El Dr. Hoffe habla sobre los coágulos y trombos en gente vacunada

Dr. Hoffe: “En el 62% de los vacunados hay evidencias de coágulos”

Ha usado la prueba del Dímero D en sus pacientes. El 62% de ellos sufre de estos coágulos, que pueden ser algo gravísimo, porque normalmente afectarán a muchos tejidos que no puede regenerarse más.

https://www.bitchute.com/embed/ChQwQBggc8TL/ (En inglés)

Éstas son algunas de las cosas que dice en el trozo de entrevista que se ve en el vídeo:

“Cuando te inyectan la vacuna Covid en el brazo, ahora ya sabemos que solo el 25% de esa vacuna se queda en el brazo. Y el otro 75% es literalmente recogido por el sistema linfático, que lo introduce en el sistema circulatorio”.


[Para los coágulos que no son detectables a través de TACs o Resonancias magnéticas, sino que son verdaderamente pequeños] “La única manera de saber si este predecible efecto de coagulación está sucediendo, es haciendo esta prueba de sangre llamada del Dímero D. Esta prueba indica si ha habido una coagulación reciente en la sangre. No indica nada más que esto: un coagulación reciente. No indica antiguos coágulos, sino nuevos coágulos en la sangre. Ahora estoy haciendo esta prueba con mis pacientes, encontrando gente que se ha puesto la vacuna en los 7 días anteriores (entre 4 y 7 días antes), y haciéndoles esta prueba llamada el Dímero D. Todavía tengo que ir acumulando más información, pero de lo que llevo visto, en el 62% de ellos hay evidencias de coágulos. Lo que significa que estos coágulos no son raros. Significa que la mayoría de la gente tiene estos coágulos de sangre y no tienen ni idea de que los tienen.

Así, Laura, la cosa más alarmente de todo esto: Hay muchas partes del cuerpo, como el corazón, el cerebro, la médula espinal y los pulmones, que no se pueden regenerar. Cuando estos tejidos están dañados en sus vasos capilares, se quedan dañados para siempre.

Así que yo ahora tengo 6 pacientes con lo que llamamos tolerancia disminuida para el esfuerzo, que significa que se quedan sin aire mucho más fácilmente de lo que solían. Tengo un hombre que solía venir andando a mi consulta cada semana para una inyección para la artritis, que me dice que podía hacer esos 3 kilometros sin problema, pero que ahora a los 400 metros se queda totalmente sin respiración, y esto está siendo así desde hace 5 meses. Basándonos en esta prueba del Dímero D que demuestra que la mayoría de la gente está produciendo coágulos, estas 6 personas con la tolerancia disminuida para el esfuerzo, lo que les ha pasado literlamente es que se les han taponado miles de capilares en los pulmones.

La cosa más terrible no es sólo que estas personas se queden sin aire y no puedan hacer lo que solían hacer, sino que una vez que tienes bloqueado un número significativo de vasos capilares en los pulmones, el corazón tiene que bombear contra una resistencia mucho mayor para hacer llegar la sangre hasta los pulmones. Esto es lo que causa la enfermedad llamada hipertensión pulmonar […] Lo terrible de esto es que las personas con esta enfermedad normalmente mueren de fallo cardiaco en unos 3 años. […] Lo peor está por llegar. Hay muchos tejidos en el cuerpo que no se pueden regenerar […] Como ahora todos estos jóvenes que tienen miocarditis después de vacunarse: ahora tienen un daño permanente. Sea lo leve que sea, no pueden hacer lo que podían hacer antes, porque el músculo del corazón no se regenera. Así que esta es la terrible preocupación. […] Con cada uno de los sucesivos pinchazos, el daño irá aumentando y aumentando. Es un daño acumulado, porque cada vez tendrás más capilares dañados”.

Aquí están las entradas más nuevas de Contra el Encierro.

Dr. Hoffe: “En el 62% de los vacunados hay evidencias de coágulos” (En inglés traducido al español). Entrevista en el programada de Laura Lynn a este médico del Canadá perseguido desde que habló en público de los daños de la vacuna en sus pacientes.

Fuente: Contra el encierro de la gente

La Red De Dinero Oscuro E Influencia De Bill Gates

PARTE 1: Conformación Narrativa Filantrópica (The Last American Vagabond)

En los primeros meses de 2020, el magnate de los negocios y multimillonario Bill Gates vio cómo su popularidad se disparaba por las nubes. Según YouGov, el 58 por ciento de los estadounidenses encuestados sobre Gates tenían una opinión positiva de él, es igualmente querido por hombres y mujeres, y tanto los Boomers como los Millennials lo adoran. La popularidad de Gates podría haber aumentado debido a que un documental viral de Netflix sobre su vida se estrenó a finales de 2019. Combine esa prensa positiva con una ola de entrevistas en los medios de comunicación que buscan la guía del hombre que “predijo” la próxima gran pandemia, y listo – Bill Gates es un superhéroe aquí para salvar al planeta de la inminente fatalidad.

Por supuesto, esta visión bastante caricaturesca ignora varios hechos incontrovertibles, y algunas teorías fuertes sobre las verdaderas intenciones de Gates. En primer lugar, los hechos. Bill Gates ha utilizado su inmensa riqueza para ganar influencia y tiempo en los medios de comunicación, difundiendo su mensaje de solucionar problemas de salud global mientras continúa ganando miles de millones. Usando la Fundación Bill y Melinda Gates para repartir subvenciones y donaciones, Gates ha creado una red de organizaciones que deben su presupuesto a la fundación o responden directamente a Gates. Al rastrear las inversiones de la Fundación y las relaciones de Gates, podemos ver que casi todas las personas involucradas en la lucha contra el COVID-19 están vinculadas a Gates o a su fundación por dos grados o menos. Esto le da a Bill Gates y su fundación una influencia indiscutida sobre la respuesta a la pandemia. Igualmente preocupante es el llamado de Gates para el bloqueo global hasta que el mundo entero haya sido vacunado y se le haya dado un certificado digital para probar la inmunidad.

Ahora, las teorías: al escuchar cuidadosamente varios discursos y declaraciones hechas por Gates, queda claro que tiene una inclinación por discutir la reducción del crecimiento de la población. A pesar de que los “verificadores de hechos” afirman que las palabras de Gates han sido sacadas de contexto, sus palabras hablan por sí mismas. Él cree que la población debe reducirse o evitarse que crezca, y cree que esto se puede hacer con vacunas y atención médica.

Mientras tratamos de despegar las capas de acrobacias de relaciones públicas y piezas de calado que adulan a Bill Gates, esperamos ilustrar que el hombre que está siendo apuntalado en el escenario global y vendido a la gente como su salvador, es cualquier cosa menos. A pesar del aparente crecimiento en el apoyo a Bill Gates, también hay evidencia en las redes sociales de que la gente está comenzando a cuestionarlo y desafiar la narrativa del salvador. Este es el primer paso para desentrañar la Red de Dinero Oscuro y Manipulación de Bill Gates.

La influencia global de la Fundación Bill y Melinda Gates

En 1994, según la historia, Bill Gates le pidió a su padre, William Gates Sr., que lo ayudara a “mejorar la salud reproductiva e infantil” fundando y dirigiendo la Fundación William H. Gates. Gates Sr. estuvo de acuerdo y en el año 2000, la Fundación se fusionó con la Gates Learning Foundation para convertirse en la Fundación Bill y Melinda Gates. Según la Fundación, Bill Gates ha donado 36 mil millones de dólares de su riqueza personal a la fundación. Se estima que la Fundación está valorada en $46.8 mil millones.

Durante las últimas dos décadas, la Fundación ha invertido en una serie de empresas y proyectos controvertidos mientras persigue su objetivo de mejorar la salud mundial y el acceso a las vacunas y la atención reproductiva. Todo esto se ha hecho como parte del plan de Gates para remodelar su imagen pública como la de un multimillonario amable y amable cuyo único objetivo es ayudar al mundo. La realidad es mucho más sospechosa.

Tomemos, por ejemplo, el documental de Netflix mencionado anteriormente,Inside Bill’s Brain: Decoding Bill Gates. En lugar de ser una mirada genuina a la vida y la personalidad de Gates, el documental no reconoció los conflictos de intereses que podrían retratar la película – y Bill Gates – bajo una luz diferente. En una reciente investigación explosiva que examina el alcance del dinero de Gates, The Nation señaló que, “en el primer episodio, el director Davis Guggenheim subraya el intelecto expansivo de Gates al entrevistar a Bernie Noe, descrito como un amigo de Gates”. Noe continúa diciendo que Gates lee 150 páginas por hora con un 90 por ciento de retención. Sin embargo, The Nation informó: “Guggenheim no le dice a las audiencias que Noe es el director de Lakeside School, una institución privada a la que la Fundación Bill y Melinda Gates ha dado $ 80 millones”. Casualmente, esta es la misma escuela a la que asisten los hijos de los Gates.

Por supuesto, el uso de la riqueza de las fundaciones para influir en la cobertura de los medios no es nuevo para Bill Gates. Aunque The Guardian reclama independencia editorial, su sección de Desarrollo Global está financiada en parte por The Gates Foundation. La fundación también ha dado más de $ 9 millones a The Guardian, más de $ 3 millones a NBC Universal, más de $ 4 millones al periódico francés Le Monde, más de $ 4.5 millones a NPR, $ 1 millón a Al-Jazeera y $ 49 millones al programa Media Action de la BBC. A la luz de estas inversiones, es fácil entender cómo Gates pudo organizar rápidamente una gira de conferencias de sus medios de comunicación favoritos.

Los medios de comunicación corporativos no son los únicos beneficiarios de la fundación Gates. También han invertido en tecnologías y compañías controvertidas, como Monsanto, geoingeniería, tecnología 5G y vacunas.

MintPress News informó recientemente sobre cómo la Fundación Gates ayudó al gigante farmacéutico y químico altamente controvertido Monsanto Corporation a “ganar un punto de apoyo más fuerte en África”. Mpn también señala que la fundación financió un “ensayo clínicodefectuoso de la vacuna contra el VPH en la India en 2009, donde 23.000 niñas empobrecidas de entre 9 y 15 años estuvieron expuestas a medicamentos potencialmente letales sin siquiera el consentimiento de sus padres, lo que llevó a siete muertes”.

En 2010, también se informó que desde 2007, Gates había dado $ 4.5 millones para estudiar métodos de geoingeniería para alterar la estratosfera para reflejar la energía solar, técnicas para filtrar el dióxido de carbono directamente de la atmósfera y el brillo de las nubes del océano. La geoingeniería es la manipulación deliberada a escala masiva del clima con el propósito declarado de reducir el calentamiento en el planeta. The Guardian señaló previamente que Gates da “unasuma no revelada” al defensor de la geoingeniería y profesor de Harvard David Keith. Gates también posee una participación mayoritaria en la compañía de geoingeniería de Keith, Carbon Engineering. El prominente investigador de geoingeniería Ken Caldeira dice que recibe $ 375,000 al año de Gates y trabaja para Intellectual Ventures, una compañía privada de investigación de geoingeniería propiedad parcial de Gates y dirigida por Nathan Myhrvold, ex jefe de tecnología de Microsoft.

La Fundación también ha invertido 10 millones de dólares en el desarrollo de antenas que acelerarán el despliegue de la controvertida tecnología celular de 5ª generación, también conocida como 5G.

Las preocupaciones en torno a la fortuna de Bill Gates y su uso de la Fundación Bill y Melinda Gates para influir en proyectos de mascotas no es la única preocupación expresada por los críticos de la fundación. El más grande – y más inmediato – es que los multimillonarios no electos como Gates están usando sus fortunas para dar forma a las políticas públicas utilizando sus fundaciones filantrópicas. Este método de invertir miles de millones de dólares en forma de donaciones de caridad deducibles de impuestos a compañías privadas está permitiendo a Gates dar forma a la política y las ganancias al mantener acciones en las mismas compañías apoyadas por la Fundación Gates.

Una investigación reciente de The Nation descubrió más de 19,000 subvenciones caritativas de la Fundación Gates en las últimas dos décadas. También encontraron $ 2 mil millones en estas donaciones caritativas deducibles de impuestos a empresas privadas. Las compañías que reciben estas donaciones incluyen GlaxoSmithKline, Unilever, IBM y NBC Universal Media. La Nación señaló que la Fundación Gates ha dado 250 millones de dólares a compañías de medios y “otros grupos para influir en las noticias”.

La Nación encontró cerca de $ 250 millones en donaciones caritativas de la Fundación Gates a compañías en las que la fundación tiene acciones y bonos corporativos: Merck, Novartis, GlaxoSmithKline, Vodafone, Sanofi, Ericsson, LG, Medtronic, Teva y numerosas nuevas empresas.

Es posible que vea la declaración anterior y pregunte, “¿cómo puede ser esto legal? ¿No es un conflicto de intereses mantener acciones en una empresa a la que también se dan donaciones libres de impuestos?” El simple hecho es que no hay reglas o leyes en contra de hacer exactamente lo que la Fundación Bill y Melinda Gates están haciendo. Si bien algunos podrían argumentar que el esquema de Bill Gates es brillante – donar su fortuna mediante la formación de una fundación que puede dar donaciones deducibles de impuestos a las empresas que en parte posee y cosechar ganancias, mientras que evitar los impuestos – que le está permitiendo ocultar su dinero en una miríada de maneras. Se ha vuelto casi imposible rastrear cada donación, inversión u otra asociación.

La Nación concluyó, “es difícil ignorar las ocasiones en que sus actividades caritativas parecen servir principalmente a intereses privados, incluidos los suyos, apoyando las escuelas a las que asisten sus hijos, las compañías que su fundación posee en parte y los grupos de interés especial que defienden a los estadounidenses ricos, al tiempo que generan miles de millones de dólares en ahorros fiscales”.

