Esto hace saltar por los aires la estafa del Covid. Se acabó.

No creo que sea por dinero, en esto del Covid-19 hay algo más. Es la vacuna, o más bien, la vacunación ¿Qué hay en la vacuna? Lo que ellos quieran y cuando quieran. Pero antes de llegar a esta conclusión, lean.

Todas las patentes, todos los criminales, todas las empresas, y citas como esta: «La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: «necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso».

Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC (En inglés y alemán)


Reiner Fuellmich, Dr. David Martin, Prof. Martin Schwab, Dr. Wolfgang Wodarg, Viviane Fischer

Reiner Fuellmich  00:09

Así que creo que es mejor si te presentas. Sé que eres el presidente de M-CAM International Innovation Risk Management, pero eso no le dice a mucha gente lo que realmente estás haciendo?

Dr David Martin  00:25

Sí, bueno, desde un punto de vista corporativo, desde 1998, hemos sido el mayor suscriptor del mundo de activos intangibles utilizados en finanzas en 168 países. Así que en la mayoría de los países de todo el mundo, nuestros sistemas de suscripción, que incluyen todo el corpus de todas las patentes, solicitudes de patentes, subvenciones federales, registros de adquisiciones, registros de gobierno electrónico, etc. Tenemos la capacidad no solo de rastrear lo que está sucediendo y quién está involucrado en lo que está sucediendo, sino que monitoreamos una serie de intereses temáticos para una variedad de organizaciones e individuos, así como para nuestro propio uso comercial, porque como probablemente sepa, mantenemos tres índices de renta variable global, que son los índices de renta variable de gran capitalización y mediana capitalización de mejor rendimiento en todo el mundo. Así que nuestro negocio es monitorear la innovación que está sucediendo en todo el mundo y específicamente monitorear la economía de esa innovación, el grado en que, ya saben, los intereses financieros están siendo atendidos, ya saben, los intereses corporativos están siendo dislocados, etc. Por lo tanto, nuestro negocio es el negocio de la innovación y sus finanzas.

Reiner Fuellmich  02:03

Reiner traduce. Bueno, lo conseguí. Sí.

Dr David Martin  02:53

Así que, obviamente desde el punto de vista de esta presentación, como saben, hemos revisado las más de 4000 patentes que se han emitido en torno al Coronavirus del SARS. Y hemos hecho una revisión muy exhaustiva de la financiación de todas las manipulaciones del Coronavirus que dieron lugar al SARS como un subclado de la familia beta del Coronavirus. Así que lo que quería hacer era darles una visión general rápida de la línea de tiempo porque no vamos a pasar por 4000 patentes en esta conversación, pero les he enviado a ustedes y a su equipo, un documento que es excepcionalmente importante. Esto se hizo público en la primavera de 2020. Este documento que usted tiene y puede ser publicado en el registro público es bastante crítico en el sentido de que tomamos la secuencia genética reportada, que al parecer fue aislada como un nuevo Coronavirus, indicada como tal por el ICTV, el Comité Internacional de Taxonomía de Virus de la Organización Mundial de la Salud, tomamos las secuencias genéticas reales que supuestamente eran nuevas y revisamos las que estaban disponibles en comparación con los registros de patentes que estaban disponibles a partir de la primavera de 2020. Y lo que encontramos, como verán en este informe, son más de 120 pruebas patentadas que sugieren que la declaración de un nuevo Coronavirus fue en realidad una falacia. No hubo nuevo Coronavirus. Hay innumerables modificaciones muy sutiles de las secuencias de Coronavirus que se han subido, pero no hubo un solo nuevo Coronavirus identificado en absoluto. De hecho, encontramos registros en los registros de patentes de secuencias atribuidas a la novedad que iban a patentes que se solicitaron ya en 1999. Entonces, esto no solo no era una novela, sino que en realidad no solo no ha sido novela, sino que no ha sido novela durante más de dos décadas. Pero tomemos un paso muy corto, y lo que haré es llevarlos en un viaje muy corto a través del panorama de las patentes para asegurarme de que la gente entienda lo que sucedió. Pero como saben, hasta 1999, el tema de Coronavirus vs V [VSV?] la actividad de patentamiento en torno al Coronavirus se aplicaba de manera única a las ciencias veterinarias. La primera vacuna patentada para coronavirus fue buscada por Pfizer. La aplicación de la primera vacuna para coronavirus, que fue específicamente esta proteína pico s. Así que exactamente lo mismo que supuestamente nos hemos apresurado a la invención. La primera solicitud se presentó el 28 de enero de 2000, hace 21 años. Así que la idea de que misteriosamente tropezamos en la forma de intervenir en las vacunas no solo es ridícula, es incrédula porque Timothy Millor, Sharon Klepfer, Albert Paul Reed y Elaine Jones el 28 de enero de 2000, presentaron lo que finalmente se emitió como la patente estadounidense 6372224, que era el virus de la proteína spike, una vacuna para el Coronavirus canino, que en realidad es una de las múltiples formas de Coronavirus. Pero como dije, el trabajo inicial hasta 1999 se centró en gran medida en el área de las vacunas para animales, los dos animales que recibieron la mayor atención fueron probablemente el trabajo de Ralph Barics sobre los conejos y la miocardiopatía del conejo que se asoció con problemas significativos entre los criadores de conejos, y luego el Coronavirus canino en el trabajo de Pfizer para identificar cómo desarrollar candidatos a diana de vacunas de proteína s y spike, dando lugar a la evidencia obvia que dice que ni el concepto de Coronavirus de una vacuna, ni el principio del Coronavirus en sí como un patógeno de interés con respecto al comportamiento de las proteínas spike es nada nuevo en absoluto. De hecho, tiene 22 años, según las solicitudes de patente. Lo que es más problemático, y lo que en realidad es el problema más atroz es que Anthony Fauci y el NIAID encontraron que la maleabilidad del Coronavirus era un candidato potencial para las vacunas contra el VIH. Así que el SARS en realidad no es una progresión natural de una modificación zoonética del Coronavirus. De hecho, muy específicamente en 1999 Anthony Fauci financió una investigación en la Universidad de Carolina del Norte Chapel Hill, específicamente para crear, y no puedes evitar, ya sabes, lamentar lo que estoy a punto de leer porque esto viene directamente de una solicitud de patente presentada el 19 de abril de 2002. Y ustedes escucharon correctamente la fecha de 2002 en la que el NIAID construyó una replicación infecciosa defectuosa del Coronavirus que estaba específicamente dirigida al epitelio pulmonar humano. En otras palabras, fabricamos el SRAS y lo patentamos el 19 de abril de 2002, antes de que se hubiera producido ningún supuesto brote en Asia, que, como saben, le siguió varios meses. Esa patente emitida es la patente estadounidense 7279327. Esa patente establece claramente en una secuenciación genética muy específica, el hecho de que sabíamos que el receptor ACE, el dominio de unión a ACE2, la proteína espiga s1 y otros elementos de lo que hemos llegado a conocer como este patógeno azote no solo se diseñó, sino que podría modificarse sintéticamente en el laboratorio, utilizando nada más que tecnologías de secuenciación de genes, tomando código informático y convirtiéndolo en un patógeno o un intermediario del patógeno. Y esa tecnología se financió exclusivamente en los primeros días como un medio por el cual podríamos aprovechar el Coronavirus como un vector para distribuir la vacuna contra el VIH. Les dejé traducir eso porque eso es mucho material.

Reiner Fuellmich  11:30

Bien. Reiner traduce. Bien.

Reiner Fuellmich  15:32

(inaudible) Sequoia Pharmaceuticals.

