Ex vicepresidente de Pfizer: ‘Totalmente posible, esto se utilizará para la despoblación a gran escala’

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’

por Mordechai Sones

Los Médicos de Primera Línea de Estados Unidos (AFLDS) hablaron con el ex Vicepresidente y Director científico de Pfizer, Dr. Mike Yeadon, sobre sus puntos de vista sobre la vacuna COVID-19, hidroxicloroquina e ivermectina, las autoridades reguladoras y más.

Al principio, el Dr. Yeadon dijo: “Soy muy consciente de los crímenes globales contra la humanidad perpetrados contra una gran proporción de la población mundial.

“Siento un gran miedo, pero no me disuaden de dar testimonio de expertos a múltiples grupos de abogados capaces como Rocco Galati en Canadá y Reiner Fuellmich en Alemania.

“No tengo ninguna duda de que estamos en presencia del mal (no una determinación que he tomado antes en una carrera de investigación de 40 años) y productos peligrosos.

“En el Reino Unido, está muy claro que las autoridades están empeñadas en un curso que dará lugar a la administración de ‘vacunas’ a tanta población como puedan. Esto es una locura, porque incluso si estos agentes fueran legítimos, la protección sólo es necesaria por aquellos con un riesgo notablemente elevado de muerte por el virus. En esas personas, incluso podría haber un argumento de que vale la pena asumir los riesgos. Y definitivamente hay riesgos que son lo que yo llamo “mecanicista”: incorporado en la forma en que funcionan.

“Pero todas las demás personas, las que están en buen estado de salud y menores de 60 años, tal vez un poco mayores, no perecen por el virus. En este gran grupo, es totalmente poco ético administrar algo novedoso y para el que el potencial de efectos no deseados después de unos meses es completamente poco característico.

“En ninguna otra época sería prudente hacer lo que se dice como la intención.

“Como lo sé con certeza, y sé que los que lo conducen también lo saben, tenemos que preguntar: ¿Cuál es su motivo?

“Aunque no lo sé, tengo respuestas teóricas fuertes, sólo una de las cuales se relaciona con el dinero y ese motivo no funciona, porque el mismo cuántico se puede llegar duplicando el costo unitario y dando el agente a la mitad de la gente. Dilema resuelto. Así que es otra cosa.
Apreciando que, por toda la población, también se pretende que los niños menores y eventualmente los bebés sean incluidos en la red, y eso es lo que interpreto como un acto malvado.

“No hay ninguna razón médica para ello. Sabiendo como lo hago que el diseño de estas “vacunas” resulta, en la expresión en los cuerpos de los receptores, la expresión de la proteína de pico, que tiene efectos biológicos adversos propios que, en algunas personas, son perjudiciales (iniciar la coagulación de la sangre y activar el ‘sistema de complemento’ inmune), estoy decidido a señalar que aquellos que no están en riesgo de este virus no deben estar expuestos al riesgo de efectos no deseados de estos agentes.”

AFLDS: La decisión de la Corte Suprema de Israel la semana pasada de cancelar las restricciones de vuelo covid dijo: “En el futuro, cualquier nueva restricción a los viajes hacia o fuera de Israel necesita, en términos legales, una base integral, fáctica y basada en datos”.

En una charla que dio hace cuatro meses, dijiste

“La duración más probable de la inmunidad a un virus respiratorio como el SARS CoV-2 es de varios años. ¿Por qué digo eso? En realidad tenemos los datos de un virus que arrasó partes del mundo hace diecisiete años llamado SARS, y recordamos que el SARS CoV-2 es un 80% similar al SRAS, así que creo que esa es la mejor comparación que cualquiera puede proporcionar.

“La evidencia es clara: estos inmunólogos celulares muy inteligentes estudiaron a todas las personas que podían conseguir que habían sobrevivido al SRAS hace 17 años. Tomaron una muestra de sangre, y analizaron si respondieron o no al SRAS original y todos lo hicieron; todos tenían una memoria celular T perfectamente normal y robusta. En realidad también estaban protegidos contra el SARS CoV-2, porque son muy similares; es inmunidad cruzada.

“Por lo tanto, yo diría que los mejores datos que existen es que la inmunidad debe ser robusta durante al menos 17 años. Creo que es totalmente posible que sea de por vida. El estilo de las respuestas de las células T de estas personas era el mismo que si te hubieran vacunado y luego vuelves años más tarde para ver si esa inmunidad se ha conservado. Así que creo que la evidencia es realmente fuerte de que la duración de la inmunidad será de varios años, y posiblemente de por vida.

En otras palabras, la exposición previa al SRAS – es decir, una variante similar al SARS CoV-2 – otorgó inmunidad al SARS CoV-2.

El gobierno de Israel cita nuevas variantes para justificar bloqueos, cierres de vuelos, restricciones y emisión de pasaportes verdes. Dado el veredicto de la Corte Suprema, ¿cree que es posible adelantar futuras medidas gubernamentales con información precisa sobre variantes, inmunidad, inmunidad de rebaño, etc. que podrían proporcionarse a los abogados que impugnarán esas medidas futuras?

Yeadon: “Lo que delineé en relación con la inmunidad al SRAS es precisamente lo que estamos viendo con el SARS-CoV-2.
El estudio es de uno de los mejores laboratorios en su campo.

“Por lo tanto, teóricamente, las personas podrían probar su inmunidad de células T midiendo las respuestas de las células en una pequeña muestra de su sangre. Hay tales pruebas, no son de “alto rendimiento” y es probable que cueste unos pocos cientos de USD cada una en escala. Pero no miles. La prueba que conozco aún no está disponible comercialmente, pero la investigación sólo en el Reino Unido.

“Sin embargo, espero que la compañía pueda ser inducida a proporcionar kits de prueba “para la investigación” a escala, sujeto a un acuerdo. Si usted fuera a organizar para probar unos pocos miles de israelíes no vacunados, puede ser una espada de doble filo. Según otras experiencias de los países, el 30-50% de las personas tenían inmunidad previa y además alrededor del 25% han sido infectadas y ahora son inmunes.

“Personalmente, no me gustaría tratar con las autoridades en sus propios términos: que se sospecha que usted es una fuente de infección hasta que se demuestre lo contrario. No deberías estar demostrando que no eres un riesgo para la salud de los demás. Aquellos sin síntomas nunca son una amenaza para la salud de los demás. Y en cualquier caso, una vez que los que están preocupados por el virus son vacunados, simplemente no hay argumentos para que nadie más necesite ser vacunado”.

Mi comprensión de una “vacuna con fugas” es que sólo disminuye los síntomas en los vacunados, pero no detiene la transmisión; por lo tanto, permite la propagación de lo que luego se convierte en un virus más mortal.

Por ejemplo, en China utilizan deliberadamente vacunas con fugas contra la gripe aviar para sacrificar rápidamente bandadas de pollo, porque los no vacunados mueren en un plazo de tres días. En la enfermedad de Marek, de la que necesitaban salvar a todos los pollos, la única solución era vacunar al 100% del rebaño, porque todos los no vacunados tenían un alto riesgo de muerte. Así que cómo se utiliza un vax con fugas es impulsado por la intención, es decir, es posible que la intención puede ser causar un gran daño a los no vacunados.

Por lo general, las cepas más fuertes no se propagan a través de una población porque matan al huésped demasiado rápido, pero si los vacunados experimentan sólo una enfermedad menos grave, entonces propagan estas cepas a los no vacunados que contraen enfermedades graves y mueren.

¿Está de acuerdo con esta evaluación? Además, ¿está de acuerdo en que si los no vacunados se convierten en los susceptibles, la única manera de avanzar es la profilaxis HCQ para aquellos que aún no han tenido COVID-19?

¿Funcionaría el Protocolo Zelenko contra estas cepas más fuertes si este es el caso?

Y si muchos ya tienen la mencionada “inmunidad sars de 17 años”, ¿no protegería eso de ninguna súper variante?

“Creo que la historia de Gerrt Vanden Bossche es altamente sospechosa. No hay ninguna evidencia de que la vacunación esté liderando o conduzca a “variantes peligrosas”. Me preocupa que sea una especie de truco.

“Como regla general, las variantes se forman muy a menudo, rutinariamente, y tienden a volverse menos peligrosas y más infecciosas con el tiempo, a medida que entra en equilibrio con su huésped humano. Las variantes generalmente no se vuelven más peligrosas.

“Ninguna variante difiere de la secuencia original en más de un 0,3%. En otras palabras, todas las variantes son al menos un 99,7% idénticas a la secuencia wuhan.

“Es una ficción, y una malvada en eso, que las variantes son probables para “escapar de la inmunidad”.

“No sólo es intrínsecamente improbable – porque este grado de similitud de variantes significa cero posibilidades de que una persona inmune (ya sea de infección natural o de vacunación) se enferme por una variante – sino que está empíricamente apoyada por investigaciones de alta calidad.

“La investigación a la que me refiero muestra que las personas que se recuperan de una infección o que han sido vacunadas todos tienen una amplia gama de células inmunes que reconocen TODAS las variantes.

Este trabajo muestra POR QUÉ el amplio reconocimiento molecular por parte del sistema inmune hace que los pequeños cambios en las variantes sean irrelevantes.

“No puedo decir lo suficiente: Las historias en torno a las variantes y la necesidad de recargar las vacunas son FALSAS. Me preocupa que haya una razón muy maligna detrás de todo esto. Ciertamente no está respaldado por las mejores maneras de mirar la inmunidad. Las afirmaciones siempre carecen de sustancia cuando se examinan, y utilizan varios trucos, como la manipulación de condiciones para probar la eficacia de los anticuerpos. Los anticuerpos probablemente no tienen importancia en la protección del huésped contra este virus. Ha habido algunos “experimentos naturales”, personas que desafortunadamente no pueden fabricar anticuerpos, pero son capaces con bastante éxito de repeler este virus. Definitivamente están mejor con anticuerpos que sin ellos. Menciono a estos pacientes raros porque muestran que los anticuerpos no son esenciales para albergar inmunidad, por lo que algunas pruebas inventadas en un laboratorio de anticuerpos y virus variantes diseñados NO justifican la necesidad de recargar las vacunas.

“Las únicas personas que pueden seguir siendo vulnerables y necesitan profilaxis o tratamiento son las personas mayores y/o enfermas y no desean recibir una vacuna (como es su derecho).

“La buena noticia es que hay múltiples opciones disponibles: hidroxicloroquina, ivermectina, budesonida (esteroide inhalado utilizado en asmáticos), y por supuesto vitamina D oral, zinc, azitromicina, etc. Estos reducen la gravedad hasta tal punto que este virus no necesitaba convertirse en una crisis de salud pública”.

¿Siente que la FDA hace un buen trabajo regulando las grandes farmacéuticas? ¿De qué manera se sortean las grandes farmacéuticas alrededor del regulador? ¿Siente que lo hicieron por la inyección de ARNM?

“Hasta hace poco, tenía un gran respeto por los reguladores mundiales de medicamentos. Cuando estaba en Pfizer, y más tarde CEO de una biotecnología que fundé (Ziarco, más tarde adquirida por Novartis), interactuamos respetuosamente con la FDA, la EMA y la MHRA del Reino Unido.
Siempre interacciones de buena calidad.

“Recientemente, me di cuenta de que la Fundación Bill & Melinda Gates (BMGF) había hecho una subvención a la Agencia Reguladora de Medicamentos y Productos Sanitarios (MHRA)! ¿Puede ser apropiado? Están financiados con dinero público. Nunca deben aceptar dinero de un organismo privado.

“Así que aquí hay un ejemplo donde el regulador del Reino Unido tiene un conflicto de intereses.

“La Agencia Europea de Medicamentos no requirió ciertas cosas como se revela en el ‘hackeo’ de sus archivos durante la revisión de la vacuna Pfizer.

“Puedes encontrar ejemplos en el “Comité Corona” de Reiner Fuellmich en línea.

“Así que ya no creo que los reguladores sean capaces de protegernos. Por lo tanto, la «aprobación» no tiene sentido.

“El Dr. Wolfgang Wodarg y yo solicitamos a la EMA el 1 de diciembre de 2020 sobre las vacunas genéticas. Nos ignoraron.

“Recientemente, les escribimos en privado, advirtiendo de coágulos de sangre, nos ignoraron. Cuando hicimos pública nuestra carta, fuimos completamente censurados. Días después, más de diez países detuvieron el uso de una vacuna citando coágulos sanguíneos.

“Creo que el gran dinero de las farmacéuticas más el efectivo de BMGF crea el entorno donde decir que no simplemente no es una opción para el regulador.

“Debo volver al tema de las ‘vacunas de recarga’ (inyecciones de refuerzo) y es toda esta narrativa la que me temo que explotará y utilizó para ganar un poder sin precedentes sobre nosotros.

“Por favor, advierta a cada persona que no se acerque a las vacunas de recarga. No hay absolutamente ninguna necesidad de ellos.

“Como no hay necesidad de ellos, sin embargo, se están haciendo en las farmacéuticas, y los reguladores se han mantenido a un lado (sin pruebas de seguridad), sólo puedo deducir que se utilizarán con fines nefastos.

“Por ejemplo, si alguien quisiera dañar o matar a una proporción significativa de la población mundial en los próximos años, los sistemas que se están poniendo en marcha en este momento lo permitirán.

“Mi opinión es que es totalmente posible que esto se utilice para la despoblación a gran escala”.

Exclusive: Former Pfizer VP to AFLDS: ‘Entirely possible this will be used for massive-scale depopulation’ – America’s Frontline Doctors

Oponerse a la dictadura sanitaria perjudica gravemente la salud

Opposing the health dictatorship seriously harms health

Burundi y Tanzania compartieron la oposición de sus dirigentes ante las medidas de la OMS. El presidente de Burundi, Pierre Nkurunziza, expulsó a los sicarios de la OMS de su país, mientras que el presidente tanzano, John Magufuli, químico, hizo lo propio, tras demostrar al mundo que los test PCR con los que querían justificar la inexistente epidemia, ofrecían falsos positivos, tanto en muestras obtenidas en papayas, como en aceite de coche o en cabras. Twitter.

