¿Podrían las vacunas contra el ARNm alterar permanentemente el ADN? La ciencia reciente sugiere que podrían.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might.

Por Equipo de Defensa de la Salud Infantil

La investigación sobre el ARN SARS-CoV-2 realizada por científicos de Harvard y el MIT tiene implicaciones sobre cómo las vacunas contra el ARNM podrían alterar permanentemente el ADN genómico, según Doug Corrigan, Ph.D., un biólogo bioquímico-molecular que dice que se necesita más investigación.

Durante el año pasado, sería casi imposible para los estadounidenses no darse cuenta de la decisión de los medios de comunicación de hacer de las vacunas la narrativa dominante de COVID, apresurada a hacerlo incluso antes de que ocurrieran muertes atribuidas al coronavirus.

La cobertura inclinada de los medios de comunicación ha proporcionado un impulso particularmente fructífero de las relaciones públicas para las vacunas con ARN mensajero (ARNM), décadas en desarrollo pero nunca aprobadas para uso humano, ayudando a acercar la tecnología experimental a la línea de meta regulatoria.

En circunstancias ordinarias, el cuerpo produce (“transcribes”) ARNm a partir del ADN en el núcleo de una célula. A continuación, el ARNM viaja fuera del núcleo hacia el citoplasma, donde proporciona instrucciones sobre qué proteínas hacer.

En comparación, las vacunas contra el ARNM envían su carga útil de ARNm sintetizada químicamente (incluida con instrucciones de fabricación de proteínas de pico) directamente al citoplasma.

Según los Centros para el Control y la Prevención de Enfermedades (CDC) y la mayoría de los científicos de vacunas contra el ARNM, el dinero se detiene allí: las vacunas contra el ARNM “no afectan ni interactúan con nuestro ADN de ninguna manera”, dicen los CDC. Los CDC afirman primero que el ARNM no puede entrar en el núcleo de la célula (donde reside el ADN), y segundo, que la célula , al estilo Misión Imposible, “se deshace del ARNm poco después de que termine de usar las instrucciones”.

Una preimpresión de diciembre sobre el SARS-CoV-2, por científicos del Instituto Tecnológico de Harvard y Massachusetts (MIT), produjo hallazgos sobre coronavirus salvajes que plantean preguntas sobre cómo funciona el ARN viral.

Los científicos llevaron a cabo el análisis porque estaban “perplejos por el hecho de que hay un número respetable de personas que están dio positivo para COVID-19 por PCR mucho después de que la infección se había ido”.

Sus hallazgos clave fueron los siguientes: los RNAs SARS-CoV-2 “pueden ser transcritos inversamente en células humanas”, “estas secuencias de ADN se pueden integrar en el genoma celular y posteriormente ser transcritas” (un fenómeno llamado “integración retro”) y hay vías celulares viables para explicar cómo sucede esto.

Según el doctor en bioquímica y biólogo molecular Dr. Doug Corrigan,estos importantes hallazgos (que van en contra del “dogma biológico actual”) pertenecen a la categoría de “Cosas que estábamos absolutamente e inequívocamente seguros de que no podían suceder lo que realmente sucedió”.

Los hallazgos de los investigadores de Harvard y el MIT también pusieron las suposiciones de los CDC sobre las vacunas contra el ARNM en terreno más inestable, según Corrigan. De hecho, un mes antes de que apareciera la preimpresión Harvard-MIT, Corrigan ya había escrito un blog en el que se esbozaban posibles mecanismos y vías por las que las vacunas contra el ARNM podían producir el fenómeno idéntico.

En una segunda entrada de blog, escrita después de que la preimpresión salió a la bolsa, Corrigan enfatizó que los hallazgos de Harvard-MIT sobre el ARN coronavirus tienen implicaciones importantes para las vacunas contra el ARNM, un hecho que describe como “el gran elefante en la habitación”. Aunque no afirma que el ARN de la vacuna necesariamente se comportará de la misma manera que el ARN coronavirus , es decir, alterando permanentemente el ADN genómico, Corrigan cree que la posibilidad existe y merece un escrutinio estrecho.

