Los países de la UE con las tasas de vacunación más altas también tienen las tasas de exceso de mortalidad más altas

 Por Lance D Johnson

    El 10 de octubre de 2022, un comité se reunió en el Parlamento Europeo para investigar el fraude, los delitos y la mortalidad asociados con las vacunas covid-19 y la sórdida respuesta del gobierno. El comité incluía representantes de los veintisiete estados miembros de la Unión Europea (UE). Christian Terhes, el representante de Rumania, presentó evidencia que muestra que las altas tasas de vacunación en los países de la UE se correlacionan con el exceso de tasas de mortalidad (en comparación con los promedios de 2016-2019). De hecho, a medida que aumenta la tasa de vacunación contra el COVID en un país, ¡también lo hace la tasa de exceso de mortalidad!

    Terhes informó : “La tasa de exceso de mortalidad en la UE ha aumentado un 16 % más que el promedio. Si miras el mapa, los países con las tasas de vacunación más altas actualmente tienen la tasa de exceso de mortalidad más alta”.

    Terhes continuó: “Entonces, obviamente, preguntamos: ‘¿Existe una conexión entre estar vacunado y tener una tasa de mortalidad más alta? Todo el mundo está evitando responder a esta pregunta lógica’”. No se puede negar el asesinato en masa.

    El CEO de Pfizer duda en mostrar su rostro, mientras comienza la supervisión judicial

    El director ejecutivo de Pfizer, Albert Bourla, sufrió recientemente dos episodios de la enfermedad covid-19 en agosto y septiembre de 2022. En ambas ocasiones, Bourla usó su enfermedad para publicitar las vacunas fallidas de ARNm de su empresa. El cuádruple vacunado Bourla también expresó su intención de recibir una quinta dosis de su producto fallido, incluso después de contraer y sucumbir a infecciones de las que se suponía que estaba protegido en primer lugar.

    Cuando se le pidió a Bourla que compareciera ante el Parlamento de la UE en octubre, se comunicó a través de un mensaje de texto y envió a otra persona en su lugar: Janine Small, presidenta de Mercados desarrollados internacionales de Pfizer. La Sra. Small se negó a ser transparente con los datos y las comunicaciones de Pfizer y, a menudo, dudaba en abordar los asuntos serios en cuestión.

    Rob Roos, el miembro del parlamento holandés preguntó a la representante de Pfizer, Janine Small, si alguna vez se probó la vacuna COVID de la compañía para detener la transmisión del virus. El representante de Pfizer admitió ante el Parlamento que la vacuna de ARNm de Pfizer nunca se probó para bloquear la transmisión antes de lanzarla al mercado. Quizás es por eso que los CDC cambiaron la definición de «vacuna» en 2021.

    “¿Se probó la vacuna Pfizer COVID para detener la transmisión del virus antes de que ingresara al mercado?” Roos preguntó. “Si no, por favor dígalo claramente. En caso afirmativo, ¿está dispuesto a compartir los datos con este comité?”

    “Con respecto a la pregunta, ¿sabíamos sobre detener la inmunización antes de que ingresara al mercado? No. Realmente tenemos que movernos a la velocidad de la ciencia para comprender realmente lo que está sucediendo en el mercado”, respondió Small.

    Terhes presionó más, exponiendo una conspiración criminal : “El 11 de enero de 2020, el gobierno chino dio a conocer al público los datos de ADN del virus y 3 días después, Pfizer ya comenzó las pruebas para esta vacuna, ¿cómo es eso posible?”

    Los representantes de la UE calificaron como una «gran desgracia» que el director ejecutivo de Pfizer, Albert Bourla, no se mostrara frente al comité y respondiera preguntas sobre su producto y su empresa. “El hecho de que el Sr. Bourla, director ejecutivo de Pfizer, tuviera la audacia de negarse a comparecer ante el Comité para responder preguntas, constituye un gran desprecio por las personas cuyo dinero de los impuestos tomó por cierto”, dijo Christine Anderson, quien sirvió como miembro suplente de Alemania en el Parlamento Europeo. “Si no podemos obligar a un jugador crucial a presentarse frente a este Comité, entonces este Comité es inútil. Entonces propongo que nos declaremos incompetentes”.

    De hecho, se necesitarán más que comités especiales y conferencias de prensa para investigar a Pfizer y al resto de la corrupta industria farmacéutica. Las citaciones y los interrogatorios están justificados. Todos los involucrados en defraudar al público, dañar a la población y violar los derechos humanos deben rendir cuentas.

    https://www.brighteon.com/embed/2ed3a206-df25-4afd-b2ca-0f0de6743f08

    Fuente: https://www.naturalnews.com/2022-10-14-eu-countries-highest-vaccination-highest-excess-deaths.html

    ¿Qué tan corrupto es el presidente ucraniano Volodímir Zelenski?

    Por Jeremy KUZMAROV

    Antes de la invasión rusa, informes de la CIA lo relacionaban con un oligarca tan sucio y tan sumido en una “corrupción significativa” que el Departamento de Estado le prohibió la entrada a EE.UU.

    Pero ahora la propaganda de la CIA retrata a Zelensky como más noble que Winston Churchill y más santo que la Madre Teresa.

    ¿Se levantará el verdadero Volodymyr Zelensky?

    En 2019,  Radio Free Europe , dirigida por la CIA,  informó sobre la conexión del presidente ucraniano Volodymyr Zelensky con Ihor Kholomoisky, un oligarca ucraniano a quien el Departamento de Estado prohibió ingresar a EE. UU. en marzo de 2021 debido a su “significativa corrupción”. Vea el informe de video a continuación.

    (Haga clic en la imagen para vincular al video) [Fuente:  realclearpolitics.com ]

    Este informe es irónico dado que, desde que comenzó la guerra de Ucrania con Rusia hace más de cuatro meses, Radio Free Europe junto con el resto de los medios occidentales ha representado a Zelensky como algo equivalente a una reencarnación de Winston Churchill y la Madre Teresa, impulsando una campaña para su nominación para el Premio Nobel de la Paz e inspirando un  tributo musical extravagante  durante los premios Grammy 2022.

    Grammys 2022: video de Zelensky y otros momentos judíos - Agencia Telegráfica Judía

    Zelensky da un discurso en video en los premios Grammy 2022 en abril. [Fuente:  jta.org ]

    Dirigir uno de los esquemas Ponzi más grandes de la historia mundial

    Mientras tanto, en enero de 2022, el Departamento de Justicia de EE. UU. presentó una  denuncia de decomiso civil —la cuarta en su contra— que alega que Kholomoisky y Gennadiy Bogolyubov, propietarios de PrivatBank, uno de los bancos más grandes de Ucrania, malversaron y defraudaron al banco por $ 5.5 mil millones que desapareció.

    Los dos supuestamente obtuvieron préstamos y líneas de crédito fraudulentos entre 2008 y 2016 y lavaron parte de sus ganancias criminales utilizando una serie de cuentas bancarias de compañías ficticias, principalmente en la sucursal de PrivatBank en Chipre, antes de transferir los fondos a los EE. UU., donde continuaron lavando ellos ilegalmente a través de un asociado que opera fuera de las  oficinas en Miami .

    [Fuente:  johnhelmer.org ]

    Parte del dinero robado procedía  de préstamos del FMI otorgados al gobierno ucraniano después del golpe de Maidan de 2014, que el Banco Nacional de Ucrania pagó a Privatbank . [1]

    [Fuente:  johnhelmer.org ]

    Según un perfil en  The American Spectator , Kholomoisky lavó millones en Cleveland, Ohio, y en todo el Medio Oeste donde, como «uno de los mayores propietarios de bienes raíces [de la región]»,  «dirigió uno de los esquemas Ponzi más grandes de la historia mundial». .”

    Haciendo incluso a otros oligarcas. No son ajenos a los delitos violentos

    Nacido en la Ucrania soviética en 1963, Kholomoisky estuvo entre los que se beneficiaron después del colapso soviético a principios de la década de 1990 con la venta de empresas que antes eran estatales, como plantas siderúrgicas y pozos de gas, a precios de liquidación.

    Según  The American Spectator , Kholomoisky tenía dos ventajas sobre otros oligarcas nacientes. Primero, tenía experiencia en metalurgia, en la ciencia de fabricar y moldear metales y aleaciones en demanda. En segundo lugar, Kholomoisky  “mostró una crueldad que hizo palidecer incluso a otros oligarcas, no ajenos a los delitos violentos”.

    Un escritor de  la revista Forbes  informó que, en un caso, vio a «cientos de alborotadores contratados armados con bates de béisbol, barras de hierro, pistolas de gas y balas de goma y motosierras [tomar] por la fuerza» una planta de acero que Kholomoisky observó.

    Para lograr el efecto completo del villano Bond, Kholomoisky colocó un  tanque de tiburones en su oficina . Supuestamente, no era reacio a empujar la cabeza de un visitante como un recordatorio para nunca cruzarlo.

    Igor Kolomoisky, multimillonario y gobernador de la región de Dnipropetrovsk, posa para una fotografía en su gabinete en la sede del gobierno regional en Dnipropetrovsk el 24 de mayo de 2014.
    Poner una cara amigable: Kholomoisky posando para una foto en 2014. [Fuente:  nypost.com ]

    Un judío que financia a los neonazis

    Según  Oleg Noginsky, presidente de la Unión Aduanera de Proveedores, después de la Revolución Euro-Maidan de Ucrania en febrero de 2014, Kholomoisky “contrató a los tipos que llevaron a cabo la masacre de Odessa”, el asesinato de varias docenas de simpatizantes del depuesto presidente aliado ruso Viktor Yanukovych que se refugiaron en un edificio sindical.

    Como gobernador del  óblast de Dnipropetrovsk  desde 2014 hasta 2016, Kholomoisky financió unidades antirrusas que operaban con el ejército ucraniano en Donetsk y Lugansk, que votaron a favor de la secesión después de que el gobierno posterior a Maidan intentara imponerles el idioma ucraniano.

    Estas unidades incluían el  batallón neonazi Azov  que aterrorizaba a la gente del este de Ucrania, junto con  los batallones Dnipro y Aidar , que a veces se desplegaban como escuadrones de matones personales para proteger los intereses financieros de Kholomoisky.

    El recién nombrado gobernador del óblast de Dnipropetrovsk, Ihor Kolomoisky (izquierda), se reúne con Yuriy Bereza, entonces jefe de la unidad regional de autodefensa proucraniana en Dnipro (entonces Dnipropetrovsk), el 4 de marzo de 2014. Bereza otorgó simbólicamente a Kolomoisky las llaves de la administración regional.  Un mes después, Bereza encabezó el batallón de voluntarios Dnipro-1 patrocinado por Kolomoisky.
    El entonces gobernador Kholomoisky con Yuriy Bereza, jefe del batallón Dnipro en marzo de 2014. [Fuente:  kyivpost.com ]

    Burisma y la CIA

    The  New York Post  informó  que Kholomoisky tenía una “participación mayoritaria” en Burisma Holdings, la compañía de energía ucraniana que contrató a Hunter Biden como miembro de la junta por $50,000 por mes. Los medios rusos, citados en  correos electrónicos del Departamento de Estado , se refirieron a Burisma como “parte del imperio financiero de Kholomoisky”.

    Seis meses después de la partida de Hunter Biden,  Burisma nombró a Cofer Black en su directorio , cargo que mantiene. Black era un oficial de carrera de la CIA que se desempeñó como director del Centro de Contraterrorismo de la CIA luego de los ataques del 11 de septiembre.

    Este nombramiento plantea dudas sobre si Burisma sirvió como una operación de fachada de la CIA diseñada para ayudar a financiar las milicias antirrusas en el este de Ucrania.

    La teoría de la conspiración del gas natural Biden-Ucrania de Trump: falsa, pero viva

    Ihor y Volodymyr sentados en un árbol…

    La relación de Kholomoisky con Zelensky se remonta a alrededor de 2012, cuando Zelensky y sus socios en una productora de televisión, Kvartal 95, comenzaron a crear contenido regular para las estaciones de televisión propiedad de Kholomoisky.

    Un comediante y actor que había sido famoso desde la década de 2000, Zelensky comenzó su ascenso político unos años después de asumir un papel protagónico en la sátira política «Servant of the People», que comenzó a transmitirse en la red de Kholomoisky en 2015.

    El programa protagonizó a Zelensky como un humilde profesor de historia cuya diatriba anticorrupción en clase es filmada por un estudiante, se vuelve viral en línea y gana un cargo nacional.

    Un programa de televisión que predijo la vida de un hombre |  Volodimir Zelenskyy - Servidor del Pueblo

    [Fuente:  pollingua.com ]

    En un caso de arte que imita la vida, Zelensky terminó ganando la presidencia ucraniana en el mundo real solo tres años y medio después del lanzamiento del programa, con más del 73% de los votos.

    Zelensky en personaje pateando las piernas en un podio presidencial.
    Zelensky sobre “Servidor del Pueblo”. [fuente:  slate.com ]

    Zelensky aprovechó la ira pública generalizada por la corrupción, pero su campaña de 2019 estuvo plagada de dudas sobre su buena fe anticorrupción dada su conexión con Kholomoisky.

    En el fragor de la campaña, un aliado del titular Petro Poroshenko, Volodymyr Ariev, publicó un gráfico en Facebook que pretendía mostrar que Zelensky y sus socios de producción de televisión eran  beneficiarios de una red de empresas extraterritoriales que habían establecido a partir de 2012. que supuestamente recibió $41 millones en fondos del Privatbank de Kholomoisky .

    Ariev no proporcionó pruebas irrefutables, aunque los Pandora Papers (11,9 millones de documentos filtrados publicados por un consorcio de periodistas de investigación en octubre de 2021) muestran que al menos algunos de los detalles de este supuesto esquema corresponden a la realidad.

    En concreto, los Documentos de Pandora revelan información sobre diez empresas de la red que coinciden con las estructuras detalladas en el gráfico de Ariev, y muestran que  Zelensky y sus socios utilizaron empresas con sede en las Islas Vírgenes Británicas (BVI), Belice y Chipre .

    La revista Forbes  actualmente sitúa  el valor neto de Zelensky entre $20 y $30 millones , un total que no podría haber ganado simplemente como actor de televisión y comediante.

    Zelensky supuestamente posee lujosas propiedades en el centro de Londres, Italia y  Miami Beach , donde podría retirarse si se ve obligado a huir de Ucrania.

    El exterior de la casa de Zelensky en Fort dei Marmi, Italia. [Fuente:  alamy.com ]

    Dos de los socios de Zelensky en la red offshore, que también formaban parte de su productora de televisión, han ocupado cargos de poder en su gobierno. Serhiy Shefir es el principal asistente presidencial de Zelensky, mientras que Ivan Bakanov dirigió hasta hace muy poco el temido Servicio de Seguridad de Ucrania (SBU), que es  la agencia de seguridad más grande de Europa  y  tiene casi el mismo tamaño que el FBI a pesar de que Ucrania es 16 veces más pequeña que Estados Unidos .

    Ivan Bakanov, a quien el presidente ha descrito como el "jefe de SBU más honesto", no hizo comentarios personalmente.  (foto de archivo)
    Iván Bakanov [Fuente:  rferl.org ]

    Tú me rascas la espalda, yo te rasco la tuya

    Además de brindar apoyo financiero durante las elecciones de Ucrania de 2019, Kholomoisky le  proporcionó un automóvil a Zelensky  y le prestó su abogado personal para que fuera asesor de campaña y promocionó su candidatura en varios medios de comunicación de su propiedad.

    Los estrechos lazos entre los dos se hicieron evidentes en 2018 cuando  Zelensky viajó a Ginebra, Suiza, para el cumpleaños de Kholomoisky , y luego  regresó a Ginebra otras diez veces .

    Cuando Kholomoisky se mudó a Tel Aviv, Israel, Zelensky  viajó allí para visitarlo tres veces, según Radio Free Europe .

    Zelensky afirmó que su relación con Kholomoisky no era política; más bien había ido a visitarlo por su trabajo en la televisión.

    Sin embargo, Zelensky se aseguró de recompensarlo cuando se convirtió en presidente. Retiró a los opositores de Kholomoisky, el Fiscal General, el Gobernador del Banco Nacional de Ucrania y su propio primer ministro, quien trató de regular el control de Kholomoisky de una compañía eléctrica estatal.

    El parlamento de Ucrania también aprobó una medida que evitaba que Kholomoisky tuviera que  pagar impuestos más altos por sus operaciones mineras .

    Zelensky y Kholomoisky durante una reunión en el palacio presidencial de Ucrania. [Fuente:  economictimes.indiatimes.com ]

    Ningún león de un líder

    Los lazos de larga data de Zelensky con Kholomoisky desmienten la imagen pública prístina de un hombre aclamado por los políticos estadounidenses como un  «líder león»  (August Pfluger R-TX) y una persona de » increíble valentía»  (Adam Schiff, D-CA).