Dr David Martin  15:32

Bien. Así que la cosa empeora. Se nos pidió a mi organización que vigilara las violaciones de los tratados sobre armas biológicas y químicas en los primeros días del año 2000. Recordarán los eventos de ántrax en septiembre de 2001. Y fuimos parte de una investigación que dio lugar a la investigación del Congreso no solo sobre los orígenes del ántrax, sino también sobre lo que era un comportamiento inusual en torno al medicamento de ciprofloxacina Bayers, que era un medicamento utilizado como tratamiento potencial para el envenenamiento por ántrax. Y a lo largo del otoño de 2001, comenzamos a monitorear una enorme cantidad de patógenos bacterianos y virales que estaban siendo patentados a través de los NIH, NIAID, US AMRIID, el Programa de Enfermedades Infecciosas de las Fuerzas Armadas de los Estados Unidos y una serie de otras agencias internacionales que colaboraron con ellos. Y nuestra preocupación era que el Coronavirus estaba siendo visto no solo como un potencial agente manipulable para su uso potencial como vector de vacuna, sino que también estaba siendo considerado muy claramente como un candidato a arma biológica. Así que nuestro primer informe público sobre esto tuvo lugar antes del brote de SRAS en la última parte de 2001. Así que pueden imaginarse lo decepcionado que estoy de estar sentado aquí 20 años después de haber señalado 20 años antes que había un problema que se avecinaba en el horizonte con respecto al Coronavirus. Pero después del supuesto brote y siempre diré supuesto brote porque creo que es importante que entendamos que el Coronavirus como patógeno circulante dentro del modelo viral que tenemos en realidad no es nuevo en la condición humana y no es nuevo en las últimas dos décadas. En realidad ha sido parte de la secuencia de proteínas que circula durante mucho tiempo. Sin embargo, el supuesto brote que tuvo lugar en China en 2002, hasta 2003, dio lugar a una presentación muy problemática en abril de 2003 por parte del Centro para el Control y la Prevención de Enfermedades de los Estados Unidos. Y este tema es de importancia crítica para obtener el matiz muy preciso, porque además de archivar toda la secuencia genética en lo que se convirtió en coronavirus SARS, que en realidad es una violación de 35 US Code Sección 101. No se puede patentar una sustancia natural. La violación de la Sección 101 del Código de los Estados Unidos 35 fue el número de patente 7220852. Ahora bien, esa patente también tenía una serie de patentes derivadas asociadas a ella, estas son nuestras solicitudes de patente que se separaron porque eran de múltiples materias patentables. Pero estos incluyen la patente de EE.UU. 46592703p, que en realidad es una designación muy interesante, patente de EE.UU. 7776521. Estas patentes no solo cubrían la secuencia genética del Coronavirus SARS, sino que también cubrían los medios para detectarlo mediante RT-PCR. Ahora, la razón por la que eso es un problema es que si ambos poseen la patente sobre el gen en sí, y poseen la patente sobre su detección, tienen una ventaja cortante para poder controlar el 100 por ciento de la procedencia no solo del virus en sí, sino también de su detección, lo que significa que tienen todo el control científico y de mensajes. Y esta patente solicitada por los CDC supuestamente fue justificada por su equipo de relaciones públicas como buscada para que todos fueran libres de poder investigar el Coronavirus. El único problema con esa afirmación es que es una mentira y la razón por la que es una mentira es porque la oficina de patentes no una sino dos veces rechazó la patente sobre la secuencia genética como no patentable porque la secuencia genética ya estaba en el dominio público. En otras palabras, antes de que los CDCs solicitaron una patente, la oficina de patentes encontró un 99.9 por ciento de identidad con el Coronavirus ya existente registrado en el dominio público, y sobre el rechazo del examinador de patentes. Y después de tener que pagar una multa de apelación en 2006 y 2007, los CDC anularon el rechazo de las oficinas de patentes de su patente y finalmente en 2007 obtuvieron la patente sobre el Coronavirus SARS. Ahora, cada declaración pública que los CDC han hecho que dijo que esto era de interés público es falsificable por su propio soborno pagado a la oficina de patentes. Esto no es algo que es sutil, y para empeorar las cosas que pagaron una tarifa adicional para mantener su solicitud privada. La última vez que lo comprobé, si está tratando de hacer que la información esté disponible para la investigación pública, no pagaría una tarifa para mantener la información privada. Me hubiera gustado haber inventada cualquier cosa que acabo de decir, pero todo eso está disponible en el registro del archivo público de patentes que cualquier miembro del público puede revisar. Y el PAR Público, como se le llama en la Oficina de Patentes de los Estados Unidos, no sólo tiene la evidencia, sino los documentos reales que tengo en mi poder. Ahora, esto es críticamente importante. Es de vital importancia porque los verificadores de hechos han declarado repetidamente que el nuevo Coronavirus, designado como SARS CoV 2, es de hecho distinto de la patente de los CDC. Y aquí está el problema genético y el problema de las patentes. Si nos fijamos en la secuencia de genes que es presentada por los CDC en 2003, de nuevo en 2005 y luego de nuevo en 2006, lo que se encuentra es la identidad en algún lugar entre el 89 y el 99 por ciento de las superposiciones de secuencias que se han identificado en lo que se llama el nuevo subclado de SARS CoV 2. Lo que sabemos es que la designación central de SARS Coronavirus, que en realidad es el clado de la familia de los betacoronavirus y el subclado que se ha llamado SARS CoV 2 tienen que superponerse desde un punto de vista taxonómico. No se puede tener la designación del SRAS en una cosa sin que primero sea el SRAS. Así que la verificación de hechos falsos que se ha hecho diciendo que de alguna manera u otro CDC no tiene nada que ver con esta patente en particular, o este patógeno en particular, está más allá de la credibilidad literal de las secuencias publicadas. Y también está más allá de la credulidad cuando se trata de la taxonomía de ICTV porque establece muy claramente que este es de hecho un subclado del clado llamado Coronavirus SARS. Ahora, lo importante es el 28 de abril, y escuchen la fecha con mucha atención porque esta fecha es problemática. Tres días después de que los CDC presentaron la patente sobre el Coronavirus sars en 2003. Tres días más tarde, Sequoia Pharmaceuticals, una compañía que se estableció en Maryland, Sequoia pharmaceuticals el 28 de abril de 2003, presentó una patente sobre agentes antivirales de tratamiento y control de infecciones por coronavirus. Los CDC presentaron tres días antes, y luego el tratamiento estuvo disponible tres días después. Ahora, solo mantenga ese pensamiento por un segundo.

Dr David Martin  25:26

Bueno, ahí lo tienes. Esa es una buena pregunta porque Sequoia Pharmaceuticals y, en última instancia, Ablynx Pharmaceuticals se convirtieron en las tenencias propietarias de Pfizer, Crucell y Johnson and Johnson.

Reiner Fuellmich  25:43


Dr David Martin  25:45

Así que hágase una pregunta simple. ¿Cómo se tendría una patente sobre un tratamiento para una cosa que se había inventado tres días antes?

Reiner Fuellmich  25:55


Dr David Martin  25:57

La patente en cuestión, la patente del 28 de abril de 2003 7151163,emitida a Sequoia Pharmaceuticals tiene otro problema. El problema es que se emitió y publicó antes de que se permitiera la patente de los CDC sobre coronavirus. Por lo tanto, el grado en que la información podría haber sido conocida por cualquier medio que no sea información privilegiada entre esas partes es cero. No es físicamente posible patentar una cosa que trata una cosa que no había sido publicada, porque los CDC habían pagado para mantenerla en secreto. Esta, mis amigos es la definición de conspiración criminal extorsión y colusión. Esto no es una teoría. Esto es una prueba. No se puede tener información en el futuro en forma [para] un tratamiento para una cosa que no existía.

Reiner Fuellmich  27:16

Esto bien podría estallar en un caso Rico, en última instancia.