Otros hechos notables de la investigación incluyen que la “dotación de $ 50 mil millones de la Fundación Gates ha generado $ 28.5 mil millones en ingresos de inversión en los últimos cinco años”, mientras que solo regala $ 23.5 mil millones en subvenciones caritativas. Además, una investigación de 2007 de LA Times encontró que la organización estaba involucrada en préstamos hipotecarios de alto riesgo y hospitales con fines de lucro que, según los informes, realizaron cirugías innecesarias. Según los informes, la Fundación Gates también invierte en compañías de chocolate que utilizan mano de obra infantil.

Sería un error ver a la Fundación Bill y Melinda Gates como un mero recipiente para que un hombre rico esconda su dinero y obtenga ganancias inconmensurables. No, la Fundación es “más que una colección de subvenciones y proyectos”, dice el Dr. David McCoy, médico de salud pública e investigador del University College de Londres y asesor del Movimiento por la Salud popular. McCoy dice que la Fundación “opera a través de una red interconectada de organizaciones e individuos en el mundo académico y los sectores de ONG y negocios” que permite a Bill Gates “aprovechar” la influencia” en una especie de “pensamiento grupal”.

En la parte 2 de esta investigación examinaremos la miríada de conexiones entre Bill Gates, su fundación y los muchos actores involucrados en la respuesta al COVID-19. También intentaremos responder a la pregunta esencial: ¿Es Bill Gates una fuerza para el bien o una fuerza para el daño?

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 1: Conformación narrativa filantrópica (thelastamericanvagabond.com)

PARTE 2: La Operación COVID-19

Antes de sumergirnos en la actual crisis del COVID-19, se necesita un poco más de información sobre Gates. En la última pieza discutimos la historia de las inversiones de la Fundación Gates. Lo que es importante tener en cuenta es que al usar la Fundación como la organización principal, Gates puede donar e influir en hospitales, universidades, medios de comunicación, gobiernos y organizaciones de salud. La Fundación claramente tiene la capacidad de dar forma a las decisiones tomadas por algunas de las instituciones que financian, incluso cuando estas decisiones van en contra de los deseos de las masas que dicen estar ayudando.

Por ejemplo, en 2017 Independent Science News publicó un informe que detallaba cómo la Fundación Bill y Melinda Gates pagó a la firma de relaciones públicas Emerging Ag $ 1.6 millones para “reclutar a una coalición encubierta de académicos para manipular un proceso de toma de decisiones de la ONU sobre las unidades genéticas”. Los correos electrónicos publicados por la Solicitud de la Ley de Libertad de Información revelan que el esfuerzo de reclutamiento de gates fue parte de un plan para “luchar contra los defensores de la moratoria de la impulsión genética”. Las unidades genéticas son una controvertida tecnología de extinción genética promovida como una forma de eliminar los mosquitos con malaria, plagas agrícolas y especies invasoras.

En el Convenio de las Naciones Unidas sobre la Diversidad Biológica de 2016, 179 organizaciones internacionales pidieron una moratoria de la ONU sobre las unidades genéticas. Los opositores a esta tecnología también distribuyeron una carta, “Un llamado a la conservación con conciencia: no hay lugar para las unidades genéticas en la conservación”, firmada por 30 líderes ambientales que pidieron un “alto a todas las propuestas para el uso de tecnologías de impulso genético, pero especialmente en la conservación”. La Fundación Gates está fuertemente invertida en tecnología de conducción genética y no estaba contenta de ver un retroceso diverso y unificado contra la conducción de genes. La Fundación contrató a Emerging Ag , que tiene su propia red de conexiones con Big Pharma y Big Ag , para cerrar los opositores a la conducción de genes. Emerging Ag tuvo éxito y la moratoria fue derribada.

Coincidentemente, en 2016, la Academia Nacional de Ciencias de Estados Unidos publicó un informe sobre la conducción de genes que fue cofinanciado por la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA) y la Fundación Bill y Melinda Gates. DARPA también se invierte en la investigación de la unidad genética. Como señaló The Guardian después de la publicación del informe nas:

“La misma agencia de investigación de defensa estadounidense (DARPA) que pagó por el estudio NAS ha hecho saber que están participando en la investigación y el desarrollo de organismos sintéticos ‘robustos’. Hay buenas razones para estar preocupados”.

Además, Jim Thomas, del Grupo ETC, que monitorea el impacto de las tecnologías emergentes y las estrategias corporativas en la biodiversidad, la agricultura y los derechos humanos, dijo a ISN que cree que las unidades genéticas son armas biológicas potenciales que podrían tener un impacto “desastroso” en la vida humana y la seguridad alimentaria. “El hecho de que el desarrollo de la unidad genética ahora esté siendo financiado y estructurado principalmente por el ejército estadounidense plantea preguntas alarmantes sobre todo este campo”, declaró.

Independent Science News también señaló:

“Esta tampoco es la primera vez que la Fundación Gates ha utilizado a académicos para influir en la opinión pública y privada sobre las tecnologías de ingeniería genética, como lo demuestra su financiación de la Cornell Alliance for Science“.”

Los correos electrónicos privados obtenidos por Independent Science News se suman a las montañas de evidencia que detallan cómo Gates es capaz de presionar a las organizaciones para que lleven a cabo sus intereses y los de su fundación.

La mafia de la salud global

Bill Gtaes

Teniendo en cuenta estos alarmantes informes sobre la influencia de Gates en la política de salud pública, es importante tomarse un momento para examinar la respuesta actual al COVID-19. Cuando observamos a los actores e instituciones involucradas, ¿vemos la influencia y el dinero de Gates? En caso afirmativo, ¿qué significa esto para la salud pública? ¿La gigantesca influencia y las finanzas de Gates le permitirán dirigir personalmente el curso de la recuperación del COVID-19?

Comencemos por mirar al doctor Anthony S. Fauci, director del Instituto Nacional de Alergias y Enfermedades Infecciosas (NIAID), parte de los Institutos Nacionales de Salud y líder en la lucha contra el COVID-19. Desafortunadamente, cuando se trata de Fauci y el NIAID vemos claramente la influencia de Bill Gates. En 2010, el NIAID y la Fundación Bill y Melinda Gates anunciaron su “Década de colaboración en materia de vacunas”, en la que pedían la coordinación entre la “comunidad internacional de vacunas” y la creación de un “Plan de Acción Mundial sobre Vacunas”. El Dr. Fauci fue nombrado miembro del Consejo de Liderazgo de la asociación. Del mismo modo, Bill Gates se ha asociado con los NIH durante varios años.

A finales de abril, se conoció la noticia de que el NIAID de Fauci donó un total de 7,4 millones de dólares a la investigación relacionada con el coronavirus de murciélagos. Las inversiones agregaron combustible a la teoría de que covid-19 podría ser un virus de bioingeniería que fue liberado a propósito o accidentalmente desde el Instituto de Virología de Wuhan en Wuhan, China. La noticia de la financiación plantea la pregunta obvia; ¿El dinero de Gates influyó o coronó la investigación del coronavirus del NIAID? El tiempo lo dirá.

Otra jugadora importante con conexiones con Gates es la Dra. Deborah Birx, una médica y diplomática estadounidense que se desempeña como Coordinadora Mundial de Sida de Estados Unidos para los presidentes Barack Obama y Donald Trump desde 2014. Actualmente es la Coordinadora de Respuesta al Coronavirus para el Grupo de Trabajo de la Casa Blanca de la Administración Trump. Birx también forma parte de la Junta Directiva de The Global Fund,una organización a la que la Fundación Bill y Melinda Gates prometió una inversión de 750 millones de dólares en 2012. El Fondo Mundial también cuenta con el miembro de la junta directiva Kieran Daly, director adjunto de Política Global y Promoción de la Fundación Gates.

“La Fundación Bill y Melinda Gates es un socio clave del Fondo Mundial, proporcionando contribuciones en efectivo, participando activamente en su junta directiva y comités, y apoyando los esfuerzos de promoción, comunicación y recaudación de fondos del Fondo Mundial”, afirma el Fondo Mundial.

La Universidad Johns Hopkins ha sido un miembro igualmente importante de la respuesta global al COVID-19. Los cálculos de la universidad de las tasas globales de infección y mortalidad se citan comúnmente en los principales medios de comunicación. Sin embargo, una vez más, encontramos que la Fundación Bill y Melinda Gates ha estado invirtiendo en Johns Hopkins durante dos décadas.

Por último, recientemente se informó que la organización conocida como Wellcome Trust se ha asociado con la Fundación Bill y Melinda Gates y MasterCard para “catalizar el trabajo inicial” del Acelerador terapéutico COVID-19. Se supone que la Aceleradora acelerará y evaluará “medicamentos y productos biológicos nuevos y reutilizados para tratar a pacientes con COVID-19 a corto plazo”. Lo que no se mencionó es que la Fundación Gates ha sido un “Fideicomisario” del Wellcome Trust durante varios años. Curiosamente, en 2017, Mark Henderson, Director de Comunicaciones de Wellcome Trust participó en un panel llamado “Deep Dive: Preventing Pandemics”. El Dr. Anthony Fauci también participó en la mesa redonda.

Uno podría señalar la participación de Fauci y Wellcome Trust en un panel sobre pandemias como perfectamente razonable, después de todo, estos son profesionales que se centran en la salud global. Sin embargo, ignorar que las huellas dactilares de Bill Gates están en toda la industria de la salud global sería un error.

Basado en el historial de la Fundación Gates de contratar empresas de relaciones públicas para cerrar detractores o usar su dinero para influir en las instituciones, uno podría ser perdonado por asumir que la fundación no sería alta en la lista de líderes potenciales para una crisis de salud pública. Desafortunadamente, a partir de mayo de 2020, Bill Gates y su Fundación siguen siendo promovidos como héroes en la lucha contra el COVID-19.

¿Quién dirige la OMS?

Desde el brote de COVID-19, tanto Bill Gates como la Organización Mundial de la Salud han entrado en el centro del escenario mientras el mundo los mira en busca de respuestas. A estas alturas, es bien sabido que la Fundación Bill y Melinda Gates es el principal donante no estatal a la OMS. Estados Unidos ha sido el principal donante estatal, pero eso puede cambiar bajo la administración Trump. Gates también fue la primera persona no estatal en dar un discurso de apertura ante la asamblea general de la OMS.

Según un informe de Politico, la opinión (y el dinero) de Bill Gates tiene tanta influencia en la OMS que los funcionarios lo llaman en privado “el Bill Chill”. Dieciséis funcionarios que hablaron bajo condición de anonimato dijeron a Politico que Gates tiene una influencia desmesada en la política de la OMS y pocos se atreven a desafiarlo. “Es tratado como un jefe de Estado, no solo en la OMS, sino también en el G20”,declaró un representante de una ONG con sede en Ginebra.

Las acusaciones de la influencia de Gates fueron secundadas por Foreign Affairs cuando informaron que “pocas iniciativas de política o estándares normativos establecidos por la Organización Mundial de la Salud se anuncian antes de que hayan sido investigadas casual y extraoficialmente por el personal de la Fundación Gates”.

El actual Director General de la OMS es Tedros Adhanom, ex Ministro de Salud de Etiopía. Durante su mandato como Ministro de Salud de Etiopía, Tedros colaboró con la Fundación Clinton y la Fundación Bill y Melinda Gates para trabajar en vacunas, entre otras medidas sanitarias. Politico informó que antes de que Tedros fuera seleccionado para el puesto de la OMS en 2017, Gates fue acusado de apoyar a Tedros y usar su influencia para ayudar a ganar la nominación.

Si bien la mayoría de los delegados de los países miembros expresaron su creencia de que Gates tiene buenas intenciones, algunos temían que el dinero de la Fundación Gates provenga de “grandes empresas” y pudiera “servir como un caballo de Troya para que los intereses corporativos socaven el papel de la OMS en el establecimiento de normas y la formulación de políticas de salud”.

La conclusión más importante es que las tarifas pagadas por los países miembros de la OMS representan menos de una cuarta parte del presupuesto bienal de 4,5 mil millones de dólares, lo que deja a Gates, los gobiernos y otras fundaciones para llenar el vacío. Estas donaciones se destinan a proyectos específicos y la OMS no puede decidir cómo utilizarlas. En el caso de la Fundación Bill y Melinda Gates, esos fondos suelen destinarse a programas de vacunación.

No importa de qué manera abordes las soluciones que se presentan como respuesta a la pandemia de COVID-19, encontrarás las huellas dactilares de Bill Gates. En repetidas ocasiones ha utilizado su dinero e influencia para obtener ganancias y ganar poder constantemente sin haber sido elegido para un cargo político.

En la parte 3 de esta investigación examinaremos las estrategias que Bill Gates ha pedido en respuesta al COVID-19. También veremos cómo Bill Gates y la familia Rockefeller han ido prediciendo una situación como la que estamos presenciando actualmente. Finalmente, mostraremos cómo esta crisis presenta la oportunidad perfecta para que Gates y sus cohortes obtengan enormes ganancias y se posicionen a la cabeza de un Estado tecnocrático emergente.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 2: La operación COVID-19 (thelastamericanvagabond.com)

PARTE 3: Vigilancia De La Salud, Evento 201 Y La Conexión Rockefeller

Bloqueos, rastreo de contactos, certificados digitales y vacunas

En los últimos cuatro meses Bill Gates ha hecho decenas de apariciones en medios donde ha pedido varias “soluciones” controvertidas al COVID-19. Gates dice que estas propuestas deben implementarse antes de que la sociedad pueda volver a la “normalidad”. Desde pedir bloqueos prolongados, vigilancia de la salud (también conocido como rastreo de contactos)certificados digitales.

