegar a entender que podría tener motivos que son muy diferentes de sus declaraciones públicas.

El hecho es que Bill Gates corre en círculos de élite donde la promoción de la eugenesia, el control de la población, la esterilización y otras tácticas de ingeniería social son la norma. Este hombre está siendo apuntalado frente al mundo como el héroe que necesitamos desesperadamente para liberarnos de las garras de la pandemia de COVID-19. Si sus trucos de relaciones públicas y filantropía logran convencer a las personas de que él es el salvador que han estado buscando, es probable que nos enfrentemos a un futuro de vigilancia de rastreo de contactos, certificados digitales para viajar, vacunas forzadas, seguimiento y restricciones de todo movimiento y cuarentenas forzadas.

Lo único que se interpone entre Gates y su agenda son los corazones y las mentes libres del mundo. Nuestro tiempo es corto. Debemos organizarnos, compartir esta información vital y #ExposeBillGates.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 3: Vigilancia de la salud, Evento 201 y la conexión Rockefeller (thelastamericanvagabond.com)

The Last American Vagabond

15,472 MUERTOS 1.5 Millones de heridos (50% GRAVES) reportados en la base de datos de la Unión Europea de reacciones adversas a medicamentos por vacunas contra COVID-19

por Brian Shilhavy

Editor, Health Impact News

La base de datos europea de informes de presuntas reacciones a fármacos es EudraVigilance, que también rastrea los informes de lesiones y muertes tras las «vacunas» experimentales de COVID-19.

Un suscriptor de Europa nos envió recientemente un correo electrónico y nos recordó que esta base de datos mantenida en EudraVigilance es solo para países de Europa que forman parte de la Unión Europea (UE), que comprende 27 países.

El número total de países de Europa es mucho mayor, casi el doble, y se trata de unos 50, aunque existen algunas diferencias de opinión sobre qué países forman parte técnicamente de Europa.

Así que por muy altas que sean estas cifras, NO reflejan toda Europa. El número real en Europa de muertos o heridos debido a las vacunas contra el COVID-19 sería mucho mayor que el que estamos reportando aquí.

La base de datos de EudraVigilance informa que hasta el 19 de junio de 2021 hay 15,472 muertes y 1,509,266 lesiones reportadas después de las inyecciones de cuatro vacunas experimentales de COVID-19:

Del total de heridos registrados, la mitad de ellos (753.657) son heridos graves.

«La gravedad proporciona información sobre el presunto efecto indeseable; se puede clasificar como ‘grave’ si corresponde a un incidente médico que resulta en la muerte,es potencialmente mortal, requiere hospitalización de pacientes hospitalizados, resulta en otra condición médicamente importante o prolongación de la hospitalización existente, resulta en una discapacidad o incapacidad persistente o significativa, o es una anomalía congénita / defecto congénito «.

Un suscriptor de Health Impact News en Europa publicó los informes de cada una de las cuatro vacunas de COVID-19 que estamos incluyendo aquí. Este suscriptor se ha ofrecido como voluntario para hacer esto, y es mucho trabajo tabular cada reacción con lesiones y muertes, ya que no hay lugar en el sistema EudraVigilance que hemos encontrado que tabula todos los resultados.

Desde que empezamos a publicar esto, otros de Europa también han calculado los números y confirmado los totales.*

Estos son los datos resumidos hasta el 19 de junio de 2021.

Reacciones totales para la vacuna experimental de ARNm Tozinameran (código BNT162b2,Comirnaty) de BioNTechPfizer: 7.420 muertes 560.256 lesiones hasta el 19/06/2021

  • 16.133 Trastornos de la sangre y del sistema linfático, incluidas 81 muertes
  • 12,637   Cardiac disorders incl. 964 deaths
  • 101 Trastornos congénitos, familiares y genéticos, incluidas 6 muertes
  • 7000 Trastornos del oído y del laberinto, incluidas 4 muertes
  • 265        Endocrine disorders incl. 1 death
  • 8.122 Trastornos oculares, incluidas 17 muertes
  • 51,030   Gastrointestinal disorders incl. 348 deaths
  • 155.486 Trastornos generales y condiciones del lugar de administración, incluidas 2.290 muertes
  • 468        Hepatobiliary disorders incl. 31 deaths
  • 6,110     Immune system disorders incl. 32 deaths
  • 17.549 Infecciones e infestaciones, incluidas 762 muertes
  • 6.275 Lesiones, envenenamiento y complicaciones procesales, incluidas 104 muertes
  • 13,249   Investigations incl. 285 deaths
  • 4.162 Trastornos del metabolismo y la nutrición, incluidas 139 muertes
  • 79.125 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 88 muertes
  • 325 Neoplasias benignas, malignas y no especificadas (incluidos quistes y pólipos) incl. 23 muertes
  • 100,895 Nervous system disorders incl. 780 deaths
  • 384 Embarazo, puerperio y afecciones perinatales, incluidas 10 muertes
  • 107        Product issues
  • 9,928     Psychiatric disorders incl. 105 deaths
  • 1.765 Trastornos renales y urinarios, incluidas 115 muertes
  • 2.696 Trastornos del aparato reproductor y mamarios, incluidas 3 muertes
  • 23.689 Trastornos respiratorios, torácicos y mediastínicos, incluidas 848 muertes
  • 26.641 Trastornos de la piel y del tejido subcutáneo, incluidas 66 muertes
  • 846        Social circumstances incl. 10 deaths
  • 281 Procedimientos quirúrgicos y médicos, incluidas 19 muertes
  • 14,987   Vascular disorders incl. 289 deaths

Reacciones totales para la vacuna experimental de ARNm mRNA-1273(CX-024414) de Moderna: 4.147 muertes y 122.643 heridos hasta el 19/06/2021

  • 2.239 Trastornos de la sangre y del sistema linfático, incluidas 29 muertes
  • 3,315     Cardiac disorders incl. 446 deaths
  • 39 Trastornos congénitos, familiares y genéticos, incluidas 3 muertes
  • 1,454     Ear and labyrinth disorders
  • 82           Endocrine disorders incl. 1 death
  • 1.883 Trastornos oculares, incluidas 7 muertes
  • 10.655 Trastornos gastrointestinales incl. 142 muertes
  • 33.936 Trastornos generales y condiciones del lugar de administración, incluidas 1.759 muertes
  • 209 Trastornos hepatobiliares incl. 11 muertes
  • 1.117 Trastornos del sistema inmunitario, incluidas 5 muertes
  • 3.835 Infecciones e infestaciones, incluidas 234 muertes
  • 2.480 Lesiones, envenenamiento y complicaciones procesales, incluidas 77 muertes
  • 2.670 Investigaciones, entre las que se supe 89 muertes
  • 1.297 Trastornos del metabolismo y la nutrición, incluidas 85 muertes
  • 15.131 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 77 muertes
  • 128 Neoplasias benignas, malignas y no especificadas (incluido. quistes y pólipos) incl. 15 muertes
  • 21.684 Trastornos del sistema nervioso, incluidas 424 muertes
  • 255 Embarazo, puerperio y afecciones perinatales, incluida la muerte por 2
  • 20 Problemas con el producto
  • 2.437 Trastornos psiquiátricos, incluidas 69 muertes
  • 807 Trastornos renales y urinarios, incluidas 52 muertes
  • 459 Trastornos del sistema reproductivo y de las mamas, incluida 1 muerte
  • 5.640 Trastornos respiratorios, torácicos y mediastínicos, incluidas 399 muertes
  • 6.538 Trastornos de la piel y del tejido subcutáneo, incluidas 28 muertes
  • 504 Circunstancias sociales, incluidas 13 muertes
  • 397 Procedimientos quirúrgicos y médicos, incluidas 38 muertes
  • 3.432 Trastornos vasculares incl. 141 muertes