Dr David Martin  27:20

Es decir, es un caso Rico. No se puede explotar, es un caso de Rico. Y el patrón Rico, que se estableció en abril de 2003 para el primer Coronavirus, se jugó exactamente en el mismo horario cuando vemos que el SARS CoV 2 aparece cuando tenemos a Moderna recibiendo la secuencia de proteínas spike por teléfono del centro de investigación de vacunas del NIAID antes de la definición del nuevo subclado. ¿Cómo tratas una cosa antes de que realmente la tengas?

Reiner Fuellmich  28:04

Tengo que traducir esto, ¿no puedes inventar esto? Definitivamente no. Reiner traduce.

Reiner Fuellmich  33:22

Sí, bueno, va a empeorar aquí.

Reiner Fuellmich  33:22

Oh no, no puede empeorar.

Dr David Martin  33:24

Oh, lo hace. El 5 de junio de 2008, que es una fecha importante porque en realidad es alrededor de la época en que DARPA el Programa de Investigación Avanzada de Defensa en los Estados Unidos se hizo activamente un interés en coronavirus como un arma biológica. 5 de junio 2008 Ablynx, que como usted sabe ahora es parte de Sanofi, presentó una serie de patentes que se dirigieron específicamente a lo que nos han dicho es la característica novedosa del virus SARS CoV 2. Y escucharon lo que acabo de decir, este es el 5 de junio de 2008.

Reiner Fuellmich  34:09

¿Encontraron qué?

Dr David Martin  34:10

Específicamente se dirigieron a lo que se llamó el sitio de escisión poli básica para el SARS Cov, la nueva proteína spike y el dominio de unión al receptor ACE2 que supuestamente es nuevo para el SARS CoV 2, y todo eso fue patentado el 5 de junio de 2008. Y esas patentes en secuencia se emitieron entre el 24 de noviembre de 2015, que fue la patente estadounidense 9193780. De modo que uno saliera después del aumento de la moratoria de la función. Ese se produjo después del brote de MERS en Oriente Medio, pero lo que se encuentra es que luego, en 2016, 2017, 2019, se emitió una serie de patentes que cubren no solo las hebras de ARN, sino también los subcomponentes de las hebras genéticas, a Ablynx y Sanofi. Y luego tenemos a Crucell. Tenemos Rubius Therapeutics. Tenemos Children’s Medical Corporation. Tenemos muchos otros que incluyen la Universidad Ludwig Maximillans en Munchen, Protein Sciences Corporation, Dana-Farber Cancer Institute, La Universidad de Iowa, la Universidad de Hong Kong, el Centro Nacional chino del Genoma Humano en Shanghai, todos los que se identifican en las solicitudes de patente que van desde 2008 hasta 2017. Cada atributo que supuestamente fue publicado de forma única por la publicación de referencia única, el nuevo murciélago Coronavirus, revela inserciones naturales de la s1 s2 al sitio de escisión de la proteína spike y posibles tres orígenes recombinantes del virus SARS CoV 2, el artículo que se ha utilizado rutinariamente para identificar el nuevo virus. Desafortunadamente, si realmente tomas lo que informan como novedoso, encuentras 73 patentes emitidas entre 2008 y 2019, que tienen los elementos que supuestamente eran novedosos en el SARS CoV 2, específicamente en lo que se refiere al sitio de escisión poli básico basado en tu dominio de unión al receptor y la proteína spike. Así que los componentes clínicamente nuevos de lo clínicamente único, clínicamente contagioso, ¿saben a dónde voy con esto? Bien. No hubo brote de SRAS, porque habíamos diseñado todos los elementos de eso. Y en 2016, el documento que se financió durante la moratoria de ganancia de función, que decía que el Coronavirus del SARS estaba listo para la emergencia humana escrito nada menos que por Ralph Baric, no solo estaba listo para la emergencia humana, sino que fue patentado para la explotación comercial 73 veces.

Reiner Fuellmich  38:07

Ralph Baric, creo que vi un videoclip con él dando un discurso en el que le dijo explícitamente a la audiencia que se puede ganar mucho dinero con esto.

Dr David Martin  38:17

Sí se puede. Y ha hecho mucho dinero haciendo esto.

Reiner Fuellmich  38:22


Dr David Martin  38:25

Así que para aquellos que quieran vivir en la ilusión de que de una manera u otra ese es el final de la historia, prepárese para una decepción mayor porque alguien sabía algo en 2015 y 2016, lo que dio lugar a mi cita favorita de toda esta pandemia. Y por eso no estoy siendo lindo. Mi cita favorita de esta pandemia fue una declaración hecha en 2015 por Peter Daszak. La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: «necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso». fin de la cita.

Viviane Fischer  39:47

Eso es bastante impactante, porque pensé que –

Reiner Fuellmich  39:49

Eso es realmente quiero decir, Peter Doshi, no era él el uno –

Dr David Martin 39:49

– déjame leer eso de nuevo, solo porque no sé si podría perderme en la traducción. Así que déjenme seguir adelante y leerlo lentamente. Sí, y como a los estadounidenses les encanta hacer cuando hablan a una audiencia multilingüe, tal vez debería decirlo más fuerte. No lo haré. «Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. los inversionistas responderán si ven ganancias al final del proceso». Fin de la cita.

Reiner Fuellmich  40:45

– no no no Peter Daszak.

Viviane Fischer  40:46

Oh Daszak?

Dr David Martin  40:47

Peter Daszak el jefe de Eco Health Alliance?

Reiner Fuellmich  40:49

Peter Doshi es el bueno.

Viviane Fischer  40:51

Sí, yo era sólo –

Dr David Martin  40:52

– Peter Daszak la persona que estaba corroborando de forma independiente la teoría de la fuga china no de laboratorio porque no había una fuga de laboratorio. Esta fue una bio-militarización intencional de proteínas espiga para inyectar en las personas para que sean adictas a una vacuna pan-Coronavirus. Esto no tiene nada que ver con un patógeno que se liberó y cada estudio que se ha lanzado para tratar de verificar una fuga de laboratorio es una pista falsa.

Viviane Fischer  41:26

¿Y realmente no hay nada que sea nuevo en esto?

Dr David Martin 41:29

nada. cero. 73 patentes sobre todo lo clínicamente novedoso. 73, todos emitidos antes de 2019. Y les voy a dar la bomba más grande de todas para demostrar que esto en realidad no fue una liberación de nada porque la Patente 7279327, la patente sobre la naturaleza recombinante de ese pulmón dirigido al Coronavirus, fue transferida misteriosamente de la Universidad de Carolina del Norte, Chapel Hill a los Institutos Nacionales de Salud en 2018. Ahora, aquí está el problema con eso. Bajo la Ley Bayh-Dole, el gobierno de los Estados Unidos ya tiene lo que se llama una disposición de derecho de margen. Eso significa que si se paga al gobierno estadounidense por la investigación, tienen derecho a beneficiarse de esa investigación a petición suya o a su antojo. Así que explique por qué, en 2017 y 2018, de repente los Institutos Nacionales de Salud tienen que tomar posesión de la patente que ya tenían derechos sobre la Universidad de Carolina del Norte, Chapel Hill. ¿Y cómo tenían que presentar un Certificado de Corrección para asegurarse de que era legalmente ejecutable? Porque hubo un error tipográfico en la referencia de concesión en la primera presentación. Por lo tanto, necesitaban asegurarse de que no solo lo hacían bien, sino que también debían asegurarse de que cada tipo de error gráfico que figuraba en la patente fuera correcto. Sobre la patente única requerida para desarrollar el mandato del Instituto de Investigación de Vacunas, que fue compartido entre la Universidad de Carolina del Norte, Chapel Hill en noviembre de 2019 y Moderna en noviembre de 2019 cuando UNC Chapel Hill, NIAID y Moderna comenzaron la secuenciación de una vacuna de proteína spike un mes antes de que ocurriera un brote.