    Un neoliberal que avanzó una iniciativa de privatización radical, Zelensky ha prohibido once partidos de oposición y ha llevado a cabo un  régimen de terror contra los opositores políticos .

    Entre las víctimas se encuentran el exlíder de las fuerzas de izquierda ucranianas,  Vasily Volga, y los hermanos Kononovich, líderes de la Liga de Jóvenes Comunistas de Ucrania  que fueron acusados ​​de ser prorrusos.

    Los hermanos Kononovich, líderes de la Unión de Jóvenes Comunistas de Ucrania, detenidos desde el 6 de marzo. [Fuente:  wardsfreedom.org ]

    A pesar de hacer campaña sobre una plataforma de paz, Zelensky provocó la guerra con Rusia a)  promulgando una importante acumulación de tropas en el este de Ucrania  en febrero; b)  aumento de los bombardeos del este de Ucrania en violación de los acuerdos de alto el fuego ; yc) pedir la  recuperación de Crimea y la ciudad de Sebastopol de Rusia , que alberga la flota del Mar Negro de la Armada rusa.

    Mapa que muestra las concentraciones de tropas ucranianas en la frontera oriental de Ucrania en vísperas de la invasión rusa del 24 de febrero de 2022. Según el viceministro de Relaciones Exteriores de Rusia, Ucrania había concentrado 122 000 tropas en la frontera con Donbass. Además, la Duma ha afirmado tener inteligencia que indica que estas tropas estaban  planeando una ofensiva en Donbas, que la invasión rusa se adelantó . [Fuente:  consortiumnews.com ]

    Desde que comenzaron los combates, Zelensky ha evitado las negociaciones y, en cambio, ha suplicado a Occidente por más y más armas mientras invitaba a mercenarios extranjeros a Ucrania.

    El periodista suizo Guy Mettan ha escrito que Zelensky será responsable en última instancia de la devastación de Ucrania en la guerra, ya que  «prefirió la ruina de su país a un compromiso oportuno».

    Esta valoración está en desacuerdo con la hagiografía mediática actual de Zelensky, que también oscurece sus vínculos con Kholomoisky que la propia CIA ha reconocido.

    (1) El periodista John Helmer señala que Hillary Clinton, Victoria Nuland y Christine LaGarde, las ex directoras del FMI, ignoraron la evidencia de la corrupción de Kholomoisky y el despilfarro del dinero del préstamo del FMI en un esquema ponzi; probablemente debido al imperativo político subyacente a la política del FMI hacia Ucrania después del golpe de Maidan. John Helmer, “La pirámide de Kolomoisky comenzó con Hillary Clinton y Victoria Nuland del Departamento de Estado más Christine Lagarde del FMI”, http://johnhelmer.org/the-kolomoisky-pyramid-started-with-hillary-clinton-and- victoria-nuland-del-departamento-de-estado-más-christine-lagarde-del-fm/

    covertactionmagazine.com

    Fuente: https://www.strategic-culture.org/news/2022/07/25/how-corrupt-is-ukrainian-president-volodymyr-zelensky/

    La trama de la vacuna Covid

    Por Lew Rockwell, Lew Rockwell

    La vacuna del covid mata gente. Esto no es un secreto, y surge naturalmente la pregunta: ¿por qué la gente nos presiona con la vacuna? ¿Por qué están empujando esta droga mortal en los niños pequeños? Responder a esta pregunta nos lleva a la raíz de las fuerzas oscuras que controlan el mundo.

    Está claro que quienes impulsan la vacuna conocen sus efectos letales. Como señala la gran Dra. Naomi Wolf, “he estado en silencio durante algunas semanas. Perdónenme.

    La verdad es que me he quedado casi sin palabras —o el equivalente literario de eso— porque recientemente he tenido la poco envidiable tarea de tratar de anunciar al mundo que sí, un genocidio —o lo que he llamado, torpe pero urgentemente, se está produciendo una ‘muerte de bebés’.

    Los Voluntarios de Investigación de Documentos de WarRoom/DailyClout Pfizer, un grupo de 3000 médicos altamente acreditados, RN, bioestadísticos, investigadores de fraudes médicos, clínicos de laboratorio y científicos de investigación, han estado produciendo informe tras informe, como sabrán, para decirle al mundo lo que es en los 55.000 documentos internos de Pfizer que la FDA había pedido a un tribunal que mantuviera en secreto durante 75 años. Por orden judicial, estos documentos fueron revelados a la fuerza. Y nuestros expertos están sirviendo a la humanidad leyendo estos documentos y explicándolos en términos sencillos. Las mentiras reveladas son impresionantes.

    Los voluntarios de WarRoom/DailyClout han confirmado: que Pfizer (y, por lo tanto, la FDA) sabían en diciembre de 2020 que las vacunas MRNA no funcionaban, que ‘disminuían en eficacia’ y presentaban ‘fracaso de la vacuna’. Un efecto secundario de vacunarse, como sabían un mes después del lanzamiento masivo de 2020, fue ‘COVID’.

    Pfizer supo en mayo de 2021 que el corazón de 35 menores se había dañado una semana después de la inyección de MRNA, pero la FDA implementó la EUA para adolescentes un mes después de todos modos, y los padres no recibieron un comunicado de prensa del gobierno de los EE. UU. sobre los daños cardíacos hasta agosto de 2021, después de que miles de adolescentes fueran vacunados.

    Pfizer (y por lo tanto la FDA; muchos de los documentos dicen «FDA: CONFIDENCIAL» en el límite inferior) sabía que, contrariamente a lo que los portavoces altamente pagados y los médicos comprados aseguraban a las personas, el MRNA, la proteína de punta y las nanopartículas de lípidos hicieron no se quedó en el sitio de inyección en el deltoides, sino que pasó, dentro de las 48 horas, al torrente sanguíneo, de ahí a alojarse en el hígado, bazo, glándulas suprarrenales, ganglios linfáticos y, si es mujer, en los ovarios.

    Pfizer (y, por lo tanto, la FDA) sabía que la vacuna Moderna tenía 100 mcg de MRNA, nanopartículas de lípidos y proteína de punta, que era más de tres veces la dosis de 30 mcg de Pfizer para adultos; los documentos internos de la compañía muestran una tasa más alta de eventos adversos con la dosis de 100 mcg, por lo que dejaron de experimentar internamente con esa cantidad debido a su «reactogenicidad», palabras de Pfizer, pero nadie les dijo a todos los millones de estadounidenses que recibieron la primera y la segunda dosis de Moderna de 100 mcg,  y los refuerzos .

    Pfizer distorsionó a los sujetos del ensayo para que casi las tres cuartas partes fueran mujeres, un género que es menos propenso al daño cardíaco. Pfizer  perdió  los registros de lo que pasó con cientos de sujetos de prueba.

    En los ensayos internos, hubo más de 42 000 eventos adversos y más de 1200 personas murieron. Cuatro de las personas que fallecieron,  fallecieron el día que les inyectaron.

    Los eventos adversos registrados en los documentos internos de Pfizer son completamente diferentes de los informados en el sitio web de los CDC o anunciados por médicos corruptos, organizaciones médicas y hospitales. Estos incluyen grandes columnas de dolor en las articulaciones, dolor muscular (mialgia), masas de efectos neurológicos que incluyen esclerosis múltiple, Guillain Barre y parálisis de Bell, encefalia, todas las iteraciones posibles de coagulación sanguínea, trombocitopenia a gran escala, accidentes cerebrovasculares, hemorragias y muchos tipos de rupturas de membranas de todo el cuerpo humano. Los efectos secundarios que Pfizer y la FDA conocían, pero usted no, incluyen problemas de formación de ampollas, erupciones cutáneas, culebrilla y condiciones herpéticas (de hecho, una variedad de condiciones de formación de ampollas que extrañamente presagian los síntomas de la viruela del mono).

    Los documentos internos muestran que Pfizer (y, por lo tanto, la FDA) sabían que las ronchas rojas o la urticaria eran una reacción común al PEG, un alérgeno derivado del petróleo en los ingredientes de la vacuna, uno que ciertamente no se supone que debes ingerir. De hecho, el PEG es un alérgeno tan grave que muchas personas pueden sufrir un shock anafiláctico si se exponen a él. Pero a las personas con alergia al PEG no se les advirtió que no se vacunaran ni sus médicos las observaron atentamente, con el EpiPen en la mano. Se quedaron a su suerte.

    Pfizer sabía que la ‘exposición’ a la vacuna se definía, en sus propias palabras, a los bebés, como contacto sexual (especialmente en el momento de la concepción), contacto con la piel, inhalación o lactancia. Los ‘verificadores de datos’ pueden negar esto todo lo que quieran. Los documentos hablan por sí solos.

    Leer más @ LewRockwell.com

    Fuente: https://www.sgtreport.com/2022/07/the-covid-vaccine-plot/

    Experto advierte que 700 millones morirán por inyecciones de COVID para 2028 – Apagón de los medios

    Por Sean Adl Tabatabai

    Un destacado médico advirtió que las inyecciones de Covid se están utilizando como una forma de genocidio en toda la población y predijo que más de 700 millones de personas podrían morir para el año 2028.

    En una entrevista reciente (publicada a continuación) con Greg Hunter, el Doctor David Martin presenta evidencia de que las inyecciones de COVID-19 no son vacunas reales sino armas biológicas.

    En marzo de 2022, Martin presentó una demanda federal contra el presidente Biden, el Departamento de Salud y Servicios Humanos y los Centros de Servicios de Medicare y Medicaid alegando que las inyecciones de COVID-19 convierten el cuerpo en una fábrica de armas biológicas, fabricando proteína de punta. 2

    Uncanceled.news informa: “Y no solo no seremos demandados por, ya sabes, ninguna difamación o información errónea, sino que en realidad estamos responsabilizando penalmente a las personas por su terrorismo doméstico, sus crímenes contra la humanidad y la historia del armamentismo del coronavirus que se remonta a 1998”, dice Martin. 3

    SARS-CoV-2 ha estado en proceso durante décadas

    Martin ha estado en el negocio del seguimiento de solicitudes y aprobaciones de patentes desde 1998. Su empresa, M-Cam International Innovation Risk Management, es el suscriptor de activos intangibles utilizados en finanzas más grande del mundo en 168 países. M-Cam también ha monitoreado las violaciones de los tratados de armas biológicas y químicas en nombre del gobierno de los EE. UU., luego del susto del ántrax en septiembre de 2001.4

    Según Martin, hay más de 4.000 patentes relacionadas con el coronavirus del SARS. Su compañía también ha realizado una revisión exhaustiva de la financiación de la investigación relacionada con la manipulación de coronavirus que dio lugar al SARS como subclado de la familia de coronavirus beta.

    Gran parte de la investigación fue financiada por los Institutos Nacionales de Alergias y Enfermedades Infecciosas (NIAID) bajo la dirección del Dr. Anthony Fauci. 5  Martín explicó: 6

    “Creo que es importante que sus oyentes y espectadores recuerden que fue en 1999 cuando Anthony Fauci y Ralph Baric de la Universidad de Carolina del Norte en Chapel Hill decidieron comenzar a armar el coronavirus que patentaron en 2002, y escucharon esa fecha correctamente, eso es un año. antes del brote de SARS en China.

    La primera vez que patentaron lo que llamaron una ‘quimera defectuosa de replicación infecciosa’ del coronavirus. Y vamos a desempacar lo que eso significa.

    Infeccioso significa que en realidad es más letal para el objetivo. La replicación defectuosa significa que su daño es principalmente para el objetivo y no para la familia, los amigos, la comunidad o cualquier otra cosa del objetivo. Y en 2002, la Universidad de Carolina del Norte, Chapel Hill, patentó la quimera de coronavirus infeccioso defectuoso en la replicación, que luego se convirtió en la primera instancia de SARS.

    Y se perfeccionó en 2013 a 2016 durante la moratoria de ganancia de función, donde la Universidad de Carolina del Norte Chapel Hill recibió una exención de la moratoria de ganancia de función para que pudieran continuar armando el virus hasta el punto en que en 2016, Ralph Baric publicó un artículo en el que decía que el virus uno del Instituto de Virología de Wuhan, el coronavirus, estaba «preparado para la emergencia humana», por lo que lo sabían todo el tiempo.

    Ya sabes, sabían que era un arma biológica desde 2005. Sabían que era eficaz para eliminar poblaciones, dañar a las poblaciones, intimidar y coaccionar a las poblaciones. Y lo hicieron todo muy intencionalmente con el propósito de destruir a la humanidad”.

    Las vacunas contra el COVID-19 son un ‘acto de bioterrorismo’

    Según Martin, la proteína espiga que fabrican las inyecciones de COVID-19 es una simulación por computadora de una quimera de la proteína espiga del coronavirus. “De hecho, no es una vacuna contra el coronavirus. Es una instrucción de proteína de pico para hacer que el cuerpo humano produzca una toxina, y esa toxina ha sido programada como un agente biológico conocido de preocupación con respecto a las armas biológicas durante la última década y media”, dijo. 7

    En lugar de ser una medida de salud pública como se promovió ampliamente, las inyecciones de COVID-19 son un acto de armas biológicas y bioterrorismo. Martin compartió que en 2015, el Dr. Peter Daszak, jefe de EcoHealth Alliance que canalizó dólares de investigación del NIAID al Instituto de Virología de Wuhan para la investigación del coronavirus, declaró: 8

    “Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-coronavirus. Un impulsor clave son los medios y la economía seguirá el bombo publicitario. Necesitamos usar esa exageración a nuestro favor, para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso”.

    Daszak, a quien Martin se refiere como “el lavador de dinero en jefe”, “en realidad declaró que todo este ejercicio fue una campaña de terror doméstico para lograr que el público aceptara la plataforma de vacuna universal utilizando un arma biológica conocida. Y esas son sus propias palabras, no mi interpretación”, dijo Martin. 9

    Martin: 100 millones pueden morir debido a vacunas COVID

    Tanto las vacunas contra el COVID-19 de Pfizer como las de Moderna contienen secuencias de ácido nucleico que no son parte de la naturaleza y no se han introducido previamente en el cuerpo humano. Esto equivale a un experimento de ingeniería genética que no pasó por estudios en animales ni ensayos clínicos.

    Sin embargo, ya hay personas que mueren a causa de las inyecciones y, afirma Martin, “muchas más morirán” debido a problemas como coágulos de sangre, daño al sistema cardiovascular y problemas con la función hepática, renal y pulmonar. 10

    También se prevé una avalancha de casos de cáncer reproductivo y relacionados con las inyecciones. “El hecho es que una enorme cantidad de personas que se inyectan ya llevan las semillas de su propia muerte”, dijo Martin. 11  En cuanto a cuántos pueden morir, Martin cree que los números pueden haber sido revelados en 2011, cuando la Organización Mundial de la Salud anunció su «década de vacunación»: 12

    “Basado en su propia estimación de 2011, y… esta es una estimación escalofriante, pero tenemos que publicarla… Cuando la Fundación Bill y Melinda Gates, los CDC de China, Jeremy Farrar Wellcome Trust y otros publicaron La Década de la Vacunación para la Organización Mundial de la Salud en 2011, su objetivo declarado era una reducción de la población del 15% de la población mundial.

    Ponga eso en perspectiva, eso es alrededor de 700 millones de personas muertas… y eso pondría a la participación de EE. UU. en eso ciertamente como una proporción de la población inyectada en algún lugar entre 75 y 100 millones de personas».

    Cuando se le preguntó en qué período de tiempo podrían morir estas personas, Martin sugirió que «hay muchas razones económicas por las que la gente espera que sea entre ahora y 2028». 13  Esto se debe a “una pequeña falla en el horizonte”: la falta de liquidez proyectada de los programas de Seguro Social, Medicare y Medicaid para 2028.

    “Entonces, cuantas menos personas reciban Seguro Social, Medicare y Medicaid, mejor”, dijo Martin. «No es sorprendente que probablemente sea una de las motivaciones que llevaron a la recomendación de que las personas mayores de 65 años fueran las primeras en inyectarse». 14  Otras poblaciones en riesgo son los cuidadores, incluidos los proveedores de atención médica, y otros miembros de la fuerza laboral que se vieron obligados a inyectarse, como los pilotos.

    “¿Por qué de repente se cancelan (en USA) 700 vuelos al día porque, supuestamente, las aerolíneas no tienen pilotos? … el sucio secreto … hay muchos pilotos que tienen problemas microvasculares y problemas de coagulación, y eso los mantiene fuera de la cabina, que es un buen lugar para no tenerlos si van a arrojar un coágulo por un derrame cerebral o un ataque al corazón”,  dijo Martin.

    “Pero el problema es que vamos a comenzar a ver exactamente el mismo fenómeno en la industria de la atención médica y a una escala mucho mayor, lo que significa que ahora tenemos, además del problema de la morbilidad y mortalidad reales, lo que significa que las personas se enferman. y gente muriendo.