Reacciones totales para la vacuna experimental AZD1222/VAXZEVRIA (CHADOX1 NCOV-19) de Oxford/ AstraZeneca3.364 muertes793.036 lesiones a 19/06/2021

  • 9.136 Trastornos de la sangre y del sistema linfático, incluidas 132 muertes
  • 12.135 Trastornos cardíacos incl. 396 muertes
  • 95 Trastornos congénitos, familiares y genéticos, incluidas 2 muertes
  • 8.797 Trastornos del oído y del laberinto
  • 309 Trastornos endocrinos incl. 2 muertes
  • 13.459 Trastornos oculares, incluidas 12 muertes
  • 81.806 Trastornos gastrointestinales incl. 161 muertes
  • 212.663 Trastornos generales y condiciones del lugar de administración, incluidas 891 muertes
  • 525 Trastornos hepatobiliares incl. 25 muertes
  • 3.085 Trastornos del sistema inmunitario, incluidas 11 muertes
  • 17.791 Infecciones e infestaciones, incluidas 217 muertes
  • 7.854 Lesiones, envenenamiento y complicaciones procesales, incluidas 77 muertes
  • 16.731 Investigaciones, entre las que se han fallecido 79
  • 9.765 Trastornos del metabolismo y la nutrición, incluidas 50 muertes
  • 123.637 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 45 muertes
  • 332 Neoplasias benignas, malignas y no especificadas (incluidos quistes y pólipos) incl. 8 muertes
  • 169.286 Trastornos del sistema nervioso, incluidas 532 muertes
  • 223 Embarazo, puerperio y afecciones perinatales, incluidas 4 muertes
  • 103 Problemas del producto
  • 14.931 Trastornos psiquiátricos, incluidas 27 muertes
  • 2.809 Trastornos renales y urinarios, incluidas 29 muertes
  • 5.967 Trastornos del sistema reproductivo y de la mama
  • 26.631 Trastornos respiratorios, torácicos y mediastínicos, incluidas 387 muertes
  • 36.457 Trastornos de la piel y del tejido subcutáneo, incluidas 22 muertes
  • 772 Circunstancias sociales, incluidas 4 muertes
  • 671 Procedimientos quirúrgicos y médicos, incluidas 16 muertes
  • 17.066 Trastornos vasculares incl. 235 muertes

Reacciones totales para la vacuna experimental covid-19 JANSSEN (AD26. COV2. S) de Johnson &Johnson541 muertes 33, 331 lesiones a 19/06/2021

  • 306 Trastornos de la sangre y del sistema linfático, incluidas 16 muertes
  • 496 Trastornos cardíacos incl. 56 muertes
  • 14 Trastornos congénitos, familiares y genéticos
  • 177 Trastornos del oído y del laberinto
  • 8 Trastornos endocrinos incluido. 1 muerte
  • 383 Trastornos oculares incl. 3 muertes
  • 3.086 Trastornos gastrointestinales incl. 23 muertes
  • 8.761 Trastornos generales y condiciones del lugar de administración, incluidas 137 muertes
  • 52 Trastornos hepatobiliares incl. 4 muertes
  • 85 Trastornos del sistema inmunitario
  • 392 Infecciones e infestaciones incl. 13 muertes
  • 320 Lesiones, envenenamiento y complicaciones del procedimiento, incluidas 8 muertes
  • 2.003 Investigaciones, entre las que se han fallecido 37
  • 184 Trastornos del metabolismo y la nutrición, incluidas 10 muertes
  • 5.718 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 17 muertes
  • 16 Neoplasias benignas, malignas y no especificadas (incluido. quistes y pólipos)
  • 7.093 Trastornos del sistema nervioso, incluidas 68 muertes
  • 9 Embarazo, puerperio y afecciones perinatales, incluida 1 muerte
  • 9             Product issues
  • 355 Trastornos psiquiátricos incl. 5 muertes
  • 119        Renal and urinary disorders incl. 8 deaths
  • 114 Trastornos del sistema reproductivo y de la mama
  • 1.130 Trastornos respiratorios, torácicos y mediastínicos, incluidas 43 muertes
  • 804 Trastornos de la piel y del tejido subcutáneo, incluidas 2 muertes
  • 72           Social circumstances incl. 3 deaths
  • 336 Procedimientos quirúrgicos y médicos, incluidas 26 muertes
  • 1,289     Vascular disorders incl. 60 deaths

*Estos totales son estimaciones basadas en informes presentados a EudraVigilance. Los totales pueden ser mucho más altos en función del porcentaje de reacciones adversas que se notifican. Algunos de estos informes también pueden ser reportados a las bases de datos de reacciones adversas de cada país, como la base de datos VAERS de los Estados Unidos y el sistema de tarjetas amarillas del Reino Unido. Las muertes se agrupan por síntomas, y algunas muertes pueden haber resultado de múltiples síntomas.

15,472 MUERTOS 1.5 Millones de heridos (50% GRAVES) reportados en la base de datos de la Unión Europea de reacciones adversas a medicamentos por vacunas contra COVID-19 (healthimpactnews.com)

La Dra. Nadiya Popel, atacada por el Estado por hablar de las vacunas

Esta señora puede tener razón o no tenerla, pero tiene derecho a expresar su opinión. El Centro médico si no esta de acuerdo debe sacar datos para demostrarlo. El no argumentar y castigar va contra el derecho de los ciudadanos a estar informados. Más transparencia y menos medidas disciplinarias!!

Dirigida a la Junta de Personal del Hospital Mateu Orfila, Menorca, islas Baleares

DENUNCIA

Yo, Nadiya Popel, con DNI XXXXXXXX, EA de Urgencias del Hospital Mateu Orfila en presencia de la Junta del Hospital, incluyendo los representantes sindicales, denuncio las graves irregularidades que están sucediendo en estos momentos en el Hospital y en toda el área de salud de Menorca.

Las irregularidades son:

1. Ocultación ante la población de los efectos secundarios de las vacunas experimentales anti Covid.

2. Ocultación del hecho que todas las vacunas son Experimentales, ensayo clínico en Fase III. Ensayo clínico que acaba en el año 2023.

3. Ocultación de los compuestos tóxicos en las vacunas como SM-102 cloroformo.

4. Ocultacion de que las vacunas anti COVID producen afectacion genética con rotura de ADN y cambios en el genoma humano.

5. Incumplimiento de 30 artículos del Codigo deontológico Médico.

6. Incumpimiento del Juramento Hipocrático.

7. No dar informacón sobre la imantación en zonas de la inyeccion de las vacunas anti COVID y por todo el cuerpo en los vacunados.

8. Incumplimiento del Código de Núremberg sobre a experimentación en los humanos.

9. No asignación de un médico y un enfermero que vaya a hacer segumiento de este ensayo clínico.

10. No realización del consentimiento informado antes del procedmiento/consentimiento informado incompleto.

11. No tomar responsabilidad ni hacer seguimento de las personas afectadas.

12. Politización de la medicina.


13. No atender a mis repetidos avisos del peligro de las vacunas anti COVID y no realizar una profunda investigación.

14. No convocar un debate científico sobre el tema ni asignar un equipo de investigación urgente.

15. Transgredir los derechos fundamentales de la constitución espanola de la libre expresión y manifestación.


16. Dar directrices incorrectas sobre el manejo de esta situación socio-sanitaria.

17. Transgredir la ley de protección de datos personales utilizandode teléfono personal de las personas para llamarles a su donicilos, sin que ellos lo hayan solicitado. Repetir las llamadas hasta 4 veces.

18. Ocultación de las muertes por las vacunas anti COVD.

19. No realización de las autopsias en personas fallecidas afectadas por la iatrogenia de las vacuna.

20. Incumplimiento del Convenio de Oviedo.


EXIJO:

1. Suspensión inmediata de la administracon de las vacunas anti COVID.

2. Restitución immediata de mi persona en el trabajo para que pueda formar parte de un comité científico de investigación y seguimiento de las personas afectadas.