Reiner Fuellmich  43:51

Tienes toda la evidencia, ¿verdad?

Dr David Martin  43:53


Reiner Fuellmich  43:55

Tendré que traducir esto. Así que todo es sobre dinero.

Dr David Martin 49:25

Siempre ha sido cuestión de dinero, y sólo para responder a una pregunta que se ha formulado un poco antes. El guion de esto fue escrito el 6 de enero de 2004.

Reiner Fuellmich  49:39

¿6 de enero de 2004? ¿Quién escribió el guion?

Dr David Martin  49:42

Merck, en una conferencia llamada SARS y bioterrorismo, bioterrorismo enfermedades infecciosas emergentes, antimicrobianos, terapéutica y moduladores inmunológicos. Merck introdujo la noción de lo que llamaron la nueva normalidad. Propio sustantivo de la nueva normalidad, que es el lenguaje que se convirtió en la campaña de marca que fue adoptada por la Organización Mundial de la Salud, la Junta de Monitoreo de la Preparación Global, que fue la junta en la que se sentaron juntos el Director del Centro para el Control de Enfermedades de China, el Dr. Elias de Bill Gates, de la Fundación Gates, y Anthony Fauci en esa junta directiva. Pero la primera introducción de la campaña de la nueva normalidad, que trataba de hacer que la gente aceptara una vacuna universal contra el pan-coronavirus, en realidad se adoptó el 6 de enero de 2004. Así que ha existido bastante tiempo. No voy a decir muchos más puntos, aparte de decir que estaba muy claro que Merck lo sabía, lamento que Moderna supiera que se iba a poner al frente de la línea con respecto al desarrollo de una vacuna en marzo de 2019. Y esta es una fecha muy importante, porque en marzo de 2019, por razones que no son transparentes, de repente modificaron una serie de solicitudes de patentes rechazadas, lo cual es un comportamiento muy extraño, pero modificaron una serie de solicitudes de patentes para hacer referencia específicamente a una liberación intencional o accidental, lo siento, su término liberación intencional de Coronavirus. Así que en marzo, enmendaron cuatro solicitudes de patente fallidas para comenzar el proceso de desarrollo de una vacuna contra el Coronavirus. Y empezaron a lidiar con un problema muy importante que tenían, que era que dependían de tecnología que no poseían. Dos compañías canadienses Arbutus Pharmaceuticals y Acuitas Pharmaceuticals en realidad poseen la patente sobre la envoltura de nanopartículas lipídicas que se requiere para administrar la inyección del fragmento de ARNm. Y esas patentes se han emitido tanto en Canadá como en los Estados Unidos y luego en todo el mundo en su equivalencia mundial de propiedad intelectual. Moderna sabía que no poseía los derechos y comenzó a tratar de negociar con Arbutus y Acuitas para obtener la resolución de la tecnología patentada de nanopartículas lipídicas disponible para ser puesta en una vacuna. Y sabemos, como hice referencia antes, que en noviembre, firmaron un acuerdo de investigación y cooperación de investigación y desarrollo con UNC Chapel Hill con respecto a conseguir que la proteína espiga se pusiera dentro de la nanopartícula lipídica para que realmente tuvieran una vacuna candidata antes de que tuviéramos un patógeno, supuestamente que estaba corriendo alrededor. Lo que hace que esa historia sea más problemática más allá de la naturaleza evidente de la misma es que sabemos que desde 2016 hasta 2019, en cada una de las reuniones de la junta del Consejo Asesor del NIAID, Anthony Fauci lamentó el hecho de que no pudo encontrar una manera de hacer que la gente aceptara la vacuna universal contra la influenza, que es lo que era su objetivo favorito. , estaba tratando de que la población se involucrara en este proceso. Y lo que se hace muy evidente con Peter Daszak Eco Health Alliance, UNC Chapel Hill y otros, y luego más específicamente, en marzo de 2019, en las solicitudes de patentes enmendadas de Moderna, vemos que hay una epifanía que dice: ¿Qué pasaría si hubiera una liberación accidental o intencional de un patógeno respiratorio? Y lo que hace que esa frase en particular sea problemática es que se recita exactamente en el libro Un mundo en riesgo, que es el escenario que armó la Organización Mundial de la Salud en septiembre de 2019. Así que meses antes hay un supuesto patógeno, que dice que necesitamos tener una experiencia global coordinada de la liberación de un patógeno respiratorio, que para septiembre de 2020, debe poner en marcha una capacidad universal para la gestión de las relaciones públicas, el control de multitudes y la aceptación de un mandato de vacuna universal. Eso fue septiembre de 2019. Y el lenguaje de una liberación intencional de un patógeno respiratorio se escribió en el escenario que cita «debe estar terminado para septiembre de 2020».

Dr. Wolfgang Wodarg 55:44

Este era un texto para la sra. Brundtland estaba al frente de esta comisión, ¿no es así?

Dr David Martin  55:50

Bueno, esta es la declaración unificada de las juntas de monitoreo de preparación global. Hay una serie de personas que han tomado crédito y luego se han alejado del crédito por ello, pero sí, tienes razón.

Dr Wolfgang Wodarg  56:00

¿Estoy en lo cierto también cuando digo que también el receptor ACE2 que ya estaba descrito en las patentes antes de 2019?

Dr David Martin  56:11

Sí, tenemos 117 patentes con el mecanismo de focalización del receptor ACE2 específicamente para el Coronavirus SARS.

Dr Wolfgang Wodarg  56:20

Porque siempre dicen que esto es lo nuevo con el virus.

Dr David Martin  56:24

Ahora, no es nuevo, y no ha sido ni remotamente nuevo. Está en publicaciones que se remontan a 2008. En las conferencias sobre emplazamiento de armas que tuvieron lugar en Eslovenia, en Europa, en toda Europa y en toda la infraestructura de DARPA. Lo sabemos desde 2013. Es aislamiento y amplificación.

Viviane Fischer  56:49

Y esta, la enmienda que Merck hizo a esto, [donde] rechazaron las solicitudes de patente, entonces, ¿fue solo por el hecho de que es como deliberadamente, ya saben, como, poner en el medio ambiente o algo así, o agregaron algo más?

Dr David Martin  57:05

Pues bien, se trata de cuatro solicitudes de patente fallidas que se revitalizaron esencialmente en marzo de 2019. Y fue Moderna, me equivoco. Hablé de Merck, era Moderna, y traté de corregir que lamento que eso no salió adelante. Pero son las solicitudes de patente de Moderna las que fueron modificadas en marzo de 2019 para incluir la liberación intencional de un lenguaje de patógeno respiratorio.

Viviane Fischer  57:35

Si eso no hubiera sido rechazado por alguna razón, simplemente no estarían sentados allí básicamente.

Dr David Martin  57:41

No, hacen procesos similares a otras compañías farmacéuticas, donde se utilizan de hoja perenne y modifican continuamente las aplicaciones para disfrutar de las primeras fechas de prioridad disponibles. Pero es por eso que tienes que volver atrás y mirar la enmienda de los registros de solicitud para averiguar cuándo se puso en marcha el lenguaje de enmienda real. Pero sí, quiero decir, el hecho del asunto es, y como dije, no voy a ser belabour todos los datos de patentes, pero cualquier afirmación de que este patógeno es de alguna manera único o novedoso se desmorona en las secuencias de genes reales, que se publican en el registro de patentes, y luego más atrozmente se desmorona en el hecho de que tenemos Peter Daszak mismo afirmando que tenemos que crear publicidad pública para obtener el público para aceptar la contramedida médica de una vacuna pan-Coronavirus. Y lo que hace que eso sea más ridículo es el hecho de que, como sabemos, la Organización Mundial de la Salud había declarado el Coronavirus, ya saben, una especie de interés muerto. Es decir, dijeron que habíamos erradicado el Coronavirus como una preocupación. Entonces, ¿por qué haberlo erradicado en 2007 y 2008? ¿Por qué empezamos a gastar miles de millones de dólares a nivel mundial en una vacuna para una cosa que había sido erradicada por declaración en 2008? Ya saben, como que cae en la zona de la incredulidad, por decir lo menos.