La ciencia detrás de los cierres ha sido cuestionada en numerosas ocasiones por los expertos en salud. Más recientemente, Michael Levitt, un profesor de la Universidad de Stanford que predijo la trayectoria inicial de la pandemia, declaró que creía que el confinamiento fue un “gran error” y que en realidad pudo haber costado vidas. TLAV también ha expuesto el rastreo de contratos y el llamado a un “ejército” de personas para monitorear al público como una expansión de la vigilancia. Coincidentemente, se informó esta misma semana que la Fundación Gates invirtió recientemente cientos de millones de dólares en compañías tecnológicas como Google, que pueden terminar construyendo la infraestructura de rastreo de contactos.

Lo que Gates describe como “certificados digitales” suena idéntico a lo que algunos llaman “pasaportes de inmunidad”, una forma de identificación digital que incluirá los datos de salud de una persona, así como su estado de vacunación. Durante un AMA de Reddit, Gates declaró: “Eventualmente tendremos algunos certificados digitales para mostrar quién se ha recuperado o ha sido probado recientemente o cuando tengamos una vacuna quién la ha recibido”. Lo que Gates describe –un certificado digital para demostrar quién ha sido vacunado– suena similar a los recientes llamamientos para que los pasajeros usen pasaportes de inmunidad antes de que se les permita volar.

Sin embargo, las declaraciones y la filantropía de Gates revelan su enfoque principal en la “lucha por la salud global”: la promoción de vacunas para todo el mundo. En lugar de centrarse en el agua potable, el acceso a la vivienda o cualquier otra propuesta para ayudar a los más pobres del mundo, Gates cree que el acceso a las vacunas es más apremiante. Mucho antes del COVID-19, la Fundación Gates ha estado involucrada en la financiación de polémicos esfuerzos de vacunación en África e India.

Un informe de 2015 titulado, Poder filantrópico y desarrollo: ¿Quién da forma a la agenda?, examina la influencia de la filantropía global y proporciona ejemplos de la influencia indebida que Gates y otros pueden ejercer. El informe describe gran parte de lo que describimos en la Parte 1 de esta investigación, incluyendo cómo,“a través de la colocación del personal de la Fundación en los órganos de toma de decisiones de las organizaciones internacionales y las asociaciones mundiales de salud” la Fundación Gates influye y guía la política de salud pública. La Fundación Gates es miembro de la junta directiva no sólo de GAVI, sino también del Fondo Mundial, la Alianza para la Salud de la Madre, el Recién Nacido y el Niño, la Empresa medicamentos para la malaria, la Alianza para lograr la regresión de la malaria, la Alianza contra la Tuberculosis, la Alianza Alto a la Tuberculosis y muchas otras.

La investigación también proporciona detalles sobre las inversiones de Gates en vacunas y sus conexiones con los fabricantes de vacunas. Como se informó en la Parte 2 de esta investigación, en 2010 la Fundación Bill y Melinda Gates lanzó la “Década de las Vacunas” y pidió un “Plan de Acción Mundial de Vacunas”. También ayudaron a crear la asociación público-privada conocida como GAVI, o la Alianza Mundial para el Fomento de la Vacunación y la Inmunización.

“La Fundación Gates proporcionó una promesa inicial de cinco años de US$ 750 millones como capital inicial para lanzar esta asociación mundial público-privada en el año 2000 y ha seguido siendo su fuerza impulsora y su mayor donante”, señala el informe. “Entre 2000 y 2014, la Fundación Gates aportó el 23 por ciento (US$2.287,94 millones) del financiamiento total de los donantes de alrededor de US$9,9 mil millones”.

El informe señaló que los investigadores han criticado a GAVI por seguir un “enfoque gates” sobre los desafíos de salud global, “centrándose en intervenciones de salud verticales específicas de la enfermedad (a través de vacunas), en lugar de enfoques horizontales y holísticos (por ejemplo, el fortalecimiento del sistema de salud)”. Además, hay evidencia de que el apoyo de la Fundación Gates a GAVI ha alentado a los fabricantes de vacunas a producir vacunas específicas que resultan en “más de $ 1 mil millones para Pfizer y GlaxoSmithKline (GSK)”.

La organización no gubernamental Médicos sin Fronteras (MSF) también ha cuestionado el impacto general de la Alianza GAVI en la asequibilidad de las vacunas, afirmando que “el costo de inmunizar completamente a un niño fue 68 veces más caro en 2014 que en 2001”. MSF también pide a GAVI que excluya a las compañías farmacéuticas de su consejo de administración para reducir los conflictos de intereses.

Una de las conclusiones más importantes de la investigación es que la Fundación Gates opera una puerta giratoria entre el personal de la Fundación y las grandes compañías farmacéuticas como Merck y GSK. El informe proporciona varios ejemplos de esta puerta giratoria, incluido Trevor Mundel, el presidente de la División de Salud Global de la Fundación Gates, trabajó anteriormente con Novartis, Pfizer y Parke-Davis. El predecesor de Mundel, Tachi Yamada, había sido ejecutivo y miembro de la junta directiva de GSK. Kim Bush, responsable de las iniciativas de asociación con la atención médica para la Fundación Gates, anteriormente trabajó para Baxter International Healthcare Corporation. Penny Heaton, Directora de Desarrollo de Vacunas en la Fundación Gates desde 2013, trabajó antes para Novartis Vaccines and Diagnostics y para Merck &Co.

La Fundación Gates y las vacunas de ARNm

Otra nota interesante del informe es cómo la Fundación tiene una participación de 52 millones de dólares en el capital de la compañía farmacéutica alemana CureVac. La colaboración está destinada a acelerar el desarrollo de vacunas de ARN mensajero (ARNm) contra diversas enfermedades, incluidos el rotavirus, el VIH y el virus sincitial respiratorio.

La vacuna de ARNm se ha discutido como un candidato potencial para la vacuna contra el COVID-19. Específicamente, la compañía biotecnológica Moderna Therapeutics está liderando el camino para la terapéutica de ARNm y las vacunas potenciales. El programa de vacunación contra el ARN de Moderna ha recibido 100 millones de dólares en fondos de la Fundación Gates. La controvertida vacuna de ARNm de Moderna también fue desarrollada con una donación de 25 millones de dólares de la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA).

Como informó TLAV, Donald Trump también nombró al Dr. Moncef Slaoui , un ex ejecutivo de Big Pharma que hasta hace poco se sentaba en la junta de Moderna , como su “Zar de las Vacunas” para dirigir la “Operación Warp Speed”, el esfuerzo de la administración Trump para acelerar una vacuna para fines de 2020. En 2016, Slaoui fue nombrado miembro del Consejo de Administración de Moderna Therapeutics. Renunció al ser nombrado para un cargo en la actual administración estadounidense.

La escritora de TLAV Whitney Webb informó recientemente sobre el papel de Moderna en la lucha contra el COVID-19 y sus conexiones con la Fundación Gates:

“La Coalición para las Innovaciones en Preparación para Epidemias (CEPI, por sus, anunció que financiaría tres programas separados para promover el desarrollo de una vacuna para el nuevo coronavirus responsable del brote actual.

Cepi – que se describe a sí mismo como “una asociación de organizaciones públicas, privadas, filantrópicas y civiles que financiará y coordinará el desarrollo de vacunas contra amenazas de alta prioridad para la salud pública” – fue fundada en 2017 por los gobiernos de Noruega y la India junto con el Foro Económico Mundial y la Fundación Bill y Melinda Gates. Su financiación masiva y sus estrechas conexiones con organizaciones públicas, privadas y sin ánimo de lucro la han posicionado para poder financiar la rápida creación de vacunas y distribuirlas ampliamente.

El reciente anuncio de CEPI reveló que financiaría dos compañías farmacéuticas , Inovio Pharmaceuticals y Moderna Inc., así como la Universidad de Queensland de Australia, que se convirtió en socio de CEPI a principios del año pasado. Cabe destacar que las dos compañías farmacéuticas elegidas tienen estrechos vínculos y/o asociaciones estratégicas con DARPA y están desarrollando vacunas que involucran de manera controvertida material genético y/o edición de genes. La Universidad de Queensland también tiene vínculos con DARPA, pero esos vínculos no están relacionados con la investigación biotecnológica de la universidad, sino con la ingeniería y el desarrollo de misiles“.”

Webb continúa detallando cómo Moderna está trabajando con los NIH de Estados Unidos para desarrollar una vacuna para el nuevo coronavirus y cómo el proyecto será financiado en su totalidad por cepi, que a su vez fue fundada y financiada por la Fundación Bill y Melinda Gates.

No debería sorprender que Bill Gates ahora esté apoyando abiertamente las vacunas de ARN. El desarrollo de estas vacunas —y el esfuerzo general de la Operación Warp Speed— está ignorando los ya inestables protocolos y medidas de seguridad para la fabricación de vacunas. La Operación Warp Speed y los ensayos posteriores en humanos en los que participaron 100.000 voluntarios “comprimirán lo que normalmente son 10 años de desarrollo y pruebas de vacunas en cuestión de meses”.

La prisa por conseguir al público una vacuna que no ha sido probada adecuadamente es aún más preocupante teniendo en cuenta las recientes declaraciones de Gates sobre la necesidad de vacunar a toda la población mundial. En un blog en su sitio web, Gate afirma: “El objetivo es elegir una o dos mejores construcciones de vacunas y vacunar a todo el mundo, es decir, 7 mil millones de dosis si es una vacuna de dosis única y 14 mil millones si es una vacuna de dos dosis”.

El impulso de Gates para una vacuna obligatoria probablemente tendrá un fuerte impacto en las decisiones de la OMS, los CDC y otras organizaciones de salud globales que financia, influye o de las que es miembro de la junta directiva. La financiación de Gates de un ” tatuaje de punto cuántico” que puede almacenar registros de vacunación ha hecho poco para calmar la disidencia y el miedo a sus verdaderas motivaciones.

A pesar de la proclamación de Gates como un héroe que ha salvado millones de vidas, la idea de forzar las vacunas ha provocado una creciente oposición a las vacunas y preocupaciones sobre su seguridad. Ya sea que se trate del denunciante de los CDC, el testimonio del Dr. Andrew Zimmerman sobre la seguridad de las vacunas o simplemente el apoyo a la libertad de elección, las personas de todo el mundo son escépticas de la seguridad de las vacunas y la influencia de las grandes farmacéuticas y no es probable que acepten una vacuna obligatoria en silencio.

La conexión rockefeller, el paso de bloqueo y el evento 201

Bill Gates

A medida que concluimos nuestra investigación sobre Bill Gates y consideramos sus segundas intenciones, es importante hacer un balance de la compañía que mantiene y las filosofías que ha promovido.

El informe, Poder filantrópico y desarrollo: ¿Quién da formaa la agenda? , también proporciona un antecedente importante sobre los orígenes de la filantropía moderna y la capacidad de ese dinero para influir en la salud global, la alimentación y la política agrícola. Los investigadores describen el papel de las dinastías Rockefeller y Carnegie en la creación de la filantropía estadounidense:

“Las raíces de la filantropía moderna se remontan al comienzo del siglo 20 en los Estados Unidos, cuando los magnates de los negocios John D. Rockefeller y Andrew Carnegie establecieron las primeras grandes fundaciones estadounidenses, principalmente como una forma de proteger algunos de sus ingresos de los impuestos, pero también como una forma de obtener prestigio e influencia en los Estados Unidos y los asuntos mundiales.

En 1911 Andrew Carnegie estableció la Carnegie Corporation de Nueva York y le dio una dotación de 125 millones de dólares, convirtiéndola en el mayor fideicomiso filantrópico jamás establecido hasta ese momento. Un año antes, Carnegie, que hizo su fortuna en la industria del acero, fundó el Carnegie Endowment for International Peace, que se convirtió en uno de los principales think tanks de política exterior de EEUU”.

Irónicamente, la formación de la Fundación Rockefeller suena inquietantemente similar a la propia historia de Gates de enfrentar acusaciones antimonopolio y de monopolio durante su tiempo en Microsoft y luego fundar la Fundación Bill y Melinda Gates como una forma de reescribir la historia y crear un personaje de héroe alrededor de sí mismo.

“La Fundación Rockefeller se estableció en 1913, dos años después de que la Corte Suprema de los Estados Unidos dictaminara que la Standard Oil Company de John D. Rockefeller era un monopolio ilegal y ordenó que se dividiera en compañías más pequeñas. La disolución de la entonces compañía petrolera más grande del mundo convirtió a su fundador y principal accionista John D. Rockefeller en el hombre más rico del mundo. Con el establecimiento de su fundación, pudo aislar una gran parte de su fortuna de los impuestos sobre la renta y la herencia.

La filantropía y la evasión fiscal no son los únicos puntos en común entre Bill Gates y los Rockefeller. Según los registros genealógicos, Gates está relacionado con la familia Rockefeller a través de Nelson Rockefeller, un ex vicepresidente de los ESTADOS UNIDOS. Sin embargo, las conexiones van más allá de ser asociadas por parientes lejanos. Tanto la Fundación Rockefeller como la Fundación Gates aparentemente “predijeron” un escenario muy similar al de la pandemia que se desarrolla frente a nuestros ojos.

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates se asoció con el Centro Johns Hopkins para la Seguridad de la Salud y el Foro Económico Mundial en un ejercicio pandémico de alto nivel conocido como Evento 201. Gates es un largo tiempo “Colaborador de agenda” para el WEF y ha donado a Johns Hopkins. El evento 201 simuló cómo respondería el mundo a una pandemia de coronavirus que arrasó el planeta. La simulación imaginó la muerte de 65 millones de personas, los cierres masivos, las cuarentenas, la censura de puntos de vista alternativos bajo el pretexto de combatir la “desinformación”, e incluso planteó la idea de arrestar a las personas que cuestionan la narrativa de la pandemia.

