Iglesias, Navalni, Rhodes y Soros

Cuatro apellidos y cinco nacionalidades. El paraguas de Soros, judío, cubre a los otros tres. Iglesias cubre al otro judío, Rhodes, de los de clase alta de la City londinense, con paraguas sin abrir. Iglesias le cierra el paraguas a Navalni, pero en realidad no le cubría la cabeza, órdago.

¿El problema? Putin no necesita paraguas. Borrell cree que la lluvia de Europa moja igual que la de Rusia. Cala más. El paraguas se le queda pequeño. Soros lo sabe. Abre dos cortes con una navaja. Siempre le interesó una Europa débil, resquebrajada, dividida.

Pero aquí rozan muchos paraguas, se saltan ojos. Soros contra Putin. A los dos les interesa la Europa fragmentada. Los dos ven bien el conflicto catalán. Aquí no se moja ninguno. A Iglesias le presta Soros un paraguas ruso, se cala hasta los hombros. Rhodes toca el piano.

Borrell, cuando no llueve, se cierra el paraguas. Putin juega sus cartas. ¿A qué no sabes qué carta del tarot le han tirado? El paraguas. -¡Pero esa no existe! -Y menos de seis puntas. Tampoco se abre en un sitio cerrado. Ahí sólo se toca el piano.

Llueve en Europa, se empapa España. Se necesita paragüero. Siempre España. Abre las cartas, cierra el paraguas, suenan dos pianos a ocho manos pertenecientes a Soros, digo los pianos, no las manos ¿o sí?. Y suena una balalaika.

Y se hace la melodía.


Iglesias, Navalni, Rhodes y Soros

Four surnames and five nationalities. Soros’s umbrella, a Jew, covers the other three. Iglesias covers the other Jew, Rhodes, of the upper class of the London City, with unopened umbrellas. Iglesias closes Navalni’s umbrella, but it wasn’t really covering his head, hell.

The problem? Putin does not need an umbrella. Borrell believes that Europe’s rain is just as wet as Russia’s. He seeps more. The umbrella is too small for him. Soros knows it. He opens two cuts with a razor. He was always interested in a weak, cracked, divided Europe.

But here many umbrellas touch, eyes pop. Soros against Putin. They are both interested in fragmented Europe. They both see the Catalan conflict well. None of them get wet here. Iglesias lends Soros a Russian umbrella, sinks down to his shoulders. Rhodes plays the piano.

Borrell, when it doesn’t rain, closes the umbrella. Putin plays his cards. Don’t you know what tarot card they have thrown? The umbrella. -But that doesn’t exist! -And less than six points. Nor does it open in a closed place. There you only play the piano.

It rains in Europe, Spain is soaked. Umbrella stand is needed. Always Spain. He opens the cards, closes the umbrella, two eight-handed pianos belonging to Soros are playing, I mean the pianos, not the hands, right? And a balalaika sounds.

And the melody is made.

Tribunal Portugués: Pruebas PCR “poco fiables” y Cuarentenas “Ilegales”

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de “alto riesgo de infección” basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.


La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.

Ex funcionarios “bipartidistas” de Washington insertos en el mundo privado revelaron su plan para desatar el caos si Trump gana las elecciones.

Un grupo de republicanos neoconservadores “bipartidistas” y demócratas del establishment han “simulado” múltiples escenarios de catástrofe para la elección de 2020, incluyendo una simulación en donde una clara victoria del titular provoca medidas “sin precedentes”, la cual podría ser tomada por la campaña de Biden para frustrar una nueva llegada al poder de Trump.

Por Whitney Webb 

Un grupo conformado por exfuncionarios de Gobierno insertos en el mundo privado del Partido Demócrata, por exfuncionarios de la era de Obama y Clinton y también por una facción de republicanos neoconservadores del movimiento “Nunca Trump” han realizado, durante los últimos meses, simulaciones y “juegos de guerra” sobre los diferentes escenarios apocalípticos de la elección de 2020. 