Reiner Fuellmich  59:23

¿No significa eso también si se toma la totalidad de la evidencia, entonces esta es una herramienta el Coronavirus y las vacunas, esta es una herramienta, y el interés de DARPA en crear un arma biológica a partir de esto, esta es una herramienta para todo lo demás que se aferra a esto, incluido el control de la población, por ejemplo?

Dr David Martin  59:50

Bueno, escuchen, tenemos que dejar de caer incluso en la narrativa convencional en nuestra propia línea de cuestionamiento porque el hecho es que esto fue visto como una fuente biológica altamente maleable. No cabe duda de que en 2005 era, sin lugar a dudas, un arma preferida. Y la ilusión de que desafortunadamente seguimos viendo a personas muy bien intencionadas que quedan atrapadas en conversaciones sobre si estamos teniendo una vacuna para un virus. El hecho es que no lo estamos, estamos inyectando una secuencia de ARNm de proteína spike, que es una simulación por computadora, no se deriva de la naturaleza. Es una simulación por ordenador de una secuencia que se conoce y patenta desde hace años. Y lo que sabemos es que esa secuencia, como se informó, se informa a través de cosas como ustedes saben, las conversaciones telefónicas muy confiables que tuvieron lugar entre Moderna y el centro de investigación de vacunas por autoinforme, donde no sé si usted estaba en una llamada telefónica y escuchó ATTCCGGTTCCGABBB, ya sabes, ¿hay alguna posibilidad de que puedas obtener una carta de valor una consonante caída aquí o allá? La naturaleza ridícula de la historia de que esto es de alguna manera profiltivo o preventivo va en contra del 100 por ciento de la evidencia, porque la evidencia deja muy claro que no ha habido ningún esfuerzo por parte de ninguna compañía farmacéutica para combatir el virus. Se trata de conseguir que las personas se inyecten con la proteína espiga s1 que se sabe que es dañina. Así que la historia de portada es que si obtienes una expresión de una proteína espiga, vas a tener algún tipo de alivio sintomático general. Pero el hecho es que nunca ha habido una intención de vacunar a una población como la define el universo de vacunación. Y es importante, quiero decir, repasemos solo para que conste, cuando Anthony Fauci intentó desesperadamente que se publicaran algunas de sus citas, «vacunas de ARN sintético», la oficina de patentes le rechazó sus propias patentes. Y quiero leer lo que le dijo la oficina de patentes. Cuando el propio Anthony Fauci del NIAID pensó que podía obtener una vacuna similar al ARNm patentada como vacuna. Y aquí está la cita, «estos argumentos son persuasivos en la medida en que un péptido antigénico estimula una respuesta inmune que puede producir anticuerpos que se unen a un péptido o proteína específica, pero no es persuasivo en lo que respecta a una vacuna». Bien, esta es la oficina de patentes. No se trata de una especie de agencia de salud pública. Esta es la oficina de patentes. «La respuesta inmune producida por una vacuna debe ser algo más que una simple respuesta inmune, sino que también debe ser protectora. Como se señaló en la acción anterior de la Oficina, el arte reconoce que el término vacuna es un compuesto que previene la infección. El solicitante no ha demostrado que la vacuna reclamada instantáneamente cumpla ni siquiera con el estándar más bajo establecido en la especificación, y mucho menos con la definición estándar para ser operativa. En lo que respecta, por lo tanto, las reivindicaciones cinco, siete y nueve no están operativas, ya que la vacuna contra el VIH, que es en lo que estaba trabajando, no es una utilidad patentable». Así que el propio Anthony Fauci fue informado por la oficina de patentes, que lo que estaba proponiendo como una vacuna no cumple con el estándar patentable, el estándar legal o el estándar clínico.

Prof. Martin Schwab 1:04:10

Oh, ¿podemos traducir esto para nuestra audiencia? Esto podría ser muy importante.

Reiner Fuellmich  1:04:20

Por cierto, David, ese es nuestro amigo, Martin Schwab, el profesor Martin Schwab de, es nuestro asesor legal más importante de la Universidad de Bielefeld.

Dr. David Martin 1:04:34

Oh, cierto.

Reiner Fuellmich  1:04:36

Es muy inteligente. Lo sé, David sé que muchos de nuestros espectadores están realmente sorprendidos. Lo veo en las respuestas. Uno de nuestros espectadores es nuestro especialista en pruebas PCR, el profesor Kemera. Ella no puede creer lo que está pasando aquí.

Dr David Martin  1:09:51

Bueno, la triste y sobria ironía es que planteé estas cuestiones a partir de 2002, después del susto del ántrax, y la tragedia es que ahora estamos sentados en un mundo donde tenemos cientos de millones de personas a las que se les está inyectando una secuencia informática estimulante de patógenos, que se está vendiendo bajo lo que la oficina de patentes , lo que la profesión médica, y lo que la FDA y sus propias normas clínicas no sugerirían es una vacuna, pero al usar el término en realidad ahora estamos sometiendo a cientos de millones de personas a lo que se sabía que era en 2005 un arma biológica.

Reiner Fuellmich  1:10:54

Reiner traduce.

Dr David Martin  1:11:44

Así que obviamente tengo cientos de horas de estas cosas comprometidas con la memoria porque lo he estado haciendo durante dos décadas. Pero si tiene alguna pregunta, estaré encantado de responderlas.

Reiner Fuellmich  1:11:55

Estoy seguro de que va a haber cientos de preguntas, David. Vamos a estar en contacto. Creo que vas a ser inundado por la gente, por los correos electrónicos de la gente, etc. Solo voy a adelantar lo que entra o vamos a presentar lo que entra, pero creo que, oh, sí, tenemos un Martin Schwab, probablemente tiene una pregunta muy seria.

Prof Martin Schwab  1:12:16

Y después de mí Wolfgang también. Bien. Soy profesor de derecho en la Facultad de Derecho aquí en Bieldfeld, tengo que decirles que las Unidades de Protección Constitucional del Ministerio del Interior ahora observan la llamada escena negacionista de Corona. La negación de corona es todo aquel que se atreve a no estar de acuerdo con el –

Reiner Fuellmich  1:12:54

– con la línea oficial –

Prof Martin Schwab  1:12:55

– con la línea oficial. Sí. Ahora. Si esta Unidad de Protección Constitucional toma nota de que participe en una discusión de que esta pandemia se puso en escena intencionalmente, probablemente intentarán despedirme de mi trabajo. Así que al menos tengo que hacer algunas preguntas. Mientras te oía hablar, eché un vistazo al número de patente, oh, cuál era, 7220852 7151163. Y 7220852 se presentó el 12 de abril y 715 y así sucesivamente se presentó el 28 de abril de 2004. Veo una diferencia entre 16, no 3 días, ¿qué entendí mal?

Dr David Martin  1:14:03

No. ¿El 23 de abril de 2003 fue la fecha de presentación maestra de los CDC?

Prof Martin Schwab  1:14:09

Bien. Bien. Hice esta pregunta porque si tratan de hacerme bajar por mi trabajo, tengo que proporcionar pruebas sólidas.