La osadía de estos presidentes les ha costado la vida, ambos han sufrido un desafortunado “infarto” como advertencia al resto sobre que va a suceder a cualquiera que no colabore con los psicópatas que controlan el mundo

Estamos ante dos mártires de la lucha contra la dictadura mundial, pero una historia escrita por estos asesinos, olvidará pronto y pervertirá la memoria sobre estos y todos los que se oponen a el N.O.M.

Por supuesto sus sucesores han tomado buena nota de lo que les espera si no colaboran y de lo rentable que puede resultar para ellos que lo hagan. No habrá que extrañarse, pues, de que de las ínfimas cifras de muertes atribuidas al coronavirus en dichos países (recordemos que los diez países más pobres de Africa han tenido, en conjunto, menos víctimas mortales del Covid que la Comunidad Autónoma de Madrid, por tener un referente) pasemos en breve a elevadas tasas de mortalidad que “obliguen” a las autoridades a abrir las puertas a las “salvadoras” compañías farmacéuticas.

A estas alturas debería entenderse que a pesar de ser un negocio millonario, no se trata solo de dinero. También que estamos solo al principio de algo mucho peor de lo que las mentes más retorcidas puedan sospechar.

(Fuente: Astillas de realidad)

ISRAEL se enfrenta a LA HAYA por el ‘HOLOCAUSTO’ de VACUNAS

por Jules Gomes  Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

TEL AVIV, Israel (ChurchMilitant.com) – La Corte Penal Internacional (CPI) está considerando una investigación sobre las violaciones “flagrantes y extremas” del Código de Nuremberg por parte de Israel después de que los objetores de conciencia judía del obligatorio régimen de vacunación COVID-19 de la nación demandaron al gobierno por “crímenes de lesa humanidad”.

Image
Sillas en la playa de Tel Aviv: Israel presenta el ‘apartheid médico’

La beca Anshe Ha-Emet (Pueblo de la Verdad), integrada por médicos, abogados, activistas y ciudadanos preocupados israelíes, se quejó ante el fiscal de la CPI en La Haya, acusando al gobierno de llevar a cabo un “experimento médico” nacional sin antes buscar “consentimiento informado”.

“Cuando los jefes del Ministerio de Salud, así como el primer ministro presentaron la vacuna en Israel y comenzaron la vacunación de los residentes israelíes, no se informó a los vacunados, que, en la práctica, están participando en un experimento médico y que su consentimiento es necesario para ello bajo el Código de Núremberg”, dice la demanda de Anshe Ha-Emet.

La firma A. Suchovolsky & Co. Law, con sede en Tel Aviv, sostiene que el acuerdo del primer ministro Benjamin Netanyahu con Pfizer y la propia admisión de Netanyahu dejan claro que la campaña de vacunación contra la velocidad warp de Israel “es de hecho un experimento médico y que esta fue la esencia del acuerdo”.

Netanyahu contrató con Pfizer para recibir “una enorme cantidad de millones de porciones de vacunas” a cambio de dar a la compañía información médica secreta y personal sobre personas “sin su conocimiento o consentimiento de antemano”, alega Anshe Ha-Emet.A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana. Tweet

Al etiquetar la inoculación del virus de China como “un tratamiento médico innovador” que introduce un “ARNm sintético al cuerpo” (la vacuna ha obtenido recientemente la aprobación de la FDA en los Estados Unidos , una aprobación que no es definitiva y se obtuvo únicamente en un procedimiento de emergencia) y que detalla 22 efectos secundarios de la vacuna, la queja señala que la “influencia de largo alcance del tratamiento” no se prueba científicamente y se desconoce el “efecto de largo alcance y la seguridad del tratamiento en sus receptores”.

“El Código de Núremberg, escrito después de que los médicos nazis fueran juzgados por realizar sus experimentos médicos con prisioneros de campos de concentración, estipula que es profundamente poco ético obligar o coaccionar a una persona para que participe en experimentos médicos”, dijo la antropóloga judía Karen Harradine a Church Militant. https://rumble.com/embed/vc4ebl/?pub=b62dwIlana Rachel Daniel detalla el apartheid médico que envuelve a Israel


“Estableciendo directrices para la experimentación médica, el código dice: ‘El consentimiento voluntario del sujeto humano es absolutamente esencial'”, explicó Harradine.

El ceo de Pfizer, Albert Bourla, provocó indignación cuando llamó a Israel el “laboratorio mundial” para la vacuna experimental Pfizer-BioNTech durante una entrevista con NBC News en febrero.Así es como se ve un Holocausto en 2021. Tweet

Bourla ahora dice que se arrepiente de haber usado la frase “laboratorio del mundo” cuando se refiere a Israel, aunque no se arrepiente de haber elegido a Israel como un caso de estudio para examinar la eficacia del jab.

Bourla se vio obligado a cancelar su visita a Israel en marzo después de que se supo que no había sido completamente vacunado usando la segunda inyección de la propia vacuna de su empresa porque no quiere “cortar en línea”.

Image
Ruth Machnes Suchovolsky representando a Anshe Ha-Emet

Mark P. Dillon, jefe de la Oficina de la Unidad de Información y Pruebas de la CPI, reconoció haber recibido la demanda el 13 de marzo, señalando que sería tratada de acuerdo con “las disposiciones del Estatuto de Roma de la CPI”.

Sin embargo, la carta de Dillon aclaró que la carta de reconocimiento no significa que “se haya abierto una investigación; niserá abierto por la Fiscalía.”

“La denuncia por violación del Código de Núremberg ha sido aceptada y la Corte Penal Internacional de La Haya está sentada en el banquillo. … Seguiremos actualizándonos”, escribió ruth Machnes Suchovolsky, abogada que representa a Anshe Ha-Emet, en las redes sociales.

En una entrevista con el poeta y autor franco-canadiense Guy Boulianne, Suchovolsky describió la dictadura médica de Israel:

Es terrible lo que está pasando aquí. La gente se enferma de parálisis. Y los medios lo esconden. Es una verdadera matanza. Una mujer de 34 años, madre de cuatro hijos, no puede mover la mitad de su cuerpo. Está en silla de ruedas. Vacunaron indiscriminadamente al 81% del ejército israelí. No tenemos elección sobre qué tipo de mundo vamos a experimentar para nuestros hijos. Tenemos que luchar.

Mientras tanto, en un artículo de blog titulado “31 Reasons Why I Won’t Take the Vaccine”, el rabino Chananya Weissman llamó a los jabs del virus de China “el mayor experimento médico en la historia de la raza humana”.

“A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado”, escribió Weissman.

El rabino ortodoxo, autor de siete libros y columnista de The Times of Israel, explicó:

Si estuvieran al frente con las masas, muy pocos estarían de acuerdo en participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.

Las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados; el establecimiento médico los está dejando de lado como no relacionados o insignificantes; los medios de comunicación lo están ignorando; las compañías farmacéuticas avanzan a toda velocidad y los que levantan una bandera roja siguen siendo intimidados, censurados y castigados. … No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima “coincidencia”.

Ilana Rachel Daniel, asesora sanitaria del nuevo Partido Rapeh de Israel , que disputa las próximas elecciones en la plataforma de libertad de encierros y vacunación forzada, también ha protestado contra el pasaporte vacunal de Israel en una serie de entrevistas.

Image
La Corte Penal Internacional de La Haya

“Están haciendo este pasaporte verde donde la mitad de la población no puede entrar en teatros o centros comerciales o todo tipo de cosas a menos que haya tomado la vacuna. Están creando un apartheid médico”, dijo Daniel.

“Así es como se ve un Holocausto en 2021”, le dijo Daniel al periodista inglés James Delingpole. “Es terrible. Es una situación muy, muy, muy aterradora. No están dejando que niños de tan solo 16 años tomen sus exámenes de matriculación sin tomar esta inyección”.

El israelí Gilad Rosinger, de Radiant Israel, describió el sistema de pasaportes verdes como una “agenda previa al holocausto”.

“Si no te sometes a esta agenda malvada, demoníaca y tiránica; si decides decir: ‘sabes qué, no estoy listo para participar en este programa experimental’, entonces ahora eres considerado un ciudadano de segunda clase en Israel”, lamentó Rosinger, nieto de un sobreviviente del Holocausto.

Israel Faces Hague for Vaccine ‘Holocaust’ (churchmilitant.com)

Médico noruego afirma encontrar vínculo entre la vacuna AstraZeneca y los coágulos sanguíneos raros

POR TYLER DURDEN Norwegian Doctor Claims To Find Link Between AstraZeneca Vaccine And Rare Blood Clots | ZeroHedge

la espera de la decisión de la EMA, un alto funcionario de salud noruego encargado de investigar una serie de tres casos de alto perfil de trabajadores sanitarios menores de 50 años hospitalizados por casos similares de coágulos sanguíneos raros después de recibir la vacuna AstraZeneca han propuesto una teoría que está destinada a enfurecer a AstraZeneca, junto con la EMA y la OMS.

El médico jefe y profesor Pål Andre Holme dijo a los periódicos noruegos el jueves, pocas horas antes de que la EMA fuera lista para dar a conocer los resultados de su prometida “revisión de seguridad” (que se llevó a cabo aún más apresuradamente que los estudios iniciales de la vacuna), que tiene una nueva teoría sobre qué causó las reacciones en los trabajadores de la salud, y desafortunadamente, según Holme, el jab AstraZeneca actuó como el detonante.

“Se ha encontrado la razón del estado de nuestros pacientes”, anunció hoy el médico jefe y profesor Pål Andre Holme al diario nacional noruego VG.

Ha liderado el trabajo para averiguar por qué tres trabajadores sanitarios menores de 50 años fueron hospitalizados con coágulos sanguíneos graves y bajos niveles de plaquetas sanguíneas después de haber tomado la vacuna AstraZeneca Covid. Uno de los trabajadores sanitarios murió el lunes.

Los expertos han trabajado en una teoría de que, de hecho, fue la vacuna la que desencadenó una respuesta inmune inesperada y poderosa, una teoría que ahora creen que han confirmado.

“Nuestra teoría de que esta es una poderosa respuesta inmune que muy probablemente fue causada por la vacuna se ha encontrado. En colaboración con expertos en el campo del Hospital Universitario del Norte de Noruega HF, hemos encontrado anticuerpos específicos contra plaquetas sanguíneas que pueden causar estas reacciones, y que conocemos de otros campos de la medicina, pero luego con medicamentos como la causa de la reacción”, explica el médico jefe a VG.

Aunque reconoció que la teoría era sólo eso- una teoría, Holme insistió en que no había nada más que pudiera haber desencadenado una respuesta inmune tan intensa en los tres pacientes. La vacuna fue el único factor común.

Cuando se le pide que aclare por qué dice “muy probablemente” en la cita, Holme responde con confianza que se ha encontrado la razón de estos raros casos de coágulos sanguíneos.

“Tenemos la razón. Nada más que la vacuna puede explicar por qué estos individuos tuvieron esta respuesta inmune”, afirma.

VG también pregunta cómo Holme puede saber que la respuesta inmune no es causada por algo que no sea la vacuna.

“No hay nada en la historia del paciente de estos individuos que pueda dar una respuesta inmune tan poderosa. Estoy seguro de que los anticuerpos que hemos encontrado son la causa, y no veo otra explicación que ser la vacuna que lo desencadena”, responde.

En un intento de explicar a los lectores por qué deberían preocuparse, Holme concluyó: “Estamos hablando de gente relativamente joven que se ha vuelto muy enferma aquí, y murió, que probablemente no habría recibido un caso tan serio de Covid”.

En particular, la Agencia Noruega de Medicamentos no desea comentar las conclusiones del Hospital Universitario de Oslo: “Primero tenemos que examinar los resultados, no quiero comentar sobre esto ahora”, dijo el director médico Steinar Madsen en una declaración a la agencia noruega de noticias.

Más de 2 docenas de casos de coágulos sanguíneos raros han sido reportados, por las autoridades locales han señalado una posible relación entre los pacientes con recuentos bajos de plaquetas de sangre. Sin embargo, después de unas dosis de 10M, el número de incidentes confirmados de coágulos sanguíneos es de poco más de 25. Esas son algunas probabilidades bastante bajas.

Para aquellos confundidos sobre la naturaleza del problema, el Dr. John Weiner lo desglosa: el problema, como explicó Holme, es un tipo específico de coágulo peligroso que ha ocurrido. twitter

No es que el enfoque de “abundancia de precaución” no esté justificado. Después de lo que sucedió el año pasado cuando la gran tecnología censuró a cualquiera que se pronunciara en contra de las narrativas oficiales de COVID sobre máscaras y bloqueos, nos preguntamos cuándo Twitter y Facebook se moverán para censurar a Holme. En particular, parece que la prensa internacional ha transmitido la historia, a pesar de más informes de coágulos de sangre que golpean el jueves por la mañana mientras esperamos el informe de la EMA.

Fuente: Norwegian Doctor Claims To Find Link Between AstraZeneca Vaccine And Rare Blood Clots | ZeroHedge

COVID, GRIPE Y RESFRIADO (SENTIDO) COMÚN

Seré breve. Según la Universidad de Maryland, EE.UU. hizo un estudio allá por el “lejano” 2018: “Descubrimos que las personas que tienen gripe contaminan con virus el aire que les rodea simplemente al respirar, sin necesidad de toser ni estornudar“, reconoce Donald Milton, profesor de salud ambiental en Maryland y principal investigador del estudio. Este especialista explica que las personas con gripe generan aerosoles infecciosos, que son pequeñas gotas que permanecen suspendidas en el aire durante mucho tiempo, incluso cuando no están tosiendo, y especialmente durante los primeros días de la enfermedad.

¿Les suena? Por tanto la gripe no ha podido desaparecer, si así fuera, tampoco habría contagio por aerosoles de la Covid-19. Es curioso. Hasta ahora, ¡¡¡SEIS CASOS DE GRIPE en la temporada 2020/21 en España!!! Con sentido común, esto es imposible de creer.