Según varios informes de los medios sobre el grupo, llamado Proyecto de Integridad en la Transición” (TIP, por su sigla en inglés), justifican estos ejercicios como una preparación específica para un escenario donde el presidente Trump pierde la elección del 2020 y se niega a dejar el poder, lo que causaría una posible crisis constitucional. Sin embargo, según documentos propios del TIP, incluso sus simulaciones que implican una “victoria clara”  para Trump en la próxima elección podrían causar una crisis constitucional, tal como predijeron la campaña de Biden, la cual haría movimientos atrevidos para asegurar la presidencia, sin importar el resultado de la elección.  

Esto es particularmente alarmante, dado que TIP tiene vínculos importantes con el gobierno de Obama, en donde Biden fue vicepresidente, así como con varios grupos que están fuertemente a favor de Biden, además de su campaña misma. En efecto, el hecho de que un grupo de exfuncionarios de gobierno insertos en el mundo privado que apoyan abiertamente a Biden hayan creado escenarios para posibles resultados electorales y sus consecuencias, todos terminando en Biden llegando a la presidencia o en una crisis constitucional, indica que fuerzas poderosas que influencian a la campaña del candidato demócrata lo impulsan a negarse de conceder la elección, incluso si la pierde.

Por supuesto, esto debilita gravemente la afirmación de TIP de garantizar la “integridad” en el proceso de transición presidencial y en cambio, indica que el grupo planea abiertamente la manera de asegurar que Trump deje la presidencia sin importar el resultado o la forma de fabricar la propia crisis constitucional que el grupo dice prevenir a través de sus simulaciones. 

Dichas preocupaciones se amplían por las recientes afirmaciones hechas por la candidata presidencial del 2016 del Partido Demócrata y ex secretaria de Estado del gobierno de Obama, Hillary Clinton, que dicen que Biden “no debe ceder bajo ninguna circunstancia”. “Creo que esto se prolongará, y creo que ,eventualmente, él ganará si no cedemos ni un centímetro, y si es que estamos igual de concentrados e implacables que el otro lado”, indicó Clinton en una entrevista con Showtime en septiembre.  El resultado de las simulaciones del TIP ha hecho un eco importante a las afirmaciones de Clinton de que Biden “eventualmente” ganará si el proceso para determinar el resultado de las elecciones se “prolonga”.

Los juegos de guerra unipartidistas

Los miembros del TIP se reunieron en junio para realizar cuatro “juegos de guerra” que simularon unas oscuras 11 semanas entre el día de la elección y la investidura presidencial en las cuales “Trump y sus aliados republicanos usaron todos los aparatos del gobierno, como el Servicio Postal, legisladores del Estado, el Departamento de Justicia, agentes federales y los militares, para mantenerse en el poder y los demócratas se tomaron las cortes y las calles para tratar de detenerlos”, según un informe de The Boston Globe.Sin embargo, una de estas simulaciones que examinó lo que podría ocurrir entre el día de la elección y el día de la investidura presidencial si Trump obtiene una “victoria clara”, mostró que el TIP no solamente simuló como los republicanos pueden usar todo lo que tengan a su disposición para “mantenerse en el poder”, también simuló cómo los demócratas podrían hacer lo mismo si no ganan la elección del 2020.

Si bien, algunos medios de comunicación principalmente de derecha, como este artículo de The National Pulse, señalaron que las simulaciones del TIP involucran a la campaña de Biden negándose a ceder, el documento del TIP sobre las maniobras reveló que se tomarán acciones específicas por parte de la campaña de Biden luego de que la campaña de Trump obtuviese una “victoria clara”. Como no es de extrañar, estas acciones podrían agravar las tensiones políticas actuales en los Estados Unidos, un resultado final que el TIP afirma que ellos fueron creados para evitarlo, lo que debilita la justificación oficial para sus simulaciones, junto con la razón oficial para la existencia del grupo.