    De hecho, tenemos ese objetivo en la industria del cuidado de la salud en grande, lo que significa que vamos a tener médicos y enfermeras que estarán entre los enfermos y los muertos. Y eso significa que los enfermos y los moribundos tampoco reciben atención”. 15

    Por qué las vacunas COVID pueden cambiar su ADN

    Los medios de comunicación y los funcionarios de salud pública han enfatizado que las vacunas contra el COVID-19 no alteran el ADN. Sin embargo, Martin llama la atención sobre una subvención poco conocida de la Fundación Nacional de Ciencias, conocida como sistemas químicos darwinianos, 16  que involucró la investigación para incorporar ARNm en genomas específicos. Según Martín: 17

    “Moderna se inició… gracias a una subvención de 10 años de la Fundación Nacional de Ciencias. Y esa subvención se llamó sistemas químicos darwinianos… el proyecto que dio origen a la propia empresa Moderna fue un proyecto en el que estaban averiguando específicamente cómo hacer que el ARNm se escribiera en el genoma de cualquier objetivo que persiguieran.

    Se desconoce por completo cuáles serán los efectos a corto o largo plazo del análogo de proteína de pico que se encuentra dentro de las personas que recibieron inyecciones de COVID-19. Pero con respecto a la alteración del genoma, Martin afirma que los datos muestran que el ARNm tiene la capacidad de escribir en el ADN de los humanos, y “como tal, los efectos a largo plazo no van a ser meramente sintomáticos. Los efectos a largo plazo serán que el genoma humano de los individuos inyectados se verá alterado”. 18

    El fraude elimina el escudo de responsabilidad de las grandes farmacéuticas

    El ataque de ántrax de 2001, que surgió de la investigación médica y de defensa, condujo a la aprobación de la Ley PREP, que eliminó la responsabilidad de los fabricantes de contramedidas médicas de emergencia.

    Esto significa que mientras EE. UU. esté en estado de emergencia, cosas como las «vacunas» contra el COVID-19 están permitidas bajo autorización de uso de emergencia. Y mientras la autorización de uso de emergencia esté vigente, los fabricantes de estas terapias génicas experimentales no son financieramente responsables de ningún daño que resulte de su uso.

    Es decir, siempre que sean «vacunas». Si estas inyecciones NO son vacunas, entonces el escudo de responsabilidad desaparece, porque no existe un escudo de responsabilidad para una contramedida de emergencia médica que es la terapia génica. Además, las demandas que pueden probar que las empresas cometieron fraude también anularán el escudo de responsabilidad. Martín afirma: 19

    “Una de las cosas convenientes de la Ley PREP es que el escudo de inmunidad de responsabilidad en realidad es tan bueno como la ausencia de fraude. Porque si hubo fraude en la promulgación de los eventos, lo que condujo a una autorización de uso de emergencia, entonces todo el escudo de inmunidad se eliminó.

    Entonces, la razón por la que es tan importante que las conversaciones como la que estamos teniendo realmente se promuevan y avancen es porque las compañías farmacéuticas, y esto incluye a Pfizer, Moderna y J&J, saben que están perpetuando un fraude. Lo bueno de esto es que cuando se establece el fraude, el 100 % de la responsabilidad vuelve a ellos.

    … cuando un fraude fue la base de un fraude, entonces en realidad tenemos una serie de otros remedios legales que le permiten levantar ese velo. Entonces, al final, no hay duda… y es bastante evidente en base a los datos actuales de mortalidad y morbilidad dado el hecho de que cuando se trata de armas biológicas y bioterrorismo, cada cargo conlleva una multa de $100 millones. Eso es lo que nos da el estatuto federal.

    La sanción por terrorismo doméstico corporativo, cuando tienes $ 100 millones por cuenta de responsabilidades emergentes, esa es una amenaza existencial que lleva a una compañía como Pfizer o lleva a una compañía como Moderna fuera de existencia. Y eso es por lo que estamos trabajando todos los días”.

    Si desea seguir el progreso de los casos legales en curso que buscan exponer la verdad, que una organización criminal busca obtener el control de la población mundial a través de la creación de armas biológicas patentadas comercializadas como nuevos virus e inyecciones, puede encontrar todo los detalles en ProsecuteNow.io, un sitio web compilado por Martin y sus colegas. 20

    https://rumble.com/embed/v17qics/?pub=13m19j

    Fuente: https://newspunch.com/expert-warns-100-million-will-die-from-covid-jabs-by-2028-media-blackout/

    El próximo colapso de la industria del transporte aéreo

    por Alex Krainer

    La producción de alimentos y las industrias de combustibles fósiles no son las únicas en el tajo de los globalistas. El fin de semana pasado me invitaron a una llamada de zoom con la diputada eurodiputada alemana Christine Anderson , quien nos dio un breve informe sobre  la reciente votación en el parlamento de la UE para extender el requisito del pase Covid  por un año más. 

    El parlamento votó a favor de la prórroga en sesión plenaria a pesar de que la medida es totalmente inútil e injustificada, por no hablar del hecho de que el 99 % de los europeos se opone a ella. La evaluación explícita de la Sra. Anderson sobre el asunto fue que la democracia de la UE es una farsa y un fraude. El plenario nunca debatió la medida, simplemente tomaron la votación. Por qué la mayoría de los eurodiputados votaron a favor es un misterio y siniestro. 

    Pero quizás la parte más interesante e inesperada de la llamada de 3 horas fue sobre la industria de las aerolíneas. Tres de los participantes en la llamada tenían un conocimiento profundo de la industria de las aerolíneas (uno de ellos un piloto) y dijeron en términos claros que la industria ahora está siendo demolida de manera sistemática y deliberada. Aparentemente, el propósito final es acabar con los viajes en avión por completo. Los tres participantes pidieron que no se usaran sus nombres, pero parecían excepcionalmente bien informados y completamente creíbles. En cualquier caso, el flujo de noticias ha corroborado bastante bien sus afirmaciones.

    https://platform.twitter.com/embed/Tweet

    Es bastante evidente que algo ESTÁ sucediendo con los viajes aéreos: una ola repentina de disfunción, como la que estamos experimentando en la industria energética, la producción de petróleo, las cadenas de suministro y la atención médica. Tal vez me perdí algunos. Y aunque los medios han informado sobre el caos en muchos aeropuertos del mundo (casi en todas partes, al parecer), las explicaciones parecen bastante inocentes: los aeropuertos tienen poco personal y no pueden hacer frente a la oleada repentina de viajeros. Aquí hay una pequeña muestra de los informes recientes:

    De repente, tenemos miles de vuelos cancelados o retrasados, el proceso de manejo de equipaje se detiene, horas desperdiciadas en el check-in y los controles de seguridad, ¿y todo esto sucede prácticamente en todas partes? Los teóricos de la coincidencia se tragarán las explicaciones oficiales con un encogimiento de hombros, pero encuentro todo esto extremadamente extraño.

    Los sistemas de gestión del tráfico que han evolucionado durante casi un siglo y que habían funcionado casi a la perfección durante décadas, ahora parecen desmoronarse repentinamente. Si lo que decían los señores en nuestra llamada de zoom era cierto, el caos del aeropuerto podría convertirse en algo crónico. De hecho, otra persona en la llamada, que dijo que había leído muchos de los documentos del WEF y toda la Agenda de la ONU 2020/30/50/etc. dijo que todo esto está realmente escrito como un objetivo explícito. Ella dijo que la intención final es acabar con los viajes y establecer un arreglo feudal en el que las personas permanezcan fijas en su lugar y todos los viajes estén prohibidos.

    Por supuesto, no necesitamos hacer demasiado con tales documentos: simplemente reflejan la visión declarada de alguien sobre el tipo de arreglo social que cree deseable por cualquier razón. Por otro lado, el precio de la libertad es la eterna vigilancia y, a estas alturas, lo mínimo que debemos hacer es prestar atención. Los teóricos de la coincidencia entre nosotros, los consumidores siempre leales de la narrativa dominante, siempre están felices de dispersarse cuando se les dice que lo hagan porque «no hay nada que ver aquí…» Sin embargo, esta cohorte ha tenido un historial de predicción extremadamente pobre, especialmente durante el últimos dos años o más. Para la mayoría del resto de nosotros, es hora de prestar mucha atención y sembrar el sistema con la debida fricción si se está desviando hacia fines no deseados. Este es nuestro futuro que está en juego y el mundo que heredarán nuestros hijos y sus hijos.

    Si bien es posible que los sumos sacerdotes de Davos no puedan llevar a cabo sus planes hasta el final, han demostrado ser lo suficientemente poderosos como para causar un gran daño.

    Fuente: https://www.globalresearch.ca/coming-collapse-air-travel-industry/5785710

    Trudeau y los camioneros (Freedom Convoy). Hacia un movimiento mundial contra los mandatos del Covid-19

    Por TONY HALL 

    Los convoyes de camioneros canadienses que convergieron en Ottawa el 29 de enero están ayudando a energizar el creciente movimiento global que favorece la libertad y el sentido común sobre las atrocidades habilitadas por la tiranía medicalizada desenfrenada. Una buena representación de camioneros canadienses comenzó a unirse como un grupo político en oposición a la parodia de forzar golpes obligatorios a grandes grupos de personas.

    Los miles de hombres y mujeres que optaron por transportar sus quejas a Ottawa vieron fácilmente las desastrosas implicaciones de hacer de la aceptación de las vacunas COVID una condición necesaria para el empleo, la educación y la participación ciudadana en muchas otras facetas del flujo y reflujo de la sociedad. Los camioneros, además, se apresuraron a ver la obscenidad de extender las inyecciones obligatorias hacia la segregación implícita en la institución de pasaportes de vacunas.

    Siguiendo la estela de la devastación física, mental y económica masiva causada por los confinamientos, la creación y aplicación de mandatos de inyección pone de relieve aún más la megalomanía que ha llegado a infectar a gran parte de nuestra clase gobernante. Con el respaldo bien orquestado de la propaganda de los medios de comunicación, los gobiernos continuaron alineándose en coordinación con las agendas de los globalistas, corporativistas, transhumanistas y legiones de oportunistas autopromocionados.

    Las fijaciones y prioridades de nuestro primer ministro globalista, Justin Trudeau, demuestran mucho sobre los patrones más amplios de pensamiento y acción a través de los cuales hemos estado viviendo durante dos años. En términos generales, Trudeau deja poco espacio para que la gente promedio desempeñe un papel significativo en el desarrollo de las políticas nacionales y extranjeras de Canadá.

    Trudeau tiende a tomar su guía, desde procedimientos secretos en lugares supranacionales que hacen sus negocios políticos a niveles de interacción muy por encima de las relaciones internacionales. Trudeau está lejos de ser el único entre los líderes gubernamentales en la aplicación de este enfoque, especialmente a la formulación de políticas COVID.

    Como en la mayoría de los países, la disposición inicial del público a aceptar las políticas COVID de Canadá ha dependido del cultivo de histeria colectiva 24/7 de los medios de comunicación. La experiencia a lo largo del tiempo ha dejado muy claro que la traumatización intencional de los medios de comunicación de grandes porciones de la gente está destinada a abrumar incluso la posibilidad de un discurso racional sobre las tomas de poder que tienen lugar en nombre de la salud pública.

    En lo que debe pasar a la historia como uno de los ejemplos clásicos de ineptitud política jamás puestos en el registro público, Trudeau inicialmente desestimó los convoyes de camioneros y sus partidarios como una «pequeña minoría marginal … tener puntos de vista inaceptables [que] no representan a los canadienses».

    Vea esto.

    Lo absurdo de los comentarios ahora notorios de Trudeau se contradijo incluso en el momento en que el primer ministro los hizo por la ávida atención de grandes segmentos de personas en los viajes por carretera de los camioneros a Ottawa. El espectáculo atrajo la participación entusiasta de un gran número de canadienses que felizmente salieron al aire libre para desafiar en el frío clima de mediados de invierno del norte de América del Norte.

    En las grandes ciudades, pueblos pequeños, pequeñas aldeas y en cientos de pasos elevados de carreteras, canadienses de muchos orígenes y persuasiones políticas se reunieron en memorables demostraciones de unidad nacional. Como canadienses, expresamos nuestras amenazadas libertades de reunión, conciencia y expresión en decenas de lugares a lo largo de miles de millas de la Carretera Transcanadiense. Esta muestra patriótica de amor a la patria durante un momento muy problemático ocupará para siempre un lugar único en la historia social y política de nuestro país.

    A pesar del crudo esfuerzo de los medios de comunicación para difamar y degradar esta muestra indígena de resistencia a las locuras de COVID, no se puede negar la escala y la audacia que abarcan todo el continente de esta muestra de resistencia popular. Continúa proporcionando evidencia convincente de que no había nada pequeño o marginal o minoritario en esta efusión de sentimiento popular.

    La dramática movilización de las grandes plataformas y sus conductores de mentalidad independiente fue recibida con una aprobación masiva, especialmente por la clase trabajadora y la clase media canadienses. En términos generales, sin embargo, la clase dominante y sus acólitos despiertos no se divirtieron. A través de sus extensiones mediáticas, nuestras élites gobernantes trataron de minimizar la importancia local, nacional e internacional de este aumento en el autoempoderamiento político por parte de los trabajadores esenciales que se negaron a cumplir.

    Hubo muchas manifestaciones de apoyo entusiasta a la decisión de los camioneros de llevar una colección muy importante de mensajes políticos a funcionarios distantes reunidos en y alrededor del Parlamento de Canadá. Después de dos años de intrusión invasiva del gobierno en básicamente todas las facetas de nuestras vidas privadas y públicas, finalmente parecía haber alguna esperanza de alivio en el horizonte. Millones de canadienses decidieron simultáneamente que los camioneros del país tenían la capacidad de liderar un giro colectivo de la esquina hacia alguna medida de cordura y sentido común.

    Era el momento adecuado para mirar hacia atrás a la directiva inicial del gobierno a principios de 2020 de refugiarse en el lugar durante dos semanas para aplanar la curva de hospitalizaciones. Esa orden original fue repetida, extendida, reforzada y construida para provocar casi dos años de tratamiento cada vez más represivo por parte de nuestros arrogantes gobernadores.

    En el proceso, nuestros gobiernos y los medios de comunicación se transformaron en muchas variedades de oficialidad COVID. Nada más que el COVID parecía importarles a los tiranos que habían tomado el control. La gama completa de políticas gubernamentales aparentemente se rebajó a favor de resaltar una política ubicua para enfrentar de múltiples maneras las supuestas amenazas de COVID-19.

    Esta política generalizada se basa en afirmaciones de la necesidad de una amplia gama de respuestas de emergencia a un coronavirus supuestamente nuevo. Hasta el día de hoy no se ha producido ninguna evidencia que demuestre que el día del virus supuestamente nuevo haya sido aislado e identificado.

    La estrategia central proveniente de los gobiernos y sus elaborados conjuntos de conductos propagandísticos de los medios de comunicación ha sido persuadir a todos los miembros del público en general para que se consideren unos a otros como riesgos biológicos activos o potenciales. Estos esfuerzos de COVID Officialdom para destruir la base perceptiva de la cohesión social han sido concertados e intensos. El proceso fue ayudado por el esfuerzo de ponernos detrás de máscaras obligatorias y nos rodeó en muchas de nuestras transacciones con barreras de plexiglás. En muchos sentidos fuimos amordazados, degradados y deshumanizados.

    Al mismo tiempo, los confinamientos sin sentido nos impidieron ruinosamente continuar muchas de nuestras interacciones humanas, incluidas las relacionadas con el comercio, la educación, la religión, la cultura, la recreación y los deportes. Todas estas imposiciones fueron impuestas de maneras bien calculadas para restringir nuestras capacidades de organizarnos en resistencia a la negación muy agresiva de nuestros derechos humanos y constitucionales.

    A medida que se intensificaba el confinamiento de nuestros derechos y libertades, nos colmó un aluvión de respaldos huecos de celebridades que elogiaban las restricciones. Un buen ejemplo de este fenómeno está en el contenido de un especial de televisión respaldado por la OMS. En abril de 2020 aparecieron artistas de la talla de Lady Gaga, Elton John, los Rolling Stones y el perenne estafador de COVID, Stephen Colbert.

    Personalidades conocidas fueron reclutadas de muchos campos, incluidos los deportes y la religión cristiana, para contribuir a un spinorama gigante de relaciones públicas. Su propósito era inducir al público a suspender sus instalaciones críticas y aceptar que el vuelco de nuestras vidas estaba justificado e incluso era sensato. Desafortunadamente, demasiadas personas mordieron el anzuelo.

    Vea esto.

    Muchos de nosotros que trabajamos duro para mantenernos informados y mantener nuestra capacidad de razón solo ahora estamos empezando a enfrentarnos a la escala monumental de los fraudes multifacéticos a los que hemos sido sometidos. A los ojos de un segmento significativo de la población, esa narrativa oficial de COVID-19 se está deshaciendo rápidamente.