3. Formación de un comité científico urgente sobre las vacunas anti COVID.

4. Urgente comunicación a la poblacion de la situación de IATROGENIA de las vacunas ANTI COVID.


5. Exposición de la información sobre los compuestos tóxicos de las vacuras anti COVID y mecanismo de acción.

6. Realización de las autopsias en los fallecidos sospechosos de IATROGENIA con ESPECIAL atención sobre el cerebro (si contiene nanopartículas).

7. La búsqueda urgente de la reversión y la neutralización de los efectos dañinos de las vacunas anti Covid.


8. Denuncia de las protocolos incorrectos.

9. Divulgación de la informacion a la población sobre las terapias génicas.

10. Divulgación de la información sobre el uso de nanopartículas en las vacunas anti Covid.

11. Divulgación sobre el contenido de grafeno en las vacunas anti Covid.

12. Pedir perdón a la población por olvidar los principios éticos de la medicina y elegir obediencia ciega a los intereses políticos.

Se adjunta la documentación mencionada en la denuncia.

En Mahon, a 1 de junio, 2021
Dra. Nadiya Popel.

Contra el encierro de la gente: Denuncia de la Dra. Nadiya Popel, hospital Mateu Orfila de Menorca

Contra el encierro de la gente: La Dra. Nadiya Popel, atacada por el Estado por hablar, contesta en una carta

Nadiya Popel denuncia la ocultación de efectos adversos de las vacunas (menorca.info)

Magníficas entrevistas en Cop225 y La Quinta Columna a Nadia Popel, la doctora expedientada en Baleares por denunciar las vacunas, escuchen sus palabras con atención – El Diestro

LA QUINTA COLUMNA

Médico de pueblo vs la gran farsa

DAVID CONTRA GOLIAT: MÉDICO CANADIENSE DENUNCIA QUE LAS «VACUNAS COVID» MATARON O INCAPACITARON A MIEMBROS DE SU COMUNIDAD

Charles Hoffe ha sido médico durante 28 años en la pequeña ciudad rural de Lytton en Columbia Británica, Canadá. La ciudad está compuesta por muchos grupos indígenas de las “Primeras Naciones”.

Cuando el Dr. Hoffe recibió 900 dosis de las inyecciones de COVID-19 experimentales de Moderna administró las dosis a través de la Clínica Médica Lytton a quienes las querían.

Eligió no inyectarse él mismo.

El Dr. Hoffe informa que el resultado de inyectar a 900 personas entre la comunidad indígena de las Primeras Naciones fue que dos personas sufrieron un shock anafiláctico, una persona murió y varias otras han sufrido lo que parecen ser discapacidades permanentes. Relata cómo una de sus pacientes siente tanto dolor ahora que prefiere la muerte a continuar una vida de sufrimiento.

Durante el «pico» de la supuesta pandemia, en 2020, nadie en la comunidad murió o quedó incapacitado.

El Dr. Hoffe informó estas reacciones adversas por correo electrónico al personal médico de su comunidad que fue responsable del lanzamiento de las vacunas Moderna, que incluía a farmacéuticos, enfermeras y médicos de su área, un total de aproximadamente 18 personas, dice.

Su correo electrónico expresó una gran preocupación por los efectos secundarios que estaba viendo, y preguntó si tal vez deberían pausar las inyecciones por un tiempo.

En 48 horas recibió una severa reprimenda de sus superiores de la Autoridad Sanitaria Interior acusándolo de causar “dudas por las vacunas” y que iban a denunciarlo al BC College of Physicians and Surgeons.

Le prohibieron formular ninguna crítica a las inyecciones de Moderna, emitiendo una orden de silencio en su contra al más puro estilo «La Inquisición contra Galileo».

El Dr. Hoffe explica que este es un método de intimidación que se está utilizando contra otros médicos que tienen demasiado miedo de hablar, porque el Colegio de Médicos y Cirujanos tiene una gran autoridad para cerrar las carreras de los médicos o multarlos fuertemente.

A medida que siguió viendo más lesiones la semana siguiente, su enojo contra la orden de silencio fue en aumento. Le dijeron que si tenía alguna inquietud sobre las inyecciones, debía comunicarse con el oficial médico de salud a cargo del despliegue de Moderna.

Lo hizo, pero cuando no recibió una respuesta, decidió escribir una carta abierta directamente a la Dra. Bonnie Henry, Oficial de Salud Provincial de Columbia Británica, en desafío directo a la «ley del silencio» que se le impuso, en los siguientes términos:

Dr. Charles D. Hoffe, BSc, MB, BCh, LMCC
Lytton Medical Clinic
Lytton BC V0K 1Z0

5 de abril de 2021

Dra. Bonnie Henry,
Oficial de Salud Provincial de Columbia Británica
Ministerio de Salud
1515 Blanchard Street
Victoria, BC, V8W 3C9


Estimada Dra. Henry

La primera dosis de la vacuna Moderna ha sido recientemente administrada a algunos de mis pacientes en la comunidad de Lytton, BC. Esto comenzó con los miembros de las Primeras Naciones de nuestra comunidad a mediados de enero de 2021. Ahora se han administrado 900 dosis.

Me ha alarmado bastante la alta tasa de efectos secundarios graves de este nuevo tratamiento. De este número relativamente pequeño de personas vacunadas hasta ahora, hemos tenido:

Numerosas reacciones alérgicas, con dos casos de anafilaxia.

Una vacuna (al parecer) indujo muerte súbita, (en un paciente de 72 años con EPOC. Este paciente se quejaba de tener dificultad para respirar después de recibir la vacuna, y murió repentina e inesperadamente el día 24, después de la vacuna. Carecía de antecedentes de enfermedad cardiovascular).

Tres personas con déficits neurológicos continuos e incapacitantes, con dolor crónico asociado, que persisten durante más de 10 semanas después de su primera vacuna. Estos déficits neurológicos incluyen: mareos continuos e incapacitantes, debilidad neuromuscular generalizada o localizada, con o sin pérdida sensorial. El dolor crónico en estos pacientes es generalizado o regional, con o sin cefalea.

En resumen, en nuestra pequeña comunidad de Lytton, BC, tenemos una persona muerta y tres personas que parecen estar permanentemente discapacitadas, luego de su primera dosis de la vacuna Moderna. La edad de los afectados oscila entre los 38 y los 82 años.

Entonces tengo un par de preguntas y comentarios:

¿Se consideran estos efectos secundarios normales y aceptables a largo plazo para la terapia de modificación genética? A juzgar por los informes médicos de todo el mundo, nuestra experiencia con Lytton no es inusual.

¿Tiene idea de qué procesos patológicos pueden haberse iniciado para producir estos síntomas neurológicos continuos?

¿Tiene alguna sugerencia sobre cómo debería tratar la debilidad neurológica inducida por la vacuna, los mareos, la pérdida sensorial y los síndromes de dolor crónico en estas personas, o deberían simplemente derivarlos a todos a un neurólogo? Anticipo que seguirán muchos más, a medida que se lance la vacuna. Esta fue solo la fase uno y la primera dosis.

En marcado contraste con los efectos nocivos de esta vacuna en nuestra comunidad, no hemos tenido que brindar ningún tipo de atención médica a nadie con Covid-19. Debemos deducir que, en nuestra limitada experiencia, esta vacuna resulta claramente más peligrosa que el Covid.

Me doy cuenta de que toda terapia médica tiene una relación riesgo-beneficio, y que las enfermedades graves requieren medicamentos serios. Pero ahora sabemos que la tasa de recuperación de Covid-19 es similar a la de la gripe estacional, en todas las categorías de edad. Además, es bien sabido que los efectos secundarios después de una segunda inyección son significativamente peores que los de la primera. Así que lo peor aún está por llegar.