Coincidentemente, uno de los jugadores involucrados en el Evento 201 fue el Dr. Michael Ryan, el jefe del equipo de la Organización Mundial de la Salud responsable de la contención internacional y el tratamiento del COVID-19. Ryan llamó a buscar familias para encontrar individuos potencialmente enfermos y aislarlos de sus familias.

La Fundación Rockefeller imaginó un escenario similar en 2010 como parte de su documento,“Escenarios para el futuro de la tecnología y el desarrollointernacional”. Este documento incluye un escenario llamado “Lockstep”, que describe una pandemia que arrasa el mundo y resulta en un control más autoritario por parte de los gobiernos de los países desarrollados. El documento también describe la respuesta a la pandemia de la siguiente manera:

“Durante la pandemia, los líderes nacionales de todo el mundo exhibieron su autoridad e impusieron reglas y restricciones herméticas, desde el uso obligatorio de mascarillas hasta controles de temperatura corporal en las entradas a espacios comunes como estaciones de tren y supermercados. Incluso después de que la pandemia se desvaneció, este control y supervisión más autoritarios de los ciudadanos y sus actividades se mantuvo e incluso se intensificó”.

En el escenario imaginado, la fundación Rockefeller predice que “los escáneres que utilizan tecnología avanzada de resonancia magnética funcional (fMRI) se convierten en la norma en los aeropuertos y otras áreas públicas para detectar comportamientos anormales que pueden indicar “intención antisocial”. Curiosamente, la Administración de Seguridad en el Transporte anunció recientemente planes para controlar las temperaturas en los aeropuertos estadounidenses. El documento continúa describiendo cómo, eventualmente, la gente del mundo se cansaría del control y los disturbios civiles comenzarían:

“Para 2025, la gente parecía estar cansándose de tanto control de arriba hacia abajo y dejando que los líderes y las autoridades tomaran decisiones por ellos. Dondequiera que los intereses nacionales chocan con los intereses individuales, hay conflictos. El retroceso esporádico se volvió cada vez más organizado y coordinado, a medida que los jóvenes desafectos y las personas que habían visto cómo su estatus y sus oportunidades se escapaban, principalmente en los países en desarrollo, incitaban a los disturbios civiles”.

Si bien podría ser conveniente descartar el Evento 201 y Lock Step como una coincidencia, sería miope ignorarlos teniendo en cuenta que las Fundaciones Gates y Rockefeller están muy involucradas en la financiación de la industria mundial de la salud. Si bien abundan las teorías sobre si la pandemia de COVID-19 fue planeada o diseñada de alguna manera, como para imitar los planes discutidos en el Evento 201 y Lock Step, evidencia dura si actualmente falta. Aun así, no debemos descartarlos por completo.

Reducción de la población a través de la eugenesia

Las dinastías Gates y Rockefeller también están unidas por su interés común en la eugenesia, la ciencia desacreditada que promovió la idea de que las personas de “buen nacimiento” deben ser alentadas a reproducirse, mientras que aquellos con “genes malos” deben ser desalentados de la reproducción o esterilizados por completo. La ciencia fue desarrollada por Francis Galton como una estrategia para mejorar la raza humana. La idea era extremadamente popular en Estados Unidos antes de que los nazis abrazaran la doctrina y la llevara al extremo.

La eugenesia también fue extremadamente popular entre la familia Rockefeller. Un informe del Instituto Hudson señala que “las primeras fundaciones estadounidenses estaban profundamente inmersas en la eugenesia, el esfuerzo por promover la reproducción del ajuste y suprimir la reproducción de los no aptos”. El informe afirma que los Rockefeller y otros primeros filántropos estadounidenses creían en la “eugenesia filantrópica”, la idea de que podían usar su dinero para crear fundaciones que promovieran la filosofía de la eugenesia.

La Fundación Rockefeller y su familia ayudaron a financiar a los investigadores de los Institutos Kaiser Wilhelm en Alemania que estaban involucrados en los programas de esterilización nazi, financiaron la Oficina de Registros de Eugenesia y muchos otros programas que promovían el control de la población. En 1952, después de que los experimentos de eugenesia nazis fueran ampliamente conocidos, John D. Rockefeller III ayudó a crear el Population Council para promover la eugenesia sin el bagaje del término.

En su libro, Apareciendo por la vida,el padre de Bill Gates, William H. Gates II, escribió sobre su admiración por los Rockefeller y su filantropía:

“Una lección que aprendimos al estudiar y trabajar con los Rockefeller es que para tener éxito en la búsqueda de objetivos audaces se necesitan socios de ideas afines con los que colaborar.

Y aprendimos que tales goles no son premios reclamados por los de corto plazo. Los Rockefellers se quedan con problemas difíciles durante generaciones”.

Parece que Gates II era un partidario de la filosofía de eugenesia de Rockefellers, ya que sirvió como jefe de Planned Parenthood durante un tiempo. Planned Parenthood fue financiado en parte por una donación de $1.5 millones del Consejo de Población creado por Rockefeller. Gates II fue precedido en Planned Parenthood por Alan Guttmacher, quien simultáneamente se desempeñó como Director de la Sociedad Americana de Eugenesia.

Este interés en la eugenesia puede haber retrocedido tres generaciones al abuelo de Bill Gates, William H. Gates, ya que la Sociedad Americana de Eugenesia tenía un miembro con el nombre de “William H. Gates” en la década de 1920. El William H. Gates que aparece en la lista de AES fue catalogado como “profesor” y hay un profesor William H. Gates de la Universidad Estatal de Luisiana, pero todavía no hay evidencia de que el abuelo de Gates sea el mismo William H. Gates.

A pesar de todo, la actual familia Gates tiene la costumbre de pasar tiempo alrededor de sus compañeros eugenistas filantrópicos. En diciembre de 2001, William H. Gates recibió la inauguración de las “Medallas Andrew Carnegie de Filantropía” por su trabajo de caridad. Gates Sr. recibió su premio junto a Walter H. y Leonore Annenberg en nombre de la Fundación Annenberg, Brooke Astor, Irene Diamond, David y Laurance S. Rockefeller en nombre de la familia Rockefeller, George Soros y Ted Turner. Aunque Bill Gates no aparece en la foto, la Carnegie Corporation menciona que el mayor Gates estaba representando a la “familia Gates”.

Bill Gates
Bill Gates

Más recientemente, en 2010 Bill Gates fue visto con otros multimillonarios en un evento que fue descrito por los medios corporativos como “Se llaman el Buen Club – y quieren salvar al mundo.” The Guardian informó:

“Este es el Buen Club, el nombre dado a la pequeña élite global de filántropos multimillonarios que recientemente celebraron su primera y altamente secreta reunión en el corazón de la ciudad de Nueva York.

Los nombres de algunos de los miembros son figuras familiares: Bill Gates, George Soros, Warren Buffett, Oprah Winfrey, Michael Bloomberg, David Rockefeller y Ted Turner. Pero también hay otros, como los gigantes empresariales Eli y Edythe Broad, que son igualmente ricos pero menos conocidos. En total, sus miembros valen 125 mil millones de dólares”.

The Guardian también señala que Rockefeller, Gates y Buffet organizaron la reunión. The Wall Street Journal informó que la reunión se centró en la desaceleración del crecimiento de la población, un eufemismo para la eugenesia. La aparición de Ted Turner tanto en la reunión de 2001 como en la reunión de 2010 no debería ser una sorpresa, ya que también ha sido un defensor vocal del control de la población.

También cabe señalar que a pesar de las negaciones de Bill Gates, también fue socio del depredador sexual Jeffrey Epstein. La escritora de TLAV Whitney Webb documentó previamente la relación y los intentos de ocultarla. Coincidentemente, Epstein también fue expuesto como un defensor de la eugenesia.

¿Se levantará el verdadero Bill Gates?

Ahora que hemos llegado al final de esta investigación sobre las vidas, las finanzas y la historia de Bill Gates, debemos detenernos a reflexionar sobre sus motivaciones. ¿Es Bill Gates el adorable filántropo multimillonario que podría salvar al mundo del COVID-19? ¿Es el financiador de los peligrosos ensayos de vacunas? ¿Está motivado por un deseo de ayudar a la humanidad o está motivado por una filosofía desacreditada o la ciencia de la raza y la eugenesia?
Si vamos a juzgar a un individuo por la empresa que mantiene, por los proyectos que financian y por las palabras que dicen, entonces debería quedar claro que la familia Gates tiene una historia de promoción y apoyo a la eugenesia. Armados con este conocimiento podemos echar un nuevo vistazo a la filantropía de Bill Gates y llegar a entender que podría tener motivos que son muy diferentes de sus declaraciones públicas.

El hecho es que Bill Gates corre en círculos de élite donde la promoción de la eugenesia, el control de la población, la esterilización y otras tácticas de ingeniería social son la norma. Este hombre está siendo apuntalado frente al mundo como el héroe que necesitamos desesperadamente para liberarnos de las garras de la pandemia de COVID-19. Si sus trucos de relaciones públicas y filantropía logran convencer a las personas de que él es el salvador que han estado buscando, es probable que nos enfrentemos a un futuro de vigilancia de rastreo de contactos, certificados digitales para viajar, vacunas forzadas, seguimiento y restricciones de todo movimiento y cuarentenas forzadas.

Lo único que se interpone entre Gates y su agenda son los corazones y las mentes libres del mundo. Nuestro tiempo es corto. Debemos organizarnos, compartir esta información vital y #ExposeBillGates.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 3: Vigilancia de la salud, Evento 201 y la conexión Rockefeller (thelastamericanvagabond.com)

The Last American Vagabond

15,472 MUERTOS 1.5 Millones de heridos (50% GRAVES) reportados en la base de datos de la Unión Europea de reacciones adversas a medicamentos por vacunas contra COVID-19

por Brian Shilhavy

Editor, Health Impact News

La base de datos europea de informes de presuntas reacciones a fármacos es EudraVigilance, que también rastrea los informes de lesiones y muertes tras las “vacunas” experimentales de COVID-19.

Un suscriptor de Europa nos envió recientemente un correo electrónico y nos recordó que esta base de datos mantenida en EudraVigilance es solo para países de Europa que forman parte de la Unión Europea (UE), que comprende 27 países.

El número total de países de Europa es mucho mayor, casi el doble, y se trata de unos 50, aunque existen algunas diferencias de opinión sobre qué países forman parte técnicamente de Europa.

Así que por muy altas que sean estas cifras, NO reflejan toda Europa. El número real en Europa de muertos o heridos debido a las vacunas contra el COVID-19 sería mucho mayor que el que estamos reportando aquí.

La base de datos de EudraVigilance informa que hasta el 19 de junio de 2021 hay 15,472 muertes y 1,509,266 lesiones reportadas después de las inyecciones de cuatro vacunas experimentales de COVID-19:

Del total de heridos registrados, la mitad de ellos (753.657) son heridos graves.

La gravedad proporciona información sobre el presunto efecto indeseable; se puede clasificar como ‘grave’ si corresponde a un incidente médico que resulta en la muerte,es potencialmente mortal, requiere hospitalización de pacientes hospitalizados, resulta en otra condición médicamente importante o prolongación de la hospitalización existente, resulta en una discapacidad o incapacidad persistente o significativa, o es una anomalía congénita / defecto congénito “.

Un suscriptor de Health Impact News en Europa publicó los informes de cada una de las cuatro vacunas de COVID-19 que estamos incluyendo aquí. Este suscriptor se ha ofrecido como voluntario para hacer esto, y es mucho trabajo tabular cada reacción con lesiones y muertes, ya que no hay lugar en el sistema EudraVigilance que hemos encontrado que tabula todos los resultados.

Desde que empezamos a publicar esto, otros de Europa también han calculado los números y confirmado los totales.*

Estos son los datos resumidos hasta el 19 de junio de 2021.

Reacciones totales para la vacuna experimental de ARNm Tozinameran (código BNT162b2,Comirnaty) de BioNTechPfizer: 7.420 muertes 560.256 lesiones hasta el 19/06/2021

  • 16.133 Trastornos de la sangre y del sistema linfático, incluidas 81 muertes
  • 12,637   Cardiac disorders incl. 964 deaths
  • 101 Trastornos congénitos, familiares y genéticos, incluidas 6 muertes
  • 7000 Trastornos del oído y del laberinto, incluidas 4 muertes
  • 265        Endocrine disorders incl. 1 death
  • 8.122 Trastornos oculares, incluidas 17 muertes
  • 51,030   Gastrointestinal disorders incl. 348 deaths
  • 155.486 Trastornos generales y condiciones del lugar de administración, incluidas 2.290 muertes
  • 468        Hepatobiliary disorders incl. 31 deaths
  • 6,110     Immune system disorders incl. 32 deaths
  • 17.549 Infecciones e infestaciones, incluidas 762 muertes
  • 6.275 Lesiones, envenenamiento y complicaciones procesales, incluidas 104 muertes
  • 13,249   Investigations incl. 285 deaths
  • 4.162 Trastornos del metabolismo y la nutrición, incluidas 139 muertes
  • 79.125 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 88 muertes
  • 325 Neoplasias benignas, malignas y no especificadas (incluidos quistes y pólipos) incl. 23 muertes
  • 100,895 Nervous system disorders incl. 780 deaths
  • 384 Embarazo, puerperio y afecciones perinatales, incluidas 10 muertes
  • 107        Product issues
  • 9,928     Psychiatric disorders incl. 105 deaths
  • 1.765 Trastornos renales y urinarios, incluidas 115 muertes
  • 2.696 Trastornos del aparato reproductor y mamarios, incluidas 3 muertes
  • 23.689 Trastornos respiratorios, torácicos y mediastínicos, incluidas 848 muertes
  • 26.641 Trastornos de la piel y del tejido subcutáneo, incluidas 66 muertes
  • 846        Social circumstances incl. 10 deaths
  • 281 Procedimientos quirúrgicos y médicos, incluidas 19 muertes
  • 14,987   Vascular disorders incl. 289 deaths