En el escenario del TIP que muestra una victoria clara de Trump (véase la página 17), Joe Biden, dirigido en el juego de guerra por John Podesta, el director de la campaña del 2016 de Hilary Clinton, se retractó de su concesión de la noche de las elecciones y posteriormente convenció a “tres estados con gobernadores demócratas (Carolina del Norte, Wisconsin y Michigan) para que pidieran recuentos” Luego, los gobernadores de Wisconsin y Michigan “envió listas separadas de electores para contrarrestar a los enviados por la legislatura estatal” al Colegio Electoral, en donde Trump había ganado, en un intento de debilitar, si no evitar, esa victoria.

Luego, “la campaña de Biden alentó a los estados del oeste, particularmente a California, pero también a Oregon y Washington, que colectivamente se conocen como “Cascadia”, a separarse de la Unión a menos que los republicanos del Congreso accedieran a hacer un conjunto de reformas estructurales. (de una manera enfática)”. Posteriormente “aconsejado por el ex presidente Obama”, la campaña de Biden estableció esas “reformas” de la siguiente manera:

  1. Otorgar condición de Estado a Washington, DC y Puerto Rico.
  2. Dividir a California en cinco estados “para representarlos en el Senado de una manera mucho más fiel a su población.
  3. Exigir que los jueces de la Corte Suprema se jubilen a los 70.
  4. Eliminar el Colegio Electoral

En otras palabras, éstas “reformas estructurales” implican la creación de lo que esencialmente equivale a tener a Estados Unidos compuesto por 56 estados, con los nuevos estados establecidos para asegurar una mayoría continua para los demócratas, ya que sólo las áreas con una mayoría demócrata (DC, Puerto Rico y California) reciben la estatidad. Destacadamente, en otros escenarios donde Biden gana el Colegio Electoral, los demócratas no apoyaron su eliminación. 

También es destacado el hecho de que, en esta simulación, el TIP culpó a la campaña de Trump por la decisión de los demócratas por haber tomado “acciones provocativas y sin precedentes” expuestas anteriormente, al afirmar que tal campaña había “creado las condiciones para forzar a que la campaña de Biden” tome estas acciones al hacer ciertas cosas, como dar “una entrevista” a The Intercept en donde Trump indicó que el habría perdido la elección si es que Bernie Sanders hubiese sido nominado” como candidato presidencial demócrata, en vez de Biden.  

El TIP también afirmó que la campaña de Trump buscaría pintar estas “acciones provocativas y sin precedentes” como “un intento de los demócratas de intentar orquestar un golpe de estado ilegal”, a pesar de que eso es esencialmente lo que implican todas estas acciones. De hecho, otras simulaciones en donde la campaña de Trump se comportó en esta línea, la retórica del TIP sobre esta categoría de acciones extremas es claramente diferente.

Sin embargo, las acciones simuladas de la campaña de Biden en este escenario no terminaron allí. Posteriormente la campaña de Biden “provocó un colapso en la sesión conjunta del Congreso (el 6 de enero) al lograr que la Cámara de Representantes acordara otorgarle la presidencia a Biden”, y agregó que esto se” basó en las presentaciones alternativas con apoyo a Biden enviada a los gobernadores que apoyan al ex vicepresidente. Obviamente, el Partido Republicano no consintió e indicó que Trump había ganado la elección a través de su victoria en el Colegio Electoral. En la simulación de la “victoria clara de Trump” terminó con ningún presidente electo para la investidura del 20 de enero, con el TIP indicando que “no está claro lo que harían los militares en esta situación”. 

Por supuesto que algunos miembros de TIP, incluyendo a la cofundadora Rosa Brooks, ex-consejera del Pentágono en la era de Obama y actual miembro del think tank “New America”, tienen su preferencia en “que harían los militares en esta situación.” Por ejemplo, Brooks,  escribiendo 2 semanas después de la investidura de Trump del año 2017, explicó en Foreign Policy que “un golpe militar o al menos una negación de ciertas órdenes de parte de los militares” fue una de las cuatro posibilidades de remover a Trump del mandato previa a la elección del 2020.

¿Quién está detrás del TIP?