En opinión de Corrigan, la contribución de la preimpresión es que “valida que esto es al menos plausible, y muy probablemente probable”.

transcripción inversa

Como la frase “transcripción inversa” implica, la vía de ADN a ARNm no siempre es una calle de un solo sentido. Las enzimas llamadas transcriptasas inversas también pueden convertir el ARN en ADN, permitiendo que esta última se integre en el ADN en el núcleo celular.

Tampoco es poco frecuente la transcripción inversa. Los genetistas informan que “más del 40% de los genomas de mamíferos comprenden los productos de la transcripción inversa”.

La evidencia preliminar citada por los investigadores de Harvard-MIT indica que las enzimas transcriptasa inversas endógenas pueden facilitar la transcripción inversa de los ANR coronavirus y desencadenar su integración en el genoma humano.

Los autores sugieren que si bien las consecuencias clínicas requieren más estudio, los efectos perjudiciales son una posibilidad distinta y, dependiendo de los “sitios de inserción en el genoma humano” de los fragmentos virales integrados y del estado de salud subyacente de un individuo, podrían incluir “una respuesta inmune más grave … como una ‘tormenta de citoquinas’ o reacciones autoinmunes”.

En 2012, un estudio sugirió que la integración del genoma viral podría “conducir a consecuencias drásticas para la célula huésped, incluyendo la alteración genética, la mutagénesis insertal y la muerte celular”.

Corrigan hace un punto de decir que las vías hipotizadas para facilitar la retro-integración del ARN viral – o vacuna – en el ADN “no son desconocidas para las personas que entienden la biología molecular a un nivel más profundo”.

Aun así, la discusión de la preimpresión sobre la transcripción inversa y la integración del genoma provocó una vorágine de comentarios negativos de lectores reacios a repensar el dogma biológico, algunos de los cuales incluso abogaron por la retractación (aunque las preimpresiones son, por definición, inéditas) con el argumento de que “teóricos de la conspiración … llevará este documento a la “prueba” de que las vacunas contra el ARNM pueden, de hecho, alterar su código genético”.

Los lectores más reflexivos estuvieron de acuerdo con Corrigan en que el documento plantea preguntas importantes. Por ejemplo, un lector declaró que falta evidencia confirmatoria “para mostrar que la proteína de pico sólo se expresa por un corto período de tiempo (digamos 1-3 días) después de la vacunación”, y agregó: “Creemos que este es el caso, pero no hay evidencia para eso”.

De hecho, el tiempo que el ARNm sintético de las vacunas —y por lo tanto las instrucciones para que las células sigan fabricando proteína de espiga— persisten dentro de las células es una pregunta abierta.

Normalmente, el ARN es una molécula “notoriamente frágil” e inestable. Según los científicos, “esta fragilidad es cierta en el ARNm de cualquier ser vivo, ya sea que pertenezca a una planta, bacterias, virus o humanos”.

Pero el ARN sintético en las vacunas COVID es una historia diferente. De hecho, el paso que finalmente permitió a los científicos y fabricantes de vacunas resolver su impasse de la vacuna contra el ARNM de décadas fue cuando descubrieron cómo modificar químicamente el ARNM para aumentar su estabilidad y longevidad, es decir, producir ARN “que se queda en la célula mucho más tiempo que el ARN viral, o incluso arneses que nuestra célula normalmente produce para la producción normal de proteínas”.

Nadie sabe lo que está haciendo el ARNm sintético mientras está “dando vueltas”, pero Corrigan especula que su mayor longevidad aumenta la probabilidad de que “se convierta en ADN”.

Además, debido a que el ARNM de la vacuna también está diseñado para ser más eficiente al traducirse en proteínas, “los efectos negativos podrían ser más frecuentes y más pronunciados con la vacuna en comparación con el virus natural”.

Señales de dólar

Corrigan reconoce que algunas personas pueden rechazar sus advertencias, diciendo: “Si el virus es capaz de lograr esto, entonces ¿por qué debería importarme si la vacuna hace lo mismo?”