Reacciones totales para la vacuna experimental de ARNm mRNA-1273(CX-024414) de Moderna: 4.147 muertes y 122.643 heridos hasta el 19/06/2021

  • 2.239 Trastornos de la sangre y del sistema linfático, incluidas 29 muertes
  • 3,315     Cardiac disorders incl. 446 deaths
  • 39 Trastornos congénitos, familiares y genéticos, incluidas 3 muertes
  • 1,454     Ear and labyrinth disorders
  • 82           Endocrine disorders incl. 1 death
  • 1.883 Trastornos oculares, incluidas 7 muertes
  • 10.655 Trastornos gastrointestinales incl. 142 muertes
  • 33.936 Trastornos generales y condiciones del lugar de administración, incluidas 1.759 muertes
  • 209 Trastornos hepatobiliares incl. 11 muertes
  • 1.117 Trastornos del sistema inmunitario, incluidas 5 muertes
  • 3.835 Infecciones e infestaciones, incluidas 234 muertes
  • 2.480 Lesiones, envenenamiento y complicaciones procesales, incluidas 77 muertes
  • 2.670 Investigaciones, entre las que se supe 89 muertes
  • 1.297 Trastornos del metabolismo y la nutrición, incluidas 85 muertes
  • 15.131 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 77 muertes
  • 128 Neoplasias benignas, malignas y no especificadas (incluido. quistes y pólipos) incl. 15 muertes
  • 21.684 Trastornos del sistema nervioso, incluidas 424 muertes
  • 255 Embarazo, puerperio y afecciones perinatales, incluida la muerte por 2
  • 20 Problemas con el producto
  • 2.437 Trastornos psiquiátricos, incluidas 69 muertes
  • 807 Trastornos renales y urinarios, incluidas 52 muertes
  • 459 Trastornos del sistema reproductivo y de las mamas, incluida 1 muerte
  • 5.640 Trastornos respiratorios, torácicos y mediastínicos, incluidas 399 muertes
  • 6.538 Trastornos de la piel y del tejido subcutáneo, incluidas 28 muertes
  • 504 Circunstancias sociales, incluidas 13 muertes
  • 397 Procedimientos quirúrgicos y médicos, incluidas 38 muertes
  • 3.432 Trastornos vasculares incl. 141 muertes

Reacciones totales para la vacuna experimental AZD1222/VAXZEVRIA (CHADOX1 NCOV-19) de Oxford/ AstraZeneca3.364 muertes793.036 lesiones a 19/06/2021

  • 9.136 Trastornos de la sangre y del sistema linfático, incluidas 132 muertes
  • 12.135 Trastornos cardíacos incl. 396 muertes
  • 95 Trastornos congénitos, familiares y genéticos, incluidas 2 muertes
  • 8.797 Trastornos del oído y del laberinto
  • 309 Trastornos endocrinos incl. 2 muertes
  • 13.459 Trastornos oculares, incluidas 12 muertes
  • 81.806 Trastornos gastrointestinales incl. 161 muertes
  • 212.663 Trastornos generales y condiciones del lugar de administración, incluidas 891 muertes
  • 525 Trastornos hepatobiliares incl. 25 muertes
  • 3.085 Trastornos del sistema inmunitario, incluidas 11 muertes
  • 17.791 Infecciones e infestaciones, incluidas 217 muertes
  • 7.854 Lesiones, envenenamiento y complicaciones procesales, incluidas 77 muertes
  • 16.731 Investigaciones, entre las que se han fallecido 79
  • 9.765 Trastornos del metabolismo y la nutrición, incluidas 50 muertes
  • 123.637 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 45 muertes
  • 332 Neoplasias benignas, malignas y no especificadas (incluidos quistes y pólipos) incl. 8 muertes
  • 169.286 Trastornos del sistema nervioso, incluidas 532 muertes
  • 223 Embarazo, puerperio y afecciones perinatales, incluidas 4 muertes
  • 103 Problemas del producto
  • 14.931 Trastornos psiquiátricos, incluidas 27 muertes
  • 2.809 Trastornos renales y urinarios, incluidas 29 muertes
  • 5.967 Trastornos del sistema reproductivo y de la mama
  • 26.631 Trastornos respiratorios, torácicos y mediastínicos, incluidas 387 muertes
  • 36.457 Trastornos de la piel y del tejido subcutáneo, incluidas 22 muertes
  • 772 Circunstancias sociales, incluidas 4 muertes
  • 671 Procedimientos quirúrgicos y médicos, incluidas 16 muertes
  • 17.066 Trastornos vasculares incl. 235 muertes

Reacciones totales para la vacuna experimental covid-19 JANSSEN (AD26. COV2. S) de Johnson &Johnson541 muertes 33, 331 lesiones a 19/06/2021

  • 306 Trastornos de la sangre y del sistema linfático, incluidas 16 muertes
  • 496 Trastornos cardíacos incl. 56 muertes
  • 14 Trastornos congénitos, familiares y genéticos
  • 177 Trastornos del oído y del laberinto
  • 8 Trastornos endocrinos incluido. 1 muerte
  • 383 Trastornos oculares incl. 3 muertes
  • 3.086 Trastornos gastrointestinales incl. 23 muertes
  • 8.761 Trastornos generales y condiciones del lugar de administración, incluidas 137 muertes
  • 52 Trastornos hepatobiliares incl. 4 muertes
  • 85 Trastornos del sistema inmunitario
  • 392 Infecciones e infestaciones incl. 13 muertes
  • 320 Lesiones, envenenamiento y complicaciones del procedimiento, incluidas 8 muertes
  • 2.003 Investigaciones, entre las que se han fallecido 37
  • 184 Trastornos del metabolismo y la nutrición, incluidas 10 muertes
  • 5.718 Trastornos musculoesqueléticos y del tejido conectivo, incluidas 17 muertes
  • 16 Neoplasias benignas, malignas y no especificadas (incluido. quistes y pólipos)
  • 7.093 Trastornos del sistema nervioso, incluidas 68 muertes
  • 9 Embarazo, puerperio y afecciones perinatales, incluida 1 muerte
  • 9             Product issues
  • 355 Trastornos psiquiátricos incl. 5 muertes
  • 119        Renal and urinary disorders incl. 8 deaths
  • 114 Trastornos del sistema reproductivo y de la mama
  • 1.130 Trastornos respiratorios, torácicos y mediastínicos, incluidas 43 muertes
  • 804 Trastornos de la piel y del tejido subcutáneo, incluidas 2 muertes
  • 72           Social circumstances incl. 3 deaths
  • 336 Procedimientos quirúrgicos y médicos, incluidas 26 muertes
  • 1,289     Vascular disorders incl. 60 deaths

*Estos totales son estimaciones basadas en informes presentados a EudraVigilance. Los totales pueden ser mucho más altos en función del porcentaje de reacciones adversas que se notifican. Algunos de estos informes también pueden ser reportados a las bases de datos de reacciones adversas de cada país, como la base de datos VAERS de los Estados Unidos y el sistema de tarjetas amarillas del Reino Unido. Las muertes se agrupan por síntomas, y algunas muertes pueden haber resultado de múltiples síntomas.

15,472 MUERTOS 1.5 Millones de heridos (50% GRAVES) reportados en la base de datos de la Unión Europea de reacciones adversas a medicamentos por vacunas contra COVID-19 (healthimpactnews.com)

La Dra. Nadiya Popel, atacada por el Estado por hablar de las vacunas

Esta señora puede tener razón o no tenerla, pero tiene derecho a expresar su opinión. El Centro médico si no esta de acuerdo debe sacar datos para demostrarlo. El no argumentar y castigar va contra el derecho de los ciudadanos a estar informados. Más transparencia y menos medidas disciplinarias!!

Dirigida a la Junta de Personal del Hospital Mateu Orfila, Menorca, islas Baleares


Yo, Nadiya Popel, con DNI XXXXXXXX, EA de Urgencias del Hospital Mateu Orfila en presencia de la Junta del Hospital, incluyendo los representantes sindicales, denuncio las graves irregularidades que están sucediendo en estos momentos en el Hospital y en toda el área de salud de Menorca.

Las irregularidades son:

1. Ocultación ante la población de los efectos secundarios de las vacunas experimentales anti Covid.

2. Ocultación del hecho que todas las vacunas son Experimentales, ensayo clínico en Fase III. Ensayo clínico que acaba en el año 2023.

3. Ocultación de los compuestos tóxicos en las vacunas como SM-102 cloroformo.

4. Ocultacion de que las vacunas anti COVID producen afectacion genética con rotura de ADN y cambios en el genoma humano.

5. Incumplimiento de 30 artículos del Codigo deontológico Médico.

6. Incumpimiento del Juramento Hipocrático.

7. No dar informacón sobre la imantación en zonas de la inyeccion de las vacunas anti COVID y por todo el cuerpo en los vacunados.

8. Incumplimiento del Código de Núremberg sobre a experimentación en los humanos.

9. No asignación de un médico y un enfermero que vaya a hacer segumiento de este ensayo clínico.

10. No realización del consentimiento informado antes del procedmiento/consentimiento informado incompleto.

11. No tomar responsabilidad ni hacer seguimento de las personas afectadas.

12. Politización de la medicina.

13. No atender a mis repetidos avisos del peligro de las vacunas anti COVID y no realizar una profunda investigación.

14. No convocar un debate científico sobre el tema ni asignar un equipo de investigación urgente.

15. Transgredir los derechos fundamentales de la constitución espanola de la libre expresión y manifestación.

16. Dar directrices incorrectas sobre el manejo de esta situación socio-sanitaria.

17. Transgredir la ley de protección de datos personales utilizandode teléfono personal de las personas para llamarles a su donicilos, sin que ellos lo hayan solicitado. Repetir las llamadas hasta 4 veces.

18. Ocultación de las muertes por las vacunas anti COVD.

19. No realización de las autopsias en personas fallecidas afectadas por la iatrogenia de las vacuna.

20. Incumplimiento del Convenio de Oviedo.


1. Suspensión inmediata de la administracon de las vacunas anti COVID.

2. Restitución immediata de mi persona en el trabajo para que pueda formar parte de un comité científico de investigación y seguimiento de las personas afectadas.

3. Formación de un comité científico urgente sobre las vacunas anti COVID.

4. Urgente comunicación a la poblacion de la situación de IATROGENIA de las vacunas ANTI COVID.

5. Exposición de la información sobre los compuestos tóxicos de las vacuras anti COVID y mecanismo de acción.

6. Realización de las autopsias en los fallecidos sospechosos de IATROGENIA con ESPECIAL atención sobre el cerebro (si contiene nanopartículas).

7. La búsqueda urgente de la reversión y la neutralización de los efectos dañinos de las vacunas anti Covid.

8. Denuncia de las protocolos incorrectos.

9. Divulgación de la informacion a la población sobre las terapias génicas.

10. Divulgación de la información sobre el uso de nanopartículas en las vacunas anti Covid.

11. Divulgación sobre el contenido de grafeno en las vacunas anti Covid.

12. Pedir perdón a la población por olvidar los principios éticos de la medicina y elegir obediencia ciega a los intereses políticos.

Se adjunta la documentación mencionada en la denuncia.

En Mahon, a 1 de junio, 2021
Dra. Nadiya Popel.

Contra el encierro de la gente: Denuncia de la Dra. Nadiya Popel, hospital Mateu Orfila de Menorca

Contra el encierro de la gente: La Dra. Nadiya Popel, atacada por el Estado por hablar, contesta en una carta

Nadiya Popel denuncia la ocultación de efectos adversos de las vacunas (menorca.info)

Magníficas entrevistas en Cop225 y La Quinta Columna a Nadia Popel, la doctora expedientada en Baleares por denunciar las vacunas, escuchen sus palabras con atención – El Diestro


Médico de pueblo vs la gran farsa


Charles Hoffe ha sido médico durante 28 años en la pequeña ciudad rural de Lytton en Columbia Británica, Canadá. La ciudad está compuesta por muchos grupos indígenas de las “Primeras Naciones”.

Cuando el Dr. Hoffe recibió 900 dosis de las inyecciones de COVID-19 experimentales de Moderna administró las dosis a través de la Clínica Médica Lytton a quienes las querían.

Eligió no inyectarse él mismo.

El Dr. Hoffe informa que el resultado de inyectar a 900 personas entre la comunidad indígena de las Primeras Naciones fue que dos personas sufrieron un shock anafiláctico, una persona murió y varias otras han sufrido lo que parecen ser discapacidades permanentes. Relata cómo una de sus pacientes siente tanto dolor ahora que prefiere la muerte a continuar una vida de sufrimiento.

Durante el “pico” de la supuesta pandemia, en 2020, nadie en la comunidad murió o quedó incapacitado.

El Dr. Hoffe informó estas reacciones adversas por correo electrónico al personal médico de su comunidad que fue responsable del lanzamiento de las vacunas Moderna, que incluía a farmacéuticos, enfermeras y médicos de su área, un total de aproximadamente 18 personas, dice.

Su correo electrónico expresó una gran preocupación por los efectos secundarios que estaba viendo, y preguntó si tal vez deberían pausar las inyecciones por un tiempo.

En 48 horas recibió una severa reprimenda de sus superiores de la Autoridad Sanitaria Interior acusándolo de causar “dudas por las vacunas” y que iban a denunciarlo al BC College of Physicians and Surgeons.

Le prohibieron formular ninguna crítica a las inyecciones de Moderna, emitiendo una orden de silencio en su contra al más puro estilo “La Inquisición contra Galileo”.

El Dr. Hoffe explica que este es un método de intimidación que se está utilizando contra otros médicos que tienen demasiado miedo de hablar, porque el Colegio de Médicos y Cirujanos tiene una gran autoridad para cerrar las carreras de los médicos o multarlos fuertemente.