El TIP se creó a fines del año 2019 supuestamente “debido a la preocupación de que la Administración de Trump pueda manipular, ignorar, debilitar o interrumpir las elecciones presidenciales del 2020 y su proceso de transición.  Fue cofundado por Rosa Brooks junto con Nils Gilman y su actual directora es Zoe Hudson.  Brooks, como se mencionó previamente, fue consejera para el Pentágono y para el Departamento de Estado dirigido por Hilary Clinton durante el gobierno de Obama. Rosa también formó parte del consejo general del presidente del Instituto Open Society (OSF, por su sigla en inglés), una organización polémica financiada por el multimillonario George Soros. Zoe Hudson, directora del TIP, también es una figura importante en el OSF desempeñándose como analista política superior y enlace entre las fundaciones y el gobierno de los Estados Unidos por 11 años.

Los vínculos del OSF con el TIP son una bandera roja por un número de razones, concretamente debido al hecho de que el OSF y otras organizaciones financiadas por Soros tuvieron un rol fundamental en fomentar las llamadas “revoluciones de colores” para derrocar a gobiernos no alineados, particularmente durante el gobierno de Obama. Ejemplos de vínculos del OSF con todas estas “revoluciones” fabricadas, incluyendo la de Ucrania en el 2014y la “Primeravera Arabe,” que empezó el año 2011 y vio a varios gobiernos en el Medio Oriente y África del Norte que eran problemáticos para los intereses occidentales convenientemente quitados del poder.  

Unos correos filtrados posteriormente revelaron los estrechos vínculos entre Soros y la ex-secretaria de Estado Hilary Clinton, incluyendo un correo electrónico en el que Soros dirigió la política de Clinton al respecto de los disturbios en Albania, diciéndole que “se necesitan hacer dos cosas urgentemente” que eran “hacer que todo el peso de la comunidad internacional recaiga sobre el primer ministro Berisha” y “nombrar a un alto funcionario europeo como mediador”. Ambas tareas “urgentes” fueron perpetradas posteriormente por Clinton, posiblemente, a petición de Soros.

Además de sus vínculos con el gobierno de Obama y el OSF, Brooks es actualmente una académica en el  Instituto de Guerra Moderna de la Academia Militar de West Point, en donde se enfoca en “la relación entre los militares y la política interna” y también en el Programa de Innovación y Liderazgo de la Universidad de Georgetown. Actualmente ella es un actor clave en el empuje liderado por OSF para “capitalizar” los llamados legítimos de la reforma policial para justificar la creación de una policía federalizada con el pretexto de retirar fondos o eliminar departamentos de policía locales. El interés de Brooks por la “difusa línea” entre los militares y la policía es importante dado por su defensa pasada hacia un golpe militar para remover a Trump del mandato y la conclusión posterior del TIP que los militares “podrían” intervenir si Trump logra ganar la elección del 2020, según los “juegos de guerra” del grupo descritos con anterioridad.

Brooks también es una alta miembro del think tank New America. La declaración de misión de New America señala que la organización está enfocada en “enfrentar de forma honesta los desafíos causados por el rápido cambio tecnológico y social, y aprovechar las oportunidades que esos cambios crean”. Está financiado en gran parte por multimillonarios de Silicon Valley, incluidos Bill Gates (Microsoft), Eric Schmidt (Google), Reid Hoffman (LinkedIn), Jeffrey Skoll y Pierre Omidyar (eBay). Además, ha recibido millones directamente del Departamento de Estado de los EE. UU. para investigar la “clasificación de los derechos digitales”. En particular, de estos patrocinadores, Reid Hoffman fue sorprendido “entrometiéndose” en las primarias demócratas más recientes para debilitar la candidatura de Bernie Sanders durante el Caucus de Iowa y mientras otros, como Eric Schmidt y Pierre Omidyar, son conocidos por sus estrechos vínculos con la familia Clinton e incluso por vínculos con la campaña de Hillary Clinton en 2016.