Conclusión: Si tengo gripe y el año pasado o hace dos pasé un resfriado común por coronavirus, las PCR dan positivos en bastantes casos y tenemos parte de la ecuación resuelta. Un positivo por covid que en realidad es una gripe. Incluso muertes por gripe achacadas con PCR a la covid.

Si los aerosoles son el vehículo y el SarsCov-2 y el resfriado son coronavirus y viajan en el mismo vehículo, el resfriado común no ha desaparecido y la gripe tampoco. ¿Por qué motivo iban a desaparecer si utilizan la misma forma de propagarse? Quiero decir, si hay Covid, hay aerosoles y si hay aerosoles, hay gripe y resfriado común.

G.R.M.

COVID, FLU AND THE COMMON COLD

I’ll be quick. According to the University of Maryland, USA did a study back in the “distant” 2018: “We discovered that people who have the flu contaminate the air around them with viruses simply by breathing, without the need to cough or sneeze,” he acknowledges. Donald Milton, a Maryland professor of environmental health and the study’s principal investigator. This specialist explains that people with the flu generate infectious aerosols, which are small droplets that remain suspended in the air for a long time, even when they are not coughing, and especially during the first days of the illness.

Does it ring a bell? Therefore, the flu has not been able to disappear, if it were, there would be no spread by Covid-19 aerosols. It’s curious. So far, SIX CASES OF FLU in the 2020/21 season in Spain !!! With common sense, this is impossible to believe.

Bottom Line: If I have the flu and I had a common cold from coronavirus last year or two, PCR tests are positive in quite a few cases and we have part of the equation solved. A positive for covid that is actually a flu. Even deaths from influenza attributed with PCR to covid.

If the aerosols are the vehicle and the SarsCov-2 and the cold are coronavirus and they travel in the same vehicle, the common cold has not disappeared and neither has the flu. For what reason would they disappear if they use the same way of spreading? I mean, if there is Covid, there are sprays and if there are sprays, there is flu and the common cold.

EL COHETE ESQUIZOFRÉNICO

¿Y si la verdad está escrita en un blog como este? U otro cualquiera. Estamos viajando con una puerta abierta que no controlamos. Por esa puerta salen y entran deseos incontrolados, pensamientos, amigos, sentimientos, enemigos, silencios, aire, jaleos, futuros y desconocidos, amantes y males de ojos, antígenos, aguacates y agujas curvas. Entra y sale tu yo, acompañado en el peor kilometraje de demasiada compañía, a veces vacía, mucho vacío, tanto, que a veces hay que vaciar. Un viaje en retroceso, con más carga, la que vamos soltando en flashback y rescatamos in situ en el futuro rebobinado. Un futuro quieto, un pasado inquietante y un presente congelado. Es la fórmula para viajar. ¿Me acompañas?

Pues ya hemos llegado. Hemos salido. ¡Cierren la puerta! Ya estamos fuera, no podemos salir. Vi por la ventana a mis vecinos de asiento, me saludaban con las manos, sin bocas, decían adiós y hola a la vez. La puerta era capaz de esa artimaña, frontera de siempre la verdad, el espejo es la mentira, no el reflejo.

Una vez aterrizado seguíamos allí. Nos apeamos pero seguíamos allí. Y seguíamos. La puerta se cerró. ¡Pueden bajar! Entonces subieron. El sol me cegaba, la luz incontrolable hacía de la oscuridad un parto hermoso, hijo de la locura, padre del orden y bastardo de la entropía, encomienda familiar, estado puro: nacer, viajar, enloquecer. Hacer.

¡Abran! Nos quedamos en el planeta, conmigo. Ahora somos muchos, tantos y tan unidos que formamos parte de la corteza. La psicoesfera ya estaba, nació prematura y nos dice que todos retroviviremos. Ya estábamos aquí, curioso, porque también estaremos.

Un viaje estático, un viaje a lo desconocido. Y la puerta abierta…

G.R.M.

THE SCHIZOPHRENIC ROCKET

What if the truth is written on a blog like this? Or any other. We are traveling with an open door that we do not control. Through that door come and go uncontrolled desires, thoughts, friends, feelings, enemies, silences, air, hassles, futures and strangers, lovers and evil eyes, antigens, avocados and curved needles. Your self comes in and goes out, accompanied by the worst mileage of too much company, sometimes empty, much empty, so much so that sometimes you have to empty. A trip backwards, with more load, which we are releasing in flashback and we rescue in situ in the future rewind. A quiet future, a haunting past, and a frozen present. It is the formula for traveling. Will you accompany me.

Well, we have already arrived. We have dated. Close the door! We are already out, we cannot go out. I saw my neighbors sitting through the window, they waved to me, without mouths, said goodbye and hello at the same time. The door was capable of that trick, the usual border of truth, the mirror is the lie, not the reflection.

Once landed we were still there. We got out but we were still there. And we continued. The door closed. They can go down! Then they went up. The sun blinded me, the uncontrollable light made the darkness a beautiful birth, child of madness, father of order and bastard of entropy, family entrustment, pure state: being born, traveling, going crazy. Do.

Open up! We stay on the planet, with me. Now we are many, so many and so united that we are part of the crust. The psychosphere was already there, it was born prematurely and it tells us that we will all live back. We were already here, curious, because we will also be there.

A static journey, a journey into the unknown. And the open door …

En la gripe asiática de 1957-58, rechazaron los encierros

Jeffrey A. Tucker – 12 de enero de 2021

La gripe asiática de 1957-58 fue una pandemia mortal con un alcance más amplio para resultados graves que Covid-19 de 2020. Mató entre 1 y 4 millones de personas en todo el mundo, y 116.000 en los Estados Unidos en un tiempo con la mitad de la población. Fue un importante contribuyente a un año en el que Estados Unidos vio 62.000 muertes en exceso.

A nivel mundial, podría haber sido cinco veces más mortal que Covid-19, medido por muertes per cápita. Era inusualmente letal para las personas más jóvenes: el 40 por ciento de las muertes se habían producido entre personas menores de 65 años, mientras que la edad promedio de muerte de Covid-19 es de 80, con sólo el 10-20% de las muertes menores de 65 años.

Lo que llama la atención es cómo los funcionarios de salud pública manejaron la pandemia. Tuvo una respuesta diametralmente opuesta a la que los responsables políticos persiguieron en 2020. Se podría suponer que esto se debió a la negligencia y la falta de sofisticación en la comprensión de la necesidad de encierro. ¡Seguro que no sabían hace 65 años lo que sabemos hoy!

En realidad, esto es completamente falso. De hecho, los expertos en salud pública consideraron el cierre de escuelas, el cierre de negocios y la prohibición de los eventos públicos, pero todo el espíritu de la profesión los rechazó. Había dos motivos para este rechazo: los bloqueos serían demasiado perturbadores, inhabilitando la capacidad de los profesionales médicos para hacer frente competentemente a la crisis, y también porque esas políticas serían inútiles porque el virus ya estaba aquí y se estaba propagando.

Mientras que los bloqueos en el caso Covid-19 podrían haber contribuido a alargar la crisis retrasando la inmunidad del rebaño, el período en el que la gripe asiática tuvo las consecuencias más graves fue de sólo tres meses. Los periódicos apenas lo cubrían y la mayoría de la gente no se daba cuenta. Las historias de la época apenas lo mencionan, mientras que la historia temprana de 2020 hablará principalmente sobre el virus y los encierros. Esto no se debe a la pandemia, sino a la brutal respuesta de la política de pandemia.

El mejor artículo único sobre la respuesta de la política de gripe asiática de 1957-58 es “Salud Pública y Respuestas Médicas a la Pandemia de Influenza 1957-58” por el gran epidemiólogo Donald A. Henderson y otros entre sus colegas en Johns Hopkins. Apareció en 2009 en la revista Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science. Se incrusta al final de este artículo.

El artículo es de vital importancia porque demuestra que no bloquear fue una decisión deliberada, no algún tipo de fracaso. La negativa a perturbar la sociedad y restringir la libertad en presencia de un patógeno fue un logro de las ideas modernas de salud pública. Desde el mundo antiguo hasta el siglo XIX, la respuesta típica a la enfermedad era atribuirla al aire corrupto y huir mientras demonizaba y excluyeba a los enfermos. Los avances médicos modernos, con el descubrimiento de virus y bacterias, antibióticos, terapias antivirales y el funcionamiento del sistema inmunitario humano, aconsejaron la calma de la comunidad y las relaciones médico-paciente.

El organismo de salud pública más influyente en ese momento era la Asociación de Oficiales de Salud Estatales y Territoriales (ASTHO). Se conocieron el 27 de agosto de 1957. Llegaron a la conclusión de que deberían recomendar la atención domiciliaria tanto como sea posible para evitar que los hospitales se abarroten. Instruirían a las personas a buscar atención médica si los síntomas se vuelven graves.

De lo contrario, ASTHO concluyó de la siguiente manera: «’No hay ninguna ventaja práctica en el cierre de escuelas ni en la restricción de las reuniones públicas en lo que se refiere a la propagación de esta enfermedad».

En particular, las escuelas no estaban cerradas porque los expertos en salud pública observaron que los niños simplemente recogerían el virus en otros lugares. “El Comisionado de Salud del Condado de Nassau en Nueva York”, señala Henderson, “declaró que ‘las escuelas públicas deben permanecer abiertas incluso en una epidemia’ y que ‘los niños se enfermarían con la misma facilidad para salir de la escuela'”.

Hemos oído incesantemente que Covid-19 requirió cierres porque es una nueva cepa para la que no hubo una vacuna. Bueno, la gripe asiática ya era nueva y tampoco había vacuna. Para cuando llegó uno, era sólo 60% eficaz y no ampliamente utilizado. Henderson comenta: “Es evidente que la vacuna no tuvo ningún efecto apreciable en la tendencia de la pandemia”.

¿Tal vez tuvimos que cerrar debido a casos asintomáticos? No es verdad. Henderson señala sobre la gripe asiática: “Las tasas de ataque en las escuelas oscilaron entre el 40% y el 60%. Las encuestas serológicas revelaron que la mitad de los que no reportan enfermedad de la gripe mostraban evidencia serológica de infección”.

Para estar seguro de que hubo interrupciones. No ocurrieron por la fuerza, sino por necesidad debido al ausentismo. Fueron efímeros. Los millones de personas expuestas al virus desarrollaron anticuerpos y continuaron. Esto era cierto en particular para los escolares:

“El ausentismo escolar alcanzó su máximo con 280.000 ausencias el 7 de octubre. Esto equivalía al 29% de todos los asistentes a la escuela. La tasa más alta se registró para las escuelas de Manhattan, que tenían una tasa general de 43% de ausencia. Ese día, 4.642 profesores (11%) no se reportó al trabajo debido a estar enfermo. Los establecimientos comerciales, sin embargo, no reportaron un aumento significativo del ausentismo. Dentro de las 2 semanas después del pico,las tasas de absentismo escolar casi volvieron a la normalidad, alrededor del 7%”.

Los informes de periódicos en ese momento no ofrecen ningún registro de cancelaciones generalizadas de eventos públicos y mucho menos cierres forzosos. A veces, los partidos de fútbol de la universidad y de la escuela secundaria se pospusieron debido a ausencias por enfermedad. Algunas convenciones fueron canceladas por los organizadores. Pero eso es todo.

El único editorial del New York Timessobre la gripe asiática reflejó la sabiduría de salud pública: “Mantengamos la cabeza fría sobre la gripe asiática a medida que comienzan a acumularse las estadísticas sobre la propagación y la virulencia de la enfermedad”.

Henderson concluye lo siguiente:

La pandemia de 1957-58 fue una enfermedad tan rápidamente diseminada que se hizo rápidamente evidente para los funcionarios de salud estadounidenses que los esfuerzos para detener o frenar su propagación eran inútiles. Por lo tanto, no se hicieron esfuerzos para poner en cuarentena a individuos o grupos, y se tomó la decisión deliberada de no cancelar o posponer grandes reuniones como conferencias, reuniones de la iglesia o eventos deportivos con el fin de reducir la transmisión.

No se hizo ningún intento de limitar el viaje o de otros casos examinar a los viajeros. Se hizo hincapié en la prestación de atención médica a las personas afectadas y en mantener el funcionamiento continuo de los servicios comunitarios y de salud. Las enfermedades febriles y respiratorias llevaron a un gran número de pacientes a clínicas, consultorios médicos y salas de emergencia, pero un porcentaje relativamente pequeño de los infectados requirieron hospitalización.

El ausentismo escolar debido a la gripe era alto, pero las escuelas no estaban cerradas a menos que el número de estudiantes o maestros cayera a un número lo suficientemente bajo como para justificar el cierre. Sin embargo, el curso del brote en las escuelas fue relativamente breve, y muchos podrían volver fácilmente a las actividades en un plazo de 3 a 5 días. Se dijo que un número significativo de trabajadores sanitarios estaban afectados por la gripe, pero los informes indican que los hospitales eran capaces de adaptarse adecuadamente para hacer frente a las cargas de los pacientes.

Los datos disponibles sobre el absentismo industrial indican que las tarifas eran bajas y que no se interrumpió los servicios esenciales ni de la producción. El impacto global sobre el PIB fue insignificante y probablemente dentro del rango de variación económica normal.

Los funcionarios de salud tenían la esperanza de que los suministros significativos de vacunas pudieran estar disponibles a su debido tiempo, y se hicieron esfuerzos especiales para acelerar la producción de vacunas, pero las cantidades que se disponían eran demasiado tarde para afectar el impacto de la epidemia. La propagación nacional de la enfermedad fue tan rápida que en 3 meses había arrasado por todo el país y había desaparecido en gran medida.

Uno lee este relato detallado de cómo la salud pública respondió entonces en comparación con ahora y la respuesta es llorar. ¿Cómo pudo pasarnos esto? Sabíamos con seguridad que los encierros eran terribles para la salud pública. Lo sabemos desde hace 100 años.