Dr David Martin  1:14:22

Ahora tenemos todo esto enviado a, sé que el Dr. Fuellmich tiene todo el registro en el expediente fauci. El 100 por ciento de este registro está ahí. El apéndice adicional que envié a través de todos tiene los registros allí incluyendo todas las fechas de presentación de prioridad, así como la fecha de emisión. Así que el 100 por ciento de esto está en registros escritos publicados y ustedes tienen los registros escritos.

Prof Martin Schwab  1:14:26


Reiner Fuellmich  1:14:28

He creado mi propio archivo, y está etiquetado como David Martin.

Prof Martin Schwab  1:15:00

Bueno, hay, hice [un] análisis de los informes de los medios aquí, y puedo confirmar que dan una cuenta muy unilateral sobre la pandemia. Todos los que se atreven a declarar que la amenaza es menos peligrosa que el gobierno serán denunciados como teóricos de la conspiración, pecaminosos, etc. Así que los medios de comunicación hicieron exactamente lo que usted señaló en la frase que repitió dos veces antes de ahora. En realidad, nos cuentan la historia de la variante Delta, que se dice que es mucho más contagiosa que todo lo demás. Los expertos con los que he hablado me dijeron que las bases de datos contienen hasta más o 40.000 cepas de virus.

Dr David Martin  1:16:01


Prof Martin Schwab  1:16:02

Entonces, ¿podría esta variante delta ser algún tipo de bombo mediático del que nos hablaste antes?

Dr David Martin  1:16:12

No existe tal cosa como una alfa o una beta o una gamma o una variante delta. Este es un medio por el cual lo que se busca desesperadamente es un grado en el que los individuos puedan ser coaccionados para que acepten algo que de otra manera no aceptarían. No ha habido en ninguno de los estudios publicados sobre lo que se ha reportado la variante Delta, no ha habido una población no se calculan, que es la tasa de replicación real. Lo que se ha estimado son simulaciones por ordenador. Pero desafortunadamente, si nos fijamos en GISAID, que es la fuente pública de subir cualquiera de una serie de variaciones, lo que encontrarán es que no ha habido capacidad para identificar ninguna secuencia de genes clínicamente alterada, que luego tiene una variación clínicamente expresada. Y este es el problema desde el principio. Este es el problema que se remonta al comienzo de lo que se alega que es una pandemia, es que no tenemos ninguna evidencia de que la alteración de la secuencia genética tuviera importancia clínica alguna. No ha habido un solo artículo publicado por nadie que realmente haya establecido que cualquier cosa novedosa desde noviembre de 2019, tiene distinción clínica de cualquier cosa que sea anterior a noviembre de 2019. El problema con las 73 patentes que describí es que esas 73 patentes contienen lo que se informó que era novedoso en diciembre de 2019 y 2020, respectivamente. Así que el problema es que incluso si aceptáramos que hay neumonías idiopáticas, incluso si aceptáramos que hay algún conjunto de síntomas inducidos por patógenos, no tenemos una sola evidencia publicada que nos diga que cualquier cosa sobre el subclado SARS CoV 2 tiene distinción clínica de todo lo que se sabía y se publicó antes de noviembre de 2019 en 73 patentes que datan de 2008.

Viviane Fischer  1:18:56

¿Podría ser que la variante Delta es que solo las diferencias, saben que los síntomas clínicos son los mismos, pero que tiene la capacidad de infectar a alguien que ya ha pasado por la variante B?

Dr David Martin  1:19:14

Bueno, aquí es donde vemos una enorme cantidad de respuesta y comportamiento reflexivo al bombo de los medios. No hay, y voy a repetir esto, no hay evidencia de que la variante Delta sea de alguna manera distinta de cualquier otra cosa en GISAID. El hecho de que ahora estemos buscando una cosa no significa que sea una cosa porque estemos viendo fragmentos de cosas. Y el hecho es que si elegimos cualquier fragmento que se me ocurrió, ya saben, podría llegar a la variante Omega mañana. Y podría llegar a la variante Omega y podría decir que estoy buscando esta subcatenía de ADN o ARN, o incluso una proteína. Y podía correr alrededor del mundo yendo, «oh, Dios mío, miedo a la variante Omega».

Prof Martin Schwab  1:20:15


Dr David Martin  1:20:16

Y el problema es que debido a la naturaleza de la forma en que actualmente secuenciamos genomas, que en realidad es un proceso de composición, es lo que llamamos en matemáticas y entrelazado. No tenemos ningún punto de referencia para saber realmente si lo que estamos viendo es, de hecho, distinto del sentido clínico o incluso genómico. Y entonces estamos atrapados en un mundo donde desafortunadamente, si van y miran como yo los papeles que aislaron la variante Delta, y en realidad hacen la pregunta, ¿es la variante Delta algo más que la selección de una secuencia en un cambio sistemático de una otra secuencia ya revelada? La respuesta es, es sólo una alteración, y cuando se inicia y se detiene lo que se llama el marco de lectura. No hay nada novedoso. Sí, bueno

Dr. Wolfgang Wodarg 1:21:20

El Dr. Wolfgang Wodarg traduce.

Reiner Fuellmich  1:28:41

David, voy a hacer una larga historia muy corta. Él está totalmente de acuerdo con su análisis. Él entiende tu angustia con respecto a que le hayas dicho al mundo sobre esto hace 20 años, casi. Y admira su tenacidad. Y está muy agradecido por haber tomado esta mirada tan de cerca al problema a través de la ley de patentes. El Dr. Wodarg cree que las patentes son realmente problemáticas, porque resulta que probablemente sea cinco veces más caro patentar medicamentos, en lugar de tener universidades públicas, no públicas, privadas, sino públicas, que obtengan los estipendios obteniendo el dinero que necesitan para desarrollar estas vacunas.

Dr David Martin  1:29:38

Sí, voy a hacer algo que es muy injusto, pero voy a mantener el documento muy cerca de la pantalla. Y es sólo para fines de representación. Pero quiero que vean que esta es la patente del cuartel que los NIH necesitaban haberles devuelto por razones misteriosas en 2018, esta es la 7279327. Y la gente puede buscar esto por su cuenta. Pero si realmente miras las secuencias que están patentadas, que es una de las cosas que hemos hecho, en realidad miramos las secuencias publicadas, y nos damos cuenta de que dependiendo de dónde recortes la cadena de secuencia real, tendrás lo mismo o tendrás una cosa diferente basada nada más que en dónde decidas analizar el clip. Y quiero leerles, quiero decir, esto es algo que viene directamente de su solicitud de patente. Cuando en realidad hablan de las hebras de ADN, que llaman números de identificación de secuencia. En realidad, dicen específicamente que el organismo es una secuencia artificial, una secuencia artificial, lo que significa que no es una secuencia que tiene una base de reglas en la naturaleza, no es algo que se manifestó para una proteína derivada natural en particular o una secuencia de ARNm derivada natural que se aisló, cada una de ellas es de hecho una secuencia sintética y artificial. Y si volvemos atrás y miramos cada una de ellas, lo que hemos hecho, lo que encontraremos es que las secuencias, de hecho, son contiguas, en muchos casos, pero se superponen en otras, donde es simplemente una determinación de Capricho que dice que algo es o no es parte de un marco de lectura abierto, o es o no es parte de una secuencia de oligonucleótidos en particular. Ahora, la razón por la que eso es importante es porque si vamos a examinar lo que finalmente se está inyectando en los individuos, necesitamos la secuencia exacta, no un tipo de similar a, necesitamos la secuencia exacta. Y si nos fijamos en el requisito de la FDA, y si nos fijamos en el entorno regulatorio europeo, y si nos fijamos en el resto del entorno regulatorio del mundo, por razones que no se pueden explicar, la secuencia exacta que ha entrado en lo que se amplifica dentro de la inyección parece ser esquiva, parece ser algo que alguien no puede, de hecho, afirmar con 100 por ciento de certeza, la secuencia es x. El problema que esto presenta es que en este momento, por mucho que se nos pueda decir que hay, ya saben, ensayos clínicos en curso, y hay todo tipo de otras cosas sucediendo, no tenemos forma de verificar que una secuencia completa ha sido, es, o potencialmente incluso podría ser fabricada en lo que en última instancia se convierte en la nanopartícula lipídica que es la frecuencia portadora en la que se administra la inyección. Y es importante que la gente entienda que ya en 2002, y a lo largo de las solicitudes de patentes de 2003, y luego las patentes de armamentización que comenzaron en 2008, en cada uno de estos casos, se identifican fragmentos, pero se identifican sin especificidad. Así que no tenemos extremos terminales directos de los fragmentos, tenemos fragmentos que tienen, ya saben, brechas esencialmente hipotéticas en las que se puede colocar cualquier cosa. Y esa es la razón por la que encuentro que la verificación de hechos en torno a la situación de las patentes es muy decepcionante. Debido a que la razón por la que los verificadores de hechos entre sus atributos perezosos generales, la razón por la que los verificadores de hechos no están verificando realmente los hechos cuando se trata de los asuntos de patentes es porque las secuencias reales no están representadas en una forma digital que facilita hacer esta comparación. Literalmente, tuvimos que tomar imágenes de papel mecanografiado enviado, y luego codificarlas para hacer nuestra propia evaluación. No se puede hacer esto en el sitio de patentes de la OEP. No se puede hacer esto con los datos de la OMPI de Ginebra. No se puede hacer esto con los datos de la Oficina de Patentes de los Estados Unidos. En realidad tienes que entrar y reconstruir las secuencias genéticas reales a mano y luego compararlas con lo que se ha subido a los servidores públicos y ahí es donde encuentras que la cuestión de la novedad es algo que no se abordó. Era una ilusión fabricada.