Tiene una respuesta lista y convincente:

“Hay una gran diferencia entre el escenario en el que las personas al azar, y sin darse cuenta, tienen su genética en mono porque estaban expuestas al coronavirus, y el escenario en el que vacunamos deliberadamente a miles de millones de personas mientras les decimos que esto no está sucediendo”.

Lamentablemente, la actitud predominante parece ser que la “carrera para vacunar al público” justifica la asunción de estos riesgos adicionales.

A mediados de noviembre, después de que el Jerusalem Post dijera a los lectores que “cuando el mundo comience a inocularse con estas vacunas completamente nuevas y revolucionarias, no sabrá prácticamente nada sobre sus efectos a largo plazo”, un director de hospital israelí argumentó que no vale la pena esperar dos años más para eliminar los “riesgos únicos y desconocidos” o los posibles efectos a largo plazo de las vacunas contra el ARNM.

En los Estados Unidos, el entusiasmo por la tecnología de ARNm es igualmente sin restricciones. Apenas unos días después de que los CDC publicaran datos actualizados que mostraban que más de 2.200 muertes de personas que habían recibido las vacunas contra el ARNm Pfizer o Moderna habían sido reportadas a partir del 26 de marzo, The Atlantic elogió la tecnología, sugiriendo que la “ingeniosa” tecnología sintética de ARNM detrás de las vacunas COVID de Pfizer y Moderna representaba un “avance” que podría “cambiar el mundo”.

En lugar de descartar la perspectiva de la integración retro del ADN extranjero como una “teoría de la conspiración”, los científicos deberían estar llevando a cabo estudios con el ARNm vacunado para evaluar los riesgos reales.

Por ejemplo, Corrigan cree que si bien los datos in vitro en líneas celulares humanas (una de las fuentes de datos examinadas por los investigadores de Harvard-MIT) ofrecen resultados “herméticos”, todavía hay una necesidad de demostrar concluyentemente la alteración genómica de la vida real a través de “PCR, secuenciación de ADN o Blot del Sur … ADN genómico purificado de pacientes con COVID-19″ y individuos vacunados.

Sin embargo, en lugar de abordar estas brechas de investigación, las empresas están salivando sobre el potencial de utilizar el ARNm editado por humanos para “comandar nuestra maquinaria celular” y “hacer casi cualquier proteína bajo el sol”.

Un comunicado de prensa del 10 de marzo en el que se pronunciaban las vacunas contra el ARNM, los claros ganadores de la carrera vacunal COVID-19 señalaron que todas las principales compañías farmacéuticas están ahora “probando la tecnología [mRNA] mediante la celebración de acuerdos de licencia y/o colaboración con empresas de ARN bien establecidas”.

En viejos dibujos animados de Disney, los espectadores a menudo presenciaban al tío rico del Pato Donald, Scrooge McDuck, “ojos abultados [se convierten] en signos de dólares de máquinas tragamonedas de Las Vegas de gran tamaño” al contemplar oportunidades para aumentar su ya inmensa riqueza.

A juzgar por la disposición de los ejecutivos de las compañías farmacéuticas a pasar por alto los riesgos a largo plazo y posiblemente multigeneracionales de las vacunas contra el ARNM, deben estar igualmente atraídos por visiones de signo de dólar de una interminable cartera de productos de ARNm “plug and play”.

Could mRNA Vaccines Permanently Alter DNA? Recent Science Suggests They Might. • Children’s Health Defense

Ex vicepresidente de Pfizer: ‘Totalmente posible, esto se utilizará para la despoblación a gran escala’

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’

por Mordechai Sones

Los Médicos de Primera Línea de Estados Unidos (AFLDS) hablaron con el ex Vicepresidente y Director científico de Pfizer, Dr. Mike Yeadon, sobre sus puntos de vista sobre la vacuna COVID-19, hidroxicloroquina e ivermectina, las autoridades reguladoras y más.

Al principio, el Dr. Yeadon dijo: “Soy muy consciente de los crímenes globales contra la humanidad perpetrados contra una gran proporción de la población mundial.