El cierre de una economía contradice rotundamente un principio fundacional de la Organización Mundial de la Salud: “El desarrollo económico y la salud pública son inseparables y complementarios… el desarrollo social, cultural y económico de una comunidad, y su estado de salud, son interdependientes”.

En 1957-58, los funcionarios de salud pública se tomaron en serio esa observación. Esta gripe muy grave se produjo y se produjo con una mínima perturbación social y económica. Sistemas inmunes en los Estados Unidos y en todo el mundo adaptados a la nueva cepa de la gripe.

Diez años más tarde, llegó una nueva mutación de esta gripe. La salud pública respondió de la misma manera, con sabiduría, calma y sin intervenciones en los derechos y libertades de las personas. El funcionamiento social y económico se consideró acertadamente crucial para una visión global de la salud pública.

Los bloqueos fueron descartados en el pasado precisamente para que el daño de una pandemia se minimizara y pudiéramos superarlo más rápidamente. Esta era la ciencia. Esta fue la ciencia hasta la primavera de 2020, cuando todo cambió. De repente, la “ciencia” favoreció olvidar todo lo que hemos aprendido del pasado y reemplazarlo por políticas brutales que destrozaron la economía y la vida de las personas, al tiempo que no lograban nada en términos de minimizar el daño pandémico.

Habíamos pensado en nosotros un vocabulario completamente nuevo diseñado para disfrazar lo que se nos estaba haciendo. No estábamos bajo arresto domiciliario, nuestros negocios destrozados, las escuelas cerradas, las artes en vivo y los deportes abolidos, nuestros planes de viaje destrozados y separados por la fuerza de sus seres queridos. No, sólo estábamos experimentando “mitigación de enfermedades” a través de “contención en capas dirigidas”, “intervenciones no farmacológicas” y “distanciamiento social”.

Todo esto es Owelliano con la sabiduría tradicional de salud pública habiendo sido derribado por el agujero de la memoria. La ciencia real no cambió. La salud pública tradicional nos implora que consideremos no sólo un patógeno, sino todas las variables que afectan a la salud, no sólo a corto plazo, sino también a largo plazo. Así fue y así es hoy.

In the Asian Flu of 1957-58, They Rejected Lockdowns – AIER

EL VIRUS CAE DEL CIELO

The virus falls from the sky

Que no del espacio exterior. Buscando y leyendo desde que empezó el tema del coronavirus, a falta de la coherencia oficial, como que en octubre de 2020 la OMS cambiara la versión y significado de “inmunidad de rebaño”, he leído de todo, hay que saber buscar. En los medios de comunicación masivos sólo hay un mensaje, dirigido y teledirigido a base de acallar al otro, al que piensa diferente pero también científicamente. Hay de todo, malo, bueno y barato, tanto en el mensaje oficial (ridículo, porque en realidad están diciendo que no sabemos nada de este virus, y más bien de los virus en general) como en los mensajes digamos extraoficiales, al menos llenos de matices y colmando un vacío que proporcionado a sabiendas, la propia naturaleza humana lo ocupa a veces hasta rebozar. Bueno, somos humanos, tan naturales como un virus, bueno, o no.

Yoichi Shimatsu, periodista y escritor en una saga de 28 escritos o artículos que van del 9 de enero al 16 de noviembre de 2020 para rense.com que hacen de el un verdadero ensayo. En la entrega o parte 20 tiene una teoría de la propagación de esta quimera (virus) al menos un tanto curiosa y no menos científica, nunca antes ni oída ni vista para con los virus y su propagación.

Os dejo aquí la parte del artículo que nos concierne, y yo me pregunto, ¿alguien nos está ocultando información? Si se dan cuenta, las autoridades tienen una obsesión con la noche, no quieren que salgamos a la calle digamos de 12 a 6 am. ¿Pero porqué? ¿Qué nos esconden?

Aquí la parte del artículo 20, por cierto, está escrito (los tiempos son importantes) el 23 de abril de 2020 titulado Nublado con una probabilidad de caídas de los cadáveres dispersos COVID en las islas de calor urbano – Parte 20 / Cloudy With A Chance Of Scattered Cadavers COVID Fallout On Urban Heat Islands – Part 20 :

Arquitecto de soluciones Urban Heat Island

Mi área de especialización en periodismo de crisis con especial atención a los desastres, con enfoque en los factores humano-causales y el impacto social, se enriqueció mucho al cooperar con el profesor de arquitectura Stephen Lau, el pionero más importante de Asia en los efectos de la isla de calor urbana (UHI) entonces en la Universidad de Hong Kong y más recientemente en la Universidad Nacional de Singapur. La concentración de calor sobre ciudades y ciudades más grandes es un fenómeno probado por la investigación con un impacto importante en la salud pública, como se muestra en este contagio del coronavirus.

Fuera del campo arquitectónico, el efecto Isla de Calor Urbano (UHI) no es bien conocido debido a la desafortunada dominación mediática por dudosos estudios ambientales de la teoría del “calentamiento global”, la mayoría de ellos un fraude promovido por la industria de la energía nuclear para perpetuar el mito de que el uranio es seguro, limpio, barato y “verde” (como la kriptonita es para Superman). El monopolio mediático de la agenda climática alimentada por la energía nuclear es el principal factor para que el público desconocie el papel de la corriente de chorro en la transmisión del COV a las metrópolis del hemisferio norte.

Ciudades en una burbuja

En la parte superior de una burbuja de calor sobre cualquier ciudad dada, hay un diferencial de temperatura de mediodía diario mensurable de alrededor de 7 grados C (alrededor de 12 F) más alto que la atmósfera circundante, mientras que los modelos de cambio climático, que no se basan en la investigación de campo real, estiman menos de un aumento de 1 grado durante un siglo. LA UHI es palpable y a veces insoportable, mientras que el “calentamiento global” es imperceptible en un termómetro de mercurio. Casi todos los activistas del cambio climático residen y crecen en las grandes ciudades, confundiendo un punto de calor localizado para una condición general del mundo. En esta premisa falsa, la percepción distorsionada se extrapola utilizando datos de estaciones meteorológicas metropolitanas para aumentar los hallazgos de los centros de meteorología rurales, sesgando los resultados a un nivel más alto posible de 1 grado C durante cien años, no es gran cosa en absoluto. Cientos de millones de dólares.han sido desperdiciados en este ejercicio de distracción por la industria de la energía nuclear, mientras que las grandes ciudades se han quedado indefensas contra las enfermedades infecciosas transmitidas por la corriente de chorro y el efecto UHI. Nuclear siempre se escapa de sus crímenes, incluyendo Three Mile Island, Chernobyl y Fukushima, castigados con una bofetada en la mano y nada cercano a la indemnización para las víctimas de sus inversores, y mucho menos multas punitivas.

Este tipo de fraude científico y colusión política han suscitado malas decisiones políticas por parte de los ayuntamientos y los gobiernos nacionales en favor de la urbanización de alta densidad y la concentración de población dentro de las megaciudades en beneficio de los grandes bancos, el capital privado, los inversores institucionales, los desarrolladores inmobiliarios y las cadenas minoristas corporativas. Desde esta perspectiva, el contagio del coronavirus es principalmente culpa de la política estatal corrupta en favor de los desarrolladores de propiedades y el capitalismo de consumo en oposición al interés nacional a largo plazo servido por una mezcla de baja densidad de ciudades rodeadas por un campo financieramente estable de granjas familiares, el modelo basado en la democracia Jeffersoniana en lugar del favoritismo hamiltoniano hacia los bancos centrales y las finanzas de Wall Street.

Plume sobre Wuhan

Para comprender cómo los virus de Wuhan y Chongqing rodearon el planeta para converger e infectar ciudades con una enorme bio-caída, debemos comenzar al principio, en los 84 hornos en crematorios en Wuhan y aproximadamente la mitad de ese número aguas arriba en la guarnición de Chongqing del Grupo PLA 77, donde posiblemente más de 2.000 soldados murieron de infección por COV por el ataque de la guerra contra el CISM. Como se evidencia en la larga franja amarilla a la izquierda de la imagen del satélite Windy, sus cuerpos de soldados infectados durante y después de los juegos militares de Wuhan fueron eliminados en secreto en los crematorios en todo el municipio de Chongqing, aparentemente todavía sin notificación de sus parientes más cercanos. Este trato de los jóvenes caídos no es el honor que se debe dar a los jóvenes patrióticos que protegieron a los atletas militares extranjeros, se reunieron en defensa de la ciudadanía wuhan y evitaron una propagación aún peor por todo el mundo. Especialmente después de meditar en el aro de los medios de comunicación de Beijing sobre “ganar una guerra popular en Wuhan”, me entristece aún más pensar en términos del costo humano de las profundidades a las que la propaganda del régimen puede hundirse a expensas de vidas innecesariamente perdidas consideradas meras carnes de cañón. ¿Qué tan importante es salvar la cara cuando las víctimas inocentes están perdiendo la vida en masa?

Dado el recuento repetido de falsos cuerpos, el número total de cremaciones sigue siendo cuestionable, incluso con el nuevo recuento revisado de 3.869 muertes en Wuhan, aparentemente sin incluir a los oficiales de policía y a los condenados a prisiones. Una estimación conservadora de 6.000 muertes militares y civiles también puede ser una subestimación, al considerar el tamaño de la neblina de azufre sobre las dos ciudades durante más de un mes de cremaciones sin parar. El aparejo de números es intolerable, bárbaro e inhumano, especialmente para los parientes más cercanos de los muertos.

La temperatura dentro de un horno de crematorio es ideal en el rango de 975 C (1.750 F), más o menos cien grados, para hacer un cuerpo a cenizas en una hora. Durante las semanas centrales de la crisis de Wuhan, las temperaturas de combustión deben haber aumentado para acelerar la eliminación de cuerpos para evitar la descomposición y la liberación de virus. Las altas temperaturas constantes del horno, sin embargo, causan la descamación y roturas de las tuberías de alimentación de gas, añadiendo más presión sobre los equipos de trabajo agotados. El intervalo entre cremaciones implica la reducción de la temperatura con el fin de eliminar las cenizas e insertar el siguiente cadáver. Este nivel de calor más bajo durante el período de reinicio permitió a los virus escapar a través de las chimeneas relativamente cortas para montar el penacho de calor de enfriamiento en el cielo.

Debido a la amenaza potencial para que los equipos de emergencia que transportaban cuerpos de los hospitales a los crematorios, los cadáveres frescos fueron desempolvados con polvo de azufre para evitar que las infecciones bacterianas se expandieran las pústulas en llagas abiertas que liberan virus en el aire. Este tipo de método pragmático es uno de los aspectos más desconcertantes para manejar los cuerpos de los muertos, que no se reporta en los medios de comunicación o incluso en la literatura académica, que presencié cuando era un niño y ayudante en la funeraria de mi tío para crear un parecido del difunto para una visión de ataúd abierto por los dolientes. Bombear formaldehído en las venas como un antiséptico, un conservante, consume demasiado tiempo e inapropiado para una emergencia como Wuhan y tal arte no tiene sentido cuando un cuerpo requiere eliminación inmediata a medida que la descomposición se instala, la propagación del hedor, los líquidos y las bacterias junto con los virus en el aire. Un cadáver infectado que se desintegró en una acera en Wuhan habría sido desastroso, por lo que algunas toallas y azufre tuvieron que ser suficientes para el traseso del hospital y el viaje en furgoneta de una hora de duración a un crematorio. Saludo a esos héroes no cantados, los trabajadores de emergencia, por su gran resistencia a luchar a través de ese infierno en la Tierra.

Cube-Sat infrarrojo sobre la pira

El sitio de desinformación de la CIA Snopes, hace mucho tiempo desacreditado en mis artículos de años atrás, está arrojando tonterías sobre supuestos gráficos falsos del servicio meteorológico Windy. Además del polvo de azufre para evitar la descomposición de la piel, se encuentran cantidades adicionales de dióxido de azufre y óxido nitroso en el gas natural de menor calidad de las plantas de separación de gases. Por el contrario, se filtra el gas de cocina para su cocina a un alto costo. Como nadie está cenando en la carne asada, el gas más barato tiene que ser suficiente. Las imágenes ventosas de las emisiones de azufre y nitrógeno no son gráficos informáticos fantasiosos basados en el modelado teórico, como afirma falsamente Snopes, sino basados en la vigilancia de los satélites de observación de la Tierra utilizados para detectar liberaciones y explosiones químicas.

El EOS de teledetección (satélite de observación de la Tierra) es un dispositivo de monitoreo en forma de cubo o “cúbico” con un detector hiperespectral (multi-longitud de onda altamente sensible) en el ancho de banda infrarrojo, que también se puede utilizar para detectar preparaciones de lanzamiento para cohetes y rastrear incendios forestales, cualquier cosa que emita calor. Los datos son procesados por ordenador en imágenes precisas codificadas por colores, en este caso particular por el servicio meteorológico Windy con sede en Praga, República Checa. Lo imaginante no es una especie de ficción, como afirma Snopes, pero es muy precisa y científica.

Esta distorsión es otro ejemplo de la gran cantidad de desinformación oficial en respuesta al peor evento terrorista de la historia reciente, mucho más allá del 911. La operación de desninfo del Estado Profundo debe ser investigada, desmantelada y los funcionarios a cargo encarcelados. Demasiada gente está muerta y muriendo por este tipo de interferencia política y chicanería mediática. ¡Muchas gracias al equipo Windy por la gran captura, Dekuji!

Exploding Body Fat

Los virus del COV permanecen activos dentro de los cadáveres y pueden ser infecciosos durante un período indeterminable, como recientemente se descubrió en el shock de un forense en Tailandia. El cuerpo de un adulto no se convierte fácilmente en cenizas, siendo tan pesado como una vaquilla con contenido de agua en alrededor del 55 por ciento del peso corporal. La fase inicial de la cremación tiene que representar gran parte del contenido de agua como vapor, lo que impide la incineración. Otro problema para la quemadura es la grasa subcutánea, y los chinos de hoy tienden a tener sobrepeso de una dieta aceitosa. La grasa del vientre explota y silba, soplando partículas de sangre y carne en la columna de calor hacia el cielo. Sería como poner al máximo tu parrilla de barbacoa y añadir un lanzallamas, soplando ese asado de cerdo como un petardo en pocos segundos.