Debe enfatizarse que estas personas no eran personas enfermas. Se trataba de personas previamente sanas a las que se les ofreció una terapia experimental, con efectos secundarios desconocidos a largo plazo, para protegerlas contra una enfermedad que tiene la misma tasa de mortalidad que la gripe. Lamentablemente, sus vidas ahora están arruinadas.

Normalmente se considera un principio fundamental de la ética médica interrumpir un ensayo clínico si se demuestra un daño significativo del tratamiento bajo investigación.

Entonces, mi última pregunta es la siguiente: ¿Es ético desde el punto de vista médico continuar con el lanzamiento de esta vacuna, en vista de la gravedad de estos efectos secundarios que alteran la vida solo después de la primera inyección? En Lytton, BC, tenemos una incidencia de 1 en 225 de efectos secundarios graves que alteran la vida, debido a esta terapia de modificación genética experimental.

También he notado que estos efectos secundarios inducidos por la vacuna casi no son reportados por los responsables de su lanzamiento. Soy consciente de que esto suele ser un problema, con las vacunas en general, y que los efectos secundarios retardados después de las vacunas a veces se etiquetan como “coincidencias”, ya que la causalidad a menudo es difícil de probar. Sin embargo, en vista del hecho de que se trata de un tratamiento experimental, sin datos de seguridad a largo plazo, creo que quizás este tema también debería ser abordado.

Además, he notado que el formulario provincial de notificación de lesiones por vacunas, que fue claramente diseñado para vacunas convencionales, ni siquiera tiene lugar para informar las lesiones por vacunas de la naturaleza y gravedad que estamos viendo en esta nueva terapia de ARNm.

Ahora es claramente evidente, con evidencia médica de todo el mundo, que los perfiles de efectos secundarios de las diversas terapias de modificación genética contra Covid-19 han sido muy subestimados por sus fabricantes, que estaban ansiosos por demostrar su seguridad.

Gracias por su atención a este asunto de salud pública críticamente urgente.

Suyo sinceramente,

Dr. Charles Hoffe

El IH (Interior Health) respondió a su carta públicamente con una réplica que fue publicada en el Ashcroft Cache Creek Journal en un claro intento por hacer un “control de daños” y atacar al Dr. Hoffe.

IH dice que las vacunas COVID-19 son seguras a pesar de las afirmaciones del médico de Lytton
El médico hace afirmaciones sin fundamento sobre los efectos secundarios graves de la vacuna Moderna
por BARBARA RODEN

Interior Health (IH) está tranquilizando a Lytton y a los residentes del área sobre la seguridad de las vacunas COVID-19, luego de que un médico de esa comunidad compartiera una carta en la que afirmaba que la muerte de un residente de Lytton estaba relacionada con la vacuna Moderna.

En una carta a la funcionaria provincial de salud, la Dra. Bonnie Henry, con fecha del 5 de abril, el Dr. Charles Hoffe afirmó que había habido “numerosas” reacciones alérgicas, incluidos dos casos de anafilaxia, entre las personas en Lytton y el área que habían recibido la vacuna Moderna. También afirmó que tres personas presentaban déficits neurológicos “continuos e incapacitantes”.

Hoffe también afirmó que “supone” que la muerte de un paciente de 72 años con EPOC, 24 días después de que el hombre fue vacunado, fue inducida por la vacuna. El médico no presentó ninguna prueba para demostrar que alguno de los eventos fuera el resultado de la vacuna.

“Ha sido un desafío para nosotros investigar esto a fondo y tomar los informes en serio”, dice la Dra. Carol Fenton, Oficial de Salud Médica de IH. En una declaración escrita emitida el 14 de abril, Fenton dice que “no ha habido muertes o reacciones adversas duraderas relacionadas con las vacunas Moderna/Pfizer, o cualquier vacuna COVID-19, en Lytton, Interior Health o BC en este momento”.

La declaración agrega que IH sabe inequívocamente que las vacunas son más seguras que el propio Covid-19, y que se ha demostrado que las vacunas son fiables y efectivas a través de todos los niveles de ensayos clínicos.

“Existe un proceso detallado para revisar todos los efectos adversos después de las vacunas, y todos los eventos graves se registran y se informan a nivel provincial y nacional para monitorear las señales de seguridad que pueden pasarse por alto a nivel local. Con la información que tenemos del lanzamiento de la vacuna hasta ahora, las vacunas Covid-19 son muy seguras “.

Fenton le dice al Journal que, si bien siempre habrá algunas variaciones entre los médicos, cuando se trata de la seguridad de las vacunas, es importante mirar los informes basados en el consenso de aquellos que están capacitados en el campo.

“Estas personas son los expertos de los expertos”, dice. “Puedo responder la mayoría de las preguntas sobre vacunas, pero no me considero un experto en vacunas. Las decisiones y los análisis los definen personas con las habilidades y la experiencia para analizar la información que tenemos”.

Las clínicas de inmunización administradas por IH cuentan con vacunadores capacitados en el lugar para monitorear y responder a reacciones alérgicas y anafilácticas, que son raras, pero que pueden ocurrir con cualquier vacuna o medicamento.

“La seguridad de las personas en Lytton, Nlaka’pamux, Northern St’at’imc Nations y todas las comunidades es la máxima prioridad, y nuestra recomendación es que todas las personas deben vacunarse cuando sean elegibles”, dice el comunicado.

Básicamente, lo mismo que estamos viendo en el resto del mundo cuando médicos honestos se presentan e informan la verdad.

Las autoridades sanitarias mienten. Sin ciencia, sin estadísticas, solo un llamamiento a la autoridad, un insultante “Sabemos de lo que estamos hablando, pero este médico no”.

El Dr. Hoffe ha servido a los miembros de su comunidad durante 28 años y tenía una reputación intachable entre sus pacientes, con excelentes reseñas en línea.

Ahora se informa en algunos sitios de redes sociales que a sus pacientes se les dice que ya no está disponible para reunirse con ellos.

(Fuente: Astillas de realidad: DAVID CONTRA GOLIAT: MÉDICO CANADIENSE DENUNCIA QUE LAS «VACUNAS COVID» MATARON O INCAPACITARON A MIEMBROS DE SU COMUNIDAD; https://healthimpactnews.com/; traducido por https://ejercitoremanente.com/)

¿Podrían las vacunas contra el ARNm alterar permanentemente el ADN? La ciencia reciente sugiere que podrían.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might.

Por Equipo de Defensa de la Salud Infantil

La investigación sobre el ARN SARS-CoV-2 realizada por científicos de Harvard y el MIT tiene implicaciones sobre cómo las vacunas contra el ARNM podrían alterar permanentemente el ADN genómico, según Doug Corrigan, Ph.D., un biólogo bioquímico-molecular que dice que se necesita más investigación.

Durante el año pasado, sería casi imposible para los estadounidenses no darse cuenta de la decisión de los medios de comunicación de hacer de las vacunas la narrativa dominante de COVID, apresurada a hacerlo incluso antes de que ocurrieran muertes atribuidas al coronavirus.

La cobertura inclinada de los medios de comunicación ha proporcionado un impulso particularmente fructífero de las relaciones públicas para las vacunas con ARN mensajero (ARNM), décadas en desarrollo pero nunca aprobadas para uso humano, ayudando a acercar la tecnología experimental a la línea de meta regulatoria.

En circunstancias ordinarias, el cuerpo produce («transcribes») ARNm a partir del ADN en el núcleo de una célula. A continuación, el ARNM viaja fuera del núcleo hacia el citoplasma, donde proporciona instrucciones sobre qué proteínas hacer.

En comparación, las vacunas contra el ARNM envían su carga útil de ARNm sintetizada químicamente (incluida con instrucciones de fabricación de proteínas de pico) directamente al citoplasma.