“Siento un gran miedo, pero no me disuaden de dar testimonio de expertos a múltiples grupos de abogados capaces como Rocco Galati en Canadá y Reiner Fuellmich en Alemania.

“No tengo ninguna duda de que estamos en presencia del mal (no una determinación que he tomado antes en una carrera de investigación de 40 años) y productos peligrosos.

“En el Reino Unido, está muy claro que las autoridades están empeñadas en un curso que dará lugar a la administración de ‘vacunas’ a tanta población como puedan. Esto es una locura, porque incluso si estos agentes fueran legítimos, la protección sólo es necesaria por aquellos con un riesgo notablemente elevado de muerte por el virus. En esas personas, incluso podría haber un argumento de que vale la pena asumir los riesgos. Y definitivamente hay riesgos que son lo que yo llamo “mecanicista”: incorporado en la forma en que funcionan.

“Pero todas las demás personas, las que están en buen estado de salud y menores de 60 años, tal vez un poco mayores, no perecen por el virus. En este gran grupo, es totalmente poco ético administrar algo novedoso y para el que el potencial de efectos no deseados después de unos meses es completamente poco característico.

“En ninguna otra época sería prudente hacer lo que se dice como la intención.

“Como lo sé con certeza, y sé que los que lo conducen también lo saben, tenemos que preguntar: ¿Cuál es su motivo?

“Aunque no lo sé, tengo respuestas teóricas fuertes, sólo una de las cuales se relaciona con el dinero y ese motivo no funciona, porque el mismo cuántico se puede llegar duplicando el costo unitario y dando el agente a la mitad de la gente. Dilema resuelto. Así que es otra cosa.
Apreciando que, por toda la población, también se pretende que los niños menores y eventualmente los bebés sean incluidos en la red, y eso es lo que interpreto como un acto malvado.

“No hay ninguna razón médica para ello. Sabiendo como lo hago que el diseño de estas “vacunas” resulta, en la expresión en los cuerpos de los receptores, la expresión de la proteína de pico, que tiene efectos biológicos adversos propios que, en algunas personas, son perjudiciales (iniciar la coagulación de la sangre y activar el ‘sistema de complemento’ inmune), estoy decidido a señalar que aquellos que no están en riesgo de este virus no deben estar expuestos al riesgo de efectos no deseados de estos agentes.”

AFLDS: La decisión de la Corte Suprema de Israel la semana pasada de cancelar las restricciones de vuelo covid dijo: “En el futuro, cualquier nueva restricción a los viajes hacia o fuera de Israel necesita, en términos legales, una base integral, fáctica y basada en datos”.

En una charla que dio hace cuatro meses, dijiste

“La duración más probable de la inmunidad a un virus respiratorio como el SARS CoV-2 es de varios años. ¿Por qué digo eso? En realidad tenemos los datos de un virus que arrasó partes del mundo hace diecisiete años llamado SARS, y recordamos que el SARS CoV-2 es un 80% similar al SRAS, así que creo que esa es la mejor comparación que cualquiera puede proporcionar.

“La evidencia es clara: estos inmunólogos celulares muy inteligentes estudiaron a todas las personas que podían conseguir que habían sobrevivido al SRAS hace 17 años. Tomaron una muestra de sangre, y analizaron si respondieron o no al SRAS original y todos lo hicieron; todos tenían una memoria celular T perfectamente normal y robusta. En realidad también estaban protegidos contra el SARS CoV-2, porque son muy similares; es inmunidad cruzada.

“Por lo tanto, yo diría que los mejores datos que existen es que la inmunidad debe ser robusta durante al menos 17 años. Creo que es totalmente posible que sea de por vida. El estilo de las respuestas de las células T de estas personas era el mismo que si te hubieran vacunado y luego vuelves años más tarde para ver si esa inmunidad se ha conservado. Así que creo que la evidencia es realmente fuerte de que la duración de la inmunidad será de varios años, y posiblemente de por vida.

En otras palabras, la exposición previa al SRAS – es decir, una variante similar al SARS CoV-2 – otorgó inmunidad al SARS CoV-2.