Dado que las chimeneas del crematorio son más cortas que una chimenea de chimenea, liberando prematuramente partículas de carne crujientes en la superficie exterior, pero no completamente “cocinadas”, ni siquiera medio rara pero rara. La incineración apresurada dio lugar a miles de millones y probablemente billones de virus en espiral hacia arriba en el borde del vórtice de calor que se elevan a los confines más bajos de la corriente de chorro para ser transportados a tierras extranjeras.

En un día normal, el penacho de cremación se elevará a 3.000 metros, pero Wuhan fue un extraordinario evento de super-bonfire, que va las 24 horas del día durante semanas, con una enorme efusión de energía térmica que proporciona un enorme aumento, alcanzando fácilmente 8.000 metros (5 millas), la altitud del último invierno y la corriente de chorro de primavera temprana moviéndose a más de 250 mph. Las bacterias, que contienen agua, se congelarán y morirán en estas condiciones. Los virus, sin embargo, no son organismos, sino más bien máquinas y pueden sobrevivir al frío extremo durante una larga duración, como lo muestran las partículas de ARN en el permafrost siberiano a -50C o -55F, que pueden ser revividos por los microbiólogos.

A estas alturas, un mes después del final de las cremaciones masivas, probablemente sea demasiado tarde para llevar un paraguas contra cualquier consecuencia de carne humana y virus activos. El peligro inmediato de los cielos ha pasado, aparte de la posibilidad de que los virus escapen de las cremaciones en Corea del Sur, Japón, partes de Estados Unidos y Europa, y en todo el planeta. Has oído la expresión “Está lloviendo gatos y perros afuera” para que puedas decirle a tus nietos: “Yo estaba allí cuando llovía cadáveres”.

Decencia del entierro

La indignidad de la incineración masiva en una fría y cruel respuesta urbana a una epidemia contrasta con los lentos ritos que presencié en el sur de Tailandia, como voluntario para la labor de búsqueda y rescate después del tsunami asiático que azotó el día después de la Navidad de 2004. Un cuidador con un templo local al norte de Phuket apiló madera alrededor de una víctima de ahogamiento mientras un monje cantaba una bendición, y luego puso una antorcha en los troncos. La pira ardió durante horas hasta la reducción final a cenizas y algunos huesos, que fueron rastrillados y colocados en una caja de madera con otra oración. En ese momento, me dirigí de regreso a la costa para reincorporarme a un equipo tailandés y coreano mientras el explorador olfateaba cuerpos atrapados bajo edificios, bajo montones de escombros o embistido por la presión de las olas en las raíces de las palmeras. Mi sentido del olfato era mucho mejor que otros, debido al hábito coreano de comer kimchee y los tailandeses que consumen salsa picante tipo Sri Racha, así que se dejó a mi nariz de tofu aburridamente sosa para ser el perro de búsqueda.

Días más tarde llegó una reunión de Nochevieja en silencio para voluntarios cansados desgastados por el hedor de cuerpos hinchables en descomposición mientras buscaban marcas de identificación para escribir en carteles para familias angustiadas antes de cerrar las bolsas del cuerpo. En una colina era el único lugar para que los voluntarios pasaran la noche en las vacaciones. Los tailandeses de Bangkok, canadienses, holandeses y algunos otros se reunieron sobre cajas de cerveza y almuerzos de cajas de expiración pasada para compartir tranquilamente su trauma una larga sombra del sol que se pone en el mar de Andamán se deslizó a través del amplio balcón.

Cuando un joven expresó su sentimiento de culpa por beber después de una experiencia tan horrible, como la persona mayor allí les dije a todos que cada uno de ellos se ganó este momento y relajarse en una rara noche especial aparta un año aterrador y dará a todos fuerzas para el calvario de mañana por la mañana y para el resto de sus vidas. Por cualquier razón que hayamos venido aquí, cada uno sabe ahora a través del testimonio personal que la vida termina con la muerte y por eso hemos aprendido a acercarnos a la muerte con calma no como algo horrible, sino como un tributo a la vida de otra persona. Entonces, ¿qué mejor momento para un brindis por ustedes valientes voluntarios? En los primeros albores del año 2005, cada individuo partió por un camino diferente a lo largo de la interminable línea del tsunami, cada uno de acuerdo en que aunque llegamos como extraños y quedamos traumatizados por esta experiencia fue la mejor Nochevieja que esta breve existencia podría permitirse.

Arco de la pandemia

Tokio – El penacho que sale de Wuhan llega a la costa del Pacífico en media hora, en el Mar de China Oriental, donde los primeros aviones de primavera se curvan hacia el noreste hacia Japón, mientras que las nevadas de finales de primavera se convierten en lluvias lluviosas sobre las primeras grandes islas de calor urbano de los distritos de negocios de Shinjuku, Maruchiuno y Shimbashi de Tokio. A medida que los equipos de limpieza apagan las luces de las torres de oficinas, una corriente descendente empuja innumerables virus hacia los suburbios periféricos donde sus compañeros de oficina se dirigen a la estación local, sin saber que están caminando a través de una niebla viral. En la hora punta de la mañana temprano, los virus llegan al centro con las hordas de viajeros empacados en el metro.

La capital japonesa es altamente radiactiva, como se muestra en el monitoreo de datos de un grupo ciudadano que ha encontrado docenas de puntos críticos. El nivel de radiactividad ha matado las algas en la bahía de Tokio, pero los virus corona son sólo 120 nanómetros de ancho, tres veces más pequeños que los poros en una máscara facial médica. No se ha investigado, pero los virus son probablemente lo suficientemente pequeños como para evitar impactos directos de la radiación gamma sobre la región de Tokio. Los pasajeros a bordo del crucero Diamond Princess nunca tuvieron la oportunidad, especialmente una noche, contra los miles de millones de virus que caen de la corriente de chorro hacia la bahía de Tokio, siendo estos lo suficientemente pequeños como para pasar a través del sistema de filtración de aire de la nave. Esta es la razón por la que mi equipo de microbiólogos en la crisis del SARS de Hong Kong abogó por los limpiadores de aire con la generación UV de radicales libres de dióxido de titanio para desinfectar el aire interior. El resto del mundo no se ha puesto al día y no ha mostrado mucho interés en estas tecnologías eficaces.

Trans-Pacífico – El flujo continuo de virus en el chorro de flujo que viaja hacia el norte hasta el estrecho de Bering y luego hacer una trayectoria balística hacia el sur para hacer tierra en Seattle, la primera ciudad estadounidense con una gran cantidad de infecciones, aunque muchos de ellos son parientes de Navy SEALS que participaron en los juegos de Wuhan, y luego procediendo hacia el sur a través del área de la bahía y Los Angeles , girando antes de la frontera con México hacia vastos tramos vacíos de Texas. La población de la costa oeste ha sufrido mucho daño en el tejido pulmonar por Fukushima y la radiactividad local, los incendios forestales relacionados y ahora las pruebas 5G, por lo que una alta tasa de mortalidad por virus transmitidos por chorros es una inaltería.

Nueva Orleans – Los celebrantes que convergían para Mardi Gras a finales de febrero capturaron la altura misma de las consecuencias del virus de origen Wuhan. Contrariamente a la historia de brujas sin sentido de Fauci y sus brujos, los que se fueron de fiesta de esos estados del medio oeste y del sur estaban libres de infecciones, y en su lugar los virus cayeron sobre sus cabezas después de descender a lo largo del camino de deslizamiento sobre las frías aguas del Misisipi. Nueva Orleans es una isla de calor urbano ubicada entre dos cuerpos de agua que atraen virus, el Poderoso Misisipi y el Golfo de México. Sea cual sea la forma en que sopla el viento, los virus están fluyendo hacia Bourbon Street, lo cual es una pena ya que un buen momento es tener un linint up de botellas de cerveza Dixie, pero no se trague las ostras de aguas profundas. El mundo se ha deteriorado desde aquellos días universitarios que me autogané a Nawlins para disfrutar de música y toda la noche.

Fort Lauderdale y Miami – El diferencial de temperatura de Sunny Florida entre las áreas interiores y la costa significa que las cascadas de coronavirus fluyen en corriente descendente directamente hacia las playas y son soplados de vuelta hacia la costa por la brisa de las olas, empapando en parte a los estudiantes universitarios vestidos en las vacaciones de primavera y de Pascua. Ya no enseñan ciencias en la universidad cuando la mojito mixología y el sexo son las especialidades más populares entre los jóvenes y tontos.

Nueva York – Poco después de que el Polar Vortex se desplazara hacia el este desde la región de Ohio hacia el noreste, la siguiente gran oportunidad para la infección masiva fue en la línea de abejas a Nueva York y Boston, ambos puertos con ríos y rascacielos imponentes con calor de vapor a plena ráfaga. Estas son las clásicas Islas de Calor Urbana, con potentes cambios de presión de aire como pistones. Por lo tanto, durante el día, la burbuja de calor de Manhattan arroja virus hasta los espacios abiertos de Brooklyn y Staten Island. Por la noche, después de que las oficinas cierran sus puertas y la temperatura del suelo se desploma, los virus bajan en Central Park y luego en las aceras llenas de visitantes a la Gran Manzana. Los cañones de estructuras altas atrapan virus, vertiendo por las entradas del metro, a través de puertas giratorias y en los conductos de ventilación de los taxis. El Apple es un refugio de virus, que se remata cada noche, mientras que los equipos de emergencia en carretillas elevadoras que cargan cuerpos en camiones refrigerados que están sirviendo a una morgue temporal hasta que 45 nuevas unidades de almacenamiento de cadáveres se establecen en toda la metrópolis. Hart Island se utiliza como un lugar de entierro masivo. Esto es primitivo, de vuelta a la Edad Oscura. La ciudad de Nueva York no tiene espacio para los cuerpos, que comenzarán a engordarse con billones de nuevos virus a medida que el clima se calienta a finales de abril. Wall Street está rodeada por la ola de la muerte que creó.

Londres, Madrid y Milán – Lo mismo ocurre con Europa, cuando la corriente de propulsión giraba hacia el sur sobre Londres, se dirigió a Madrid y se desmayó sobre Milán, en la peor campaña de bombardeos desde la Segunda Guerra Mundial. Desde allí el flujo de aire cruzó sobre Moscú “inmune”, que ahora se está descongelando a una floración viral. El chorro de agua ya se ha ido hacia el norte sobre Beijing y la región de Dongbei del noreste de China alrededor de Shenyang y luego Corea del Norte, donde el Gran Líder cayó repentinamente enfermo cuando CoV comenzó a mejorar en el calentamiento de las temperaturas al aire libre. El Grim Reaper es una bestia de mil millones de virus acechando la tierra para nuevas víctimas.

Aprender de los desafíos de la vida

Basado en la práctica de las contramedidas de Urban Heat Island, incluyendo “techos verdes” para reducir la burbuja de calor y el uso de agua subterránea como refrigerante en lugar de sistemas de enfriamiento de techos generadores de calor, los virus no caerían al nivel del suelo en tal abundancia, sino que circularían en la corriente de chorro hasta que la radiación solar los destruyera. La solución es así de simple. Los flujos de aire en oficinas, restaurantes y hogares que canalizan el aire rancio hacia arriba y fuera de los interiores hasta el nivel del techo reducirían las probabilidades de infección en un millón de veces más. Un mejor diseño de inodoros y urinarios, y especialmente secadores de manos, que ahora soplan virus de las manos a la cara, era parte de las propuestas de mi equipo de microbiología, con algunos adoptados en Hong Kong y el continente y otros ignorados, lo que de hecho ha ahorrado a Hong Kong la peor parte de este contagio. Pequeños pasos marcan una gran diferencia en la salud pública, ya que es más eficaz para combatir enfermedades infecciosas en el entorno construido que dentro de su cuerpo.

Si la sociedad va a revivir y sobrevivir, no puedes olvidar esta pandemia como un mal sueño cuando el encierro ha terminado y vuelve a vivir como un cerdo en un estilete. Si no se realizan cambios, entonces el próximo brote podría ser el último. Es muy importante, ya que he estado haciendo hincapié en no quedar atrapado en conceptos abstractos sin apoyo por datos convincentes, como el calentamiento global y la teoría del cambio climático, que son responsables de descarrilar los pasos básicos que fueron defendidos por el movimiento temprano del Día de la Tierra de desarrollar una sociedad de reciclaje para hacer frente a las montañas de residuos tóxicos, para eliminar radicalmente la mayoría de los pesticidas y otras contaminaciones químicas , para promover estilos de vida saludables en una mezcla de campo y ciudad en lugar de mega-ciudades, y homeopatía y terapias herbales en lugar de montones de productos farmacéuticos.

El coronavirus está aquí porque las personas eran perezosas y mentalmente laxas, permitiendo que algunos actores cínicos desarrollaran virus en armas de destrucción masiva porque se dieron cuenta de que no había medidas de bioseguridad en su lugar, ni siquiera los hábitos simplemente de saneamiento personal. Esta es probablemente la última llamada, porque si no respondes y actúas y aplicas presiones políticas y boicoteas a las corporaciones malvadas, la próxima será la última llamada.

La vida dentro de una burbuja

Las megaciudades son el problema y no la solución. Los estados centrales del medio oeste tienen los menos niveles de infecciones por coronavirus y también están en las peores condiciones financieras debido al dominio de la agroindustria corporativa que se beneficia de las exportaciones de soja y maíz a China y a los banqueros y comerciantes de materias primas que lo financian. Mientras tanto, las granjas familiares han sufrido deudas crónicas e impagos hipotecarios debido a las políticas de préstamos de ingeniería financiera en favor de los propietarios de tierras corporativas a megaescala implementadas por Wall Street y State Street, los mismos intereses plutocráticos responsables de la actual pandemia del CoV y la guerra biológica que la desató.