Según los Centros para el Control y la Prevención de Enfermedades (CDC) y la mayoría de los científicos de vacunas contra el ARNM, el dinero se detiene allí: las vacunas contra el ARNM «no afectan ni interactúan con nuestro ADN de ninguna manera», dicen los CDC. Los CDC afirman primero que el ARNM no puede entrar en el núcleo de la célula (donde reside el ADN), y segundo, que la célula , al estilo Misión Imposible, «se deshace del ARNm poco después de que termine de usar las instrucciones».

Una preimpresión de diciembre sobre el SARS-CoV-2, por científicos del Instituto Tecnológico de Harvard y Massachusetts (MIT), produjo hallazgos sobre coronavirus salvajes que plantean preguntas sobre cómo funciona el ARN viral.

Los científicos llevaron a cabo el análisis porque estaban «perplejos por el hecho de que hay un número respetable de personas que están dio positivo para COVID-19 por PCR mucho después de que la infección se había ido».

Sus hallazgos clave fueron los siguientes: los RNAs SARS-CoV-2 «pueden ser transcritos inversamente en células humanas», «estas secuencias de ADN se pueden integrar en el genoma celular y posteriormente ser transcritas» (un fenómeno llamado «integración retro») y hay vías celulares viables para explicar cómo sucede esto.

Según el doctor en bioquímica y biólogo molecular Dr. Doug Corrigan,estos importantes hallazgos (que van en contra del «dogma biológico actual») pertenecen a la categoría de «Cosas que estábamos absolutamente e inequívocamente seguros de que no podían suceder lo que realmente sucedió».

Los hallazgos de los investigadores de Harvard y el MIT también pusieron las suposiciones de los CDC sobre las vacunas contra el ARNM en terreno más inestable, según Corrigan. De hecho, un mes antes de que apareciera la preimpresión Harvard-MIT, Corrigan ya había escrito un blog en el que se esbozaban posibles mecanismos y vías por las que las vacunas contra el ARNM podían producir el fenómeno idéntico.

En una segunda entrada de blog, escrita después de que la preimpresión salió a la bolsa, Corrigan enfatizó que los hallazgos de Harvard-MIT sobre el ARN coronavirus tienen implicaciones importantes para las vacunas contra el ARNM, un hecho que describe como «el gran elefante en la habitación». Aunque no afirma que el ARN de la vacuna necesariamente se comportará de la misma manera que el ARN coronavirus , es decir, alterando permanentemente el ADN genómico, Corrigan cree que la posibilidad existe y merece un escrutinio estrecho.

En opinión de Corrigan, la contribución de la preimpresión es que «valida que esto es al menos plausible, y muy probablemente probable».

transcripción inversa

Como la frase «transcripción inversa» implica, la vía de ADN a ARNm no siempre es una calle de un solo sentido. Las enzimas llamadas transcriptasas inversas también pueden convertir el ARN en ADN, permitiendo que esta última se integre en el ADN en el núcleo celular.

Tampoco es poco frecuente la transcripción inversa. Los genetistas informan que «más del 40% de los genomas de mamíferos comprenden los productos de la transcripción inversa».

La evidencia preliminar citada por los investigadores de Harvard-MIT indica que las enzimas transcriptasa inversas endógenas pueden facilitar la transcripción inversa de los ANR coronavirus y desencadenar su integración en el genoma humano.

Los autores sugieren que si bien las consecuencias clínicas requieren más estudio, los efectos perjudiciales son una posibilidad distinta y, dependiendo de los «sitios de inserción en el genoma humano» de los fragmentos virales integrados y del estado de salud subyacente de un individuo, podrían incluir «una respuesta inmune más grave … como una ‘tormenta de citoquinas’ o reacciones autoinmunes».

En 2012, un estudio sugirió que la integración del genoma viral podría «conducir a consecuencias drásticas para la célula huésped, incluyendo la alteración genética, la mutagénesis insertal y la muerte celular».

Corrigan hace un punto de decir que las vías hipotizadas para facilitar la retro-integración del ARN viral – o vacuna – en el ADN «no son desconocidas para las personas que entienden la biología molecular a un nivel más profundo».

Aun así, la discusión de la preimpresión sobre la transcripción inversa y la integración del genoma provocó una vorágine de comentarios negativos de lectores reacios a repensar el dogma biológico, algunos de los cuales incluso abogaron por la retractación (aunque las preimpresiones son, por definición, inéditas) con el argumento de que «teóricos de la conspiración … llevará este documento a la «prueba» de que las vacunas contra el ARNM pueden, de hecho, alterar su código genético».

Los lectores más reflexivos estuvieron de acuerdo con Corrigan en que el documento plantea preguntas importantes. Por ejemplo, un lector declaró que falta evidencia confirmatoria «para mostrar que la proteína de pico sólo se expresa por un corto período de tiempo (digamos 1-3 días) después de la vacunación», y agregó: «Creemos que este es el caso, pero no hay evidencia para eso».

De hecho, el tiempo que el ARNm sintético de las vacunas —y por lo tanto las instrucciones para que las células sigan fabricando proteína de espiga— persisten dentro de las células es una pregunta abierta.

Normalmente, el ARN es una molécula «notoriamente frágil» e inestable. Según los científicos, «esta fragilidad es cierta en el ARNm de cualquier ser vivo, ya sea que pertenezca a una planta, bacterias, virus o humanos».

Pero el ARN sintético en las vacunas COVID es una historia diferente. De hecho, el paso que finalmente permitió a los científicos y fabricantes de vacunas resolver su impasse de la vacuna contra el ARNM de décadas fue cuando descubrieron cómo modificar químicamente el ARNM para aumentar su estabilidad y longevidad, es decir, producir ARN «que se queda en la célula mucho más tiempo que el ARN viral, o incluso arneses que nuestra célula normalmente produce para la producción normal de proteínas».

Nadie sabe lo que está haciendo el ARNm sintético mientras está «dando vueltas», pero Corrigan especula que su mayor longevidad aumenta la probabilidad de que «se convierta en ADN».

Además, debido a que el ARNM de la vacuna también está diseñado para ser más eficiente al traducirse en proteínas, «los efectos negativos podrían ser más frecuentes y más pronunciados con la vacuna en comparación con el virus natural».

Señales de dólar

Corrigan reconoce que algunas personas pueden rechazar sus advertencias, diciendo: «Si el virus es capaz de lograr esto, entonces ¿por qué debería importarme si la vacuna hace lo mismo?»

Tiene una respuesta lista y convincente:

«Hay una gran diferencia entre el escenario en el que las personas al azar, y sin darse cuenta, tienen su genética en mono porque estaban expuestas al coronavirus, y el escenario en el que vacunamos deliberadamente a miles de millones de personas mientras les decimos que esto no está sucediendo».

Lamentablemente, la actitud predominante parece ser que la «carrera para vacunar al público» justifica la asunción de estos riesgos adicionales.

A mediados de noviembre, después de que el Jerusalem Post dijera a los lectores que «cuando el mundo comience a inocularse con estas vacunas completamente nuevas y revolucionarias, no sabrá prácticamente nada sobre sus efectos a largo plazo», un director de hospital israelí argumentó que no vale la pena esperar dos años más para eliminar los «riesgos únicos y desconocidos» o los posibles efectos a largo plazo de las vacunas contra el ARNM.

En los Estados Unidos, el entusiasmo por la tecnología de ARNm es igualmente sin restricciones. Apenas unos días después de que los CDC publicaran datos actualizados que mostraban que más de 2.200 muertes de personas que habían recibido las vacunas contra el ARNm Pfizer o Moderna habían sido reportadas a partir del 26 de marzo, The Atlantic elogió la tecnología, sugiriendo que la «ingeniosa» tecnología sintética de ARNM detrás de las vacunas COVID de Pfizer y Moderna representaba un «avance» que podría «cambiar el mundo».