    Por ejemplo, ¿cómo podemos evitar ver las implicaciones más amplias y oscuras de la desastrosa elevación de las inyecciones modificadoras de genes como si no hubiera otros tratamientos sólidos disponibles para el contagio de COVID? El gobierno y las ramas más corruptas de la profesión médica unieron fuerzas para negar al público el acceso a remedios naturales seguros y efectivos que brindan protección contra las incursiones reales o imaginarias del virus de las celebridades.

    Con remedios naturales como la ivermectina empujados al margen, fuimos asaltados por lanzamientos publicitarios engañosos seguidos de una presión coercitiva para aceptar los peligrosos disparos de coágulos. Estos pinchazos de COVID han demostrado ser cualquier cosa menos seguros y efectivos. La evidencia continúa creciendo de que la ineficacia de las inyecciones de COVID tiene implicaciones que son mucho más profundas que un fracaso de la inmunización.

    Las agencias de medios, con las emisoras financiadas con fondos públicos como la BBC y la CBC a la cabeza, han conspirado para negar al público cualquier base fáctica para cumplir con las condiciones del consentimiento informado al participar en un experimento médico gigante que aún se encuentra en sus primeras etapas. Los engaños continúan llegando a nosotros con una intensidad de fuego rápido.

    El convoy de camioneros está ofreciendo un antídoto bien fundamentado contra la especiosidad del poder que ha estado alcanzando máximos históricos, especialmente desde que las mentiras y crímenes del 9/11 iniciaron el siglo XXI. La acción ahora centrada en Ottawa está señalando en Canadá y más allá que podría estar a la vista algún alivio de la avalancha de dictados COVID.

    El crecimiento de la resistencia se ha extendido por toda América del Norte, donde las demostraciones de apoyo y solidaridad han florecido especialmente en ambos lados de la frontera entre Canadá y Estados Unidos. Una de las manifestaciones resultó en una acción ambiciosa de camioneros y sus partidarios en un punto de cruce en la frontera internacional cerca de Coutts Alberta. Esta extensión de la protesta política en Ottawa ayudó a incitar al desorden en el fracturado gobierno provincial del primer ministro Jason Kenney.

    Vea esto.

    Dado que el transporte en camión es un requisito casi universal de las sociedades humanas organizadas en todo el mundo, el ejemplo canadiense está demostrando ser contagioso. Se ha anunciado en un titular, por ejemplo, que «el Convoy de la Libertad de Canadá ha inspirado a los camioneros en Europa, Australia y Estados Unidos a celebrar manifestaciones por la libertad en todo el mundo».

    Vea esto.

    El puesto de camioneros en Ottawa está proporcionando un prototipo de cómo la gente promedio puede organizarse y expresar el poder de manera significativa a través de la resistencia civil y el incumplimiento pacífico. Thoreau y Gandhi lo habrían aprobado. Los convoyes de libertad encarnan un medio para registrar quejas graves y posiciones de principios a través de una aplicación combinada de tácticas de zanahoria y palo.

    En este momento, el énfasis debe ser presionar a los gobiernos y sus manejadores globalistas en los bancos, los medios de comunicación y los «think tanks» para que se retiren del intento de ejercer un control autoritario tan intenso sobre nuestros cuerpos, nuestras mentes, nuestro comportamiento, nuestras instituciones e incluso nuestros espíritus. En el análisis final, el choque actual se reduce a una confrontación entre un impulso muy materialista de dominar la naturaleza, incluida la naturaleza humana, y una visión del mundo con espacio para abrazar inspiraciones espirituales y religiosas.

    Bajo estas condiciones, ¿cómo podemos dejar de contemplar los misterios sublimes expresados en el asombroso funcionamiento de los sistemas inmunológicos humanos sanos como una maravilla divina del mundo natural? ¿Qué decir de cualquier supuesta política de salud pública que resulte en ataques incapacitantes a la inmunidad natural a través de inyecciones forzadas?

    Vea esto.

    El fraude de las asociaciones público-privadas

    Al igual que Angela Merkel, Emanuel Macron, Gavin Newsom, Chrystia Freeland, Jeff Bezos, Tony Blair, Mark Zukerberg, Bill Gates junto con muchos otros artistas destacados en el Crazy COVID Circus, Justin Trudeau es un ex alumno de la escuela de Davos. A menudo asociada con reuniones anuales que tienen lugar en la ciudad turística suiza de Davos, esta escuela está contenida dentro del marco más amplio del Foro Económico Mundial.

    El WEF ha incluido durante mucho tiempo varias versiones de un programa de Líderes del Mañana en el que Justin Trudeau ha participado. Un ávido promotor del transhumanismo como base de lo que él llama la Cuarta Revolución Industrial, Karl Schwab es el fundador del WEF.

    El WEF se estableció en Ginebra, Suiza, en 1971, el mismo año en que nació Justin Trudeau. La organización se especializa en impulsar sobre los gobiernos y sobre las llamadas «organizaciones de la sociedad civil» las agendas de las corporaciones globales y sus banqueros. Las organizaciones de la sociedad civil a menudo afirman representar a algunas personas promedio y otras oprimidas. La mayoría de las veces, sin embargo, su función real es promover las agendas de los financiadores ricos, George Soros a menudo prominente entre ellos.

    El WEF es una de varias instituciones asociadas con sede en Suiza. Estas organizaciones incluyen la Cruz Roja, la Organización Mundial de la Salud (OMS) y la organización supranacional de Bill Gates, la Alianza Mundial para Vacunas e Inmunización, GAVI.

    Suiza es el lugar donde las partes beligerantes a menudo llevan a cabo negociaciones secretas, especialmente en el ámbito de las altas finanzas. Esta herencia se está aprovechando ya que Ginebra es una vez más un sitio importante de negociaciones secretas que involucran el intento de golpe global actualmente en curso. La tapadera del intento de golpe global es la emergencia sanitaria mundial categorizada engañosamente por la OMS como pandemia.

    Al igual que el WEF, GAVI busca justificarse como una meca de las llamadas «asociaciones público-privadas». Muchas de las maquinaciones de Anthony Fauci, Bill Gates, Justin Trudeau y sus compinches globalistas se describen como asociaciones público-privadas. Las asociaciones público-privadas generalmente describen el proceso de lograr que los gobiernos compren esquemas urdidos por el liderazgo de las grandes corporaciones y sus banqueros.

    Cuando los funcionarios del gobierno adoptan las agendas de las élites globalistas, roban la influencia de las mismas personas que se supone que deben representar. En consecuencia, cuando los gobiernos se convierten en servidores de plutócratas trotamundos que a menudo carecen de lealtades nacionales, privan al público de oportunidades para influir en las direcciones políticas de sus propios gobiernos nacionales.

    La privación de derechos resultante se ve agravada por la naturaleza censora de unos medios de comunicación uniformemente sesgados. Su determinación estridente de retener y bloquear el flujo de información crucial priva al público de los recursos de conocimiento que requieren para sobrevivir y prosperar. En particular, paraliza la capacidad del público para tomar buenas decisiones electorales reforzadas por el atributo del consentimiento verdaderamente informado.

    En consecuencia, la proliferación de las llamadas asociaciones público-privadas ayuda a disfrazar la realidad de que el llamado público ha sido despojado de oportunidades democráticas para influir en sus propios gobiernos. En el proceso de decidir la política, Trudeau, al parecer, está mirando mucho más a Davos que a los camioneros canadienses cuyas plataformas están estacionadas en Ottawa. ¿Cuánto tiempo permanecerán allí los camioneros?

    En 2010, Schwab esencialmente entregó una importante plataforma a Bill Gates para iniciar la llamada «Década de las Vacunas» en la reunión anual del WEF en los lujosos entornos de Davos. La Década de las Vacunas culminó convenientemente en 2020 con el inicio poco después del Evento 201 de la crisis covid fabricada.

    Según el ensayo de Joss Evans sobre «Karl Schwab’s WEF Alumi», muchos de los graduados del Programa de Jóvenes Líderes con sede en Davos han llegado a ocupar puestos de poder durante la supuesta pandemia. En estos roles, los iniciados de Schwab han actuado uniformemente de conformidad con las políticas adoptadas y defendidas por Justin Trudeau. Los ex alumnos del WEF han sido campeones celosos y firmes de las «estrategias cero covid». Estas estrategias incluyen «confinamientos, mandatos de máscaras y mandatos de vacunas».

    Mira estoesto y esto.

    La política del primer ministro Trudeau, tanto a nivel nacional como internacional, se ha alineado bien con las posiciones de Schwab y Gates. En nombre de un «Gran Reinicio», su proyecto ha sido transformar la crisis fabricada de COVID en una reformulación radical de la economía política mundial.

    Con un énfasis en facilitar aún más la concentración de la riqueza y el poder a través de renovaciones en la banca global, los defensores del Gran Reinicio han puesto una gran importancia en la eliminación de los pocos restos restantes de la soberanía nacional. El WEF disfraza su agenda globalista de corporativismo expandido detrás de una apariencia de ornamentación pseudoecológica. Los líderes de la organización describen, por ejemplo, su deseo de «lograr una economía neutra en carbono y positiva para la naturaleza y detener la pérdida de biodiversidad para 2030».

    Vea esto.

    El WEF se ha convertido en uno de los principales imanes de funciones que alguna vez pertenecieron firmemente al ámbito de la gobernanza responsable en los parlamentos y legislaturas nacionales. Estas instituciones ligadas a la tradición han sido el sitio de muchas funciones ahora asumidas por procesos supranacionales cuyos funcionarios hablan el lenguaje tecnocrático de, por ejemplo, el Gran Reinicio y las asociaciones público-privadas. Tales asociaciones no tienen un lugar real para «el público», especialmente cuando se trata de tener alguna influencia sobre la implementación del globalismo COVID-19.

    Casi invariablemente, el poder conferido a la riqueza es primordial para determinar los cambios mundiales que están matando a la clase media y transformando las legislaturas en artefactos de museos precedidos por los clubes secretos y las transacciones de multimillonarios. Estos multimillonarios han agregado más del 50% del patrimonio neto a sus carteras en su gestión interesada de la crisis de COVID fabricada. Se informa que son $ 4 billones más ricos a medida que las tasas de desempleo, suicidio y bancarrota se disparan entre la gente promedio.

    Vea esto.

    En consecuencia, los antecedentes de Justin Trudeau como heredero de la riqueza y el poder dinásticos pueden haber agregado una oleada adicional de drama en el enfrentamiento de mediados de invierno en Ottawa entre nuestro Primer Ministro de salto mundial y nuestros camioneros de la sal de la tierra. Como Jeffrey A. Tucker observó sobre el enfrentamiento en su ensayo, «Justin Trudeau esquiva la gran revuelta de los camioneros», lo que estamos presenciando se perfila como «uno de los enfrentamientos más significativos del mundo en la gran batalla entre la libertad y los gobiernos que se han propuesto aplastarla».

    Vea esto.

    Reflexionando sobre las implicaciones más amplias de lo que ha sucedido, el ex congresista estadounidense Ron Paul observó: «Todos somos camioneros canadienses ahora».

    Vea esto.

    Trudeau, Schwab, Gates y los otros principales defensores del Gran Reinicio tienen muchos planes ambiciosos. Algunos de estos planes se promueven abiertamente, mientras que otros se llevan a cabo subrepticiamente. Entre los objetivos más encubiertos se incluye la iniciativa de despoblación radical que ahora se ha iniciado. Uno de los marcadores de la existencia del plan es el impulso para universalizar las inyecciones de coágulos que alteran los genes que acortarán la vida de millones de receptores de jab. ¿Cuántas de las víctimas del pinchazo ya han muerto y por qué se oculta al público el alcance total de esta mortalidad?

    Se sabe que las vacunas funcionales previenen la transmisión hacia adentro y hacia afuera de contagios dirigidos. Ninguna de estas funciones se cumple con las inyecciones de COVID-19. Los procedimientos modificadores de genes estimulados por las inyecciones de coágulos producen proliferaciones de proteínas espiga patógenas que crean estragos especialmente en todos los sistemas cardiovasculares.

    No tenemos ninguna razón para suponer que la preocupación actual de la industria farmacéutica por la fabricación de seres humanos modificados genéticamente sea benigna o incluso bien intencionada. El objetivo de este tipo de intervención bien puede ser introducir los procedimientos y precedentes que apoyan la producción de seres transhumanos. Como ya se ha señalado, Karl Schwab se presenta como una autoridad experta en transhumanismo.

    Los objetivos que se están acercando a la mano bien podrían incluir la reformulación de nuestra posteridad como organismos bio-digitales. Para los ingenieros genéticos que están entrando en funcionamiento, estos organismos humanos alterados bien podrían ser idealizados para su integración más completa con las redes globales de vigilancia, calificación de crédito social, transacciones financieras sin efectivo, robotización generalizada e Inteligencia Artificial profundamente invasiva, IA.

    Triple vacuna y todavía contagia de COVID

    Mientras Trudeau intentaba alejarse de cualquier intercambio cara a cara o encuentro con el liderazgo de los camioneros, invocó la presencia de COVID como justificación para su comportamiento esquivo. Al principio dijo que había estado en presencia de alguien con COVID, pero que posteriormente había dado negativo. Luego, unas horas más tarde, Trudeau explicó que había sido triple pinchado pero que había sido diagnosticado como positivo para COVID mientras estaba «asintomático».

    Dejando de lado el argumento convincente de que al menos uno de sus jabs parecía involucrar la actuación en lugar de la realidad, su siguiente comentario plantea muchas cuestiones fundamentales. El Primer Ministro proclamó: «Todos, por favor, vacúnense y aumenten». ¿Por qué una persona consciente y razonable seguiría tales instrucciones de un individuo que acababa de declarar que se había contagiado de COVID incluso después de haber sido triple pinchado?

    Vea esto.

    Aparentemente sin darse cuenta, Trudeau estaba esencialmente anunciando lo que su propio caso demuestra claramente. Las inyecciones de coágulos no funcionan para prevenir la propagación del coronavirus de las celebridades. De hecho, fomentan el desarrollo de muchas patologías que ya han causado muchos millones de lesiones y muchas muertes directas en la población humana.

    Muchos médicos han sido bien recompensados por conspirar con funcionarios del gobierno para ocultar estos hechos condenatorios al público en general. Han intentado ocultar la información sobre muertes y lesiones por inyección. Mucha información sobre este tema, sin embargo, está disponible para aquellos con la capacidad y la independencia de mente para mirar fuera del dominio digital dominado por los medios heredados fuertemente censurados.

    El abyecto fracaso de Trudeau para cambiar su narrativa para tener en cuenta la imagen más completa de lo que realmente está sucediendo, se está replicando a través del amplio alcance de la oficialidad COVID. Cada vez más sus operarios tienen sangre en las manos. Para empezar, Trudeau y su directora de Salud Pública, Theresa Tam, tienen sangre en las manos. Joe Biden tiene sangre en las manos. Los falsos periodistas de la CBC y la BBC tienen sangre en las manos. Los administradores de muchas universidades tienen sangre en las manos.

    El flujo constante de desinformación vendido por decenas de miles de agencias de comunicación ha estado privando a millones de personas de toda la evidencia que necesitan para tomar decisiones sólidas de vida o muerte para ellos y sus hijos. Las muertes y lesiones por inyección no son aberraciones raras. Las inyecciones de jabs-for-jobs están haciendo un mundo de daño, mientras que ofrecen pocos o ningún beneficio, aparte de contener temporalmente la ira discriminatoria de los fanáticos de la inyección empleados en COVID Officialdom.

    Hemos sido sometidos a una estafa monumental cuyos protagonistas están explotando las imágenes de la salud pública como tapadera para la instalación de una amplia gama de precedentes y procedimientos cuyo objeto es el control tiránico de lo público.

    Jagmeet Singh es una de las figuras que mantiene a flote al dos veces gobierno minoritario de Trudeau en el entorno de Zoom que se ha hecho para reemplazar al Parlamento durante gran parte de los dos años anteriores. Singh es un sij que es líder del Nuevo Partido Democrático de Canadá (NDP). El NDP ha heredado el legado izquierdista de la socialdemocracia en Canadá. Es el equivalente político en Canadá del Partido Laborista.

    El Partido Liberal liderado por Justin Trudeau no puede obtener la mayoría de los votos en la Cámara de los Comunes de Canadá. Por lo tanto, Trudeau requiere votos adicionales de los parlamentarios que representan a otros partidos en el Parlamento. En este entorno, Trudeau a menudo recurre a Jagmeet Singh y su partido nacional NDP para contribuir con el respaldo que necesita para mantener a su minoría liberal en el poder.