Los nunca trumpistas

Además de Brooks, el otro cofundador de TIP es Nils Gilman, quien es el actual vicepresidente de proyectos del Instituto Berggruen y que antes trabajó para Salesforce, una importante empresa contratista gubernamental y de tecnología. Gilman está particularmente enfocado en la inteligencia artificial y el transhumanismo. De hecho, hace poco le dijo al New York Times que su trabajo en el Instituto Berggruen se centra en “construir [unas] redes transnacionales de filósofos + tecnólogos + políticos + artistas que están pensando en cómo las IA y la edición de genes están transfigurando lo que significa ser un humano”. Nicholas Berggruen, quien le da su nombre al Instituto Berggruen, es parte de la facción liderada por multimillonarios, junto con Steve Schwarzman y Eric Schmidt de Blackstone. Todos ellos buscan desarrollar las IA y la llamada “Cuarta Revolución Industrial” en conjunto con los líderes políticos y la élite económica de China.

Ellos critican y rivalizan con aquellos en el bando “nacionalista” con respecto a las IA y China, el cual prefiere “ignorar” de forma agresiva las capacidades del país asiático en cuanto a las IA, con el objetivo de mantener la hegemonía global de Estados Unidos frente a un “nuevo orden” promovido por Berggreun, Schmidt, Schwarzman y Henry Kissinger, otro miembro clave de la facción de la “cooperación”. La batalla por la futura política estadounidense de IA con respecto a China parece ser una de las razones principales, aunque enormemente ignorada, de la antipatía que los miembros de la facción de la “cooperación” le tienen a Trump, incluidos los que contratan a los fundadores del TIP. Esto se debe a la tendencia del presidente de los EE. UU. a apoyar, al menos de forma pública, las políticas “America First” y de aumentar las tensiones con China. Por el contrario, la familia Biden invierte en las empresas chinas de IA, lo que indica que Biden estría más dispuesto en seguir los intereses de la facción de la “cooperación” que los de Trump.

Si bien las identidades de los fundadores y el actual director del TIP se han hecho públicas, su lista completa de miembros es desconocida. Sin embargo, la organización “hermana” del TIP, llamada Grupo de Trabajo Nacional sobre Crisis Electorales (NTFEC, por sus siglas en inglés), cuenta con una lista pública de sus miembros y también se sabe que varios de ellos son miembros de TIP. Algunos de estos miembros coincidentes son Michael Chertoff, exjefe del Departamento de Seguridad Nacional (DHS, por sus siglas en inglés), Michael Steele, ex presidente del Comité Nacional Republicano, y Lawrence Wilkerson, jefe de gabinete del exsecretario de Estado, Colin Powell. Chertoff, Steele y Wilkerson, a pesar de ser republicanos, son parte del movimiento llamado “Nunca Trump”, al igual que otros conocidos miembros del TIP que son del mismo partido. Por lo tanto, si bien la naturaleza “bipartidista” del TIP puede se precisa en términos de afiliación partidaria, todos sus miembros conocidos, independiente de su partido, están unidos por su oposición a otro mandato del actual presidente.

Otros miembros conocidos del TIP son David Frum (the Atlantic), William Kristol (Proyecto para el Nuevo Siglo Estadounidense, The Bulwark), Max Boot (the Washington Post), Donna Brazile (ex-CND), John Podesta (es director de campaña de Clinton en 2006), Chuk Hagel (ex Secretario de Defensa), Reed Galen (cofundador del Proyecto Lincoln) y Norm Ornstein (American Enterprise Institute).

De sus miembros más conocidos, el más directo es Lawrence Wilkerson, quien se ha convertido a sí mismo en el portavoz “no oficial” del grupo, al haber hecho la mayoría de las entrevistas con los mediosdonde le hizo promoción al grupo y sus “juegos de guerra”. En una entrevista a finales de junio con el periodista Paul Jay, Wilkerson señala que el TIP carece de transparencia y que, además de sus “juegos de guerra”, sus otras actividades son en gran parte confidenciales.