En lugar de descartar la perspectiva de la integración retro del ADN extranjero como una «teoría de la conspiración», los científicos deberían estar llevando a cabo estudios con el ARNm vacunado para evaluar los riesgos reales.

Por ejemplo, Corrigan cree que si bien los datos in vitro en líneas celulares humanas (una de las fuentes de datos examinadas por los investigadores de Harvard-MIT) ofrecen resultados «herméticos», todavía hay una necesidad de demostrar concluyentemente la alteración genómica de la vida real a través de «PCR, secuenciación de ADN o Blot del Sur … ADN genómico purificado de pacientes con COVID-19″ y individuos vacunados.

Sin embargo, en lugar de abordar estas brechas de investigación, las empresas están salivando sobre el potencial de utilizar el ARNm editado por humanos para «comandar nuestra maquinaria celular» y «hacer casi cualquier proteína bajo el sol».

Un comunicado de prensa del 10 de marzo en el que se pronunciaban las vacunas contra el ARNM, los claros ganadores de la carrera vacunal COVID-19 señalaron que todas las principales compañías farmacéuticas están ahora «probando la tecnología [mRNA] mediante la celebración de acuerdos de licencia y/o colaboración con empresas de ARN bien establecidas».

En viejos dibujos animados de Disney, los espectadores a menudo presenciaban al tío rico del Pato Donald, Scrooge McDuck, «ojos abultados [se convierten] en signos de dólares de máquinas tragamonedas de Las Vegas de gran tamaño» al contemplar oportunidades para aumentar su ya inmensa riqueza.

A juzgar por la disposición de los ejecutivos de las compañías farmacéuticas a pasar por alto los riesgos a largo plazo y posiblemente multigeneracionales de las vacunas contra el ARNM, deben estar igualmente atraídos por visiones de signo de dólar de una interminable cartera de productos de ARNm «plug and play».

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might. • Children’s Health Defense

Ex vicepresidente de Pfizer: ‘Totalmente posible, esto se utilizará para la despoblación a gran escala’

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’

por Mordechai Sones

Los Médicos de Primera Línea de Estados Unidos (AFLDS) hablaron con el ex Vicepresidente y Director científico de Pfizer, Dr. Mike Yeadon, sobre sus puntos de vista sobre la vacuna COVID-19, hidroxicloroquina e ivermectina, las autoridades reguladoras y más.

Al principio, el Dr. Yeadon dijo: «Soy muy consciente de los crímenes globales contra la humanidad perpetrados contra una gran proporción de la población mundial.

«Siento un gran miedo, pero no me disuaden de dar testimonio de expertos a múltiples grupos de abogados capaces como Rocco Galati en Canadá y Reiner Fuellmich en Alemania.

«No tengo ninguna duda de que estamos en presencia del mal (no una determinación que he tomado antes en una carrera de investigación de 40 años) y productos peligrosos.

«En el Reino Unido, está muy claro que las autoridades están empeñadas en un curso que dará lugar a la administración de ‘vacunas’ a tanta población como puedan. Esto es una locura, porque incluso si estos agentes fueran legítimos, la protección sólo es necesaria por aquellos con un riesgo notablemente elevado de muerte por el virus. En esas personas, incluso podría haber un argumento de que vale la pena asumir los riesgos. Y definitivamente hay riesgos que son lo que yo llamo «mecanicista»: incorporado en la forma en que funcionan.

«Pero todas las demás personas, las que están en buen estado de salud y menores de 60 años, tal vez un poco mayores, no perecen por el virus. En este gran grupo, es totalmente poco ético administrar algo novedoso y para el que el potencial de efectos no deseados después de unos meses es completamente poco característico.

«En ninguna otra época sería prudente hacer lo que se dice como la intención.

«Como lo sé con certeza, y sé que los que lo conducen también lo saben, tenemos que preguntar: ¿Cuál es su motivo?

«Aunque no lo sé, tengo respuestas teóricas fuertes, sólo una de las cuales se relaciona con el dinero y ese motivo no funciona, porque el mismo cuántico se puede llegar duplicando el costo unitario y dando el agente a la mitad de la gente. Dilema resuelto. Así que es otra cosa.
Apreciando que, por toda la población, también se pretende que los niños menores y eventualmente los bebés sean incluidos en la red, y eso es lo que interpreto como un acto malvado.

«No hay ninguna razón médica para ello. Sabiendo como lo hago que el diseño de estas «vacunas» resulta, en la expresión en los cuerpos de los receptores, la expresión de la proteína de pico, que tiene efectos biológicos adversos propios que, en algunas personas, son perjudiciales (iniciar la coagulación de la sangre y activar el ‘sistema de complemento’ inmune), estoy decidido a señalar que aquellos que no están en riesgo de este virus no deben estar expuestos al riesgo de efectos no deseados de estos agentes.»

AFLDS: La decisión de la Corte Suprema de Israel la semana pasada de cancelar las restricciones de vuelo covid dijo: «En el futuro, cualquier nueva restricción a los viajes hacia o fuera de Israel necesita, en términos legales, una base integral, fáctica y basada en datos».

En una charla que dio hace cuatro meses, dijiste

«La duración más probable de la inmunidad a un virus respiratorio como el SARS CoV-2 es de varios años. ¿Por qué digo eso? En realidad tenemos los datos de un virus que arrasó partes del mundo hace diecisiete años llamado SARS, y recordamos que el SARS CoV-2 es un 80% similar al SRAS, así que creo que esa es la mejor comparación que cualquiera puede proporcionar.

«La evidencia es clara: estos inmunólogos celulares muy inteligentes estudiaron a todas las personas que podían conseguir que habían sobrevivido al SRAS hace 17 años. Tomaron una muestra de sangre, y analizaron si respondieron o no al SRAS original y todos lo hicieron; todos tenían una memoria celular T perfectamente normal y robusta. En realidad también estaban protegidos contra el SARS CoV-2, porque son muy similares; es inmunidad cruzada.

«Por lo tanto, yo diría que los mejores datos que existen es que la inmunidad debe ser robusta durante al menos 17 años. Creo que es totalmente posible que sea de por vida. El estilo de las respuestas de las células T de estas personas era el mismo que si te hubieran vacunado y luego vuelves años más tarde para ver si esa inmunidad se ha conservado. Así que creo que la evidencia es realmente fuerte de que la duración de la inmunidad será de varios años, y posiblemente de por vida.«

En otras palabras, la exposición previa al SRAS – es decir, una variante similar al SARS CoV-2 – otorgó inmunidad al SARS CoV-2.

El gobierno de Israel cita nuevas variantes para justificar bloqueos, cierres de vuelos, restricciones y emisión de pasaportes verdes. Dado el veredicto de la Corte Suprema, ¿cree que es posible adelantar futuras medidas gubernamentales con información precisa sobre variantes, inmunidad, inmunidad de rebaño, etc. que podrían proporcionarse a los abogados que impugnarán esas medidas futuras?

Yeadon: «Lo que delineé en relación con la inmunidad al SRAS es precisamente lo que estamos viendo con el SARS-CoV-2.
El estudio es de uno de los mejores laboratorios en su campo.

«Por lo tanto, teóricamente, las personas podrían probar su inmunidad de células T midiendo las respuestas de las células en una pequeña muestra de su sangre. Hay tales pruebas, no son de «alto rendimiento» y es probable que cueste unos pocos cientos de USD cada una en escala. Pero no miles. La prueba que conozco aún no está disponible comercialmente, pero la investigación sólo en el Reino Unido.

«Sin embargo, espero que la compañía pueda ser inducida a proporcionar kits de prueba «para la investigación» a escala, sujeto a un acuerdo. Si usted fuera a organizar para probar unos pocos miles de israelíes no vacunados, puede ser una espada de doble filo. Según otras experiencias de los países, el 30-50% de las personas tenían inmunidad previa y además alrededor del 25% han sido infectadas y ahora son inmunes.