    Al igual que los partidos de oposición en la mayoría de los gobiernos occidentales, Singh ha sido un entusiasta partidario incluso de las políticas COVID más extremas de Justin Trudeau. De hecho, en muchas legislaturas provinciales, los MLA del NDP a menudo se quejan de que las restricciones prevalecientes de COVID de los gobiernos no van lo suficientemente lejos. El NDP quiere más mascarillas, más confinamientos, más distanciamiento social y más inyecciones obligatorias.

    Estos antecedentes ayudan a establecer el contexto de un sorprendente tweet hecho por Singh cuando los camioneros aterrizaron en Ottawa. Señalando al partido con el segundo mayor número de parlamentarios en el Parlamento, lo que se conoce en nuestra monarquía constitucional como el Partido de Oposición Leal de Su Majestad, Singh dijo lo siguiente:

    «Hoy los parlamentarios conservadores han respaldado un convoy liderado por aquellos que reclaman la superioridad de la línea de sangre blanca y equiparan el Islam a una enfermedad».

    Vea esto.

    Esta crítica a los camioneros colectivamente y a los parlamentarios conservadores en general como islamófobos y como personas que creen en «la superioridad de la línea de sangre blanca» me parece asombrosa. Por supuesto, no se ofrece ninguna evidencia que respalde este insulto.

    Hasta donde yo sé, ninguna agencia de medios de comunicación convencional prestó la más mínima atención a esta acusación de uno de los políticos de más alto perfil de Ottawa. Tal hipérbole, supongo, ha sido «normalizada» para convertirse en una historia de mordeduras de perro. La condena de Singh a los camioneros parece estar en línea con la afirmación de Trudeau de que aquellos que se oponen a sus políticas de COVID pueden ser categorizados colectivamente como «racistas y misóginos».

    Las reglas eran muy diferentes cuando se trataba de la afirmación de algunos de que las banderas confederadas y nazis habían sido vistas en las manifestaciones de Ottawa. No tengo conocimiento de ninguna investigación adecuada para asegurarme de que estas imágenes no fueron plantadas por partisanos que buscan desacreditar los mensajes de amor, unidad, igualdad y esperanza traídos a Ottawa por el convoy de camioneros. Esta técnica para la demonización de los opositores políticos se ha vuelto demasiado común en los últimos tiempos.

    El Centro para Israel y Asuntos Judíos (CIJA) junto con B’nai Brith Canadá parecieron ponerse del lado de los esfuerzos de Trudeau para despedir a todos los manifestantes de Ottawa como representantes de una minoría marginal dominada por racistas. Ambas organizaciones étnicas son agencias del poderoso Lobby de Israel en Canadá. Shimon Koffler Fogel, el CEO de la CIJA, dejó muy clara su posición. En lugar de comentar sobre cuestiones de fondo que está decidiendo el gobierno canadiense en lugares donde Fogel tiene un asiento en la mesa, recurre a insinuaciones perjudiciales. Pide a aquellos a quienes condena «que se arrastren de nuevo bajo la roca de la que se deslizaron».

    Vea esto.

    La determinación de los camioneros de permanecer estacionados en su lugar y permanecer en Ottawa hasta que sus problemas se aborden seriamente, previsiblemente está siendo criticada. Ya no puede haber ninguna duda sobre el notorio sesgo de los medios de comunicación sesgados cuya propaganda como apologistas del poder es ahora ampliamente entendida por aquellos que prestan atención.

    Así que no busque en los medios heredados una cobertura justa de la dinámica de lo que está a punto de suceder en las fases posteriores de este enfrentamiento, uno que muy probablemente determinará el futuro político de Justin Trudeau. Su opuesto en el Parlamento ya ha sido eliminado. El 2 de febrero Erin O’Toole fue destituido de su cargo como líder del Partido Conservador federal. Su liderazgo está ahora en juego.

    Las caídas en picado en la popularidad del primer ministro de Canadá y el ex líder del Partido Conservador de la oposición se han producido simultáneamente con los anuncios de que se están eliminando muchas restricciones de COVID en once países europeos, así como en Israel. Finalmente está absolutamente claro que no hay consenso político que apoye la toma de poder de los protagonistas que han fabricado sediciosamente la crisis del COVID.

    Vea esto.

    Fuente: https://www.unz.com/article/trudeau-and-the-truckers-towards-a-worldwide-movement-against-the-covid-19-mandates/

    Más: Más convoyes de libertad: un llamado a la solidaridad de Austria

    Esto hace saltar por los aires la estafa del Covid. Se acabó.

    No creo que sea por dinero, en esto del Covid-19 hay algo más. Es la vacuna, o más bien, la vacunación ¿Qué hay en la vacuna? Lo que ellos quieran y cuando quieran. Pero antes de llegar a esta conclusión, lean.

    Todas las patentes, todos los criminales, todas las empresas, y citas como esta: «La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: «necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso».

    Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC

    https://www.bitchute.com/embed/GmcSTZv5FuPM/ (En inglés y alemán)

    Ponentes:

    Reiner Fuellmich, Dr. David Martin, Prof. Martin Schwab, Dr. Wolfgang Wodarg, Viviane Fischer

    Reiner Fuellmich  00:09

    Así que creo que es mejor si te presentas. Sé que eres el presidente de M-CAM International Innovation Risk Management, pero eso no le dice a mucha gente lo que realmente estás haciendo?

    Dr David Martin  00:25

    Sí, bueno, desde un punto de vista corporativo, desde 1998, hemos sido el mayor suscriptor del mundo de activos intangibles utilizados en finanzas en 168 países. Así que en la mayoría de los países de todo el mundo, nuestros sistemas de suscripción, que incluyen todo el corpus de todas las patentes, solicitudes de patentes, subvenciones federales, registros de adquisiciones, registros de gobierno electrónico, etc. Tenemos la capacidad no solo de rastrear lo que está sucediendo y quién está involucrado en lo que está sucediendo, sino que monitoreamos una serie de intereses temáticos para una variedad de organizaciones e individuos, así como para nuestro propio uso comercial, porque como probablemente sepa, mantenemos tres índices de renta variable global, que son los índices de renta variable de gran capitalización y mediana capitalización de mejor rendimiento en todo el mundo. Así que nuestro negocio es monitorear la innovación que está sucediendo en todo el mundo y específicamente monitorear la economía de esa innovación, el grado en que, ya saben, los intereses financieros están siendo atendidos, ya saben, los intereses corporativos están siendo dislocados, etc. Por lo tanto, nuestro negocio es el negocio de la innovación y sus finanzas.

    Reiner Fuellmich  02:03

    Reiner traduce. Bueno, lo conseguí. Sí.

    Dr David Martin  02:53

    Así que, obviamente desde el punto de vista de esta presentación, como saben, hemos revisado las más de 4000 patentes que se han emitido en torno al Coronavirus del SARS. Y hemos hecho una revisión muy exhaustiva de la financiación de todas las manipulaciones del Coronavirus que dieron lugar al SARS como un subclado de la familia beta del Coronavirus. Así que lo que quería hacer era darles una visión general rápida de la línea de tiempo porque no vamos a pasar por 4000 patentes en esta conversación, pero les he enviado a ustedes y a su equipo, un documento que es excepcionalmente importante. Esto se hizo público en la primavera de 2020. Este documento que usted tiene y puede ser publicado en el registro público es bastante crítico en el sentido de que tomamos la secuencia genética reportada, que al parecer fue aislada como un nuevo Coronavirus, indicada como tal por el ICTV, el Comité Internacional de Taxonomía de Virus de la Organización Mundial de la Salud, tomamos las secuencias genéticas reales que supuestamente eran nuevas y revisamos las que estaban disponibles en comparación con los registros de patentes que estaban disponibles a partir de la primavera de 2020. Y lo que encontramos, como verán en este informe, son más de 120 pruebas patentadas que sugieren que la declaración de un nuevo Coronavirus fue en realidad una falacia. No hubo nuevo Coronavirus. Hay innumerables modificaciones muy sutiles de las secuencias de Coronavirus que se han subido, pero no hubo un solo nuevo Coronavirus identificado en absoluto. De hecho, encontramos registros en los registros de patentes de secuencias atribuidas a la novedad que iban a patentes que se solicitaron ya en 1999. Entonces, esto no solo no era una novela, sino que en realidad no solo no ha sido novela, sino que no ha sido novela durante más de dos décadas. Pero tomemos un paso muy corto, y lo que haré es llevarlos en un viaje muy corto a través del panorama de las patentes para asegurarme de que la gente entienda lo que sucedió. Pero como saben, hasta 1999, el tema de Coronavirus vs V [VSV?] la actividad de patentamiento en torno al Coronavirus se aplicaba de manera única a las ciencias veterinarias. La primera vacuna patentada para coronavirus fue buscada por Pfizer. La aplicación de la primera vacuna para coronavirus, que fue específicamente esta proteína pico s. Así que exactamente lo mismo que supuestamente nos hemos apresurado a la invención. La primera solicitud se presentó el 28 de enero de 2000, hace 21 años. Así que la idea de que misteriosamente tropezamos en la forma de intervenir en las vacunas no solo es ridícula, es incrédula porque Timothy Millor, Sharon Klepfer, Albert Paul Reed y Elaine Jones el 28 de enero de 2000, presentaron lo que finalmente se emitió como la patente estadounidense 6372224, que era el virus de la proteína spike, una vacuna para el Coronavirus canino, que en realidad es una de las múltiples formas de Coronavirus. Pero como dije, el trabajo inicial hasta 1999 se centró en gran medida en el área de las vacunas para animales, los dos animales que recibieron la mayor atención fueron probablemente el trabajo de Ralph Barics sobre los conejos y la miocardiopatía del conejo que se asoció con problemas significativos entre los criadores de conejos, y luego el Coronavirus canino en el trabajo de Pfizer para identificar cómo desarrollar candidatos a diana de vacunas de proteína s y spike, dando lugar a la evidencia obvia que dice que ni el concepto de Coronavirus de una vacuna, ni el principio del Coronavirus en sí como un patógeno de interés con respecto al comportamiento de las proteínas spike es nada nuevo en absoluto. De hecho, tiene 22 años, según las solicitudes de patente. Lo que es más problemático, y lo que en realidad es el problema más atroz es que Anthony Fauci y el NIAID encontraron que la maleabilidad del Coronavirus era un candidato potencial para las vacunas contra el VIH. Así que el SARS en realidad no es una progresión natural de una modificación zoonética del Coronavirus. De hecho, muy específicamente en 1999 Anthony Fauci financió una investigación en la Universidad de Carolina del Norte Chapel Hill, específicamente para crear, y no puedes evitar, ya sabes, lamentar lo que estoy a punto de leer porque esto viene directamente de una solicitud de patente presentada el 19 de abril de 2002. Y ustedes escucharon correctamente la fecha de 2002 en la que el NIAID construyó una replicación infecciosa defectuosa del Coronavirus que estaba específicamente dirigida al epitelio pulmonar humano. En otras palabras, fabricamos el SRAS y lo patentamos el 19 de abril de 2002, antes de que se hubiera producido ningún supuesto brote en Asia, que, como saben, le siguió varios meses. Esa patente emitida es la patente estadounidense 7279327. Esa patente establece claramente en una secuenciación genética muy específica, el hecho de que sabíamos que el receptor ACE, el dominio de unión a ACE2, la proteína espiga s1 y otros elementos de lo que hemos llegado a conocer como este patógeno azote no solo se diseñó, sino que podría modificarse sintéticamente en el laboratorio, utilizando nada más que tecnologías de secuenciación de genes, tomando código informático y convirtiéndolo en un patógeno o un intermediario del patógeno. Y esa tecnología se financió exclusivamente en los primeros días como un medio por el cual podríamos aprovechar el Coronavirus como un vector para distribuir la vacuna contra el VIH. Les dejé traducir eso porque eso es mucho material.

    Reiner Fuellmich  11:30

    Bien. Reiner traduce. Bien.

    Reiner Fuellmich  15:32

    (inaudible) Sequoia Pharmaceuticals.

    Dr David Martin  15:32

    Bien. Así que la cosa empeora. Se nos pidió a mi organización que vigilara las violaciones de los tratados sobre armas biológicas y químicas en los primeros días del año 2000. Recordarán los eventos de ántrax en septiembre de 2001. Y fuimos parte de una investigación que dio lugar a la investigación del Congreso no solo sobre los orígenes del ántrax, sino también sobre lo que era un comportamiento inusual en torno al medicamento de ciprofloxacina Bayers, que era un medicamento utilizado como tratamiento potencial para el envenenamiento por ántrax. Y a lo largo del otoño de 2001, comenzamos a monitorear una enorme cantidad de patógenos bacterianos y virales que estaban siendo patentados a través de los NIH, NIAID, US AMRIID, el Programa de Enfermedades Infecciosas de las Fuerzas Armadas de los Estados Unidos y una serie de otras agencias internacionales que colaboraron con ellos. Y nuestra preocupación era que el Coronavirus estaba siendo visto no solo como un potencial agente manipulable para su uso potencial como vector de vacuna, sino que también estaba siendo considerado muy claramente como un candidato a arma biológica. Así que nuestro primer informe público sobre esto tuvo lugar antes del brote de SRAS en la última parte de 2001. Así que pueden imaginarse lo decepcionado que estoy de estar sentado aquí 20 años después de haber señalado 20 años antes que había un problema que se avecinaba en el horizonte con respecto al Coronavirus. Pero después del supuesto brote y siempre diré supuesto brote porque creo que es importante que entendamos que el Coronavirus como patógeno circulante dentro del modelo viral que tenemos en realidad no es nuevo en la condición humana y no es nuevo en las últimas dos décadas. En realidad ha sido parte de la secuencia de proteínas que circula durante mucho tiempo. Sin embargo, el supuesto brote que tuvo lugar en China en 2002, hasta 2003, dio lugar a una presentación muy problemática en abril de 2003 por parte del Centro para el Control y la Prevención de Enfermedades de los Estados Unidos. Y este tema es de importancia crítica para obtener el matiz muy preciso, porque además de archivar toda la secuencia genética en lo que se convirtió en coronavirus SARS, que en realidad es una violación de 35 US Code Sección 101. No se puede patentar una sustancia natural. La violación de la Sección 101 del Código de los Estados Unidos 35 fue el número de patente 7220852. Ahora bien, esa patente también tenía una serie de patentes derivadas asociadas a ella, estas son nuestras solicitudes de patente que se separaron porque eran de múltiples materias patentables. Pero estos incluyen la patente de EE.UU. 46592703p, que en realidad es una designación muy interesante, patente de EE.UU. 7776521. Estas patentes no solo cubrían la secuencia genética del Coronavirus SARS, sino que también cubrían los medios para detectarlo mediante RT-PCR. Ahora, la razón por la que eso es un problema es que si ambos poseen la patente sobre el gen en sí, y poseen la patente sobre su detección, tienen una ventaja cortante para poder controlar el 100 por ciento de la procedencia no solo del virus en sí, sino también de su detección, lo que significa que tienen todo el control científico y de mensajes. Y esta patente solicitada por los CDC supuestamente fue justificada por su equipo de relaciones públicas como buscada para que todos fueran libres de poder investigar el Coronavirus. El único problema con esa afirmación es que es una mentira y la razón por la que es una mentira es porque la oficina de patentes no una sino dos veces rechazó la patente sobre la secuencia genética como no patentable porque la secuencia genética ya estaba en el dominio público. En otras palabras, antes de que los CDCs solicitaron una patente, la oficina de patentes encontró un 99.9 por ciento de identidad con el Coronavirus ya existente registrado en el dominio público, y sobre el rechazo del examinador de patentes. Y después de tener que pagar una multa de apelación en 2006 y 2007, los CDC anularon el rechazo de las oficinas de patentes de su patente y finalmente en 2007 obtuvieron la patente sobre el Coronavirus SARS. Ahora, cada declaración pública que los CDC han hecho que dijo que esto era de interés público es falsificable por su propio soborno pagado a la oficina de patentes. Esto no es algo que es sutil, y para empeorar las cosas que pagaron una tarifa adicional para mantener su solicitud privada. La última vez que lo comprobé, si está tratando de hacer que la información esté disponible para la investigación pública, no pagaría una tarifa para mantener la información privada. Me hubiera gustado haber inventada cualquier cosa que acabo de decir, pero todo eso está disponible en el registro del archivo público de patentes que cualquier miembro del público puede revisar. Y el PAR Público, como se le llama en la Oficina de Patentes de los Estados Unidos, no sólo tiene la evidencia, sino los documentos reales que tengo en mi poder. Ahora, esto es críticamente importante. Es de vital importancia porque los verificadores de hechos han declarado repetidamente que el nuevo Coronavirus, designado como SARS CoV 2, es de hecho distinto de la patente de los CDC. Y aquí está el problema genético y el problema de las patentes. Si nos fijamos en la secuencia de genes que es presentada por los CDC en 2003, de nuevo en 2005 y luego de nuevo en 2006, lo que se encuentra es la identidad en algún lugar entre el 89 y el 99 por ciento de las superposiciones de secuencias que se han identificado en lo que se llama el nuevo subclado de SARS CoV 2. Lo que sabemos es que la designación central de SARS Coronavirus, que en realidad es el clado de la familia de los betacoronavirus y el subclado que se ha llamado SARS CoV 2 tienen que superponerse desde un punto de vista taxonómico. No se puede tener la designación del SRAS en una cosa sin que primero sea el SRAS. Así que la verificación de hechos falsos que se ha hecho diciendo que de alguna manera u otro CDC no tiene nada que ver con esta patente en particular, o este patógeno en particular, está más allá de la credibilidad literal de las secuencias publicadas. Y también está más allá de la credulidad cuando se trata de la taxonomía de ICTV porque establece muy claramente que este es de hecho un subclado del clado llamado Coronavirus SARS. Ahora, lo importante es el 28 de abril, y escuchen la fecha con mucha atención porque esta fecha es problemática. Tres días después de que los CDC presentaron la patente sobre el Coronavirus sars en 2003. Tres días más tarde, Sequoia Pharmaceuticals, una compañía que se estableció en Maryland, Sequoia pharmaceuticals el 28 de abril de 2003, presentó una patente sobre agentes antivirales de tratamiento y control de infecciones por coronavirus. Los CDC presentaron tres días antes, y luego el tratamiento estuvo disponible tres días después. Ahora, solo mantenga ese pensamiento por un segundo.