La promoción neoliberal de las megaciudades y el despojo de las comunidades agrarias es esencial para el control corporativo-bancario-político de todos los recursos naturales, desde minerales y energía hasta la producción de alimentos y fuentes de agua, mientras empaquetaba a la gente en recintos cada vez más ajustados, con un bloqueo esencial para el reciclaje psicológico de las expectativas “poco realistas” de lo que era normal no hace mucho tiempo, mientras que los miembros multimillonarios de la junta poseen múltiples mansiones, islas de playa y centros personales. El aislamiento social impuesto a los Estados del Medio Oeste sin apenas casos COVID es una prueba del internamiento masivo de una sociedad una vez libre basada en la autonomía de los hogares agrícolas y de la comunidad local. Siempre he entendido que el internamiento en tiempo de guerra de mi kinfolk fue un experimento de lavado de cerebro por parte de los liberales globalistas Roosevelt, un juicio por un eventual asalto total a los derechos constitucionales. El intento desesperado de la élite fascista neoliberal de destruir los valores y formas de vida tradicionales es una agresión sin barnizar, una guerra de clases por parte de las instituciones criminales ricas y poco representativas contra una democracia de base comprometida con la vida, la libertad y la búsqueda de la felicidad.

ZUMBIDOS EN EL OÍDO / EAR RINGING

No voy a preguntarle al doctor Google, sólo voy a hacer un juego de domingo aburrido. Voy a consultar al mayor consultado del universo mundial. Sí, Google, quizás antes de que el mayor censurador del mundo lo haga. Sí, Google y adyacentes, que censura la calidad, no la cantidad.

El juego consiste en lo siguiente, buscaré en Google zumbido oído de diez años para atrás y veremos los resultados en número de búsquedas por años, del 2011 al 2020 y la misma búsqueda sin años. Luego haré lo mismo pero en inglés con ear ringing con los mismos años. Veamos los resultados:

  • Zumbido oído 2011: 135.000 resultados.
  • Zumbido oído 2012: 149.000 resultados.
  • Zumbido oído 2013: 135.000 resultados.
  • Zumbido oído 2014: 162.000 resultados.
  • Zumbido oído 2015: 150.000 resultados.
  • Zumbido oído 2016: 167.000 resultados.
  • Zumbido oído 2017: 160.000 resultados.
  • Zumbido oído 2018: 166.000 resultados.
  • Zumbido oído 2019: 206.000 resultados.
  • Zumbido oído 2020: 368.000 resultados.
  • Zumbido oído: 448.000 resultados.

¿Qué quiero demostrar con estos datos? Mejor sería preguntar ¿Qué puedo demostrar? Pues no sirvo para realizar estadísticas así que lo dejo aquí. Decir que la búsqueda en Google, tanto en español como en inglés, en el primer caso casi dobla 2020 al 2019 y en el segundo caso, en inglés, lo supera con creces. ¿Qué ha pasado en 2020? Bueno, sería largo de contar por sus aristas e intenso y corto por su profundidad, pero diríamos que está el coronavirus y el 5G.

EAR RINGING

I’m not going to ask Dr. Google, I’m just going to make a boring Sunday game. I am going to consult the most consulted in the world universe. Yes, Google, maybe before the world’s biggest censor does. Yes, Google and adjacent, who censor quality, not quantity.

The game consists of the following, I will search Google for ear ringing ten years ago and we will see the results in number of searches by years, from 2011 to 2020 and the same search without years. Let’s see the results:

  • Ear ringing 2011: 4.590.000 results.
  • Ear ringing 2012: 5.360.000 results.
  • Ear ringing 2013: 5.310.000 results.
  • Ear ringing 2014: 5.540.000 results.
  • Ear ringing 2015: 5.550.000 results.
  • Ear ringing 2016: 6.440.000 results.
  • Ear ringing 2017: 6.930.000 results.
  • Ear ringing 2018: 6.670.000 results.
  • Ear ringing 2019: 6.740.000 results.
  • Ear ringing 2020: 15.700.000 results.
  • Ear ringing: 78.600.000

What do I want to demonstrate with this data? It would be better to ask what can I prove? Well, I’m not good for statistics so I’ll leave it here. To say that the search in Google, both in Spanish and in English, in the first case almost doubles 2020 to 2019 and in the second case, in English, it far exceeds it. What happened in 2020? Well, it would be long to count because of its edges and intense and short because of its depth, but we would say that there is the coronavirus and 5G.

La OMS elimina la inmunidad adquirida naturalmente de su sitio web

WHO Deletes Naturally Acquired Immunity from Its Website

Jeffrey A. Tucker – 23 de diciembre de 2020. Tiempo de lectura: 5 minutos

¿Quizás tienes la sensación de que algo sospechoso está pasando? Mismo. Si no es una cosa, es otra.

El coronavirus vivió en superficies hasta que no lo hizo. Las máscaras no funcionaban hasta que lo hacían, entonces no lo hicieron. Hay una transmisión asintomática, pero no la hay. Los bloqueos funcionan para controlar el virus, excepto que no lo hacen. Todas estas personas están enfermas sin síntomas hasta que, a mal tiempo, las pruebas de PCR son tremendamente inexactas porque nunca fueron diseñadas para ser herramientas de diagnóstico. Todos están en peligro del virus, excepto que no. Se propaga en las escuelas, pero no lo hace.

En él va. Diario. No es de extrañar que tanta gente haya dejado de creer cualquier cosa que digan “autoridades de salud pública”. En combinación con los gobernadores y otros autócratas que hacen sus órdenes, se propusieron quitarles la libertad y los derechos humanos y esperaban que les agradeciémos por salvarnos la vida. En algún momento de este año (para mí era el 12 de marzo) la vida comenzó a sentirse como una novela distópica de su elección.

Bueno, ahora tengo otra prueba que añadir a la pila de desorden de peces. La Organización Mundial de la Salud, por razones desconocidas, ha cambiado repentinamente su definición de una concepción básica de la inmunología: la inmunidad del rebaño. Su descubrimiento fue uno de los principales logros de la ciencia del siglo XX, emergiendo gradualmente en la década de 1920 y luego cada vez más refinado a lo largo del siglo XX.

La inmunidad al rebaño es una observación fascinante que se puede rastrear a la realidad biológica o a la teoría de probabilidad estadística, lo que prefiera. (Ciertamente no es una “estrategia”, así que ignore cualquier fuente de medios que la describa de esa manera.) La inmunidad del rebaño habla directamente, y con poder explicativo, a la observación empírica de que los virus respiratorios son generalizados y en su mayoría leves (frío común) o muy graves y de corta duración (ébola).

¿Por qué es esto? La razón es que cuando un virus mata a su huésped – es decir, cuando un virus sobrecarga la capacidad del cuerpo para integrarlo, su huésped muere y por lo tanto el virus no se propaga a otros. Cuanto más ocurre esto, menos se propaga. Si el virus no mata a su huésped, puede saltar a otros a través de todos los medios habituales. Cuando obtienes un virus y lo combates, tu sistema inmunitario codifica esa información de una manera que crea inmunidad a él. Cuando le sucede a suficientes personas (y cada caso es diferente por lo que no podemos poner un número claro en él, especialmente dadas tantas inmunidades cruzadas), el virus pierde su calidad de pandemia y se vuelve endémico, es decir predecible y manejable. Cada nueva generación incorpora esa información a través de una mayor exposición.

Esto es lo que uno llamaría Virología/Inmunología 101. Es lo que lees en todos los libros de texto. Se ha enseñado en biología celular de noveno grado durante probablemente 80 años. Observar las operaciones de este fenómeno evolutivo es bastante maravilloso porque aumenta el respeto por la forma en que la biología humana se ha adaptado a la presencia de patógenos sin enloquecer absolutamente.

Y el descubrimiento de esta fascinante dinámica en biología celular es una de las principales razones por las que la salud pública se volvió tan inteligente en el siglo XX. Mantuvimos la calma. Gestionamos virus con profesionales médicos: relaciones médico/paciente. Evitamos la tendencia medieval a correr con el pelo en llamas, sino que usamos racionalidad e inteligencia. Incluso el New York Times reconoce que la inmunidad natural es poderosa con Covid-19, lo cual no es en lo más mínimo sorprendente.

Hasta que un día, esta extraña institución llamada Organización Mundial de la Salud, una vez gloriosa porque era la principal responsable de la erradicación de la viruela, ha decidido de repente eliminar todo lo que acabo de escribir de los conceptos básicos de la biología celular. Literalmente ha cambiado la ciencia de una manera soviética. Se ha eliminado con la clave de eliminación cualquier mención de inmunidades naturales de su página web. Ha dado el paso adicional de caracterizar realmente la estructura y el funcionamiento de las vacunas.

Para que me creas, trataré de ser lo más preciso posible. Aquí está el sitio web del 9 de junio de 2020. Puedes verlo aquí en Archive.org. Usted tiene que mover hacia abajo la página y haga clic en la pregunta sobre la inmunidad del rebaño. Ves lo siguiente.

Eso es bastante preciso en general. Incluso la afirmación de que el umbral “todavía no está claro” es correcta. Hay inmunidades cruzadas a Covid de otros coronavirus y hay memoria de células T que contribuye a la inmunidad natural.

Algunas estimaciones son tan bajas como 10%, que está muy lejos de la estimación modelada del 70% de la inmunidad al virus que es estándar dentro del ámbito farmacéutico. La vida real es mucho más complicada que los modelos, en economía o epidemiología. La declaración pasada de la OMS es una descripción sólida, si “pop”.

Sin embargo, en una captura de pantalla fechada el 13 de noviembre de 2020, leemos la siguiente nota que de alguna manera pretende como si los seres humanos no tuvieran sistemas inmunes en absoluto, sino que dependen enteramente de grandes farmacias para inyectar cosas en nuestra sangre.

Lo que ha hecho esta nota en la Organización Mundial de la Salud es eliminar lo que equivale a toda la historia del millón de años de la humanidad en su delicada danza con patógenos. Sólo se podía obtener de esto que todos nosotros no somos más que pizarras en blanco e inaprobables en las que la industria farmacéutica escribe su firma.

En efecto, este cambio en la OMS ignora e incluso elimina 100 años de avances médicos en virología, inmunología y epidemiología. Es completamente poco científico: chelines para la industria de las vacunas exactamente como los teóricos de la conspiración dicen que la OMS ha estado haciendo desde el comienzo de esta pandemia.

Lo que es aún más extraño es la afirmación de que una vacuna protege a las personas de un virus en lugar de exponerlas a ella. Lo sorprendente de esta afirmación es que una vacuna funciona precisamente disparando el sistema inmunitario a través de la exposición. Por qué tuve que escribir esas palabras está realmente más allá de mí. Esto se conoce desde hace siglos. Simplemente no hay manera para que la ciencia médica reemplace por completo el sistema inmunitario humano. Sólo se puede jugar a través de lo que solía llamarse inoculación.

Toma de esto lo que quieras. Es un signo de los tiempos. Durante casi un año completo, los medios de comunicación nos han estado diciendo que la “ciencia” requiere que cumplamos con sus dictados que van en contra de cada principio del liberalismo, cada expectativa que hemos desarrollado en el mundo moderno que podemos vivir libremente y con la certeza de los derechos. Entonces la “ciencia” se hizo cargo y nuestros derechos humanos fueron criticados. Y ahora la “ciencia” en realidad está eliminando su propia historia, aerógrafo sobre lo que solía saber y reemplazarlo por algo engañoso en el mejor de los casos y evidentemente falso en el peor.

No puedo decir por qué, exactamente, la OMS hizo esto. Sin embargo, dados los acontecimientos de los últimos nueve o diez meses, es razonable suponer que la política está en juego. Desde el comienzo de la pandemia, aquellos que han estado presionando los bloqueos y la histeria sobre el coronavirus han resistido la idea de inmunidad natural del rebaño, en cambio insistiendo en que debemos vivir encerrados hasta que se desarrolle una vacuna.

Es por eso que la Declaración del Gran Barrington,escrita por tres de los epidemiólogos preeminentes del mundo y que abogaba por abrazar el fenómeno de la inmunidad del rebaño como una forma de proteger a los vulnerables y minimizar los daños a la sociedad, fue recibida con tal veneno. Ahora vemos a la OMS también sucumbiendo a la presión política. Esta es la única explicación racional para cambiar la definición de inmunidad del rebaño que ha existido durante el siglo pasado.

La ciencia no ha cambiado; sólo la política tiene. Y es precisamente por eso que es tan peligroso y mortal someter la gestión del virus a las fuerzas de la política. Eventualmente la ciencia también se inclina hacia el carácter duplicado de la industria política.

Cuando los libros de texto existentes que los estudiantes usan en la universidad contradicen los últimos pronunciamientos oficiales de las autoridades durante una crisis en la que la clase dominante claramente está tratando de apoderarse del poder permanente, tenemos un problema.

WHO Deletes Naturally Acquired Immunity from Its Website – AIER

Una teoría de la conspiración loca que se puede probar. Covid-21

A crazy conspiracy theory that can be tested. Covid-21

¿Y si la siguiente hoja de ruta loca de la teoría de la conspiración se hace realidad?

Esta hoja de ruta fue “filtrada” por un ex-miembro del Partido Verde de Alemania (David Siber). Hace que la lectura impactante, pero muy cerca de palomas con uno filtrado de Canadá. No tengo un enlace a la primera filtración porque se publica en un canal de Telegram que sigo (David Siber’s). Sin embargo, realmente no creo que la validez de su fuente importe en ningún lugar tan cerca como de su posible poder predictivo.