«Personalmente, no me gustaría tratar con las autoridades en sus propios términos: que se sospecha que usted es una fuente de infección hasta que se demuestre lo contrario. No deberías estar demostrando que no eres un riesgo para la salud de los demás. Aquellos sin síntomas nunca son una amenaza para la salud de los demás. Y en cualquier caso, una vez que los que están preocupados por el virus son vacunados, simplemente no hay argumentos para que nadie más necesite ser vacunado».

Mi comprensión de una «vacuna con fugas» es que sólo disminuye los síntomas en los vacunados, pero no detiene la transmisión; por lo tanto, permite la propagación de lo que luego se convierte en un virus más mortal.

Por ejemplo, en China utilizan deliberadamente vacunas con fugas contra la gripe aviar para sacrificar rápidamente bandadas de pollo, porque los no vacunados mueren en un plazo de tres días. En la enfermedad de Marek, de la que necesitaban salvar a todos los pollos, la única solución era vacunar al 100% del rebaño, porque todos los no vacunados tenían un alto riesgo de muerte. Así que cómo se utiliza un vax con fugas es impulsado por la intención, es decir, es posible que la intención puede ser causar un gran daño a los no vacunados.

Por lo general, las cepas más fuertes no se propagan a través de una población porque matan al huésped demasiado rápido, pero si los vacunados experimentan sólo una enfermedad menos grave, entonces propagan estas cepas a los no vacunados que contraen enfermedades graves y mueren.

¿Está de acuerdo con esta evaluación? Además, ¿está de acuerdo en que si los no vacunados se convierten en los susceptibles, la única manera de avanzar es la profilaxis HCQ para aquellos que aún no han tenido COVID-19?

¿Funcionaría el Protocolo Zelenko contra estas cepas más fuertes si este es el caso?

Y si muchos ya tienen la mencionada «inmunidad sars de 17 años», ¿no protegería eso de ninguna súper variante?

«Creo que la historia de Gerrt Vanden Bossche es altamente sospechosa. No hay ninguna evidencia de que la vacunación esté liderando o conduzca a «variantes peligrosas». Me preocupa que sea una especie de truco.

«Como regla general, las variantes se forman muy a menudo, rutinariamente, y tienden a volverse menos peligrosas y más infecciosas con el tiempo, a medida que entra en equilibrio con su huésped humano. Las variantes generalmente no se vuelven más peligrosas.

«Ninguna variante difiere de la secuencia original en más de un 0,3%. En otras palabras, todas las variantes son al menos un 99,7% idénticas a la secuencia wuhan.

«Es una ficción, y una malvada en eso, que las variantes son probables para «escapar de la inmunidad».

«No sólo es intrínsecamente improbable – porque este grado de similitud de variantes significa cero posibilidades de que una persona inmune (ya sea de infección natural o de vacunación) se enferme por una variante – sino que está empíricamente apoyada por investigaciones de alta calidad.

«La investigación a la que me refiero muestra que las personas que se recuperan de una infección o que han sido vacunadas todos tienen una amplia gama de células inmunes que reconocen TODAS las variantes.

«Este trabajo muestra POR QUÉ el amplio reconocimiento molecular por parte del sistema inmune hace que los pequeños cambios en las variantes sean irrelevantes.

«No puedo decir lo suficiente: Las historias en torno a las variantes y la necesidad de recargar las vacunas son FALSAS. Me preocupa que haya una razón muy maligna detrás de todo esto. Ciertamente no está respaldado por las mejores maneras de mirar la inmunidad. Las afirmaciones siempre carecen de sustancia cuando se examinan, y utilizan varios trucos, como la manipulación de condiciones para probar la eficacia de los anticuerpos. Los anticuerpos probablemente no tienen importancia en la protección del huésped contra este virus. Ha habido algunos «experimentos naturales», personas que desafortunadamente no pueden fabricar anticuerpos, pero son capaces con bastante éxito de repeler este virus. Definitivamente están mejor con anticuerpos que sin ellos. Menciono a estos pacientes raros porque muestran que los anticuerpos no son esenciales para albergar inmunidad, por lo que algunas pruebas inventadas en un laboratorio de anticuerpos y virus variantes diseñados NO justifican la necesidad de recargar las vacunas.

«Las únicas personas que pueden seguir siendo vulnerables y necesitan profilaxis o tratamiento son las personas mayores y/o enfermas y no desean recibir una vacuna (como es su derecho).

«La buena noticia es que hay múltiples opciones disponibles: hidroxicloroquina, ivermectina, budesonida (esteroide inhalado utilizado en asmáticos), y por supuesto vitamina D oral, zinc, azitromicina, etc. Estos reducen la gravedad hasta tal punto que este virus no necesitaba convertirse en una crisis de salud pública».

¿Siente que la FDA hace un buen trabajo regulando las grandes farmacéuticas? ¿De qué manera se sortean las grandes farmacéuticas alrededor del regulador? ¿Siente que lo hicieron por la inyección de ARNM?

«Hasta hace poco, tenía un gran respeto por los reguladores mundiales de medicamentos. Cuando estaba en Pfizer, y más tarde CEO de una biotecnología que fundé (Ziarco, más tarde adquirida por Novartis), interactuamos respetuosamente con la FDA, la EMA y la MHRA del Reino Unido.
Siempre interacciones de buena calidad.

«Recientemente, me di cuenta de que la Fundación Bill & Melinda Gates (BMGF) había hecho una subvención a la Agencia Reguladora de Medicamentos y Productos Sanitarios (MHRA)! ¿Puede ser apropiado? Están financiados con dinero público. Nunca deben aceptar dinero de un organismo privado.

«Así que aquí hay un ejemplo donde el regulador del Reino Unido tiene un conflicto de intereses.

«La Agencia Europea de Medicamentos no requirió ciertas cosas como se revela en el ‘hackeo’ de sus archivos durante la revisión de la vacuna Pfizer.

«Puedes encontrar ejemplos en el «Comité Corona» de Reiner Fuellmich en línea.

«Así que ya no creo que los reguladores sean capaces de protegernos. Por lo tanto, la «aprobación» no tiene sentido.

«El Dr. Wolfgang Wodarg y yo solicitamos a la EMA el 1 de diciembre de 2020 sobre las vacunas genéticas. Nos ignoraron.

«Recientemente, les escribimos en privado, advirtiendo de coágulos de sangre, nos ignoraron. Cuando hicimos pública nuestra carta, fuimos completamente censurados. Días después, más de diez países detuvieron el uso de una vacuna citando coágulos sanguíneos.

«Creo que el gran dinero de las farmacéuticas más el efectivo de BMGF crea el entorno donde decir que no simplemente no es una opción para el regulador.

«Debo volver al tema de las ‘vacunas de recarga’ (inyecciones de refuerzo) y es toda esta narrativa la que me temo que explotará y utilizó para ganar un poder sin precedentes sobre nosotros.

«Por favor, advierta a cada persona que no se acerque a las vacunas de recarga. No hay absolutamente ninguna necesidad de ellos.

«Como no hay necesidad de ellos, sin embargo, se están haciendo en las farmacéuticas, y los reguladores se han mantenido a un lado (sin pruebas de seguridad), sólo puedo deducir que se utilizarán con fines nefastos.

«Por ejemplo, si alguien quisiera dañar o matar a una proporción significativa de la población mundial en los próximos años, los sistemas que se están poniendo en marcha en este momento lo permitirán.

«Mi opinión es que es totalmente posible que esto se utilice para la despoblación a gran escala».

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’ – America’s Frontline Doctors

ISRAEL se enfrenta a LA HAYA por el ‘HOLOCAUSTO’ de VACUNAS

por Jules Gomes  Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

TEL AVIV, Israel (ChurchMilitant.com) – La Corte Penal Internacional (CPI) está considerando una investigación sobre las violaciones «flagrantes y extremas» del Código de Nuremberg por parte de Israel después de que los objetores de conciencia judía del obligatorio régimen de vacunación COVID-19 de la nación demandaron al gobierno por «crímenes de lesa humanidad».