Específicamente declaró que:

“Existe cierta confidencialidad sobre lo que acordamos hacer público, lo que hemos hecho público y quien es el responsable de eso, y otros aspectos de nosotros haciendo eso. Hasta este punto el Proyecto de Integridad de Transición es muy, muy cercano, completo y confidencial”.

En esa misma entrevista, Wilkerson también señaló que la actual “combinación de eventos” que involucran los recientes disturbios en varias ciudades de Estados Unidos, la crisis del coronavirus, el debate nacional sobre la vigilancia policial, la recesión económica y las elecciones de 2020 fueron la base para una revolución en los EEUU. Él le dijo a Jay que:

 “Quiero decir que así es como son las cosas, como 1917 y Rusia, como 1979 y Teherán y como 1789 en Francia. Así es como comienzan este tipo de cosas. Así que debemos tener mucho cuidado con la forma en la que tratamos con estos asuntos. Y eso me preocupa porque no tenemos un individuo muy cuidadoso en la Casa Blanca”.

Caos preplanificado: ¿quién se beneficia?

Si bien es realmente posible que en caso de una clara victoria de Biden, el presidente Trump puede negarse a dejar la Casa Blanca o tomar otras acciones que desafíen la fe de muchos estadounidenses en el sistema electoral nacional. Sin embargo, aunque en el TIP afirman que están específicamente preocupados de esta eventualidad y de “salvaguardar” la democracia sin favorecer a ninguno de los candidatos, claramente no es el caso, ya que su simulación de una clara victoria de Trump muestra ese comportamiento extremo y “antidemocrático”, en su opinión tal comportamiento es permisible si evita otros cuatro años de Trump en el mandato. Sin embargo, este claro doble estándar revela que un grupo influyente de ex funcionarios “bipartidistas” de gobierno insertos en el sector privado tiene la intención de crear una “crisis constitucional” si Trump gana y están planeando una crisis similar independientemente de los resultados de las elecciones de 2020.

Mucho antes de que surgiera el TIP o cualquiera de sus grupos afiliados para realizar estas simulaciones electorales apocalípticas, otros grupos participaron de forma similar en “juegos de guerra” que predijeron un completo caos en los Estados Unidos el día de las elecciones, así como la imposición de la ley marcial seguida de la aparición de disturbios y desórdenes sin precedentes en el país.

Varios de estos los detallé en una serie a principios de este año, donde me enfoque  principalmente en las simulaciones de la “Operación Blackout” realizadas por la empresa estadounidense-israelí Cybereason. Esa empresa tiene vínculos considerables con la inteligencia estadounidense e israelí y su mayor inversor es Softbank. En particular, Softbank es nombrado por la Comisión de Seguridad Nacional sobre IA de los EE. UU. (NSCAI, por su sigla en inglés) liderada por Eric Schmidt como la “columna vertebral” de un marco global de empresas impulsadas por IA favorecidas por la facción de la “cooperación” como un medio para promulgar la “Cuarta Revolución Industrial” en colaboración con la élite económica y política de China.

Además de Cybereason, varios informes de los principales medios de comunicación y una serie de “predicciones” sospechosas de la inteligencia de los Estados Unidos y otras agencias federales publicadas el año pasado habían sembrado la narrativa que las elecciones de 2020 no solo fracasarían de forma espectacular, sino que la democracia estadounidense “nunca se recuperaría”. Actualmente, con las simulaciones del TIP agregadas a la mezcla y el advenimiento del caos previamente predicho en todo el país con las próximas elecciones de 2020, está claro que las elecciones del 3 de noviembre no solo serán un completo desastre, sino que eso estaba planificado de antemano.

La pregunta entonces es, ¿quién se beneficia del caos total durante y después de las elecciones de 2020? Como señaló el TIP en varias de sus simulaciones, el papel poselectoral de los militares en términos de vigilancia nacional. Por cierto, la experiencia exacta de la cofundadora del TIP, Rosa Brooks, cobra gran importancia, ya que la mayoría de las simulaciones electorales apocalípticas antes mencionadas terminaron con la imposición de la ley marcial o la intervención de los militares para volver al orden y supervisar la transición.