Mi traducción de la filtración alemana (supongo que fue una fuga de septiembre/octubre, como la canadiense):

  1. Introducir el segundo bloqueo. Los cierres secundarios deben extenderse desde las ciudades hasta las áreas circundantes de una manera arrastrándose. Fecha límite: finales de noviembre de 2020.
  2. Establecimiento de centros de aislamiento en todos los estados y municipios federales. Fecha límite: finales de diciembre de 2020.
  3. Las cifras diarias de infecciones por COVID-19 están aumentando tan rápidamente que las autoridades están alcanzando los límites de su capacidad de prueba. Fecha límite: finales de noviembre de 2020.
  4. Bloqueo completo y final (restricciones más estrictas que el primer bloqueo). Fecha límite: finales de diciembre de 2020 – a partir de enero de 2021.
  5. Reforma del programa de prestaciones por desempleo y Hartz IV hacia la renta básica universal. Fecha límite: primer trimestre de 2021 – es decir, a finales de marzo de 2021.
  6. Mutación del virus COVID-19 en un virus más peligroso llamado COVID-21, que inicia una tercera oleada de infecciones con una alta tasa de mortalidad y mayores tasas de infección. Fecha límite: antes de febrero de 2021.
  7. Las nuevas infecciones diarias de COVID-21 abruman a las clínicas y hospitales. Fecha límite: trimestre 1 – trimestre 2 2021.
  8. Introducción del tercer encierro con más restricciones a la vida pública restante. Se prohibirá viajar entre estados federales e incluso ciudades. Fecha límite: trimestre 2 2021.
  9. Introducir a todos en un programa de ingresos básicos universales. Fecha límite: mediados del trimestre 2 2021.
  10. Una gran inestabilidad económica conduce al colapso de las cadenas de suministro y, por lo tanto, a la escasez de bienes en las tiendas. Fecha límite: trimestre 2 – trimestre 3 2021.
  11. Operaciones del ejército interno dentro de las principales ciudades y en autopistas. El objetivo es evitar el movimiento y los viajes de los ciudadanos y proporcionar apoyo logístico en las ciudades. Fecha límite: antes del trimestre de 2021.
  12. Se da a los ciudadanos la oportunidad de cancelar todos los préstamos personales en el marco del llamado “Programa Mundial de Restablecimiento de la Deuda”. El Estado recibe los recursos financieros necesarios del FMI (Fondo Monetario Internacional). Para adherirse a este programa, los ciudadanos deben transferir todos los derechos de propiedad a los bienes existentes y también a todos los futuros. Además, el ciudadano se compromete a aceptar las vacunas COVID-19 y COVID-21 sin resistencia. Con el nuevo pase de vacunación, se levantan todas las restricciones a cada ciudadano que cumpla con las normas. Los ciudadanos que se oponen a la vacunación y al programa de pago de la deuda se convertirán en un “riesgo para la salud de los demás”. Sólo serán liberados de las restricciones de bloqueo después de aceptar el programa de pago de la deuda y permitirse vacunarse. 

Bill Gates aparece en el video vinculado a arriba. Afirma rotly que “pandemia 2” será peor que “pandemia 1”. El video también muestra a él y a su esposa Melinda luciendo extrañamente complacidos con la perspectiva de la variante más mortífera aún por venir. ¿Cómo puede saber estas cosas? ¿Por qué la prensa no está en todas estas afirmaciones extraordinarias? ¿Quién es responsable de estos horarios posiblemente filtrados? ¿Los horarios son creíbles?

Independientemente de las posibles respuestas a tales preguntas, una teoría es buena si puede ser falsificada. Las predicciones claras cumplen ese criterio aquí. ¿Qué pasa con The Great Reset, “Build Back Better” que se utiliza simultáneamente en todo el mundo de habla inglesa, un medio de comunicación de masas de una sola melodía en todo el mundo y predicciones más transparentes sobre futuras mutaciones de virus y letalidad de un ex jefe de una gran compañía de software, si este conjunto de predicciones (declaraciones) comenzara a hacerse realidad – y parecen ser ya – , que probaría la “teoría de la conspiración”, ¿no? ¿Qué otra explicación podría explicar todos estos hechos?

Si mi lógica es sólida, entonces compartir esta información con todos y el sol es de suma importancia. Me gustaría que este horario fuera el producto de un loco en alguna parte, pero las cosas han estado más allá de la locura durante ocho meses, así que creo que esto merece atención.

Econosophy and other musings: A crazy conspiracy theory that can be tested (thdrussell.blogspot.com)

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.

¿Exagero?

Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

La COVID-19 no se transmite por vía aérea

María José Martínez Albarracín es licenciada en medicina y cirugía por la Universidad de Murcia, catedrática de procesos diagnósticos clínicos, y forma parte de la alianza internacional de Médicos por la Verdad.

Por María José Martínez Albarracín

1º) La ciencia acepta que el receptor viral del Sars-CoV-2 es el enzima ACE2. Este receptor no se expresa en el pulmón, como demostró el equipo descubridor de dicho enzima ACE2 en el año 2000 en un trabajo publicado en Journal of Biological Chemistry con el título: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE” cuya primera autora es la Dra. Sarah R. Tipnis.

El siguiente estudio, de 2020, cuyo título traducido es: “El perfil de expresión de
proteínas ACE2 en tejidos humanos” publicado en Molecular Systems Biology (doi:
10.15252/msb.20209610) de fecha 31 de marzo de 2020, analiza de forma exhaustiva los perfiles de expresión molecular de dicho receptor en diferentes tejidos y corrobora que ACE2 no se expresa en pulmón y tampoco en vías respiratorias. El equívoco se produjo en el año 2003 como explica detalladamente el documento elaborado por LA JUNTA ARGENTINA DE REVISIÓN CIENTÍFICA titulado Cronología Target Vacuna Covid-19.

2º) El Sars-CoV-2 no puede ser cultivado en células del alveolo pulmonar (A549), como demuestra este estudio publicado en Elsevier el 12/9/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) for diagnostic and research purposes”, cuyo primer autor es Sacha Stelzer-Braid. En el pulmón sólo es posible cultivarlo en células de cáncer metastásico, y las células metastásicas no son específicas de pulmón. En la ficha de la vacuna de AstraZeneca se admite esto de forma equívoca al decir textualmente que estas células A549 no permiten la replicación “del vector”.

3º) La transmisión por vía aérea (gotas y aerosoles) no está probada científicamente. Dicha transmisión sólo puede probarse mediante cultivo y secuenciación de la muestra objeto del estudio, sin embargo esto no se ha hecho tal y como admite el propio Ministerio de Sanidad Español. Cito textualmente:

“En todos los casos la cantidad de ARN detectada fue pequeña y el virus no se logró
cultivar”

Pág.8 del documento INFORMACIÓN CIENTÍFICO-TÉCNICA del Ministerio de Sanidad, CENTRO DE COORDINACIÓN DE ALERTAS Y EMERGENCIAS SANITARIAS. “Enfermedad por coronavirus, Covid-19” (actualización del 12 de noviembre de 2020).

4º) La neumonía característica de la Covid-19 es bilateral, simétrica e intersticial, lo que prueba que la patogenia se produce a través de la sangre, ya que en el intersticio pulmonar se encuentran los capilares sanguíneos.

EN CONCLUSIÓN:

Si aceptamos que la Covid-19 está producida por el Sars-CoV-2 y que el receptor celular de dicho coronavirus es ACE2, ya que este virus no puede ser cultivado en células pulmonares naturales y que el receptor ACE2 no se encuentra en tejido pulmonar, tenemos que concluir necesariamente que la Covid-19 no se transmite por vía aérea y que las mascarillas son inútiles para frenar la transmisión.

Ver este documento en formato PDF en el portal de Médicos por la Verdad.

La COVID-19 no se transmite por vía aérea – Medicos Por La Verdad

COVID-19 is not transmitted by air

1st) Science accepts that the viral receptor for Sars-CoV-2 is the enzyme ACE2. This receptor is not expressed in the lung, as the team that discovered the ACE2 enzyme demonstrated in 2000 in a work published in the Journal of Biological Chemistry with the title: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE ”whose first author is Dr. Sarah R. Tipnis. The following study, from 2020, whose translated title is: “The expression profile of ACE2 proteins in human tissues ”published in Molecular Systems Biology (doi: 10.15252 / msb.20209610) dated March 31, 2020, exhaustively analyzes the molecular expression profiles of said receptor in different tissues and corroborates that ACE2 is not expressed in the lung and neither in the respiratory tract. The mistake occurred in 2003, as explained in detail in the document prepared by THE ARGENTINE SCIENTIFIC REVIEW BOARD entitled Covid-19 Vaccine Target Chronology.

2nd) Sars-CoV-2 cannot be cultured in cells of the pulmonary alveolus (A549), as shown in this study published in Elsevier on 9/12/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2) for diagnostic and research purposes ”, whose first author is Sacha Stelzer-Braid. In the lung it is only possible to grow it in metastatic cancer cells, and metastatic cells are not lung specific. This is mistakenly admitted in the AstraZeneca vaccine file by stating verbatim that these A549 cells do not allow “vector” replication.

3º) Transmission by air (drops and aerosols) is not scientifically proven. Such transmission can only be proven by culturing and sequencing the sample under study, however this has not been done as the Spanish Ministry of Health itself admits. I quote verbatim: “In all cases the amount of RNA detected was small and the virus was not achieved cultivate” Page 8 of the document SCIENTIFIC-TECHNICAL INFORMATION of the Ministry of Health, CENTER FOR THE COORDINATION OF HEALTH ALERTS AND EMERGENCIES. “Coronavirus disease, Covid-19” (update November 12, 2020).

4th) The characteristic pneumonia of Covid-19 is bilateral, symmetric and interstitial, which proves that the pathogenesis occurs through the blood, since the blood capillaries are found in the pulmonary interstitium.

IN CONCLUSION: If we accept that Covid-19 is produced by Sars-CoV-2 and that the cellular receptor for said coronavirus is ACE2, since this virus cannot be cultured in natural lung cells and that the ACE2 receptor is not found in lung tissue , we have to necessarily conclude that Covid-19 is not transmitted by air and that masks are useless to stop the transmission.

Tribunal Portugués: Pruebas PCR “poco fiables” y Cuarentenas “Ilegales”

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de “alto riesgo de infección” basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.

*

La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

“Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico”.

https://www.msn.com/es-es/entretenimiento/noticias/la-extra%C3%B1a-muerte-por-coronavirus-de-un-anciano-argentino-que-viv%C3%ADa-aislado/ar-BB1aIm4l?ocid=msedgntp

The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

“Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, “said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, “he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, “the doctor recalled”.

Arzobispo Viganò: Carta abierta a Donald Trump, advierte sobre el “Gran Reinicio”.

DONALD J. TRUMP

Domingo, 25 de octubre de 2020

Presidente

Permítanme dirigirme a ustedes en esta hora en la que el destino de todo el mundo está siendo amenazado por una conspiración global contra Dios y la humanidad. Os escribo como arzobispo, como Sucesor de los Apóstoles, como antiguo nuncio apostólico en los Estados Unidos de América. Os escribo en medio del silencio de las autoridades civiles y religiosas. Que acepten estas palabras mías como la “voz de uno que grita en el desierto” (Jn 1, 23).

Como dije cuando les escribí mi carta en junio, en este momento histórico las fuerzas del Mal se alinean en una batalla sin cuartel contra las fuerzas del Bien; fuerzas del Mal que parecen poderosas y organizadas al oponerse a los hijos de la Luz, que están desorientados y desorganizados, abandonados por sus líderes temporales y espirituales.

Todos los días sentimos que los ataques se multiplican de aquellos que quieren destruir la base misma de la sociedad: la familia natural, el respeto por la vida humana, el amor al país, la libertad de educación y de los negocios. Vemos a los jefes de naciones y líderes religiosos atorándose a este suicidio de la cultura occidental y su alma cristiana, mientras que los derechos fundamentales de los ciudadanos y los creyentes son negados en nombre de una emergencia de salud que se está revelando cada vez más plenamente como instrumental para el establecimiento de una tiranía inhumana sin rostro.

Un plan global llamado Gran Reinicio está en marcha. Su arquitecto es una élite global que quiere someter a toda la humanidad, imponiendo medidas coercitivas con las que limitar drásticamente las libertades individuales y las de poblaciones enteras. En varias naciones este plan ya ha sido aprobado y financiado; en otros todavía está en una etapa temprana. Detrás de los líderes mundiales que son los cómplices y ejecutores de este proyecto infernal, hay personajes sin escrúpulos que financian el Foro Económico Mundial y el Evento 201,promoviendo su agenda.

El propósito del Gran Reinicio es la imposición de una dictadura de la salud con el objetivo de la imposición de medidas liberticidas, ocultas detrás de tentadoras promesas de asegurar un ingreso universal y cancelar la deuda individual. El precio de estas concesiones del Fondo Monetario Internacional será la renuncia a la propiedad privada y la adhesión a un programa de vacunación contra Covid-19 y Covid-21 promovido por Bill Gates con la colaboración de los principales grupos farmacéuticos. Más allá de los enormes intereses económicos que motivan a los promotores del Gran Restablecimiento,la imposición de la vacunación irá acompañada de la exigencia de un pasaporte sanitario y un DNI digital, con el consiguiente rastreo de contactos de la población de todo el mundo. Aquellos que no acepten estas medidas serán confinados en campos de detención o puestos bajo arresto domiciliario, y todos sus bienes serán confiscados.

Señor Presidente, me imagino que ya es consciente de que en algunos países se activará el Gran Restablecimiento entre finales de este año y el primer trimestre de 2021. Para ello, se prevén nuevos bloqueos, que se justificarán oficialmente con una supuesta segunda y tercera oleada de la pandemia. Ustedes son muy conscientes de los medios que se han desplegado para sembrar pánico y legitimar las limitaciones draconianas a las libertades individuales, provocando artísticamente una crisis económica mundial. En las intenciones de sus arquitectos, esta crisis servirá para que el recurso de las naciones al Gran Reinicio sea irreversible, dando así el golpe final a un mundo cuya existencia y muy memoria quieren cancelar por completo. Pero este mundo, señor Presidente, incluye personas, afectos, instituciones, fe, cultura, tradiciones e ideales: personas y valores que no actúan como autómatas, que no obedecen como máquinas, porque están dotados de un alma y un corazón, porque están unidos por un vínculo espiritual que extrae su fuerza de arriba, de ese Dios que nuestros adversarios quieren desafiar, tal como Lucifer hizo al principio de los tiempos con “suno serma”.