Image
Sillas en la playa de Tel Aviv: Israel presenta el ‘apartheid médico’

La beca Anshe Ha-Emet (Pueblo de la Verdad), integrada por médicos, abogados, activistas y ciudadanos preocupados israelíes, se quejó ante el fiscal de la CPI en La Haya, acusando al gobierno de llevar a cabo un «experimento médico» nacional sin antes buscar «consentimiento informado».

«Cuando los jefes del Ministerio de Salud, así como el primer ministro presentaron la vacuna en Israel y comenzaron la vacunación de los residentes israelíes, no se informó a los vacunados, que, en la práctica, están participando en un experimento médico y que su consentimiento es necesario para ello bajo el Código de Núremberg», dice la demanda de Anshe Ha-Emet.

La firma A. Suchovolsky & Co. Law, con sede en Tel Aviv, sostiene que el acuerdo del primer ministro Benjamin Netanyahu con Pfizer y la propia admisión de Netanyahu dejan claro que la campaña de vacunación contra la velocidad warp de Israel «es de hecho un experimento médico y que esta fue la esencia del acuerdo».

Netanyahu contrató con Pfizer para recibir «una enorme cantidad de millones de porciones de vacunas» a cambio de dar a la compañía información médica secreta y personal sobre personas «sin su conocimiento o consentimiento de antemano», alega Anshe Ha-Emet.A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana. Tweet

Al etiquetar la inoculación del virus de China como «un tratamiento médico innovador» que introduce un «ARNm sintético al cuerpo» (la vacuna ha obtenido recientemente la aprobación de la FDA en los Estados Unidos , una aprobación que no es definitiva y se obtuvo únicamente en un procedimiento de emergencia) y que detalla 22 efectos secundarios de la vacuna, la queja señala que la «influencia de largo alcance del tratamiento» no se prueba científicamente y se desconoce el «efecto de largo alcance y la seguridad del tratamiento en sus receptores».

«El Código de Núremberg, escrito después de que los médicos nazis fueran juzgados por realizar sus experimentos médicos con prisioneros de campos de concentración, estipula que es profundamente poco ético obligar o coaccionar a una persona para que participe en experimentos médicos», dijo la antropóloga judía Karen Harradine a Church Militant. https://rumble.com/embed/vc4ebl/?pub=b62dwIlana Rachel Daniel detalla el apartheid médico que envuelve a Israel


«Estableciendo directrices para la experimentación médica, el código dice: ‘El consentimiento voluntario del sujeto humano es absolutamente esencial'», explicó Harradine.

El ceo de Pfizer, Albert Bourla, provocó indignación cuando llamó a Israel el «laboratorio mundial» para la vacuna experimental Pfizer-BioNTech durante una entrevista con NBC News en febrero.Así es como se ve un Holocausto en 2021. Tweet

Bourla ahora dice que se arrepiente de haber usado la frase «laboratorio del mundo» cuando se refiere a Israel, aunque no se arrepiente de haber elegido a Israel como un caso de estudio para examinar la eficacia del jab.

Bourla se vio obligado a cancelar su visita a Israel en marzo después de que se supo que no había sido completamente vacunado usando la segunda inyección de la propia vacuna de su empresa porque no quiere «cortar en línea».

Image
Ruth Machnes Suchovolsky representando a Anshe Ha-Emet

Mark P. Dillon, jefe de la Oficina de la Unidad de Información y Pruebas de la CPI, reconoció haber recibido la demanda el 13 de marzo, señalando que sería tratada de acuerdo con «las disposiciones del Estatuto de Roma de la CPI».

Sin embargo, la carta de Dillon aclaró que la carta de reconocimiento no significa que «se haya abierto una investigación; niserá abierto por la Fiscalía.»

«La denuncia por violación del Código de Núremberg ha sido aceptada y la Corte Penal Internacional de La Haya está sentada en el banquillo. … Seguiremos actualizándonos», escribió ruth Machnes Suchovolsky, abogada que representa a Anshe Ha-Emet, en las redes sociales.

En una entrevista con el poeta y autor franco-canadiense Guy Boulianne, Suchovolsky describió la dictadura médica de Israel:

Es terrible lo que está pasando aquí. La gente se enferma de parálisis. Y los medios lo esconden. Es una verdadera matanza. Una mujer de 34 años, madre de cuatro hijos, no puede mover la mitad de su cuerpo. Está en silla de ruedas. Vacunaron indiscriminadamente al 81% del ejército israelí. No tenemos elección sobre qué tipo de mundo vamos a experimentar para nuestros hijos. Tenemos que luchar.

Mientras tanto, en un artículo de blog titulado «31 Reasons Why I Won’t Take the Vaccine», el rabino Chananya Weissman llamó a los jabs del virus de China «el mayor experimento médico en la historia de la raza humana».

«A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado», escribió Weissman.

El rabino ortodoxo, autor de siete libros y columnista de The Times of Israel, explicó:

Si estuvieran al frente con las masas, muy pocos estarían de acuerdo en participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.

Las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados; el establecimiento médico los está dejando de lado como no relacionados o insignificantes; los medios de comunicación lo están ignorando; las compañías farmacéuticas avanzan a toda velocidad y los que levantan una bandera roja siguen siendo intimidados, censurados y castigados. … No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima «coincidencia».

Ilana Rachel Daniel, asesora sanitaria del nuevo Partido Rapeh de Israel , que disputa las próximas elecciones en la plataforma de libertad de encierros y vacunación forzada, también ha protestado contra el pasaporte vacunal de Israel en una serie de entrevistas.

Image
La Corte Penal Internacional de La Haya

«Están haciendo este pasaporte verde donde la mitad de la población no puede entrar en teatros o centros comerciales o todo tipo de cosas a menos que haya tomado la vacuna. Están creando un apartheid médico», dijo Daniel.

«Así es como se ve un Holocausto en 2021», le dijo Daniel al periodista inglés James Delingpole. «Es terrible. Es una situación muy, muy, muy aterradora. No están dejando que niños de tan solo 16 años tomen sus exámenes de matriculación sin tomar esta inyección».

El israelí Gilad Rosinger, de Radiant Israel, describió el sistema de pasaportes verdes como una «agenda previa al holocausto».

«Si no te sometes a esta agenda malvada, demoníaca y tiránica; si decides decir: ‘sabes qué, no estoy listo para participar en este programa experimental’, entonces ahora eres considerado un ciudadano de segunda clase en Israel», lamentó Rosinger, nieto de un sobreviviente del Holocausto.

Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

«Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas».

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: «¿Esta vacuna alterará permanentemente mi ADN?» La segunda pregunta es: «Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?»

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína «Spike». Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está «vacunado» porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es «neutralizado» y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser «transcrito» en el ADN. En nuestras células se encuentran enzimas llamadas «transcriptasas inversas». Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados «retrovirus». El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las «reglas» se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas «reglas» que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral «bare» es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como «yo» en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> «Es una vacuna contra el coronavirus una bomba de tiempo de marca.»

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta «clase de parásitos» ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.»

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.»

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.»

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de «información de secuencia» porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible «aislar» un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos «infectaron» varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.»

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este «virus» secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

«No observamos ninguna liberación del virus del lado basolateral de la cultura HAE».

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de «origen desconocido».

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.»

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba «ahí». Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

«Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas»

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.»

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado».

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.»

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.»

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.»

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del «virus». Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, «esta afirmación sugiere que cada prueba debe ser positiva», (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

«Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.»

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada «basura», ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

«Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.»

La definición legal de una conspiración es:

«Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo»

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada «nueva normalidad», que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos «esperando en las alas» en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.