El marco nacional para imponer la ley marcial en los EE. UU., a través de los protocolos de “continuidad del gobierno”, se activó a principios de este año bajo el disfraz de la crisis del coronavirus y sigue en vigor. Actualmente, una serie de grupos profundamente ligados al establishment de Washington, las agencias de inteligencia nacionales y extranjeras han predicho las formas exactas para diseñar una elección fallida y manipular sus consecuencias.

¿Quién sería el más beneficiado con la imposición de la ley marcial en los Estados Unidos? Yo diría que uno no necesita mirar más allá de la batalla dentro de las facciones de poder de Washington sobre el futuro de las IA, tema que el sector público, privado y los prominentes think tank consideraron de importancia crítica para la seguridad nacional. La NSCAI liderada por Schmidt y otros organismos que determinan las políticas sobre IA del país planean implementar una serie de políticas a las que la mayoría de los estadounidenses se resistirán, estas van desde la eliminación de la propiedad individual de automóviles hasta la eliminación del dinero en efectivo, así como la imposición de sistema de vigilancia orwelliana, entre otras cosas.

Todas estas agendas han avanzado bajo el disfraz de combatir el coronavirus, pero su progreso sólo puede seguir usando esa justificación durante un tiempo. Para grupos como la NSCAI, los estadounidenses deben dar la bienvenida a estos avances impulsados por las IA, incluso si eso significa que los ciudadanos se enfrentan a perder sus trabajos o sus libertades civiles. De lo contrario, estos grupos y sus multimillonarios patrocinadores argumentan que a Estados Unidos se le “dejará fuera” y se le “dejará atrás” cuando llegue el momento de establecer los nuevos estándares globales para la tecnología de las IA, ya que la creciente industria de IA de China, la cual se alimenta de su propia implementación de estas tecnologías, superará a la de EE. UU. Al mantener a los estadounidenses enojados y distraídos por la división partidista a través del caos electoral preplanificado, un “Nuevo Estados Unidos” espera entre bastidores, uno que se avecina independientemente de lo que suceda el día de las elecciones. Por su puesto, eso pasará a menos de que los estadounidenses se den cuenta de la treta.

Autor: Whitney Webb

Whitney Webb ha sido escritora profesional, investigadora y periodista desde 2016. Ha escrito para varios sitios web y, de 2017 a 2020, fue escritora y reportera senior de investigación para Mint Press News. Actualmente escribe para The Last American Vagabond.

Arzobispo Viganò: Carta abierta a Donald Trump, advierte sobre el “Gran Reinicio”.


Domingo, 25 de octubre de 2020


Permítanme dirigirme a ustedes en esta hora en la que el destino de todo el mundo está siendo amenazado por una conspiración global contra Dios y la humanidad. Os escribo como arzobispo, como Sucesor de los Apóstoles, como antiguo nuncio apostólico en los Estados Unidos de América. Os escribo en medio del silencio de las autoridades civiles y religiosas. Que acepten estas palabras mías como la “voz de uno que grita en el desierto” (Jn 1, 23).

Como dije cuando les escribí mi carta en junio, en este momento histórico las fuerzas del Mal se alinean en una batalla sin cuartel contra las fuerzas del Bien; fuerzas del Mal que parecen poderosas y organizadas al oponerse a los hijos de la Luz, que están desorientados y desorganizados, abandonados por sus líderes temporales y espirituales.

Todos los días sentimos que los ataques se multiplican de aquellos que quieren destruir la base misma de la sociedad: la familia natural, el respeto por la vida humana, el amor al país, la libertad de educación y de los negocios. Vemos a los jefes de naciones y líderes religiosos atorándose a este suicidio de la cultura occidental y su alma cristiana, mientras que los derechos fundamentales de los ciudadanos y los creyentes son negados en nombre de una emergencia de salud que se está revelando cada vez más plenamente como instrumental para el establecimiento de una tiranía inhumana sin rostro.