    Dr David Martin  25:26

    Bueno, ahí lo tienes. Esa es una buena pregunta porque Sequoia Pharmaceuticals y, en última instancia, Ablynx Pharmaceuticals se convirtieron en las tenencias propietarias de Pfizer, Crucell y Johnson and Johnson.

    Reiner Fuellmich  25:43

    uau.

    Dr David Martin  25:45

    Así que hágase una pregunta simple. ¿Cómo se tendría una patente sobre un tratamiento para una cosa que se había inventado tres días antes?

    Reiner Fuellmich  25:55

    Sí.

    Dr David Martin  25:57

    La patente en cuestión, la patente del 28 de abril de 2003 7151163,emitida a Sequoia Pharmaceuticals tiene otro problema. El problema es que se emitió y publicó antes de que se permitiera la patente de los CDC sobre coronavirus. Por lo tanto, el grado en que la información podría haber sido conocida por cualquier medio que no sea información privilegiada entre esas partes es cero. No es físicamente posible patentar una cosa que trata una cosa que no había sido publicada, porque los CDC habían pagado para mantenerla en secreto. Esta, mis amigos es la definición de conspiración criminal extorsión y colusión. Esto no es una teoría. Esto es una prueba. No se puede tener información en el futuro en forma [para] un tratamiento para una cosa que no existía.

    Reiner Fuellmich  27:16

    Esto bien podría estallar en un caso Rico, en última instancia.

    Dr David Martin  27:20

    Es decir, es un caso Rico. No se puede explotar, es un caso de Rico. Y el patrón Rico, que se estableció en abril de 2003 para el primer Coronavirus, se jugó exactamente en el mismo horario cuando vemos que el SARS CoV 2 aparece cuando tenemos a Moderna recibiendo la secuencia de proteínas spike por teléfono del centro de investigación de vacunas del NIAID antes de la definición del nuevo subclado. ¿Cómo tratas una cosa antes de que realmente la tengas?

    Reiner Fuellmich  28:04

    Tengo que traducir esto, ¿no puedes inventar esto? Definitivamente no. Reiner traduce.

    Reiner Fuellmich  33:22

    Sí, bueno, va a empeorar aquí.

    Reiner Fuellmich  33:22

    Oh no, no puede empeorar.

    Dr David Martin  33:24

    Oh, lo hace. El 5 de junio de 2008, que es una fecha importante porque en realidad es alrededor de la época en que DARPA el Programa de Investigación Avanzada de Defensa en los Estados Unidos se hizo activamente un interés en coronavirus como un arma biológica. 5 de junio 2008 Ablynx, que como usted sabe ahora es parte de Sanofi, presentó una serie de patentes que se dirigieron específicamente a lo que nos han dicho es la característica novedosa del virus SARS CoV 2. Y escucharon lo que acabo de decir, este es el 5 de junio de 2008.

    Reiner Fuellmich  34:09

    ¿Encontraron qué?

    Dr David Martin  34:10

    Específicamente se dirigieron a lo que se llamó el sitio de escisión poli básica para el SARS Cov, la nueva proteína spike y el dominio de unión al receptor ACE2 que supuestamente es nuevo para el SARS CoV 2, y todo eso fue patentado el 5 de junio de 2008. Y esas patentes en secuencia se emitieron entre el 24 de noviembre de 2015, que fue la patente estadounidense 9193780. De modo que uno saliera después del aumento de la moratoria de la función. Ese se produjo después del brote de MERS en Oriente Medio, pero lo que se encuentra es que luego, en 2016, 2017, 2019, se emitió una serie de patentes que cubren no solo las hebras de ARN, sino también los subcomponentes de las hebras genéticas, a Ablynx y Sanofi. Y luego tenemos a Crucell. Tenemos Rubius Therapeutics. Tenemos Children’s Medical Corporation. Tenemos muchos otros que incluyen la Universidad Ludwig Maximillans en Munchen, Protein Sciences Corporation, Dana-Farber Cancer Institute, La Universidad de Iowa, la Universidad de Hong Kong, el Centro Nacional chino del Genoma Humano en Shanghai, todos los que se identifican en las solicitudes de patente que van desde 2008 hasta 2017. Cada atributo que supuestamente fue publicado de forma única por la publicación de referencia única, el nuevo murciélago Coronavirus, revela inserciones naturales de la s1 s2 al sitio de escisión de la proteína spike y posibles tres orígenes recombinantes del virus SARS CoV 2, el artículo que se ha utilizado rutinariamente para identificar el nuevo virus. Desafortunadamente, si realmente tomas lo que informan como novedoso, encuentras 73 patentes emitidas entre 2008 y 2019, que tienen los elementos que supuestamente eran novedosos en el SARS CoV 2, específicamente en lo que se refiere al sitio de escisión poli básico basado en tu dominio de unión al receptor y la proteína spike. Así que los componentes clínicamente nuevos de lo clínicamente único, clínicamente contagioso, ¿saben a dónde voy con esto? Bien. No hubo brote de SRAS, porque habíamos diseñado todos los elementos de eso. Y en 2016, el documento que se financió durante la moratoria de ganancia de función, que decía que el Coronavirus del SARS estaba listo para la emergencia humana escrito nada menos que por Ralph Baric, no solo estaba listo para la emergencia humana, sino que fue patentado para la explotación comercial 73 veces.

    Reiner Fuellmich  38:07

    Ralph Baric, creo que vi un videoclip con él dando un discurso en el que le dijo explícitamente a la audiencia que se puede ganar mucho dinero con esto.

    Dr David Martin  38:17

    Sí se puede. Y ha hecho mucho dinero haciendo esto.

    Reiner Fuellmich  38:22

    oh.

    Dr David Martin  38:25

    Así que para aquellos que quieran vivir en la ilusión de que de una manera u otra ese es el final de la historia, prepárese para una decepción mayor porque alguien sabía algo en 2015 y 2016, lo que dio lugar a mi cita favorita de toda esta pandemia. Y por eso no estoy siendo lindo. Mi cita favorita de esta pandemia fue una declaración hecha en 2015 por Peter Daszak. La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: «necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso». fin de la cita.

    Viviane Fischer  39:47

    Eso es bastante impactante, porque pensé que –

    Reiner Fuellmich  39:49

    Eso es realmente quiero decir, Peter Doshi, no era él el uno –

    Dr David Martin 39:49

    – déjame leer eso de nuevo, solo porque no sé si podría perderme en la traducción. Así que déjenme seguir adelante y leerlo lentamente. Sí, y como a los estadounidenses les encanta hacer cuando hablan a una audiencia multilingüe, tal vez debería decirlo más fuerte. No lo haré. «Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. los inversionistas responderán si ven ganancias al final del proceso». Fin de la cita.

    Reiner Fuellmich  40:45

    – no no no Peter Daszak.

    Viviane Fischer  40:46

    Oh Daszak?

    Dr David Martin  40:47

    Peter Daszak el jefe de Eco Health Alliance?

    Reiner Fuellmich  40:49

    Peter Doshi es el bueno.

    Viviane Fischer  40:51

    Sí, yo era sólo –

    Dr David Martin  40:52

    – Peter Daszak la persona que estaba corroborando de forma independiente la teoría de la fuga china no de laboratorio porque no había una fuga de laboratorio. Esta fue una bio-militarización intencional de proteínas espiga para inyectar en las personas para que sean adictas a una vacuna pan-Coronavirus. Esto no tiene nada que ver con un patógeno que se liberó y cada estudio que se ha lanzado para tratar de verificar una fuga de laboratorio es una pista falsa.

    Viviane Fischer  41:26

    ¿Y realmente no hay nada que sea nuevo en esto?

    Dr David Martin 41:29

    nada. cero. 73 patentes sobre todo lo clínicamente novedoso. 73, todos emitidos antes de 2019. Y les voy a dar la bomba más grande de todas para demostrar que esto en realidad no fue una liberación de nada porque la Patente 7279327, la patente sobre la naturaleza recombinante de ese pulmón dirigido al Coronavirus, fue transferida misteriosamente de la Universidad de Carolina del Norte, Chapel Hill a los Institutos Nacionales de Salud en 2018. Ahora, aquí está el problema con eso. Bajo la Ley Bayh-Dole, el gobierno de los Estados Unidos ya tiene lo que se llama una disposición de derecho de margen. Eso significa que si se paga al gobierno estadounidense por la investigación, tienen derecho a beneficiarse de esa investigación a petición suya o a su antojo. Así que explique por qué, en 2017 y 2018, de repente los Institutos Nacionales de Salud tienen que tomar posesión de la patente que ya tenían derechos sobre la Universidad de Carolina del Norte, Chapel Hill. ¿Y cómo tenían que presentar un Certificado de Corrección para asegurarse de que era legalmente ejecutable? Porque hubo un error tipográfico en la referencia de concesión en la primera presentación. Por lo tanto, necesitaban asegurarse de que no solo lo hacían bien, sino que también debían asegurarse de que cada tipo de error gráfico que figuraba en la patente fuera correcto. Sobre la patente única requerida para desarrollar el mandato del Instituto de Investigación de Vacunas, que fue compartido entre la Universidad de Carolina del Norte, Chapel Hill en noviembre de 2019 y Moderna en noviembre de 2019 cuando UNC Chapel Hill, NIAID y Moderna comenzaron la secuenciación de una vacuna de proteína spike un mes antes de que ocurriera un brote.

    Reiner Fuellmich  43:51

    Tienes toda la evidencia, ¿verdad?

    Dr David Martin  43:53

    sí.

    Reiner Fuellmich  43:55

    Tendré que traducir esto. Así que todo es sobre dinero.

    Dr David Martin 49:25

    Siempre ha sido cuestión de dinero, y sólo para responder a una pregunta que se ha formulado un poco antes. El guion de esto fue escrito el 6 de enero de 2004.

    Reiner Fuellmich  49:39

    ¿6 de enero de 2004? ¿Quién escribió el guion?

    Dr David Martin  49:42

    Merck, en una conferencia llamada SARS y bioterrorismo, bioterrorismo enfermedades infecciosas emergentes, antimicrobianos, terapéutica y moduladores inmunológicos. Merck introdujo la noción de lo que llamaron la nueva normalidad. Propio sustantivo de la nueva normalidad, que es el lenguaje que se convirtió en la campaña de marca que fue adoptada por la Organización Mundial de la Salud, la Junta de Monitoreo de la Preparación Global, que fue la junta en la que se sentaron juntos el Director del Centro para el Control de Enfermedades de China, el Dr. Elias de Bill Gates, de la Fundación Gates, y Anthony Fauci en esa junta directiva. Pero la primera introducción de la campaña de la nueva normalidad, que trataba de hacer que la gente aceptara una vacuna universal contra el pan-coronavirus, en realidad se adoptó el 6 de enero de 2004. Así que ha existido bastante tiempo. No voy a decir muchos más puntos, aparte de decir que estaba muy claro que Merck lo sabía, lamento que Moderna supiera que se iba a poner al frente de la línea con respecto al desarrollo de una vacuna en marzo de 2019. Y esta es una fecha muy importante, porque en marzo de 2019, por razones que no son transparentes, de repente modificaron una serie de solicitudes de patentes rechazadas, lo cual es un comportamiento muy extraño, pero modificaron una serie de solicitudes de patentes para hacer referencia específicamente a una liberación intencional o accidental, lo siento, su término liberación intencional de Coronavirus. Así que en marzo, enmendaron cuatro solicitudes de patente fallidas para comenzar el proceso de desarrollo de una vacuna contra el Coronavirus. Y empezaron a lidiar con un problema muy importante que tenían, que era que dependían de tecnología que no poseían. Dos compañías canadienses Arbutus Pharmaceuticals y Acuitas Pharmaceuticals en realidad poseen la patente sobre la envoltura de nanopartículas lipídicas que se requiere para administrar la inyección del fragmento de ARNm. Y esas patentes se han emitido tanto en Canadá como en los Estados Unidos y luego en todo el mundo en su equivalencia mundial de propiedad intelectual. Moderna sabía que no poseía los derechos y comenzó a tratar de negociar con Arbutus y Acuitas para obtener la resolución de la tecnología patentada de nanopartículas lipídicas disponible para ser puesta en una vacuna. Y sabemos, como hice referencia antes, que en noviembre, firmaron un acuerdo de investigación y cooperación de investigación y desarrollo con UNC Chapel Hill con respecto a conseguir que la proteína espiga se pusiera dentro de la nanopartícula lipídica para que realmente tuvieran una vacuna candidata antes de que tuviéramos un patógeno, supuestamente que estaba corriendo alrededor. Lo que hace que esa historia sea más problemática más allá de la naturaleza evidente de la misma es que sabemos que desde 2016 hasta 2019, en cada una de las reuniones de la junta del Consejo Asesor del NIAID, Anthony Fauci lamentó el hecho de que no pudo encontrar una manera de hacer que la gente aceptara la vacuna universal contra la influenza, que es lo que era su objetivo favorito. , estaba tratando de que la población se involucrara en este proceso. Y lo que se hace muy evidente con Peter Daszak Eco Health Alliance, UNC Chapel Hill y otros, y luego más específicamente, en marzo de 2019, en las solicitudes de patentes enmendadas de Moderna, vemos que hay una epifanía que dice: ¿Qué pasaría si hubiera una liberación accidental o intencional de un patógeno respiratorio? Y lo que hace que esa frase en particular sea problemática es que se recita exactamente en el libro Un mundo en riesgo, que es el escenario que armó la Organización Mundial de la Salud en septiembre de 2019. Así que meses antes hay un supuesto patógeno, que dice que necesitamos tener una experiencia global coordinada de la liberación de un patógeno respiratorio, que para septiembre de 2020, debe poner en marcha una capacidad universal para la gestión de las relaciones públicas, el control de multitudes y la aceptación de un mandato de vacuna universal. Eso fue septiembre de 2019. Y el lenguaje de una liberación intencional de un patógeno respiratorio se escribió en el escenario que cita «debe estar terminado para septiembre de 2020».

    Dr. Wolfgang Wodarg 55:44

    Este era un texto para la sra. Brundtland estaba al frente de esta comisión, ¿no es así?

    Dr David Martin  55:50

    Bueno, esta es la declaración unificada de las juntas de monitoreo de preparación global. Hay una serie de personas que han tomado crédito y luego se han alejado del crédito por ello, pero sí, tienes razón.

    Dr Wolfgang Wodarg  56:00

    ¿Estoy en lo cierto también cuando digo que también el receptor ACE2 que ya estaba descrito en las patentes antes de 2019?

    Dr David Martin  56:11

    Sí, tenemos 117 patentes con el mecanismo de focalización del receptor ACE2 específicamente para el Coronavirus SARS.

    Dr Wolfgang Wodarg  56:20

    Porque siempre dicen que esto es lo nuevo con el virus.

    Dr David Martin  56:24

    Ahora, no es nuevo, y no ha sido ni remotamente nuevo. Está en publicaciones que se remontan a 2008. En las conferencias sobre emplazamiento de armas que tuvieron lugar en Eslovenia, en Europa, en toda Europa y en toda la infraestructura de DARPA. Lo sabemos desde 2013. Es aislamiento y amplificación.

    Viviane Fischer  56:49

    Y esta, la enmienda que Merck hizo a esto, [donde] rechazaron las solicitudes de patente, entonces, ¿fue solo por el hecho de que es como deliberadamente, ya saben, como, poner en el medio ambiente o algo así, o agregaron algo más?