A medida que siguió viendo más lesiones la semana siguiente, su enojo contra la orden de silencio fue en aumento. Le dijeron que si tenía alguna inquietud sobre las inyecciones, debía comunicarse con el oficial médico de salud a cargo del despliegue de Moderna.

Lo hizo, pero cuando no recibió una respuesta, decidió escribir una carta abierta directamente a la Dra. Bonnie Henry, Oficial de Salud Provincial de Columbia Británica, en desafío directo a la “ley del silencio” que se le impuso, en los siguientes términos:

Dr. Charles D. Hoffe, BSc, MB, BCh, LMCC
Lytton Medical Clinic
Lytton BC V0K 1Z0

5 de abril de 2021

Dra. Bonnie Henry,
Oficial de Salud Provincial de Columbia Británica
Ministerio de Salud
1515 Blanchard Street
Victoria, BC, V8W 3C9

Estimada Dra. Henry

La primera dosis de la vacuna Moderna ha sido recientemente administrada a algunos de mis pacientes en la comunidad de Lytton, BC. Esto comenzó con los miembros de las Primeras Naciones de nuestra comunidad a mediados de enero de 2021. Ahora se han administrado 900 dosis.

Me ha alarmado bastante la alta tasa de efectos secundarios graves de este nuevo tratamiento. De este número relativamente pequeño de personas vacunadas hasta ahora, hemos tenido:

Numerosas reacciones alérgicas, con dos casos de anafilaxia.

Una vacuna (al parecer) indujo muerte súbita, (en un paciente de 72 años con EPOC. Este paciente se quejaba de tener dificultad para respirar después de recibir la vacuna, y murió repentina e inesperadamente el día 24, después de la vacuna. Carecía de antecedentes de enfermedad cardiovascular).

Tres personas con déficits neurológicos continuos e incapacitantes, con dolor crónico asociado, que persisten durante más de 10 semanas después de su primera vacuna. Estos déficits neurológicos incluyen: mareos continuos e incapacitantes, debilidad neuromuscular generalizada o localizada, con o sin pérdida sensorial. El dolor crónico en estos pacientes es generalizado o regional, con o sin cefalea.

En resumen, en nuestra pequeña comunidad de Lytton, BC, tenemos una persona muerta y tres personas que parecen estar permanentemente discapacitadas, luego de su primera dosis de la vacuna Moderna. La edad de los afectados oscila entre los 38 y los 82 años.

Entonces tengo un par de preguntas y comentarios:

¿Se consideran estos efectos secundarios normales y aceptables a largo plazo para la terapia de modificación genética? A juzgar por los informes médicos de todo el mundo, nuestra experiencia con Lytton no es inusual.

¿Tiene idea de qué procesos patológicos pueden haberse iniciado para producir estos síntomas neurológicos continuos?

¿Tiene alguna sugerencia sobre cómo debería tratar la debilidad neurológica inducida por la vacuna, los mareos, la pérdida sensorial y los síndromes de dolor crónico en estas personas, o deberían simplemente derivarlos a todos a un neurólogo? Anticipo que seguirán muchos más, a medida que se lance la vacuna. Esta fue solo la fase uno y la primera dosis.

En marcado contraste con los efectos nocivos de esta vacuna en nuestra comunidad, no hemos tenido que brindar ningún tipo de atención médica a nadie con Covid-19. Debemos deducir que, en nuestra limitada experiencia, esta vacuna resulta claramente más peligrosa que el Covid.

Me doy cuenta de que toda terapia médica tiene una relación riesgo-beneficio, y que las enfermedades graves requieren medicamentos serios. Pero ahora sabemos que la tasa de recuperación de Covid-19 es similar a la de la gripe estacional, en todas las categorías de edad. Además, es bien sabido que los efectos secundarios después de una segunda inyección son significativamente peores que los de la primera. Así que lo peor aún está por llegar.

Debe enfatizarse que estas personas no eran personas enfermas. Se trataba de personas previamente sanas a las que se les ofreció una terapia experimental, con efectos secundarios desconocidos a largo plazo, para protegerlas contra una enfermedad que tiene la misma tasa de mortalidad que la gripe. Lamentablemente, sus vidas ahora están arruinadas.

Normalmente se considera un principio fundamental de la ética médica interrumpir un ensayo clínico si se demuestra un daño significativo del tratamiento bajo investigación.

Entonces, mi última pregunta es la siguiente: ¿Es ético desde el punto de vista médico continuar con el lanzamiento de esta vacuna, en vista de la gravedad de estos efectos secundarios que alteran la vida solo después de la primera inyección? En Lytton, BC, tenemos una incidencia de 1 en 225 de efectos secundarios graves que alteran la vida, debido a esta terapia de modificación genética experimental.

También he notado que estos efectos secundarios inducidos por la vacuna casi no son reportados por los responsables de su lanzamiento. Soy consciente de que esto suele ser un problema, con las vacunas en general, y que los efectos secundarios retardados después de las vacunas a veces se etiquetan como “coincidencias”, ya que la causalidad a menudo es difícil de probar. Sin embargo, en vista del hecho de que se trata de un tratamiento experimental, sin datos de seguridad a largo plazo, creo que quizás este tema también debería ser abordado.

Además, he notado que el formulario provincial de notificación de lesiones por vacunas, que fue claramente diseñado para vacunas convencionales, ni siquiera tiene lugar para informar las lesiones por vacunas de la naturaleza y gravedad que estamos viendo en esta nueva terapia de ARNm.

Ahora es claramente evidente, con evidencia médica de todo el mundo, que los perfiles de efectos secundarios de las diversas terapias de modificación genética contra Covid-19 han sido muy subestimados por sus fabricantes, que estaban ansiosos por demostrar su seguridad.

Gracias por su atención a este asunto de salud pública críticamente urgente.

Suyo sinceramente,

Dr. Charles Hoffe

El IH (Interior Health) respondió a su carta públicamente con una réplica que fue publicada en el Ashcroft Cache Creek Journal en un claro intento por hacer un “control de daños” y atacar al Dr. Hoffe.

IH dice que las vacunas COVID-19 son seguras a pesar de las afirmaciones del médico de Lytton
El médico hace afirmaciones sin fundamento sobre los efectos secundarios graves de la vacuna Moderna

Interior Health (IH) está tranquilizando a Lytton y a los residentes del área sobre la seguridad de las vacunas COVID-19, luego de que un médico de esa comunidad compartiera una carta en la que afirmaba que la muerte de un residente de Lytton estaba relacionada con la vacuna Moderna.

En una carta a la funcionaria provincial de salud, la Dra. Bonnie Henry, con fecha del 5 de abril, el Dr. Charles Hoffe afirmó que había habido “numerosas” reacciones alérgicas, incluidos dos casos de anafilaxia, entre las personas en Lytton y el área que habían recibido la vacuna Moderna. También afirmó que tres personas presentaban déficits neurológicos “continuos e incapacitantes”.

Hoffe también afirmó que “supone” que la muerte de un paciente de 72 años con EPOC, 24 días después de que el hombre fue vacunado, fue inducida por la vacuna. El médico no presentó ninguna prueba para demostrar que alguno de los eventos fuera el resultado de la vacuna.

“Ha sido un desafío para nosotros investigar esto a fondo y tomar los informes en serio”, dice la Dra. Carol Fenton, Oficial de Salud Médica de IH. En una declaración escrita emitida el 14 de abril, Fenton dice que “no ha habido muertes o reacciones adversas duraderas relacionadas con las vacunas Moderna/Pfizer, o cualquier vacuna COVID-19, en Lytton, Interior Health o BC en este momento”.

La declaración agrega que IH sabe inequívocamente que las vacunas son más seguras que el propio Covid-19, y que se ha demostrado que las vacunas son fiables y efectivas a través de todos los niveles de ensayos clínicos.

“Existe un proceso detallado para revisar todos los efectos adversos después de las vacunas, y todos los eventos graves se registran y se informan a nivel provincial y nacional para monitorear las señales de seguridad que pueden pasarse por alto a nivel local. Con la información que tenemos del lanzamiento de la vacuna hasta ahora, las vacunas Covid-19 son muy seguras “.

Fenton le dice al Journal que, si bien siempre habrá algunas variaciones entre los médicos, cuando se trata de la seguridad de las vacunas, es importante mirar los informes basados en el consenso de aquellos que están capacitados en el campo.

“Estas personas son los expertos de los expertos”, dice. “Puedo responder la mayoría de las preguntas sobre vacunas, pero no me considero un experto en vacunas. Las decisiones y los análisis los definen personas con las habilidades y la experiencia para analizar la información que tenemos”.

Las clínicas de inmunización administradas por IH cuentan con vacunadores capacitados en el lugar para monitorear y responder a reacciones alérgicas y anafilácticas, que son raras, pero que pueden ocurrir con cualquier vacuna o medicamento.

“La seguridad de las personas en Lytton, Nlaka’pamux, Northern St’at’imc Nations y todas las comunidades es la máxima prioridad, y nuestra recomendación es que todas las personas deben vacunarse cuando sean elegibles”, dice el comunicado.

Básicamente, lo mismo que estamos viendo en el resto del mundo cuando médicos honestos se presentan e informan la verdad.

Las autoridades sanitarias mienten. Sin ciencia, sin estadísticas, solo un llamamiento a la autoridad, un insultante “Sabemos de lo que estamos hablando, pero este médico no”.

El Dr. Hoffe ha servido a los miembros de su comunidad durante 28 años y tenía una reputación intachable entre sus pacientes, con excelentes reseñas en línea.

Ahora se informa en algunos sitios de redes sociales que a sus pacientes se les dice que ya no está disponible para reunirse con ellos.

(Fuente: Astillas de realidad: DAVID CONTRA GOLIAT: MÉDICO CANADIENSE DENUNCIA QUE LAS “VACUNAS COVID” MATARON O INCAPACITARON A MIEMBROS DE SU COMUNIDAD; https://healthimpactnews.com/; traducido por https://ejercitoremanente.com/)

¿Podrían las vacunas contra el ARNm alterar permanentemente el ADN? La ciencia reciente sugiere que podrían.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might.

Por Equipo de Defensa de la Salud Infantil

La investigación sobre el ARN SARS-CoV-2 realizada por científicos de Harvard y el MIT tiene implicaciones sobre cómo las vacunas contra el ARNM podrían alterar permanentemente el ADN genómico, según Doug Corrigan, Ph.D., un biólogo bioquímico-molecular que dice que se necesita más investigación.

Durante el año pasado, sería casi imposible para los estadounidenses no darse cuenta de la decisión de los medios de comunicación de hacer de las vacunas la narrativa dominante de COVID, apresurada a hacerlo incluso antes de que ocurrieran muertes atribuidas al coronavirus.

La cobertura inclinada de los medios de comunicación ha proporcionado un impulso particularmente fructífero de las relaciones públicas para las vacunas con ARN mensajero (ARNM), décadas en desarrollo pero nunca aprobadas para uso humano, ayudando a acercar la tecnología experimental a la línea de meta regulatoria.

En circunstancias ordinarias, el cuerpo produce (“transcribes”) ARNm a partir del ADN en el núcleo de una célula. A continuación, el ARNM viaja fuera del núcleo hacia el citoplasma, donde proporciona instrucciones sobre qué proteínas hacer.

En comparación, las vacunas contra el ARNM envían su carga útil de ARNm sintetizada químicamente (incluida con instrucciones de fabricación de proteínas de pico) directamente al citoplasma.

Según los Centros para el Control y la Prevención de Enfermedades (CDC) y la mayoría de los científicos de vacunas contra el ARNM, el dinero se detiene allí: las vacunas contra el ARNM “no afectan ni interactúan con nuestro ADN de ninguna manera”, dicen los CDC. Los CDC afirman primero que el ARNM no puede entrar en el núcleo de la célula (donde reside el ADN), y segundo, que la célula , al estilo Misión Imposible, “se deshace del ARNm poco después de que termine de usar las instrucciones”.

Una preimpresión de diciembre sobre el SARS-CoV-2, por científicos del Instituto Tecnológico de Harvard y Massachusetts (MIT), produjo hallazgos sobre coronavirus salvajes que plantean preguntas sobre cómo funciona el ARN viral.

Los científicos llevaron a cabo el análisis porque estaban “perplejos por el hecho de que hay un número respetable de personas que están dio positivo para COVID-19 por PCR mucho después de que la infección se había ido”.

Sus hallazgos clave fueron los siguientes: los RNAs SARS-CoV-2 “pueden ser transcritos inversamente en células humanas”, “estas secuencias de ADN se pueden integrar en el genoma celular y posteriormente ser transcritas” (un fenómeno llamado “integración retro”) y hay vías celulares viables para explicar cómo sucede esto.

Según el doctor en bioquímica y biólogo molecular Dr. Doug Corrigan,estos importantes hallazgos (que van en contra del “dogma biológico actual”) pertenecen a la categoría de “Cosas que estábamos absolutamente e inequívocamente seguros de que no podían suceder lo que realmente sucedió”.

Los hallazgos de los investigadores de Harvard y el MIT también pusieron las suposiciones de los CDC sobre las vacunas contra el ARNM en terreno más inestable, según Corrigan. De hecho, un mes antes de que apareciera la preimpresión Harvard-MIT, Corrigan ya había escrito un blog en el que se esbozaban posibles mecanismos y vías por las que las vacunas contra el ARNM podían producir el fenómeno idéntico.

En una segunda entrada de blog, escrita después de que la preimpresión salió a la bolsa, Corrigan enfatizó que los hallazgos de Harvard-MIT sobre el ARN coronavirus tienen implicaciones importantes para las vacunas contra el ARNM, un hecho que describe como “el gran elefante en la habitación”. Aunque no afirma que el ARN de la vacuna necesariamente se comportará de la misma manera que el ARN coronavirus , es decir, alterando permanentemente el ADN genómico, Corrigan cree que la posibilidad existe y merece un escrutinio estrecho.