El gobierno de Israel cita nuevas variantes para justificar bloqueos, cierres de vuelos, restricciones y emisión de pasaportes verdes. Dado el veredicto de la Corte Suprema, ¿cree que es posible adelantar futuras medidas gubernamentales con información precisa sobre variantes, inmunidad, inmunidad de rebaño, etc. que podrían proporcionarse a los abogados que impugnarán esas medidas futuras?

Yeadon: “Lo que delineé en relación con la inmunidad al SRAS es precisamente lo que estamos viendo con el SARS-CoV-2.
El estudio es de uno de los mejores laboratorios en su campo.

“Por lo tanto, teóricamente, las personas podrían probar su inmunidad de células T midiendo las respuestas de las células en una pequeña muestra de su sangre. Hay tales pruebas, no son de “alto rendimiento” y es probable que cueste unos pocos cientos de USD cada una en escala. Pero no miles. La prueba que conozco aún no está disponible comercialmente, pero la investigación sólo en el Reino Unido.

“Sin embargo, espero que la compañía pueda ser inducida a proporcionar kits de prueba “para la investigación” a escala, sujeto a un acuerdo. Si usted fuera a organizar para probar unos pocos miles de israelíes no vacunados, puede ser una espada de doble filo. Según otras experiencias de los países, el 30-50% de las personas tenían inmunidad previa y además alrededor del 25% han sido infectadas y ahora son inmunes.

“Personalmente, no me gustaría tratar con las autoridades en sus propios términos: que se sospecha que usted es una fuente de infección hasta que se demuestre lo contrario. No deberías estar demostrando que no eres un riesgo para la salud de los demás. Aquellos sin síntomas nunca son una amenaza para la salud de los demás. Y en cualquier caso, una vez que los que están preocupados por el virus son vacunados, simplemente no hay argumentos para que nadie más necesite ser vacunado”.

Mi comprensión de una “vacuna con fugas” es que sólo disminuye los síntomas en los vacunados, pero no detiene la transmisión; por lo tanto, permite la propagación de lo que luego se convierte en un virus más mortal.

Por ejemplo, en China utilizan deliberadamente vacunas con fugas contra la gripe aviar para sacrificar rápidamente bandadas de pollo, porque los no vacunados mueren en un plazo de tres días. En la enfermedad de Marek, de la que necesitaban salvar a todos los pollos, la única solución era vacunar al 100% del rebaño, porque todos los no vacunados tenían un alto riesgo de muerte. Así que cómo se utiliza un vax con fugas es impulsado por la intención, es decir, es posible que la intención puede ser causar un gran daño a los no vacunados.

Por lo general, las cepas más fuertes no se propagan a través de una población porque matan al huésped demasiado rápido, pero si los vacunados experimentan sólo una enfermedad menos grave, entonces propagan estas cepas a los no vacunados que contraen enfermedades graves y mueren.

¿Está de acuerdo con esta evaluación? Además, ¿está de acuerdo en que si los no vacunados se convierten en los susceptibles, la única manera de avanzar es la profilaxis HCQ para aquellos que aún no han tenido COVID-19?

¿Funcionaría el Protocolo Zelenko contra estas cepas más fuertes si este es el caso?

Y si muchos ya tienen la mencionada “inmunidad sars de 17 años”, ¿no protegería eso de ninguna súper variante?

“Creo que la historia de Gerrt Vanden Bossche es altamente sospechosa. No hay ninguna evidencia de que la vacunación esté liderando o conduzca a “variantes peligrosas”. Me preocupa que sea una especie de truco.

“Como regla general, las variantes se forman muy a menudo, rutinariamente, y tienden a volverse menos peligrosas y más infecciosas con el tiempo, a medida que entra en equilibrio con su huésped humano. Las variantes generalmente no se vuelven más peligrosas.

“Ninguna variante difiere de la secuencia original en más de un 0,3%. En otras palabras, todas las variantes son al menos un 99,7% idénticas a la secuencia wuhan.

“Es una ficción, y una malvada en eso, que las variantes son probables para “escapar de la inmunidad”.