    Dr David Martin  57:05

    Pues bien, se trata de cuatro solicitudes de patente fallidas que se revitalizaron esencialmente en marzo de 2019. Y fue Moderna, me equivoco. Hablé de Merck, era Moderna, y traté de corregir que lamento que eso no salió adelante. Pero son las solicitudes de patente de Moderna las que fueron modificadas en marzo de 2019 para incluir la liberación intencional de un lenguaje de patógeno respiratorio.

    Viviane Fischer  57:35

    Si eso no hubiera sido rechazado por alguna razón, simplemente no estarían sentados allí básicamente.

    Dr David Martin  57:41

    No, hacen procesos similares a otras compañías farmacéuticas, donde se utilizan de hoja perenne y modifican continuamente las aplicaciones para disfrutar de las primeras fechas de prioridad disponibles. Pero es por eso que tienes que volver atrás y mirar la enmienda de los registros de solicitud para averiguar cuándo se puso en marcha el lenguaje de enmienda real. Pero sí, quiero decir, el hecho del asunto es, y como dije, no voy a ser belabour todos los datos de patentes, pero cualquier afirmación de que este patógeno es de alguna manera único o novedoso se desmorona en las secuencias de genes reales, que se publican en el registro de patentes, y luego más atrozmente se desmorona en el hecho de que tenemos Peter Daszak mismo afirmando que tenemos que crear publicidad pública para obtener el público para aceptar la contramedida médica de una vacuna pan-Coronavirus. Y lo que hace que eso sea más ridículo es el hecho de que, como sabemos, la Organización Mundial de la Salud había declarado el Coronavirus, ya saben, una especie de interés muerto. Es decir, dijeron que habíamos erradicado el Coronavirus como una preocupación. Entonces, ¿por qué haberlo erradicado en 2007 y 2008? ¿Por qué empezamos a gastar miles de millones de dólares a nivel mundial en una vacuna para una cosa que había sido erradicada por declaración en 2008? Ya saben, como que cae en la zona de la incredulidad, por decir lo menos.

    Reiner Fuellmich  59:23

    ¿No significa eso también si se toma la totalidad de la evidencia, entonces esta es una herramienta el Coronavirus y las vacunas, esta es una herramienta, y el interés de DARPA en crear un arma biológica a partir de esto, esta es una herramienta para todo lo demás que se aferra a esto, incluido el control de la población, por ejemplo?

    Dr David Martin  59:50

    Bueno, escuchen, tenemos que dejar de caer incluso en la narrativa convencional en nuestra propia línea de cuestionamiento porque el hecho es que esto fue visto como una fuente biológica altamente maleable. No cabe duda de que en 2005 era, sin lugar a dudas, un arma preferida. Y la ilusión de que desafortunadamente seguimos viendo a personas muy bien intencionadas que quedan atrapadas en conversaciones sobre si estamos teniendo una vacuna para un virus. El hecho es que no lo estamos, estamos inyectando una secuencia de ARNm de proteína spike, que es una simulación por computadora, no se deriva de la naturaleza. Es una simulación por ordenador de una secuencia que se conoce y patenta desde hace años. Y lo que sabemos es que esa secuencia, como se informó, se informa a través de cosas como ustedes saben, las conversaciones telefónicas muy confiables que tuvieron lugar entre Moderna y el centro de investigación de vacunas por autoinforme, donde no sé si usted estaba en una llamada telefónica y escuchó ATTCCGGTTCCGABBB, ya sabes, ¿hay alguna posibilidad de que puedas obtener una carta de valor una consonante caída aquí o allá? La naturaleza ridícula de la historia de que esto es de alguna manera profiltivo o preventivo va en contra del 100 por ciento de la evidencia, porque la evidencia deja muy claro que no ha habido ningún esfuerzo por parte de ninguna compañía farmacéutica para combatir el virus. Se trata de conseguir que las personas se inyecten con la proteína espiga s1 que se sabe que es dañina. Así que la historia de portada es que si obtienes una expresión de una proteína espiga, vas a tener algún tipo de alivio sintomático general. Pero el hecho es que nunca ha habido una intención de vacunar a una población como la define el universo de vacunación. Y es importante, quiero decir, repasemos solo para que conste, cuando Anthony Fauci intentó desesperadamente que se publicaran algunas de sus citas, «vacunas de ARN sintético», la oficina de patentes le rechazó sus propias patentes. Y quiero leer lo que le dijo la oficina de patentes. Cuando el propio Anthony Fauci del NIAID pensó que podía obtener una vacuna similar al ARNm patentada como vacuna. Y aquí está la cita, «estos argumentos son persuasivos en la medida en que un péptido antigénico estimula una respuesta inmune que puede producir anticuerpos que se unen a un péptido o proteína específica, pero no es persuasivo en lo que respecta a una vacuna». Bien, esta es la oficina de patentes. No se trata de una especie de agencia de salud pública. Esta es la oficina de patentes. «La respuesta inmune producida por una vacuna debe ser algo más que una simple respuesta inmune, sino que también debe ser protectora. Como se señaló en la acción anterior de la Oficina, el arte reconoce que el término vacuna es un compuesto que previene la infección. El solicitante no ha demostrado que la vacuna reclamada instantáneamente cumpla ni siquiera con el estándar más bajo establecido en la especificación, y mucho menos con la definición estándar para ser operativa. En lo que respecta, por lo tanto, las reivindicaciones cinco, siete y nueve no están operativas, ya que la vacuna contra el VIH, que es en lo que estaba trabajando, no es una utilidad patentable». Así que el propio Anthony Fauci fue informado por la oficina de patentes, que lo que estaba proponiendo como una vacuna no cumple con el estándar patentable, el estándar legal o el estándar clínico.

    Prof. Martin Schwab 1:04:10

    Oh, ¿podemos traducir esto para nuestra audiencia? Esto podría ser muy importante.

    Reiner Fuellmich  1:04:20

    Por cierto, David, ese es nuestro amigo, Martin Schwab, el profesor Martin Schwab de, es nuestro asesor legal más importante de la Universidad de Bielefeld.

    Dr. David Martin 1:04:34

    Oh, cierto.

    Reiner Fuellmich  1:04:36

    Es muy inteligente. Lo sé, David sé que muchos de nuestros espectadores están realmente sorprendidos. Lo veo en las respuestas. Uno de nuestros espectadores es nuestro especialista en pruebas PCR, el profesor Kemera. Ella no puede creer lo que está pasando aquí.

    Dr David Martin  1:09:51

    Bueno, la triste y sobria ironía es que planteé estas cuestiones a partir de 2002, después del susto del ántrax, y la tragedia es que ahora estamos sentados en un mundo donde tenemos cientos de millones de personas a las que se les está inyectando una secuencia informática estimulante de patógenos, que se está vendiendo bajo lo que la oficina de patentes , lo que la profesión médica, y lo que la FDA y sus propias normas clínicas no sugerirían es una vacuna, pero al usar el término en realidad ahora estamos sometiendo a cientos de millones de personas a lo que se sabía que era en 2005 un arma biológica.

    Reiner Fuellmich  1:10:54

    Reiner traduce.

    Dr David Martin  1:11:44

    Así que obviamente tengo cientos de horas de estas cosas comprometidas con la memoria porque lo he estado haciendo durante dos décadas. Pero si tiene alguna pregunta, estaré encantado de responderlas.

    Reiner Fuellmich  1:11:55

    Estoy seguro de que va a haber cientos de preguntas, David. Vamos a estar en contacto. Creo que vas a ser inundado por la gente, por los correos electrónicos de la gente, etc. Solo voy a adelantar lo que entra o vamos a presentar lo que entra, pero creo que, oh, sí, tenemos un Martin Schwab, probablemente tiene una pregunta muy seria.

    Prof Martin Schwab  1:12:16

    Y después de mí Wolfgang también. Bien. Soy profesor de derecho en la Facultad de Derecho aquí en Bieldfeld, tengo que decirles que las Unidades de Protección Constitucional del Ministerio del Interior ahora observan la llamada escena negacionista de Corona. La negación de corona es todo aquel que se atreve a no estar de acuerdo con el –

    Reiner Fuellmich  1:12:54

    – con la línea oficial –

    Prof Martin Schwab  1:12:55

    – con la línea oficial. Sí. Ahora. Si esta Unidad de Protección Constitucional toma nota de que participe en una discusión de que esta pandemia se puso en escena intencionalmente, probablemente intentarán despedirme de mi trabajo. Así que al menos tengo que hacer algunas preguntas. Mientras te oía hablar, eché un vistazo al número de patente, oh, cuál era, 7220852 7151163. Y 7220852 se presentó el 12 de abril y 715 y así sucesivamente se presentó el 28 de abril de 2004. Veo una diferencia entre 16, no 3 días, ¿qué entendí mal?

    Dr David Martin  1:14:03

    No. ¿El 23 de abril de 2003 fue la fecha de presentación maestra de los CDC?

    Prof Martin Schwab  1:14:09

    Bien. Bien. Hice esta pregunta porque si tratan de hacerme bajar por mi trabajo, tengo que proporcionar pruebas sólidas.

    Dr David Martin  1:14:22

    Ahora tenemos todo esto enviado a, sé que el Dr. Fuellmich tiene todo el registro en el expediente fauci. El 100 por ciento de este registro está ahí. El apéndice adicional que envié a través de todos tiene los registros allí incluyendo todas las fechas de presentación de prioridad, así como la fecha de emisión. Así que el 100 por ciento de esto está en registros escritos publicados y ustedes tienen los registros escritos.

    Prof Martin Schwab  1:14:26

    Bien.

    Reiner Fuellmich  1:14:28

    He creado mi propio archivo, y está etiquetado como David Martin.

    Prof Martin Schwab  1:15:00

    Bueno, hay, hice [un] análisis de los informes de los medios aquí, y puedo confirmar que dan una cuenta muy unilateral sobre la pandemia. Todos los que se atreven a declarar que la amenaza es menos peligrosa que el gobierno serán denunciados como teóricos de la conspiración, pecaminosos, etc. Así que los medios de comunicación hicieron exactamente lo que usted señaló en la frase que repitió dos veces antes de ahora. En realidad, nos cuentan la historia de la variante Delta, que se dice que es mucho más contagiosa que todo lo demás. Los expertos con los que he hablado me dijeron que las bases de datos contienen hasta más o 40.000 cepas de virus.

    Dr David Martin  1:16:01

    correcto.

    Prof Martin Schwab  1:16:02

    Entonces, ¿podría esta variante delta ser algún tipo de bombo mediático del que nos hablaste antes?

    Dr David Martin  1:16:12

    No existe tal cosa como una alfa o una beta o una gamma o una variante delta. Este es un medio por el cual lo que se busca desesperadamente es un grado en el que los individuos puedan ser coaccionados para que acepten algo que de otra manera no aceptarían. No ha habido en ninguno de los estudios publicados sobre lo que se ha reportado la variante Delta, no ha habido una población no se calculan, que es la tasa de replicación real. Lo que se ha estimado son simulaciones por ordenador. Pero desafortunadamente, si nos fijamos en GISAID, que es la fuente pública de subir cualquiera de una serie de variaciones, lo que encontrarán es que no ha habido capacidad para identificar ninguna secuencia de genes clínicamente alterada, que luego tiene una variación clínicamente expresada. Y este es el problema desde el principio. Este es el problema que se remonta al comienzo de lo que se alega que es una pandemia, es que no tenemos ninguna evidencia de que la alteración de la secuencia genética tuviera importancia clínica alguna. No ha habido un solo artículo publicado por nadie que realmente haya establecido que cualquier cosa novedosa desde noviembre de 2019, tiene distinción clínica de cualquier cosa que sea anterior a noviembre de 2019. El problema con las 73 patentes que describí es que esas 73 patentes contienen lo que se informó que era novedoso en diciembre de 2019 y 2020, respectivamente. Así que el problema es que incluso si aceptáramos que hay neumonías idiopáticas, incluso si aceptáramos que hay algún conjunto de síntomas inducidos por patógenos, no tenemos una sola evidencia publicada que nos diga que cualquier cosa sobre el subclado SARS CoV 2 tiene distinción clínica de todo lo que se sabía y se publicó antes de noviembre de 2019 en 73 patentes que datan de 2008.

    Viviane Fischer  1:18:56

    ¿Podría ser que la variante Delta es que solo las diferencias, saben que los síntomas clínicos son los mismos, pero que tiene la capacidad de infectar a alguien que ya ha pasado por la variante B?

    Dr David Martin  1:19:14

    Bueno, aquí es donde vemos una enorme cantidad de respuesta y comportamiento reflexivo al bombo de los medios. No hay, y voy a repetir esto, no hay evidencia de que la variante Delta sea de alguna manera distinta de cualquier otra cosa en GISAID. El hecho de que ahora estemos buscando una cosa no significa que sea una cosa porque estemos viendo fragmentos de cosas. Y el hecho es que si elegimos cualquier fragmento que se me ocurrió, ya saben, podría llegar a la variante Omega mañana. Y podría llegar a la variante Omega y podría decir que estoy buscando esta subcatenía de ADN o ARN, o incluso una proteína. Y podía correr alrededor del mundo yendo, «oh, Dios mío, miedo a la variante Omega».

    Prof Martin Schwab  1:20:15

    Sí.

    Dr David Martin  1:20:16

    Y el problema es que debido a la naturaleza de la forma en que actualmente secuenciamos genomas, que en realidad es un proceso de composición, es lo que llamamos en matemáticas y entrelazado. No tenemos ningún punto de referencia para saber realmente si lo que estamos viendo es, de hecho, distinto del sentido clínico o incluso genómico. Y entonces estamos atrapados en un mundo donde desafortunadamente, si van y miran como yo los papeles que aislaron la variante Delta, y en realidad hacen la pregunta, ¿es la variante Delta algo más que la selección de una secuencia en un cambio sistemático de una otra secuencia ya revelada? La respuesta es, es sólo una alteración, y cuando se inicia y se detiene lo que se llama el marco de lectura. No hay nada novedoso. Sí, bueno

    Dr. Wolfgang Wodarg 1:21:20

    El Dr. Wolfgang Wodarg traduce.

    Reiner Fuellmich  1:28:41

    David, voy a hacer una larga historia muy corta. Él está totalmente de acuerdo con su análisis. Él entiende tu angustia con respecto a que le hayas dicho al mundo sobre esto hace 20 años, casi. Y admira su tenacidad. Y está muy agradecido por haber tomado esta mirada tan de cerca al problema a través de la ley de patentes. El Dr. Wodarg cree que las patentes son realmente problemáticas, porque resulta que probablemente sea cinco veces más caro patentar medicamentos, en lugar de tener universidades públicas, no públicas, privadas, sino públicas, que obtengan los estipendios obteniendo el dinero que necesitan para desarrollar estas vacunas.

    Dr David Martin  1:29:38

    Sí, voy a hacer algo que es muy injusto, pero voy a mantener el documento muy cerca de la pantalla. Y es sólo para fines de representación. Pero quiero que vean que esta es la patente del cuartel que los NIH necesitaban haberles devuelto por razones misteriosas en 2018, esta es la 7279327. Y la gente puede buscar esto por su cuenta. Pero si realmente miras las secuencias que están patentadas, que es una de las cosas que hemos hecho, en realidad miramos las secuencias publicadas, y nos damos cuenta de que dependiendo de dónde recortes la cadena de secuencia real, tendrás lo mismo o tendrás una cosa diferente basada nada más que en dónde decidas analizar el clip. Y quiero leerles, quiero decir, esto es algo que viene directamente de su solicitud de patente. Cuando en realidad hablan de las hebras de ADN, que llaman números de identificación de secuencia. En realidad, dicen específicamente que el organismo es una secuencia artificial, una secuencia artificial, lo que significa que no es una secuencia que tiene una base de reglas en la naturaleza, no es algo que se manifestó para una proteína derivada natural en particular o una secuencia de ARNm derivada natural que se aisló, cada una de ellas es de hecho una secuencia sintética y artificial. Y si volvemos atrás y miramos cada una de ellas, lo que hemos hecho, lo que encontraremos es que las secuencias, de hecho, son contiguas, en muchos casos, pero se superponen en otras, donde es simplemente una determinación de Capricho que dice que algo es o no es parte de un marco de lectura abierto, o es o no es parte de una secuencia de oligonucleótidos en particular. Ahora, la razón por la que eso es importante es porque si vamos a examinar lo que finalmente se está inyectando en los individuos, necesitamos la secuencia exacta, no un tipo de similar a, necesitamos la secuencia exacta. Y si nos fijamos en el requisito de la FDA, y si nos fijamos en el entorno regulatorio europeo, y si nos fijamos en el resto del entorno regulatorio del mundo, por razones que no se pueden explicar, la secuencia exacta que ha entrado en lo que se amplifica dentro de la inyección parece ser esquiva, parece ser algo que alguien no puede, de hecho, afirmar con 100 por ciento de certeza, la secuencia es x. El problema que esto presenta es que en este momento, por mucho que se nos pueda decir que hay, ya saben, ensayos clínicos en curso, y hay todo tipo de otras cosas sucediendo, no tenemos forma de verificar que una secuencia completa ha sido, es, o potencialmente incluso podría ser fabricada en lo que en última instancia se convierte en la nanopartícula lipídica que es la frecuencia portadora en la que se administra la inyección. Y es importante que la gente entienda que ya en 2002, y a lo largo de las solicitudes de patentes de 2003, y luego las patentes de armamentización que comenzaron en 2008, en cada uno de estos casos, se identifican fragmentos, pero se identifican sin especificidad. Así que no tenemos extremos terminales directos de los fragmentos, tenemos fragmentos que tienen, ya saben, brechas esencialmente hipotéticas en las que se puede colocar cualquier cosa. Y esa es la razón por la que encuentro que la verificación de hechos en torno a la situación de las patentes es muy decepcionante. Debido a que la razón por la que los verificadores de hechos entre sus atributos perezosos generales, la razón por la que los verificadores de hechos no están verificando realmente los hechos cuando se trata de los asuntos de patentes es porque las secuencias reales no están representadas en una forma digital que facilita hacer esta comparación. Literalmente, tuvimos que tomar imágenes de papel mecanografiado enviado, y luego codificarlas para hacer nuestra propia evaluación. No se puede hacer esto en el sitio de patentes de la OEP. No se puede hacer esto con los datos de la OMPI de Ginebra. No se puede hacer esto con los datos de la Oficina de Patentes de los Estados Unidos. En realidad tienes que entrar y reconstruir las secuencias genéticas reales a mano y luego compararlas con lo que se ha subido a los servidores públicos y ahí es donde encuentras que la cuestión de la novedad es algo que no se abordó. Era una ilusión fabricada.