En opinión de Corrigan, la contribución de la preimpresión es que “valida que esto es al menos plausible, y muy probablemente probable”.

transcripción inversa

Como la frase “transcripción inversa” implica, la vía de ADN a ARNm no siempre es una calle de un solo sentido. Las enzimas llamadas transcriptasas inversas también pueden convertir el ARN en ADN, permitiendo que esta última se integre en el ADN en el núcleo celular.

Tampoco es poco frecuente la transcripción inversa. Los genetistas informan que “más del 40% de los genomas de mamíferos comprenden los productos de la transcripción inversa”.

La evidencia preliminar citada por los investigadores de Harvard-MIT indica que las enzimas transcriptasa inversas endógenas pueden facilitar la transcripción inversa de los ANR coronavirus y desencadenar su integración en el genoma humano.

Los autores sugieren que si bien las consecuencias clínicas requieren más estudio, los efectos perjudiciales son una posibilidad distinta y, dependiendo de los “sitios de inserción en el genoma humano” de los fragmentos virales integrados y del estado de salud subyacente de un individuo, podrían incluir “una respuesta inmune más grave … como una ‘tormenta de citoquinas’ o reacciones autoinmunes”.

En 2012, un estudio sugirió que la integración del genoma viral podría “conducir a consecuencias drásticas para la célula huésped, incluyendo la alteración genética, la mutagénesis insertal y la muerte celular”.

Corrigan hace un punto de decir que las vías hipotizadas para facilitar la retro-integración del ARN viral – o vacuna – en el ADN “no son desconocidas para las personas que entienden la biología molecular a un nivel más profundo”.

Aun así, la discusión de la preimpresión sobre la transcripción inversa y la integración del genoma provocó una vorágine de comentarios negativos de lectores reacios a repensar el dogma biológico, algunos de los cuales incluso abogaron por la retractación (aunque las preimpresiones son, por definición, inéditas) con el argumento de que “teóricos de la conspiración … llevará este documento a la “prueba” de que las vacunas contra el ARNM pueden, de hecho, alterar su código genético”.

Los lectores más reflexivos estuvieron de acuerdo con Corrigan en que el documento plantea preguntas importantes. Por ejemplo, un lector declaró que falta evidencia confirmatoria “para mostrar que la proteína de pico sólo se expresa por un corto período de tiempo (digamos 1-3 días) después de la vacunación”, y agregó: “Creemos que este es el caso, pero no hay evidencia para eso”.

De hecho, el tiempo que el ARNm sintético de las vacunas —y por lo tanto las instrucciones para que las células sigan fabricando proteína de espiga— persisten dentro de las células es una pregunta abierta.

Normalmente, el ARN es una molécula “notoriamente frágil” e inestable. Según los científicos, “esta fragilidad es cierta en el ARNm de cualquier ser vivo, ya sea que pertenezca a una planta, bacterias, virus o humanos”.

Pero el ARN sintético en las vacunas COVID es una historia diferente. De hecho, el paso que finalmente permitió a los científicos y fabricantes de vacunas resolver su impasse de la vacuna contra el ARNM de décadas fue cuando descubrieron cómo modificar químicamente el ARNM para aumentar su estabilidad y longevidad, es decir, producir ARN “que se queda en la célula mucho más tiempo que el ARN viral, o incluso arneses que nuestra célula normalmente produce para la producción normal de proteínas”.

Nadie sabe lo que está haciendo el ARNm sintético mientras está “dando vueltas”, pero Corrigan especula que su mayor longevidad aumenta la probabilidad de que “se convierta en ADN”.

Además, debido a que el ARNM de la vacuna también está diseñado para ser más eficiente al traducirse en proteínas, “los efectos negativos podrían ser más frecuentes y más pronunciados con la vacuna en comparación con el virus natural”.

Señales de dólar

Corrigan reconoce que algunas personas pueden rechazar sus advertencias, diciendo: “Si el virus es capaz de lograr esto, entonces ¿por qué debería importarme si la vacuna hace lo mismo?”

Tiene una respuesta lista y convincente:

“Hay una gran diferencia entre el escenario en el que las personas al azar, y sin darse cuenta, tienen su genética en mono porque estaban expuestas al coronavirus, y el escenario en el que vacunamos deliberadamente a miles de millones de personas mientras les decimos que esto no está sucediendo”.

Lamentablemente, la actitud predominante parece ser que la “carrera para vacunar al público” justifica la asunción de estos riesgos adicionales.

A mediados de noviembre, después de que el Jerusalem Post dijera a los lectores que “cuando el mundo comience a inocularse con estas vacunas completamente nuevas y revolucionarias, no sabrá prácticamente nada sobre sus efectos a largo plazo”, un director de hospital israelí argumentó que no vale la pena esperar dos años más para eliminar los “riesgos únicos y desconocidos” o los posibles efectos a largo plazo de las vacunas contra el ARNM.

En los Estados Unidos, el entusiasmo por la tecnología de ARNm es igualmente sin restricciones. Apenas unos días después de que los CDC publicaran datos actualizados que mostraban que más de 2.200 muertes de personas que habían recibido las vacunas contra el ARNm Pfizer o Moderna habían sido reportadas a partir del 26 de marzo, The Atlantic elogió la tecnología, sugiriendo que la “ingeniosa” tecnología sintética de ARNM detrás de las vacunas COVID de Pfizer y Moderna representaba un “avance” que podría “cambiar el mundo”.

En lugar de descartar la perspectiva de la integración retro del ADN extranjero como una “teoría de la conspiración”, los científicos deberían estar llevando a cabo estudios con el ARNm vacunado para evaluar los riesgos reales.

Por ejemplo, Corrigan cree que si bien los datos in vitro en líneas celulares humanas (una de las fuentes de datos examinadas por los investigadores de Harvard-MIT) ofrecen resultados “herméticos”, todavía hay una necesidad de demostrar concluyentemente la alteración genómica de la vida real a través de “PCR, secuenciación de ADN o Blot del Sur … ADN genómico purificado de pacientes con COVID-19″ y individuos vacunados.

Sin embargo, en lugar de abordar estas brechas de investigación, las empresas están salivando sobre el potencial de utilizar el ARNm editado por humanos para “comandar nuestra maquinaria celular” y “hacer casi cualquier proteína bajo el sol”.

Un comunicado de prensa del 10 de marzo en el que se pronunciaban las vacunas contra el ARNM, los claros ganadores de la carrera vacunal COVID-19 señalaron que todas las principales compañías farmacéuticas están ahora “probando la tecnología [mRNA] mediante la celebración de acuerdos de licencia y/o colaboración con empresas de ARN bien establecidas”.

En viejos dibujos animados de Disney, los espectadores a menudo presenciaban al tío rico del Pato Donald, Scrooge McDuck, “ojos abultados [se convierten] en signos de dólares de máquinas tragamonedas de Las Vegas de gran tamaño” al contemplar oportunidades para aumentar su ya inmensa riqueza.

A juzgar por la disposición de los ejecutivos de las compañías farmacéuticas a pasar por alto los riesgos a largo plazo y posiblemente multigeneracionales de las vacunas contra el ARNM, deben estar igualmente atraídos por visiones de signo de dólar de una interminable cartera de productos de ARNm “plug and play”.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might. • Children’s Health Defense

Ex vicepresidente de Pfizer: ‘Totalmente posible, esto se utilizará para la despoblación a gran escala’

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’

por Mordechai Sones

Los Médicos de Primera Línea de Estados Unidos (AFLDS) hablaron con el ex Vicepresidente y Director científico de Pfizer, Dr. Mike Yeadon, sobre sus puntos de vista sobre la vacuna COVID-19, hidroxicloroquina e ivermectina, las autoridades reguladoras y más.

Al principio, el Dr. Yeadon dijo: “Soy muy consciente de los crímenes globales contra la humanidad perpetrados contra una gran proporción de la población mundial.

“Siento un gran miedo, pero no me disuaden de dar testimonio de expertos a múltiples grupos de abogados capaces como Rocco Galati en Canadá y Reiner Fuellmich en Alemania.

“No tengo ninguna duda de que estamos en presencia del mal (no una determinación que he tomado antes en una carrera de investigación de 40 años) y productos peligrosos.

“En el Reino Unido, está muy claro que las autoridades están empeñadas en un curso que dará lugar a la administración de ‘vacunas’ a tanta población como puedan. Esto es una locura, porque incluso si estos agentes fueran legítimos, la protección sólo es necesaria por aquellos con un riesgo notablemente elevado de muerte por el virus. En esas personas, incluso podría haber un argumento de que vale la pena asumir los riesgos. Y definitivamente hay riesgos que son lo que yo llamo “mecanicista”: incorporado en la forma en que funcionan.

“Pero todas las demás personas, las que están en buen estado de salud y menores de 60 años, tal vez un poco mayores, no perecen por el virus. En este gran grupo, es totalmente poco ético administrar algo novedoso y para el que el potencial de efectos no deseados después de unos meses es completamente poco característico.

“En ninguna otra época sería prudente hacer lo que se dice como la intención.

“Como lo sé con certeza, y sé que los que lo conducen también lo saben, tenemos que preguntar: ¿Cuál es su motivo?

“Aunque no lo sé, tengo respuestas teóricas fuertes, sólo una de las cuales se relaciona con el dinero y ese motivo no funciona, porque el mismo cuántico se puede llegar duplicando el costo unitario y dando el agente a la mitad de la gente. Dilema resuelto. Así que es otra cosa.
Apreciando que, por toda la población, también se pretende que los niños menores y eventualmente los bebés sean incluidos en la red, y eso es lo que interpreto como un acto malvado.

“No hay ninguna razón médica para ello. Sabiendo como lo hago que el diseño de estas “vacunas” resulta, en la expresión en los cuerpos de los receptores, la expresión de la proteína de pico, que tiene efectos biológicos adversos propios que, en algunas personas, son perjudiciales (iniciar la coagulación de la sangre y activar el ‘sistema de complemento’ inmune), estoy decidido a señalar que aquellos que no están en riesgo de este virus no deben estar expuestos al riesgo de efectos no deseados de estos agentes.”

AFLDS: La decisión de la Corte Suprema de Israel la semana pasada de cancelar las restricciones de vuelo covid dijo: “En el futuro, cualquier nueva restricción a los viajes hacia o fuera de Israel necesita, en términos legales, una base integral, fáctica y basada en datos”.

En una charla que dio hace cuatro meses, dijiste

“La duración más probable de la inmunidad a un virus respiratorio como el SARS CoV-2 es de varios años. ¿Por qué digo eso? En realidad tenemos los datos de un virus que arrasó partes del mundo hace diecisiete años llamado SARS, y recordamos que el SARS CoV-2 es un 80% similar al SRAS, así que creo que esa es la mejor comparación que cualquiera puede proporcionar.

“La evidencia es clara: estos inmunólogos celulares muy inteligentes estudiaron a todas las personas que podían conseguir que habían sobrevivido al SRAS hace 17 años. Tomaron una muestra de sangre, y analizaron si respondieron o no al SRAS original y todos lo hicieron; todos tenían una memoria celular T perfectamente normal y robusta. En realidad también estaban protegidos contra el SARS CoV-2, porque son muy similares; es inmunidad cruzada.

“Por lo tanto, yo diría que los mejores datos que existen es que la inmunidad debe ser robusta durante al menos 17 años. Creo que es totalmente posible que sea de por vida. El estilo de las respuestas de las células T de estas personas era el mismo que si te hubieran vacunado y luego vuelves años más tarde para ver si esa inmunidad se ha conservado. Así que creo que la evidencia es realmente fuerte de que la duración de la inmunidad será de varios años, y posiblemente de por vida.

En otras palabras, la exposición previa al SRAS – es decir, una variante similar al SARS CoV-2 – otorgó inmunidad al SARS CoV-2.

El gobierno de Israel cita nuevas variantes para justificar bloqueos, cierres de vuelos, restricciones y emisión de pasaportes verdes. Dado el veredicto de la Corte Suprema, ¿cree que es posible adelantar futuras medidas gubernamentales con información precisa sobre variantes, inmunidad, inmunidad de rebaño, etc. que podrían proporcionarse a los abogados que impugnarán esas medidas futuras?

Yeadon: “Lo que delineé en relación con la inmunidad al SRAS es precisamente lo que estamos viendo con el SARS-CoV-2.
El estudio es de uno de los mejores laboratorios en su campo.

“Por lo tanto, teóricamente, las personas podrían probar su inmunidad de células T midiendo las respuestas de las células en una pequeña muestra de su sangre. Hay tales pruebas, no son de “alto rendimiento” y es probable que cueste unos pocos cientos de USD cada una en escala. Pero no miles. La prueba que conozco aún no está disponible comercialmente, pero la investigación sólo en el Reino Unido.

“Sin embargo, espero que la compañía pueda ser inducida a proporcionar kits de prueba “para la investigación” a escala, sujeto a un acuerdo. Si usted fuera a organizar para probar unos pocos miles de israelíes no vacunados, puede ser una espada de doble filo. Según otras experiencias de los países, el 30-50% de las personas tenían inmunidad previa y además alrededor del 25% han sido infectadas y ahora son inmunes.

“Personalmente, no me gustaría tratar con las autoridades en sus propios términos: que se sospecha que usted es una fuente de infección hasta que se demuestre lo contrario. No deberías estar demostrando que no eres un riesgo para la salud de los demás. Aquellos sin síntomas nunca son una amenaza para la salud de los demás. Y en cualquier caso, una vez que los que están preocupados por el virus son vacunados, simplemente no hay argumentos para que nadie más necesite ser vacunado”.

Mi comprensión de una “vacuna con fugas” es que sólo disminuye los síntomas en los vacunados, pero no detiene la transmisión; por lo tanto, permite la propagación de lo que luego se convierte en un virus más mortal.