Dr Wolfgang Wodarg  1:35:03

Tengo una pregunta más. ¿Es posible que veamos que la gripe ha desaparecido? Ya no tenemos gripe. La gripe seguro que los virus también están secuenciados. Y es posible que esas secuencias de partes de las que ahora hablamos puedan existir en ambos tipos de virus, de modo que es solo una cuestión de pruebas y [una] cuestión de instrumentos para observar lo que encontramos, si encontramos influenza o si encontramos Corona. Si tenemos un cierto, si usted tiene un libro, usted tiene una palabra con cinco letras, y usted encontrará estas cinco letras en muchos libros,

Dr David Martin  1:35:49

¿Correcto? exactamente. Sí. Wolfgang, tu pregunta es una hermosa metáfora de exactamente el problema. El problema es que, si lo que estamos buscando es algo que hemos decidido que ha decidido que vale la pena buscar, entonces lo encontraremos. Y la buena noticia es que lo encontraremos [en] un montón de lugares. Y si hemos decidido que ya no estamos buscando nada, no es del todo sorprendente que no lo encontremos porque no lo estamos buscando. El hecho del asunto es si es las pruebas de PCR rt que decidimos que hay fragmentos, que por cierto, he mirado cada una de las presentaciones regulatorias, que se ha presentado a la FDA, para tratar de averiguar cuál era el estándar de oro para obtener la autorización de uso de emergencia. Y qué fragmento de SARS CoV 2 era oficialmente el fragmento oficial que era el estándar comparativo. Y el problema es que no se puede obtener un solo estándar. Así que la pregunta se convierte en, en un mundo donde no hay un estándar único, ¿qué es lo que realmente encuentras? Porque si estoy buscando y ¿por qué no acabo de leer esto? Si estoy buscando un CCACGCTTTG? ¿Agrego la siguiente hebra G o voy no, no, el siguiente bit es GTTTATTCG. Y entiendes el punto. El punto es que donde elijo comenzar y detenerme, puedo decir que lo encontré. No, no lo encontré.

Dr Wolfgang Wodarg  1:37:33


Dr David Martin  1:37:35

Y no encontré la coincidencia que proyecté sobre los datos porque elegí mirar los datos de una manera que no pude encontrar la coincidencia. La gripe no abandonó a la población humana. La influenza fue un mandato fallido de una década de vacuna contra la influenza que fue promovido desesperadamente, desesperadamente por los gobiernos de todo el mundo, fracasaron y decidieron que si la influenza no cumple con la promesa pública de hacer que todos se inyecten, cambiemos el patógeno.

Dr Wolfgang Wodarg  1:38:19

Hay muchos más que pueden cambiar.

Dr David Martin  1:38:21

Oh, Dios mío, tenemos toneladas más por venir.

Reiner Fuellmich  1:38:24

Sí, pero ahora estamos en ellos.

Viviane Fischer  1:38:27

Me gustaría decirles algo sobre este desarrollo de la prueba PCR de drosten, ya saben, porque lo analizamos brevemente, no en la medida en que ahora miraron las patentes que acaban de describir, sino que observamos este tipo de milagro, o como quiero decir, aspecto extraño de como el desarrollo de la prueba de Drosten , porque él, a pesar del hecho de que habría necesitado básicamente, a través de su empleador, The Charite tendría derecho a tener las patentes sobre este, ya saben, su invento, acaba de publicar la instrucción a la casa (inaudible) para que todos pudieran verla. Así que básicamente, toda la invención perdió su posibilidad de ser patentada, y eso es un poco extraño, ya sabes, cuando lo miras, así que le pedimos a la Charita en una solicitud de ley de Libertad de Información, y entonces dijeron, Bueno, ya sabes, porque había mucha prisa por sacar la, ya sabes, esta prueba porque había esto –

Reiner Fuellmich  1:39:34

– pandemia en marcha –

Viviane Fischer  1:39:34

– pandemia en marcha, así que fue como, no miramos las finanzas, ya sabes, simplemente no nos importaba. Así que eso es un poco extraño como procedimiento, porque quiero decir, básicamente esta prueba vale como miles de millones, saben, cómo podrían, quiero decir, este es un hospital financiado con fondos públicos, cómo pueden dar, ya saben, regalar todo esto, y luego porque también estaba en estrecha cooperación con una empresa privada TIB Molbiol. Es el mismo con el que había desarrollado todas las pruebas PCR desde 2002 desde el primer SARS, y luego MERS, (inaudible) y así sucesivamente y así sucesivamente. Así que es muy extraño, ya saben, porque básicamente estaba como, funcionando como un abridor de puertas para esta compañía, ya saben, porque también nos dijeron, así que básicamente, fue Drosten quien decidió a qué posible país o como laboratorio o lo que sea la prueba, esta compañía TIB Molbiol enviaría los kits de prueba para luego, por supuesto, , ganar más dinero, porque él era básicamente como, tenía una ventaja de ser el primero en moverse, ya sabes, Drosten y o esta compañía. Así que está claro ahora, quiero decir, tal vez no había nada en ese momento, porque ya había muchas patentes en marcha. Así que básicamente, a partir de este virus no nuevo o una prueba PCR, no pudo patentar nada que hubiera sido nuevo. Así que, básicamente, era realmente como una cosa muy lógica para hacer entonces usar todo el asunto como un solo para, ya saben, obtener ganancias de esta ventaja de ser el primero en moverse. Y tal vez Drosten está de alguna manera involucrado en toda esta estafa legal, financiera –

Reiner Fuellmich  1:41:16

– oh, es una de las personas más importantes en este juego, porque él es el que está tirando de las cuerdas que tiraron primero.

Dr David Martin  1:41:22

Sí, necesitas crear la ilusión de la demanda, y no hay nada en este momento que haga un mejor trabajo de crear la ilusión de la demanda que la urgencia de un evento que has fabricado.