    Dr Wolfgang Wodarg  1:35:03

    Tengo una pregunta más. ¿Es posible que veamos que la gripe ha desaparecido? Ya no tenemos gripe. La gripe seguro que los virus también están secuenciados. Y es posible que esas secuencias de partes de las que ahora hablamos puedan existir en ambos tipos de virus, de modo que es solo una cuestión de pruebas y [una] cuestión de instrumentos para observar lo que encontramos, si encontramos influenza o si encontramos Corona. Si tenemos un cierto, si usted tiene un libro, usted tiene una palabra con cinco letras, y usted encontrará estas cinco letras en muchos libros,

    Dr David Martin  1:35:49

    ¿Correcto? exactamente. Sí. Wolfgang, tu pregunta es una hermosa metáfora de exactamente el problema. El problema es que, si lo que estamos buscando es algo que hemos decidido que ha decidido que vale la pena buscar, entonces lo encontraremos. Y la buena noticia es que lo encontraremos [en] un montón de lugares. Y si hemos decidido que ya no estamos buscando nada, no es del todo sorprendente que no lo encontremos porque no lo estamos buscando. El hecho del asunto es si es las pruebas de PCR rt que decidimos que hay fragmentos, que por cierto, he mirado cada una de las presentaciones regulatorias, que se ha presentado a la FDA, para tratar de averiguar cuál era el estándar de oro para obtener la autorización de uso de emergencia. Y qué fragmento de SARS CoV 2 era oficialmente el fragmento oficial que era el estándar comparativo. Y el problema es que no se puede obtener un solo estándar. Así que la pregunta se convierte en, en un mundo donde no hay un estándar único, ¿qué es lo que realmente encuentras? Porque si estoy buscando y ¿por qué no acabo de leer esto? Si estoy buscando un CCACGCTTTG? ¿Agrego la siguiente hebra G o voy no, no, el siguiente bit es GTTTATTCG. Y entiendes el punto. El punto es que donde elijo comenzar y detenerme, puedo decir que lo encontré. No, no lo encontré.

    Dr Wolfgang Wodarg  1:37:33

    Sí.

    Dr David Martin  1:37:35

    Y no encontré la coincidencia que proyecté sobre los datos porque elegí mirar los datos de una manera que no pude encontrar la coincidencia. La gripe no abandonó a la población humana. La influenza fue un mandato fallido de una década de vacuna contra la influenza que fue promovido desesperadamente, desesperadamente por los gobiernos de todo el mundo, fracasaron y decidieron que si la influenza no cumple con la promesa pública de hacer que todos se inyecten, cambiemos el patógeno.

    Dr Wolfgang Wodarg  1:38:19

    Hay muchos más que pueden cambiar.

    Dr David Martin  1:38:21

    Oh, Dios mío, tenemos toneladas más por venir.

    Reiner Fuellmich  1:38:24

    Sí, pero ahora estamos en ellos.

    Viviane Fischer  1:38:27

    Me gustaría decirles algo sobre este desarrollo de la prueba PCR de drosten, ya saben, porque lo analizamos brevemente, no en la medida en que ahora miraron las patentes que acaban de describir, sino que observamos este tipo de milagro, o como quiero decir, aspecto extraño de como el desarrollo de la prueba de Drosten , porque él, a pesar del hecho de que habría necesitado básicamente, a través de su empleador, The Charite tendría derecho a tener las patentes sobre este, ya saben, su invento, acaba de publicar la instrucción a la casa (inaudible) para que todos pudieran verla. Así que básicamente, toda la invención perdió su posibilidad de ser patentada, y eso es un poco extraño, ya sabes, cuando lo miras, así que le pedimos a la Charita en una solicitud de ley de Libertad de Información, y entonces dijeron, Bueno, ya sabes, porque había mucha prisa por sacar la, ya sabes, esta prueba porque había esto –

    Reiner Fuellmich  1:39:34

    – pandemia en marcha –

    Viviane Fischer  1:39:34

    – pandemia en marcha, así que fue como, no miramos las finanzas, ya sabes, simplemente no nos importaba. Así que eso es un poco extraño como procedimiento, porque quiero decir, básicamente esta prueba vale como miles de millones, saben, cómo podrían, quiero decir, este es un hospital financiado con fondos públicos, cómo pueden dar, ya saben, regalar todo esto, y luego porque también estaba en estrecha cooperación con una empresa privada TIB Molbiol. Es el mismo con el que había desarrollado todas las pruebas PCR desde 2002 desde el primer SARS, y luego MERS, (inaudible) y así sucesivamente y así sucesivamente. Así que es muy extraño, ya saben, porque básicamente estaba como, funcionando como un abridor de puertas para esta compañía, ya saben, porque también nos dijeron, así que básicamente, fue Drosten quien decidió a qué posible país o como laboratorio o lo que sea la prueba, esta compañía TIB Molbiol enviaría los kits de prueba para luego, por supuesto, , ganar más dinero, porque él era básicamente como, tenía una ventaja de ser el primero en moverse, ya sabes, Drosten y o esta compañía. Así que está claro ahora, quiero decir, tal vez no había nada en ese momento, porque ya había muchas patentes en marcha. Así que básicamente, a partir de este virus no nuevo o una prueba PCR, no pudo patentar nada que hubiera sido nuevo. Así que, básicamente, era realmente como una cosa muy lógica para hacer entonces usar todo el asunto como un solo para, ya saben, obtener ganancias de esta ventaja de ser el primero en moverse. Y tal vez Drosten está de alguna manera involucrado en toda esta estafa legal, financiera –

    Reiner Fuellmich  1:41:16

    – oh, es una de las personas más importantes en este juego, porque él es el que está tirando de las cuerdas que tiraron primero.

    Dr David Martin  1:41:22

    Sí, necesitas crear la ilusión de la demanda, y no hay nada en este momento que haga un mejor trabajo de crear la ilusión de la demanda que la urgencia de un evento que has fabricado.

    Reiner Fuellmich  1:41:43

    Esto suena casi como comedia, pero no lo es.

    Dr David Martin  1:41:47

    Bueno, es en que tenemos que darnos cuenta de que parte de la razón por la que fue tan fácil para nosotros monitorear y rastrear esta campaña particular de coerción y terror es porque lo hemos hecho antes. Ya saben, comencé mis comentarios asegurándome de que la gente lo recordara cuando se trataba de resolver el brote de ántrax. Ahora recuerden, que mientras teníamos cientos de 1000 militares en Oriente Medio, supuestamente incluso por los acontecimientos de septiembre de 2001, teníamos dos inspectores postales investigando el ántrax. ¡Dos! El mayor ataque de supuestas pinzas biológicas en suelo estadounidense y tuvimos dos Inspectores Postales. No se puede creer genuinamente que dos Inspectores Postales son los, ya saben, el crimen que detiene, ya saben, individuos alucinantemente poderosos en el universo. Ahora no tengo nada en contra de los inspectores postales, pero puedo garantizarles que si estuviera investigando un ataque bioterroroso, no tendría la oficina de correos, teniendo dos inspectores postales como su equipo de crack, haciendo la investigación. Ya saben, era falso, y el Congreso lo sabía. Y esa es la razón por la que, ya saben, publicamos una cosa que no es necesariamente un éxito de ventas, pero publicamos un informe de inteligencia sobre cada violación de los tratados de armas biológicas y químicas que la gente ha firmado en todo el mundo. Y es una guía telefónica que te dice dónde y quién y quién está financiando, por lo que para nosotros no fue difícil entender que esto no era una crisis de salud pública. Esta fue una campaña de marketing oportunista para abordar un objetivo declarado, y es por eso que esto es una maquinilla de afeitar occams. Es lo más fácil de describir, porque son ellos los que lo establecen. Y la realidad es que dijeron que necesitaban que el público aceptara una contramedida de vacuna contra el Coronavirus, y que necesitaban que los medios crearan el bombo, y que los inversores siguieran donde vieran ganancias. Usted no tiene nada más en lo que deba confiar para explicar los eventos de los últimos 20 meses, que la declaración real del perpetrador real. Y no hago el ejercicio de mirarme el ombligo de entrar para tratar de entender si había problemas de mamá detrás de un ladrón de bancos si están sosteniendo una bolsa de dinero fuera de un banco. De hecho, hago la loca suposición de que tal vez son un ladrón de bancos. Del mismo modo, si tengo a alguien que dice que necesitamos usar los medios de comunicación para promocionar una contramedida médica, que es de hecho la inyección de una proteína quimérica sintética y recombinante desarrollada a partir de una simulación por computadora. Si realmente voy a escuchar la motivación de por qué eso podría estar haciéndose, voy a escuchar a la persona que hace la manipulación que dice que los inversores seguirán donde ven las ganancias? No necesito más explicación.

    Reiner Fuellmich  1:45:28

    Yo tampoco. Bueno, esto es alucinante. Estoy muy contento, David, [quiero decir] hablamos hace un par de meses, tal vez hace 3 o 4 meses, y nos presentó un David, lo siento, James Henry.

    Dr David Martin  1:45:52

    Correcto.

    Reiner Fuellmich  1:45:52

    Y estaba tratando de encontrar abogados de patentes en este país que pudieran estar interesados en este caso. Ahora, hay algunos abogados de patentes que lo entienden, pero aparentemente no hay nadie hasta ahora, pero tal vez esto va a cambiar. Pero no había nadie dispuesto a abordar esto en el contexto de Corona. Ese es el problema.

    Dr Wolfgang Wodarg  1:46:17

    Esto no es nuevo. He tratado de encontrar un abogado así para especializarme en patentes para la Comisión (inaudible) para el Bundestag alemán hace 10 años, o hace más de 15 años. Y no lo encontramos porque tenían miedo de ser críticos con el sistema. Destruirían su propio trabajo. Esto fue muy difícil.

    Reiner Fuellmich  1:46:38

    Sí, tenga en cuenta que este es un problema antiguo, porque ahí es donde entra el problema. Desde la creación de la Oficina Europea de Patentes, los alemanes y los franceses, como era de esperar, han mantenido la animosidad que, ya saben, ha sido solo esta nueva versión de la animosidad que se remonta a siglos atrás. Pero cuando se creó la OEP, el papel de la oficina de patentes de Múnich se convirtió en una cuestión muy nacionalista para Alemania. Y la noción de que los examinadores de patentes alemanes y los profesionales de patentes alemanes todavía gozaban de supremacía sobre el resto de Europa se volvió dogmática. En 2003, en 2004, cuando mi organización auditó por primera vez la Oficina Europea de Patentes, y en la que demostramos que entre el 20 y el 30 por ciento de las patentes en Europa eran falsificaciones funcionales, lo que significa que se copiaron de patentes anteriores, la representación alemana de la Oficina Europea de Patentes perdió la cabeza ante la idea de que estaban haciendo algo remotamente mal. Cuando la Unión Europea nos encargó un examen de las patentes de software unos años más tarde, a petición de la delegación sueca ante la Unión Europea, y mostramos cientos y cientos de patentes de software que fueron concedidas ilegalmente por la Unión Europea a través de la OEP. Y luego descubrimos que eran los examinadores de patentes alemanes y los profesionales de patentes alemanes los responsables de su presentación. Una vez más vimos que había una enorme protesta. Y lo que ocurre es que tenemos una posición dogmáticamente sostenida, que dice que aunque se supone que la Oficina Europea de Patentes es paneuropea, todavía hay en la mente del sistema de patentes alemán una supremacía sobre el resto de Europa. Y si pones en duda algo, incluidas las patentes concedidas sobre un arma biológica, estás pisando un terreno por el que no hay perdón.

    Dr Wolfgang Wodarg  1:49:09

    Sí. Teníamos algunas preguntas de Transparencia Internacional, y fuimos borrados; no se siguió el tema.

    Dr David Martin  1:49:17

    sí. Simplemente no se puede. No es accesible, y esa es solo la tragedia de lo que desafortunadamente se ha convertido en una organización de captura regulatoria. En realidad no está haciendo el servicio público.

    Reiner Fuellmich  1:50:24

    Reiner traduce.

    Dr David Martin  1:50:53

    Bueno, gracias por el tiempo que has pasado y espero que haya sido útil.

    Reiner Fuellmich  1:50:57

    Fue muy útil.

    Dr Wolfgang Wodarg  1:50:59

    Muy servicial, muchas gracias.

    Reiner Fuellmich  1:51:00

    Vamos a escuchar muchos ecos. Gracias David, y que tengas un gran fin de semana.

    Dr David Martin  1:51:07

    Bien, cuídense todos.

    Dr David Martin  1:51:08

    Sí, tú también. Adiós.

    Viviane Fischer  1:51:10

    Adiós.

    Dr Wolfgang Wodarg  1:51:11

    Adiós.

    Fuente: Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC – (covidtruths.co.uk)

    COVID19 – Evidencia de fraude global

    Iain Davis

    COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

    A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

    Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

    Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

    Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

    Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

    Al hacerlo, esta «clase de parásitos» ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

    ¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

    La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

    La orientación de la OMS en las pruebas de laboratorio establece:

    El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.»

    La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

    En el Informe de Situación 2019-nCovde la OMS, afirman:

    Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.»

    Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

    Sin embargo, la OMS también afirma:

    Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.»

    Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de «información de secuencia» porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

    Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

    Los virólogos afirman que no es posible «aislar» un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

    Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

    La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos «infectaron» varias células con el virus novedoso señalaron lo siguiente:

    Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.»

    Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

    Tomando nota de este problema, un equipo de científicos polacos introdujo este «virus» secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

    «No observamos ninguna liberación del virus del lado basolateral de la cultura HAE».

    Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

    No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

    VIAJE DE DESCUBRIMIENTO

    El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

    Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

    Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

    Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

    El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

    En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

    Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de «origen desconocido».

    Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

    Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.»

    La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

    Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba «ahí». Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

    Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

    AISLAR NADA

    Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

    Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

    En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

    «Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas»

    Esto explica por qué el estado del gobierno australiano:

    La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.»

    En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

    Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado».

    Hasta la fecha no han recibido una respuesta.

    Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

    PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.»

    La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

    Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.»

    En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

    … No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.»

    Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

    Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

    PRUEBAS PARA NADA

    La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

    Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

    Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del «virus». Estos incluyen:

    • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
    • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
    • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
    • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

    La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

    Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

    Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

    Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

    Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

    La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

    Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

    Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

    Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

    Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

    Usando una serie de argumentos de paja como, «esta afirmación sugiere que cada prueba debe ser positiva», (que no lo hace) su intento de desacreditación ejecuta algo como esto:

    Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

    Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

    Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

    Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

    «Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.»

    Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

    El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

    Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada «basura», ADN (ADNm).)

    Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

    No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

    Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

    Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

    FRAUDE CONCLUYENTE

    El fraude es un acto criminal. La definición legal de fraude es:

    «Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.»

    La definición legal de una conspiración es:

    «Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo»

    Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

    Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

    Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

    Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

    Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

    Para poder participar en su llamada «nueva normalidad», que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

    Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

    No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

    En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

    Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

    Los votos de Joe Biden violan la Ley de Benford

    O dicho de otra manera, la ley y las estadísticas de Benford demuestran (o como mínimo, digamos, es bastante sospechoso) que Trump ganó las elecciones de 2020.

    En los tres casos, los datos de Biden infringen la curva normal (puntos rojos). Los datos de Trump parecen estar bien.