“No sólo es intrínsecamente improbable – porque este grado de similitud de variantes significa cero posibilidades de que una persona inmune (ya sea de infección natural o de vacunación) se enferme por una variante – sino que está empíricamente apoyada por investigaciones de alta calidad.

“La investigación a la que me refiero muestra que las personas que se recuperan de una infección o que han sido vacunadas todos tienen una amplia gama de células inmunes que reconocen TODAS las variantes.

Este trabajo muestra POR QUÉ el amplio reconocimiento molecular por parte del sistema inmune hace que los pequeños cambios en las variantes sean irrelevantes.

“No puedo decir lo suficiente: Las historias en torno a las variantes y la necesidad de recargar las vacunas son FALSAS. Me preocupa que haya una razón muy maligna detrás de todo esto. Ciertamente no está respaldado por las mejores maneras de mirar la inmunidad. Las afirmaciones siempre carecen de sustancia cuando se examinan, y utilizan varios trucos, como la manipulación de condiciones para probar la eficacia de los anticuerpos. Los anticuerpos probablemente no tienen importancia en la protección del huésped contra este virus. Ha habido algunos “experimentos naturales”, personas que desafortunadamente no pueden fabricar anticuerpos, pero son capaces con bastante éxito de repeler este virus. Definitivamente están mejor con anticuerpos que sin ellos. Menciono a estos pacientes raros porque muestran que los anticuerpos no son esenciales para albergar inmunidad, por lo que algunas pruebas inventadas en un laboratorio de anticuerpos y virus variantes diseñados NO justifican la necesidad de recargar las vacunas.

“Las únicas personas que pueden seguir siendo vulnerables y necesitan profilaxis o tratamiento son las personas mayores y/o enfermas y no desean recibir una vacuna (como es su derecho).

“La buena noticia es que hay múltiples opciones disponibles: hidroxicloroquina, ivermectina, budesonida (esteroide inhalado utilizado en asmáticos), y por supuesto vitamina D oral, zinc, azitromicina, etc. Estos reducen la gravedad hasta tal punto que este virus no necesitaba convertirse en una crisis de salud pública”.

¿Siente que la FDA hace un buen trabajo regulando las grandes farmacéuticas? ¿De qué manera se sortean las grandes farmacéuticas alrededor del regulador? ¿Siente que lo hicieron por la inyección de ARNM?

“Hasta hace poco, tenía un gran respeto por los reguladores mundiales de medicamentos. Cuando estaba en Pfizer, y más tarde CEO de una biotecnología que fundé (Ziarco, más tarde adquirida por Novartis), interactuamos respetuosamente con la FDA, la EMA y la MHRA del Reino Unido.
Siempre interacciones de buena calidad.

“Recientemente, me di cuenta de que la Fundación Bill & Melinda Gates (BMGF) había hecho una subvención a la Agencia Reguladora de Medicamentos y Productos Sanitarios (MHRA)! ¿Puede ser apropiado? Están financiados con dinero público. Nunca deben aceptar dinero de un organismo privado.

“Así que aquí hay un ejemplo donde el regulador del Reino Unido tiene un conflicto de intereses.

“La Agencia Europea de Medicamentos no requirió ciertas cosas como se revela en el ‘hackeo’ de sus archivos durante la revisión de la vacuna Pfizer.

“Puedes encontrar ejemplos en el “Comité Corona” de Reiner Fuellmich en línea.

“Así que ya no creo que los reguladores sean capaces de protegernos. Por lo tanto, la «aprobación» no tiene sentido.

“El Dr. Wolfgang Wodarg y yo solicitamos a la EMA el 1 de diciembre de 2020 sobre las vacunas genéticas. Nos ignoraron.

“Recientemente, les escribimos en privado, advirtiendo de coágulos de sangre, nos ignoraron. Cuando hicimos pública nuestra carta, fuimos completamente censurados. Días después, más de diez países detuvieron el uso de una vacuna citando coágulos sanguíneos.