Muchas personas, como bien sabemos, están molestas por esta referencia al choque entre el Bien y el Mal y el uso de matices “apocalípticos”, que según ellos exaspera espíritus y agudiza las divisiones. No es de extrañar que el enemigo se enoje por ser descubierto justo cuando cree que ha llegado a la ciudadela que busca conquistar sin perturbaciones. Lo sorprendente, sin embargo, es que no hay nadie que haga sonar la alarma. La reacción del estado profundo a quienes denuncian su plan está rota e incoherente, pero comprensible. Justo cuando la complicidad de los medios de comunicación convencionales había logrado hacer la transición al Nuevo Orden Mundial casi indoloro y desapercibido, todo tipo de engaños, escándalos y crímenes están saliendo a la luz.

Hasta hace unos meses, era fácil desprestigorarse como “teóricos de la conspiración” aquellos que denunciaron estos terribles planes, que ahora vemos que se llevan a cabo hasta el más mínimo detalle. Nadie, hasta el pasado mes de febrero, hubiera pensado que, en todas nuestras ciudades, los ciudadanos serían arrestados simplemente por querer caminar por la calle, respirar, querer mantener sus negocios abiertos, querer ir a la iglesia el domingo. Sin embargo, ahora está sucediendo en todo el mundo, incluso en la Italia de postales que muchos estadounidenses consideran un pequeño país encantado, con sus monumentos antiguos, sus iglesias, sus ciudades encantadoras, sus pueblos característicos. Y mientras los políticos están atrincherados dentro de sus palacios promulgando decretos como sátrapas persas, las empresas están fallando, las tiendas están cerrando y se impide que la gente viva, viaje, trabaje y ore. Las desastrosas consecuencias psicológicas de esta operación ya se están viendo, comenzando con los suicidios de empresarios desesperados y de nuestros hijos, segregados de amigos y compañeros de clase, que se les dice que sigan sus clases mientras se sientan en casa solo frente a una computadora.

En la Sagrada Escritura, san Pablo nos habla de “el que se opone” a la manifestación del misterio de la iniquidad,el kath-kon (2 Tes 2, 6-7). En el ámbito religioso, este obstáculo para el mal es la Iglesia, y en particular el papado; en el ámbito político, son los que impiden el establecimiento del Nuevo Orden Mundial.

Como ahora está claro, el que ocupa la Cátedra de Pedro ha traicionado su papel desde el principio para defender y promover la ideología globalista, apoyando la agenda de la iglesia profunda, que lo eligió de sus filas.

Señor Presidente, usted ha declarado claramente que desea defender a la nación : Una Nación bajo Dios,libertades fundamentales y valores innegociables que se niegan y luchan contra hoy. Eres tú, querido Presidente, quien es “el que se opone” al estado profundo, el asalto final de los hijos de las tinieblas.

Por esta razón, es necesario que todas las personas de bien sean persuadidas de la importancia de la época de la inminente elección: no tanto por el bien de este o de ese programa político, sino por la inspiración general de vuestra acción que mejor encarna , en este contexto histórico particular, ese mundo, nuestro mundo, que quieren cancelar por medio del encierro. Vuestro adversario es también nuestro adversario: es el enemigo de la raza humana, el que es “un asesino desde el principio” (Jn 8, 44).

A tu alrededor están reunidos con fe y coraje aquellos que te consideran la guarnición final contra la dictadura mundial. La alternativa es votar por una persona que es manipulada por el estado profundo, gravemente comprometida por escándalos y corrupción, que hará a los Estados Unidos lo que Jorge Mario Bergoglio está haciendo a la Iglesia, el Primer Ministro Conte a Italia, el Presidente Macron a Francia, el Primer Ministro Sánchez a España, y así sucesivamente. La naturaleza chantajable de Joe Biden, al igual que la de los prelados del “círculo mágico” del Vaticano, lo expondrá a ser utilizado sin escrúpulos, permitiendo que los poderes ilegítimos interfieran tanto en la política interna como en los equilibrios internacionales. Es obvio que aquellos que lo manipulan ya tienen a alguien peor que él listo, con quien lo reemplazarán tan pronto como surja la oportunidad.

Y sin embargo, en medio de este panorama sombrío, surge este avance aparentemente imparable del “Enemigo Invisible”, un elemento de esperanza. El adversario no sabe amar, y no entiende que no sea suficiente asegurar un ingreso universal o cancelar hipotecas para subyugar a las masas y convencerlas de que sean marcadas como ganado. Este pueblo, que durante demasiado tiempo ha soportado los abusos de un poder odioso y tiránico, está redescubriendo que tiene un alma; entiende que no está dispuesto a intercambiar su libertad para la homogeneización y cancelación de su identidad; está empezando a entender el valor de los lazos familiares y sociales, de los lazos de fe y cultura que unen a las personas honestas. Este Gran Restablecimiento está destinado a fracasar porque los que lo planearon no entienden que todavía hay gente dispuesta a tomar las calles para defender sus derechos, para proteger a sus seres queridos, para dar un futuro a sus hijos y nietos. La inhumanidad nivelada del proyecto globalista se destrozará miserablemente frente a la firme y valiente oposición de los hijos de la Luz. El enemigo tiene a Satanás de su lado, Aquel que sólo sabe odiar. Pero de nuestro lado, tenemos al Señor Todopoderoso, el Dios de los ejércitos dispuestos para la batalla, y la Santísima Virgen, que aplastará la cabeza de la antigua Serpiente. “Si Dios es para nosotros, ¿quién puede estar contra nosotros?” (Rm 8:31).

Señor Presidente, usted es muy consciente de que, en esta crucial hora, los Estados Unidos de América se consideran el muro defensor contra el que se ha desatado la guerra declarada por los defensores del globalismo. Pon tu confianza en el Señor, fortalecido por las palabras del apóstol Pablo: “Puedo hacer todas las cosas en Aquel que me fortalece” (Flp 4, 13). Ser un instrumento de la Divina Providencia es una gran responsabilidad, por la cual sin duda recibirás todas las gracias de estado que necesitáis, ya que están siendo fervientemente implorados para vosotros por las muchas personas que te apoyan con sus oraciones.

Con esta esperanza celestial y la seguridad de mi oración por vosotros, por la Primera Dama y por vuestros colaboradores, con todo mi corazón os envío mi bendición.

¡Dios bendiga a los Estados Unidos de América!

+ Carlo Maria Viganò

Teta Arzobispo de Ulpiana

Ex Nuncio Apostólico en los Estados Unidos de América

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

COVID-21 ¿Película basada en hechos reales?

Traigo aquí un supuesto correo-e de un político del Partido Liberal Canadiense. Como el virus decían que supuestamente declinaría en la época estival y así no ha sido, ya me espero cualquier cosa. Tal texto puede ser una realidad en la estrategia, las tácticas pueden variar dependiendo de muchos factores. Lean como ficción y entiendan como realidad fronteriza que nos ha tocado ver, leer y escuchar en el limbo de la percepción vital. El guion de la película está escrito…

De una fuente anónima:

Comité Estratégico de LPC LeakInboxLPC leaker <LPC_leaker@protonmail.com>1:47 PM (7 horas hace )toHello,

Mensaje Original ‐‐‐‐‐‐‐

El sábado 10 de octubre de 2020 1:38 PM,

REMOVED <REMOVED>

escribió: Querido *******, Quiero proporcionarle información muy importante. Soy miembro del comité dentro del Partido Liberal de Canadá. Me siento dentro de varios grupos de comités, pero la información que estoy proporcionando proviene del comité de Planificación Estratégica (que es dirigido por la PMO).

Necesito empezar diciendo que no soy feliz haciendo esto, pero tengo que
hacerlo. Como canadiense y lo que es más importante como padre que quiere un futuro mejor no sólo para mis hijos, sino también para otros niños. La otra razón por la que estoy haciendo esto es porque aproximadamente el 30% de los miembros del comité no están satisfechos con la dirección que esto llevará a Canadá, pero nuestras opiniones han sido ignoradas y planean avanzar hacia sus metas. También han dejado muy claro que nada detendrá los resultados previstos.

La hoja de ruta y el objetivo fueron establecidos por la PMO y es el siguiente: – Fase en las restricciones de bloqueo secundario sobre una base de rodadura, comenzando con las principales áreas metropolitanas primero y expandiéndose hacia el exterior.

Se espera para noviembre de 2020.

Apresurar la adquisición (o construcción de) instalaciones de aislamiento en todas las provincias y territorios.

Se espera para diciembre de 2020.

– Los nuevos casos diarios de COVID-19 aumentarán más allá de la capacidad de las pruebas, incluyendo aumentos en las muertes relacionadas con COVID después de las mismas curvas de

crecimiento. Se espera para finales de noviembre de 2020. – Bloqueo secundario completo y total (mucho más estricto que la primera y segunda restricciones de fase rodante).

Previsto para finales de diciembre de 2020

– principios de enero de 2021 – Reforma y ampliación del programa de desempleo que se convertirá en el programa de renta básica universal. Se espera para el primer trimestre de 2021.

– Mutación COVID-19 proyectada y/o coinución con virus secundarios(denominado COVID-21)dando lugar a una tercera onda con una tasa de mortalidad mucho mayor y una mayor tasa de infección.

Se espera para febrero de 2021.

– Los nuevos casos diarios de hospitalizaciones COVID-21 y muertes relacionadas con COVID-19 y COVID-21 superarán la capacidad de los centros de atención médica. Esperado Q1 – Q2 2021.

– Se implementarán restricciones de bloqueo mejoradas (denominadas Tercer Bloqueo). Se impondrán restricciones de viaje completas (incluidas las interridades y las interesoreidades). Se espera el segundo trimestre de 2021. – Transición de individuos al programa universal de renta básica.

Se espera a mediados del segundo trimestre de 2021. – Projected cadena de suministro descomponeciones, escasez de inventario, gran inestabilidad económica.

Se espera a finales del segundo trimestre de 2021. – Despliegue de personal militar en las principales áreas metropolitanas, así como en todas las carreteras principales para establecer puestos de control de viaje.

Restringir el viaje y el movimiento. Proporcionar apoyo logístico a la zona. Se espera para el tercer trimestre de 2021.

Junto con eso, se pidió a la comisión de Planificación Estratégica que diseñara una forma eficaz de hacer la transición de los canadienses para hacer frente a un esfuerzo económico sin precedentes.

Uno que cambiaría el rostro de Canadá y alteraría para siempre la vida de los canadienses. Lo que se nos dijo fue que para compensar lo que era esencialmente un colapso económico a escala internacional, que el gobierno federal iba a ofrecer a los canadienses un alivio total de la deuda.

Así es como funciona: el gobierno federal ofrecerá eliminar todas las deudas personales (hipotecas, préstamos, tarjetas de crédito, etc.) que todos los fondos serán proporcionados a Canadá por el FMI bajo lo que se conocerá como el programa de Restablecimiento Mundial dela Deuda .

A cambio de la aceptación de esta condonación total de la deuda, el individuo perdería la propiedad de todos y cada uno de los bienes y activos para siempre.

La persona también tendría que aceptar participar en el calendario de vacunación COVID-19 y COVID-21, que proporcionaría a la persona un viaje sin restricciones y una vida sin restricciones incluso bajo un bloqueo completo (mediante el uso de la identificación con foto conocida como HealthPass de Canadá).

Los miembros del Comité preguntaron quién se convertiría en el propietario de los bienes y activos perdidos en ese escenario y qué sucedería con los prestamistas o instituciones financieras, simplemente nos dijeron “el programa de Restablecimiento Mundial de la Deuda manejará todos los detalles”.

Varios miembros del comité también cuestionaron lo que les pasaría a las personas si se negaban a participar en el programa World Debt Reset, o el HealthPass, o el calendario de vacunación, y la respuesta que obtuvimos fue muy

preocupante. Esencialmente nos dijeron que era nuestro deber asegurarnos de que se nos ocurrió un plan para asegurar que eso nunca sucedería. Nos dijeron que era en el mejor interés para los individuos participar.

Cuando varios miembros del comité presionaron implacablemente para obtener una respuesta, nos dijeron que aquellos que se negaran vivirían primero bajo las restricciones de bloqueo indefinidamente.

Y que en un corto período de tiempo a medida que más canadienses pasaran al programa de condonación de la deuda, los que se negaran a participar se considerarían un riesgo para la seguridad pública y serían reubicados en instalaciones de aislamiento.

Una vez en esas instalaciones se les darían dos opciones, participarían en el programa de condonación de deudas y serían liberados, o permanecerían indefinidamente en la instalación de aislamiento bajo la clasificación de un grave riesgo para la salud pública y tener todos sus activos confiscados.

Así que como pueden imaginar después de escuchar todo esto se convirtió en una discusión acalorada y se intensificó más allá de cualquier cosa que he presenciado
antes. Al final, la OMG insinuó que todo el programa avanzará sin importar quién esté de acuerdo o no. Que no será sólo Canadá, sino que, de hecho, todas las naciones tendrán hojas de ruta y agendas similares.

Que tenemos que aprovechar las situaciones que tenemos ante nosotros para promover el cambio a una escala más grande para el mejoramiento de todos. Los miembros que se opusieron y los que plantearon cuestiones clave que surgirían de tal cosa fueron completamente ignorados. Nuestras opiniones e inquietudes fueron ignoradas. Simplemente nos dijeron que lo hiciéramos.

Todo lo que sé es que no me gusta y creo que va a colocar a los canadienses en un futuro oscuro.

COVID-21 Movie based on real events?

I bring here an alleged e-mail from a politician from the Canadian Liberal Party. As they said the virus would supposedly decline in the summer season and it has not, I expect anything. Such text can be a reality in strategy, tactics can vary depending on many factors. Read as fiction and understand as a border reality that we have had to see, read and hear in the limbo of vital perception. The script for the film is written …

https://www.nexusnewsfeed.com/article/geopolitics/canadian-control-measures-just-the-tip-of-the-earth-sized-iceberg