Por ejemplo, en China utilizan deliberadamente vacunas con fugas contra la gripe aviar para sacrificar rápidamente bandadas de pollo, porque los no vacunados mueren en un plazo de tres días. En la enfermedad de Marek, de la que necesitaban salvar a todos los pollos, la única solución era vacunar al 100% del rebaño, porque todos los no vacunados tenían un alto riesgo de muerte. Así que cómo se utiliza un vax con fugas es impulsado por la intención, es decir, es posible que la intención puede ser causar un gran daño a los no vacunados.

Por lo general, las cepas más fuertes no se propagan a través de una población porque matan al huésped demasiado rápido, pero si los vacunados experimentan sólo una enfermedad menos grave, entonces propagan estas cepas a los no vacunados que contraen enfermedades graves y mueren.

¿Está de acuerdo con esta evaluación? Además, ¿está de acuerdo en que si los no vacunados se convierten en los susceptibles, la única manera de avanzar es la profilaxis HCQ para aquellos que aún no han tenido COVID-19?

¿Funcionaría el Protocolo Zelenko contra estas cepas más fuertes si este es el caso?

Y si muchos ya tienen la mencionada “inmunidad sars de 17 años”, ¿no protegería eso de ninguna súper variante?

“Creo que la historia de Gerrt Vanden Bossche es altamente sospechosa. No hay ninguna evidencia de que la vacunación esté liderando o conduzca a “variantes peligrosas”. Me preocupa que sea una especie de truco.

“Como regla general, las variantes se forman muy a menudo, rutinariamente, y tienden a volverse menos peligrosas y más infecciosas con el tiempo, a medida que entra en equilibrio con su huésped humano. Las variantes generalmente no se vuelven más peligrosas.

“Ninguna variante difiere de la secuencia original en más de un 0,3%. En otras palabras, todas las variantes son al menos un 99,7% idénticas a la secuencia wuhan.

“Es una ficción, y una malvada en eso, que las variantes son probables para “escapar de la inmunidad”.

“No sólo es intrínsecamente improbable – porque este grado de similitud de variantes significa cero posibilidades de que una persona inmune (ya sea de infección natural o de vacunación) se enferme por una variante – sino que está empíricamente apoyada por investigaciones de alta calidad.

“La investigación a la que me refiero muestra que las personas que se recuperan de una infección o que han sido vacunadas todos tienen una amplia gama de células inmunes que reconocen TODAS las variantes.

Este trabajo muestra POR QUÉ el amplio reconocimiento molecular por parte del sistema inmune hace que los pequeños cambios en las variantes sean irrelevantes.

“No puedo decir lo suficiente: Las historias en torno a las variantes y la necesidad de recargar las vacunas son FALSAS. Me preocupa que haya una razón muy maligna detrás de todo esto. Ciertamente no está respaldado por las mejores maneras de mirar la inmunidad. Las afirmaciones siempre carecen de sustancia cuando se examinan, y utilizan varios trucos, como la manipulación de condiciones para probar la eficacia de los anticuerpos. Los anticuerpos probablemente no tienen importancia en la protección del huésped contra este virus. Ha habido algunos “experimentos naturales”, personas que desafortunadamente no pueden fabricar anticuerpos, pero son capaces con bastante éxito de repeler este virus. Definitivamente están mejor con anticuerpos que sin ellos. Menciono a estos pacientes raros porque muestran que los anticuerpos no son esenciales para albergar inmunidad, por lo que algunas pruebas inventadas en un laboratorio de anticuerpos y virus variantes diseñados NO justifican la necesidad de recargar las vacunas.

“Las únicas personas que pueden seguir siendo vulnerables y necesitan profilaxis o tratamiento son las personas mayores y/o enfermas y no desean recibir una vacuna (como es su derecho).

“La buena noticia es que hay múltiples opciones disponibles: hidroxicloroquina, ivermectina, budesonida (esteroide inhalado utilizado en asmáticos), y por supuesto vitamina D oral, zinc, azitromicina, etc. Estos reducen la gravedad hasta tal punto que este virus no necesitaba convertirse en una crisis de salud pública”.

¿Siente que la FDA hace un buen trabajo regulando las grandes farmacéuticas? ¿De qué manera se sortean las grandes farmacéuticas alrededor del regulador? ¿Siente que lo hicieron por la inyección de ARNM?

“Hasta hace poco, tenía un gran respeto por los reguladores mundiales de medicamentos. Cuando estaba en Pfizer, y más tarde CEO de una biotecnología que fundé (Ziarco, más tarde adquirida por Novartis), interactuamos respetuosamente con la FDA, la EMA y la MHRA del Reino Unido.
Siempre interacciones de buena calidad.

“Recientemente, me di cuenta de que la Fundación Bill & Melinda Gates (BMGF) había hecho una subvención a la Agencia Reguladora de Medicamentos y Productos Sanitarios (MHRA)! ¿Puede ser apropiado? Están financiados con dinero público. Nunca deben aceptar dinero de un organismo privado.

“Así que aquí hay un ejemplo donde el regulador del Reino Unido tiene un conflicto de intereses.

“La Agencia Europea de Medicamentos no requirió ciertas cosas como se revela en el ‘hackeo’ de sus archivos durante la revisión de la vacuna Pfizer.

“Puedes encontrar ejemplos en el “Comité Corona” de Reiner Fuellmich en línea.

“Así que ya no creo que los reguladores sean capaces de protegernos. Por lo tanto, la «aprobación» no tiene sentido.

“El Dr. Wolfgang Wodarg y yo solicitamos a la EMA el 1 de diciembre de 2020 sobre las vacunas genéticas. Nos ignoraron.

“Recientemente, les escribimos en privado, advirtiendo de coágulos de sangre, nos ignoraron. Cuando hicimos pública nuestra carta, fuimos completamente censurados. Días después, más de diez países detuvieron el uso de una vacuna citando coágulos sanguíneos.

“Creo que el gran dinero de las farmacéuticas más el efectivo de BMGF crea el entorno donde decir que no simplemente no es una opción para el regulador.

“Debo volver al tema de las ‘vacunas de recarga’ (inyecciones de refuerzo) y es toda esta narrativa la que me temo que explotará y utilizó para ganar un poder sin precedentes sobre nosotros.

“Por favor, advierta a cada persona que no se acerque a las vacunas de recarga. No hay absolutamente ninguna necesidad de ellos.

“Como no hay necesidad de ellos, sin embargo, se están haciendo en las farmacéuticas, y los reguladores se han mantenido a un lado (sin pruebas de seguridad), sólo puedo deducir que se utilizarán con fines nefastos.

“Por ejemplo, si alguien quisiera dañar o matar a una proporción significativa de la población mundial en los próximos años, los sistemas que se están poniendo en marcha en este momento lo permitirán.

“Mi opinión es que es totalmente posible que esto se utilice para la despoblación a gran escala”.

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’ – America’s Frontline Doctors

ISRAEL se enfrenta a LA HAYA por el ‘HOLOCAUSTO’ de VACUNAS

por Jules Gomes  Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

TEL AVIV, Israel (ChurchMilitant.com) – La Corte Penal Internacional (CPI) está considerando una investigación sobre las violaciones “flagrantes y extremas” del Código de Nuremberg por parte de Israel después de que los objetores de conciencia judía del obligatorio régimen de vacunación COVID-19 de la nación demandaron al gobierno por “crímenes de lesa humanidad”.

Sillas en la playa de Tel Aviv: Israel presenta el ‘apartheid médico’

La beca Anshe Ha-Emet (Pueblo de la Verdad), integrada por médicos, abogados, activistas y ciudadanos preocupados israelíes, se quejó ante el fiscal de la CPI en La Haya, acusando al gobierno de llevar a cabo un “experimento médico” nacional sin antes buscar “consentimiento informado”.

“Cuando los jefes del Ministerio de Salud, así como el primer ministro presentaron la vacuna en Israel y comenzaron la vacunación de los residentes israelíes, no se informó a los vacunados, que, en la práctica, están participando en un experimento médico y que su consentimiento es necesario para ello bajo el Código de Núremberg”, dice la demanda de Anshe Ha-Emet.

La firma A. Suchovolsky & Co. Law, con sede en Tel Aviv, sostiene que el acuerdo del primer ministro Benjamin Netanyahu con Pfizer y la propia admisión de Netanyahu dejan claro que la campaña de vacunación contra la velocidad warp de Israel “es de hecho un experimento médico y que esta fue la esencia del acuerdo”.

Netanyahu contrató con Pfizer para recibir “una enorme cantidad de millones de porciones de vacunas” a cambio de dar a la compañía información médica secreta y personal sobre personas “sin su conocimiento o consentimiento de antemano”, alega Anshe Ha-Emet.A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana. Tweet

Al etiquetar la inoculación del virus de China como “un tratamiento médico innovador” que introduce un “ARNm sintético al cuerpo” (la vacuna ha obtenido recientemente la aprobación de la FDA en los Estados Unidos , una aprobación que no es definitiva y se obtuvo únicamente en un procedimiento de emergencia) y que detalla 22 efectos secundarios de la vacuna, la queja señala que la “influencia de largo alcance del tratamiento” no se prueba científicamente y se desconoce el “efecto de largo alcance y la seguridad del tratamiento en sus receptores”.

“El Código de Núremberg, escrito después de que los médicos nazis fueran juzgados por realizar sus experimentos médicos con prisioneros de campos de concentración, estipula que es profundamente poco ético obligar o coaccionar a una persona para que participe en experimentos médicos”, dijo la antropóloga judía Karen Harradine a Church Militant. https://rumble.com/embed/vc4ebl/?pub=b62dwIlana Rachel Daniel detalla el apartheid médico que envuelve a Israel

“Estableciendo directrices para la experimentación médica, el código dice: ‘El consentimiento voluntario del sujeto humano es absolutamente esencial'”, explicó Harradine.

El ceo de Pfizer, Albert Bourla, provocó indignación cuando llamó a Israel el “laboratorio mundial” para la vacuna experimental Pfizer-BioNTech durante una entrevista con NBC News en febrero.Así es como se ve un Holocausto en 2021. Tweet

Bourla ahora dice que se arrepiente de haber usado la frase “laboratorio del mundo” cuando se refiere a Israel, aunque no se arrepiente de haber elegido a Israel como un caso de estudio para examinar la eficacia del jab.

Bourla se vio obligado a cancelar su visita a Israel en marzo después de que se supo que no había sido completamente vacunado usando la segunda inyección de la propia vacuna de su empresa porque no quiere “cortar en línea”.

Ruth Machnes Suchovolsky representando a Anshe Ha-Emet

Mark P. Dillon, jefe de la Oficina de la Unidad de Información y Pruebas de la CPI, reconoció haber recibido la demanda el 13 de marzo, señalando que sería tratada de acuerdo con “las disposiciones del Estatuto de Roma de la CPI”.

Sin embargo, la carta de Dillon aclaró que la carta de reconocimiento no significa que “se haya abierto una investigación; niserá abierto por la Fiscalía.”

“La denuncia por violación del Código de Núremberg ha sido aceptada y la Corte Penal Internacional de La Haya está sentada en el banquillo. … Seguiremos actualizándonos”, escribió ruth Machnes Suchovolsky, abogada que representa a Anshe Ha-Emet, en las redes sociales.

En una entrevista con el poeta y autor franco-canadiense Guy Boulianne, Suchovolsky describió la dictadura médica de Israel:

Es terrible lo que está pasando aquí. La gente se enferma de parálisis. Y los medios lo esconden. Es una verdadera matanza. Una mujer de 34 años, madre de cuatro hijos, no puede mover la mitad de su cuerpo. Está en silla de ruedas. Vacunaron indiscriminadamente al 81% del ejército israelí. No tenemos elección sobre qué tipo de mundo vamos a experimentar para nuestros hijos. Tenemos que luchar.

Mientras tanto, en un artículo de blog titulado “31 Reasons Why I Won’t Take the Vaccine”, el rabino Chananya Weissman llamó a los jabs del virus de China “el mayor experimento médico en la historia de la raza humana”.

“A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado”, escribió Weissman.

El rabino ortodoxo, autor de siete libros y columnista de The Times of Israel, explicó:

Si estuvieran al frente con las masas, muy pocos estarían de acuerdo en participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.

Las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados; el establecimiento médico los está dejando de lado como no relacionados o insignificantes; los medios de comunicación lo están ignorando; las compañías farmacéuticas avanzan a toda velocidad y los que levantan una bandera roja siguen siendo intimidados, censurados y castigados. … No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima “coincidencia”.

Ilana Rachel Daniel, asesora sanitaria del nuevo Partido Rapeh de Israel , que disputa las próximas elecciones en la plataforma de libertad de encierros y vacunación forzada, también ha protestado contra el pasaporte vacunal de Israel en una serie de entrevistas.

La Corte Penal Internacional de La Haya

“Están haciendo este pasaporte verde donde la mitad de la población no puede entrar en teatros o centros comerciales o todo tipo de cosas a menos que haya tomado la vacuna. Están creando un apartheid médico”, dijo Daniel.

“Así es como se ve un Holocausto en 2021”, le dijo Daniel al periodista inglés James Delingpole. “Es terrible. Es una situación muy, muy, muy aterradora. No están dejando que niños de tan solo 16 años tomen sus exámenes de matriculación sin tomar esta inyección”.

El israelí Gilad Rosinger, de Radiant Israel, describió el sistema de pasaportes verdes como una “agenda previa al holocausto”.

“Si no te sometes a esta agenda malvada, demoníaca y tiránica; si decides decir: ‘sabes qué, no estoy listo para participar en este programa experimental’, entonces ahora eres considerado un ciudadano de segunda clase en Israel”, lamentó Rosinger, nieto de un sobreviviente del Holocausto.

Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.