“Creo que el gran dinero de las farmacéuticas más el efectivo de BMGF crea el entorno donde decir que no simplemente no es una opción para el regulador.

“Debo volver al tema de las ‘vacunas de recarga’ (inyecciones de refuerzo) y es toda esta narrativa la que me temo que explotará y utilizó para ganar un poder sin precedentes sobre nosotros.

“Por favor, advierta a cada persona que no se acerque a las vacunas de recarga. No hay absolutamente ninguna necesidad de ellos.

“Como no hay necesidad de ellos, sin embargo, se están haciendo en las farmacéuticas, y los reguladores se han mantenido a un lado (sin pruebas de seguridad), sólo puedo deducir que se utilizarán con fines nefastos.

“Por ejemplo, si alguien quisiera dañar o matar a una proporción significativa de la población mundial en los próximos años, los sistemas que se están poniendo en marcha en este momento lo permitirán.

“Mi opinión es que es totalmente posible que esto se utilice para la despoblación a gran escala”.

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’ – America’s Frontline Doctors

ISRAEL se enfrenta a LA HAYA por el ‘HOLOCAUSTO’ de VACUNAS

por Jules Gomes  Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

TEL AVIV, Israel (ChurchMilitant.com) – La Corte Penal Internacional (CPI) está considerando una investigación sobre las violaciones “flagrantes y extremas” del Código de Nuremberg por parte de Israel después de que los objetores de conciencia judía del obligatorio régimen de vacunación COVID-19 de la nación demandaron al gobierno por “crímenes de lesa humanidad”.

Image
Sillas en la playa de Tel Aviv: Israel presenta el ‘apartheid médico’

La beca Anshe Ha-Emet (Pueblo de la Verdad), integrada por médicos, abogados, activistas y ciudadanos preocupados israelíes, se quejó ante el fiscal de la CPI en La Haya, acusando al gobierno de llevar a cabo un “experimento médico” nacional sin antes buscar “consentimiento informado”.

“Cuando los jefes del Ministerio de Salud, así como el primer ministro presentaron la vacuna en Israel y comenzaron la vacunación de los residentes israelíes, no se informó a los vacunados, que, en la práctica, están participando en un experimento médico y que su consentimiento es necesario para ello bajo el Código de Núremberg”, dice la demanda de Anshe Ha-Emet.

La firma A. Suchovolsky & Co. Law, con sede en Tel Aviv, sostiene que el acuerdo del primer ministro Benjamin Netanyahu con Pfizer y la propia admisión de Netanyahu dejan claro que la campaña de vacunación contra la velocidad warp de Israel “es de hecho un experimento médico y que esta fue la esencia del acuerdo”.

Netanyahu contrató con Pfizer para recibir “una enorme cantidad de millones de porciones de vacunas” a cambio de dar a la compañía información médica secreta y personal sobre personas “sin su conocimiento o consentimiento de antemano”, alega Anshe Ha-Emet.A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana. Tweet

Al etiquetar la inoculación del virus de China como “un tratamiento médico innovador” que introduce un “ARNm sintético al cuerpo” (la vacuna ha obtenido recientemente la aprobación de la FDA en los Estados Unidos , una aprobación que no es definitiva y se obtuvo únicamente en un procedimiento de emergencia) y que detalla 22 efectos secundarios de la vacuna, la queja señala que la “influencia de largo alcance del tratamiento” no se prueba científicamente y se desconoce el “efecto de largo alcance y la seguridad del tratamiento en sus receptores”.

“El Código de Núremberg, escrito después de que los médicos nazis fueran juzgados por realizar sus experimentos médicos con prisioneros de campos de concentración, estipula que es profundamente poco ético obligar o coaccionar a una persona para que participe en experimentos médicos”, dijo la antropóloga judía Karen Harradine a Church Militant. https://rumble.com/embed/vc4ebl/?pub=b62dwIlana Rachel Daniel detalla el apartheid médico que envuelve a Israel


“Estableciendo directrices para la experimentación médica, el código dice: ‘El consentimiento voluntario del sujeto humano es absolutamente esencial'”, explicó Harradine.