Reiner Fuellmich  1:41:43

Esto suena casi como comedia, pero no lo es.

Dr David Martin  1:41:47

Bueno, es en que tenemos que darnos cuenta de que parte de la razón por la que fue tan fácil para nosotros monitorear y rastrear esta campaña particular de coerción y terror es porque lo hemos hecho antes. Ya saben, comencé mis comentarios asegurándome de que la gente lo recordara cuando se trataba de resolver el brote de ántrax. Ahora recuerden, que mientras teníamos cientos de 1000 militares en Oriente Medio, supuestamente incluso por los acontecimientos de septiembre de 2001, teníamos dos inspectores postales investigando el ántrax. ¡Dos! El mayor ataque de supuestas pinzas biológicas en suelo estadounidense y tuvimos dos Inspectores Postales. No se puede creer genuinamente que dos Inspectores Postales son los, ya saben, el crimen que detiene, ya saben, individuos alucinantemente poderosos en el universo. Ahora no tengo nada en contra de los inspectores postales, pero puedo garantizarles que si estuviera investigando un ataque bioterroroso, no tendría la oficina de correos, teniendo dos inspectores postales como su equipo de crack, haciendo la investigación. Ya saben, era falso, y el Congreso lo sabía. Y esa es la razón por la que, ya saben, publicamos una cosa que no es necesariamente un éxito de ventas, pero publicamos un informe de inteligencia sobre cada violación de los tratados de armas biológicas y químicas que la gente ha firmado en todo el mundo. Y es una guía telefónica que te dice dónde y quién y quién está financiando, por lo que para nosotros no fue difícil entender que esto no era una crisis de salud pública. Esta fue una campaña de marketing oportunista para abordar un objetivo declarado, y es por eso que esto es una maquinilla de afeitar occams. Es lo más fácil de describir, porque son ellos los que lo establecen. Y la realidad es que dijeron que necesitaban que el público aceptara una contramedida de vacuna contra el Coronavirus, y que necesitaban que los medios crearan el bombo, y que los inversores siguieran donde vieran ganancias. Usted no tiene nada más en lo que deba confiar para explicar los eventos de los últimos 20 meses, que la declaración real del perpetrador real. Y no hago el ejercicio de mirarme el ombligo de entrar para tratar de entender si había problemas de mamá detrás de un ladrón de bancos si están sosteniendo una bolsa de dinero fuera de un banco. De hecho, hago la loca suposición de que tal vez son un ladrón de bancos. Del mismo modo, si tengo a alguien que dice que necesitamos usar los medios de comunicación para promocionar una contramedida médica, que es de hecho la inyección de una proteína quimérica sintética y recombinante desarrollada a partir de una simulación por computadora. Si realmente voy a escuchar la motivación de por qué eso podría estar haciéndose, voy a escuchar a la persona que hace la manipulación que dice que los inversores seguirán donde ven las ganancias? No necesito más explicación.

Reiner Fuellmich  1:45:28

Yo tampoco. Bueno, esto es alucinante. Estoy muy contento, David, [quiero decir] hablamos hace un par de meses, tal vez hace 3 o 4 meses, y nos presentó un David, lo siento, James Henry.

Dr David Martin  1:45:52


Reiner Fuellmich  1:45:52

Y estaba tratando de encontrar abogados de patentes en este país que pudieran estar interesados en este caso. Ahora, hay algunos abogados de patentes que lo entienden, pero aparentemente no hay nadie hasta ahora, pero tal vez esto va a cambiar. Pero no había nadie dispuesto a abordar esto en el contexto de Corona. Ese es el problema.

Dr Wolfgang Wodarg  1:46:17

Esto no es nuevo. He tratado de encontrar un abogado así para especializarme en patentes para la Comisión (inaudible) para el Bundestag alemán hace 10 años, o hace más de 15 años. Y no lo encontramos porque tenían miedo de ser críticos con el sistema. Destruirían su propio trabajo. Esto fue muy difícil.

Reiner Fuellmich  1:46:38

Sí, tenga en cuenta que este es un problema antiguo, porque ahí es donde entra el problema. Desde la creación de la Oficina Europea de Patentes, los alemanes y los franceses, como era de esperar, han mantenido la animosidad que, ya saben, ha sido solo esta nueva versión de la animosidad que se remonta a siglos atrás. Pero cuando se creó la OEP, el papel de la oficina de patentes de Múnich se convirtió en una cuestión muy nacionalista para Alemania. Y la noción de que los examinadores de patentes alemanes y los profesionales de patentes alemanes todavía gozaban de supremacía sobre el resto de Europa se volvió dogmática. En 2003, en 2004, cuando mi organización auditó por primera vez la Oficina Europea de Patentes, y en la que demostramos que entre el 20 y el 30 por ciento de las patentes en Europa eran falsificaciones funcionales, lo que significa que se copiaron de patentes anteriores, la representación alemana de la Oficina Europea de Patentes perdió la cabeza ante la idea de que estaban haciendo algo remotamente mal. Cuando la Unión Europea nos encargó un examen de las patentes de software unos años más tarde, a petición de la delegación sueca ante la Unión Europea, y mostramos cientos y cientos de patentes de software que fueron concedidas ilegalmente por la Unión Europea a través de la OEP. Y luego descubrimos que eran los examinadores de patentes alemanes y los profesionales de patentes alemanes los responsables de su presentación. Una vez más vimos que había una enorme protesta. Y lo que ocurre es que tenemos una posición dogmáticamente sostenida, que dice que aunque se supone que la Oficina Europea de Patentes es paneuropea, todavía hay en la mente del sistema de patentes alemán una supremacía sobre el resto de Europa. Y si pones en duda algo, incluidas las patentes concedidas sobre un arma biológica, estás pisando un terreno por el que no hay perdón.

Dr Wolfgang Wodarg  1:49:09

Sí. Teníamos algunas preguntas de Transparencia Internacional, y fuimos borrados; no se siguió el tema.

Dr David Martin  1:49:17

sí. Simplemente no se puede. No es accesible, y esa es solo la tragedia de lo que desafortunadamente se ha convertido en una organización de captura regulatoria. En realidad no está haciendo el servicio público.

Reiner Fuellmich  1:50:24

Reiner traduce.

Dr David Martin  1:50:53

Bueno, gracias por el tiempo que has pasado y espero que haya sido útil.

Reiner Fuellmich  1:50:57

Fue muy útil.

Dr Wolfgang Wodarg  1:50:59

Muy servicial, muchas gracias.

Reiner Fuellmich  1:51:00

Vamos a escuchar muchos ecos. Gracias David, y que tengas un gran fin de semana.

Dr David Martin  1:51:07

Bien, cuídense todos.

Dr David Martin  1:51:08

Sí, tú también. Adiós.

Viviane Fischer  1:51:10


Dr Wolfgang Wodarg  1:51:11


Fuente: Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC – (

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta «clase de parásitos» ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.»

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.»

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.»

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de «información de secuencia» porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible «aislar» un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos «infectaron» varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.»

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este «virus» secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

«No observamos ninguna liberación del virus del lado basolateral de la cultura HAE».

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de «origen desconocido».

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.»

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba «ahí». Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

«Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas»

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.»

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado».

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.»

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.»

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.»

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del «virus». Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, «esta afirmación sugiere que cada prueba debe ser positiva», (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

«Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.»

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada «basura», ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

«Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.»

La definición legal de una conspiración es:

«Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo»

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada «nueva normalidad», que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

Los votos de Joe Biden violan la Ley de Benford

O dicho de otra manera, la ley y las estadísticas de Benford demuestran (o como mínimo, digamos, es bastante sospechoso) que Trump ganó las elecciones de 2020.

En los tres casos, los datos de Biden infringen la curva normal (puntos rojos). Los datos de Trump parecen estar bien.