El ceo de Pfizer, Albert Bourla, provocó indignación cuando llamó a Israel el “laboratorio mundial” para la vacuna experimental Pfizer-BioNTech durante una entrevista con NBC News en febrero.Así es como se ve un Holocausto en 2021. Tweet

Bourla ahora dice que se arrepiente de haber usado la frase “laboratorio del mundo” cuando se refiere a Israel, aunque no se arrepiente de haber elegido a Israel como un caso de estudio para examinar la eficacia del jab.

Bourla se vio obligado a cancelar su visita a Israel en marzo después de que se supo que no había sido completamente vacunado usando la segunda inyección de la propia vacuna de su empresa porque no quiere “cortar en línea”.

Image
Ruth Machnes Suchovolsky representando a Anshe Ha-Emet

Mark P. Dillon, jefe de la Oficina de la Unidad de Información y Pruebas de la CPI, reconoció haber recibido la demanda el 13 de marzo, señalando que sería tratada de acuerdo con “las disposiciones del Estatuto de Roma de la CPI”.

Sin embargo, la carta de Dillon aclaró que la carta de reconocimiento no significa que “se haya abierto una investigación; niserá abierto por la Fiscalía.”

“La denuncia por violación del Código de Núremberg ha sido aceptada y la Corte Penal Internacional de La Haya está sentada en el banquillo. … Seguiremos actualizándonos”, escribió ruth Machnes Suchovolsky, abogada que representa a Anshe Ha-Emet, en las redes sociales.

En una entrevista con el poeta y autor franco-canadiense Guy Boulianne, Suchovolsky describió la dictadura médica de Israel:

Es terrible lo que está pasando aquí. La gente se enferma de parálisis. Y los medios lo esconden. Es una verdadera matanza. Una mujer de 34 años, madre de cuatro hijos, no puede mover la mitad de su cuerpo. Está en silla de ruedas. Vacunaron indiscriminadamente al 81% del ejército israelí. No tenemos elección sobre qué tipo de mundo vamos a experimentar para nuestros hijos. Tenemos que luchar.

Mientras tanto, en un artículo de blog titulado “31 Reasons Why I Won’t Take the Vaccine”, el rabino Chananya Weissman llamó a los jabs del virus de China “el mayor experimento médico en la historia de la raza humana”.

“A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado”, escribió Weissman.

El rabino ortodoxo, autor de siete libros y columnista de The Times of Israel, explicó:

Si estuvieran al frente con las masas, muy pocos estarían de acuerdo en participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.

Las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados; el establecimiento médico los está dejando de lado como no relacionados o insignificantes; los medios de comunicación lo están ignorando; las compañías farmacéuticas avanzan a toda velocidad y los que levantan una bandera roja siguen siendo intimidados, censurados y castigados. … No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima “coincidencia”.

Ilana Rachel Daniel, asesora sanitaria del nuevo Partido Rapeh de Israel , que disputa las próximas elecciones en la plataforma de libertad de encierros y vacunación forzada, también ha protestado contra el pasaporte vacunal de Israel en una serie de entrevistas.

Image
La Corte Penal Internacional de La Haya

“Están haciendo este pasaporte verde donde la mitad de la población no puede entrar en teatros o centros comerciales o todo tipo de cosas a menos que haya tomado la vacuna. Están creando un apartheid médico”, dijo Daniel.

“Así es como se ve un Holocausto en 2021”, le dijo Daniel al periodista inglés James Delingpole. “Es terrible. Es una situación muy, muy, muy aterradora. No están dejando que niños de tan solo 16 años tomen sus exámenes de matriculación sin tomar esta inyección”.

El israelí Gilad Rosinger, de Radiant Israel, describió el sistema de pasaportes verdes como una “agenda previa al holocausto”.

“Si no te sometes a esta agenda malvada, demoníaca y tiránica; si decides decir: ‘sabes qué, no estoy listo para participar en este programa experimental’, entonces ahora eres considerado un ciudadano de segunda clase en Israel”, lamentó Rosinger, nieto de un sobreviviente del Holocausto.

Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.