Un plan global llamado Gran Reinicio está en marcha. Su arquitecto es una élite global que quiere someter a toda la humanidad, imponiendo medidas coercitivas con las que limitar drásticamente las libertades individuales y las de poblaciones enteras. En varias naciones este plan ya ha sido aprobado y financiado; en otros todavía está en una etapa temprana. Detrás de los líderes mundiales que son los cómplices y ejecutores de este proyecto infernal, hay personajes sin escrúpulos que financian el Foro Económico Mundial y el Evento 201,promoviendo su agenda.

El propósito del Gran Reinicio es la imposición de una dictadura de la salud con el objetivo de la imposición de medidas liberticidas, ocultas detrás de tentadoras promesas de asegurar un ingreso universal y cancelar la deuda individual. El precio de estas concesiones del Fondo Monetario Internacional será la renuncia a la propiedad privada y la adhesión a un programa de vacunación contra Covid-19 y Covid-21 promovido por Bill Gates con la colaboración de los principales grupos farmacéuticos. Más allá de los enormes intereses económicos que motivan a los promotores del Gran Restablecimiento,la imposición de la vacunación irá acompañada de la exigencia de un pasaporte sanitario y un DNI digital, con el consiguiente rastreo de contactos de la población de todo el mundo. Aquellos que no acepten estas medidas serán confinados en campos de detención o puestos bajo arresto domiciliario, y todos sus bienes serán confiscados.

Señor Presidente, me imagino que ya es consciente de que en algunos países se activará el Gran Restablecimiento entre finales de este año y el primer trimestre de 2021. Para ello, se prevén nuevos bloqueos, que se justificarán oficialmente con una supuesta segunda y tercera oleada de la pandemia. Ustedes son muy conscientes de los medios que se han desplegado para sembrar pánico y legitimar las limitaciones draconianas a las libertades individuales, provocando artísticamente una crisis económica mundial. En las intenciones de sus arquitectos, esta crisis servirá para que el recurso de las naciones al Gran Reinicio sea irreversible, dando así el golpe final a un mundo cuya existencia y muy memoria quieren cancelar por completo. Pero este mundo, señor Presidente, incluye personas, afectos, instituciones, fe, cultura, tradiciones e ideales: personas y valores que no actúan como autómatas, que no obedecen como máquinas, porque están dotados de un alma y un corazón, porque están unidos por un vínculo espiritual que extrae su fuerza de arriba, de ese Dios que nuestros adversarios quieren desafiar, tal como Lucifer hizo al principio de los tiempos con “suno serma”.

Muchas personas, como bien sabemos, están molestas por esta referencia al choque entre el Bien y el Mal y el uso de matices “apocalípticos”, que según ellos exaspera espíritus y agudiza las divisiones. No es de extrañar que el enemigo se enoje por ser descubierto justo cuando cree que ha llegado a la ciudadela que busca conquistar sin perturbaciones. Lo sorprendente, sin embargo, es que no hay nadie que haga sonar la alarma. La reacción del estado profundo a quienes denuncian su plan está rota e incoherente, pero comprensible. Justo cuando la complicidad de los medios de comunicación convencionales había logrado hacer la transición al Nuevo Orden Mundial casi indoloro y desapercibido, todo tipo de engaños, escándalos y crímenes están saliendo a la luz.

Hasta hace unos meses, era fácil desprestigorarse como “teóricos de la conspiración” aquellos que denunciaron estos terribles planes, que ahora vemos que se llevan a cabo hasta el más mínimo detalle. Nadie, hasta el pasado mes de febrero, hubiera pensado que, en todas nuestras ciudades, los ciudadanos serían arrestados simplemente por querer caminar por la calle, respirar, querer mantener sus negocios abiertos, querer ir a la iglesia el domingo. Sin embargo, ahora está sucediendo en todo el mundo, incluso en la Italia de postales que muchos estadounidenses consideran un pequeño país encantado, con sus monumentos antiguos, sus iglesias, sus ciudades encantadoras, sus pueblos característicos. Y mientras los políticos están atrincherados dentro de sus palacios promulgando decretos como sátrapas persas, las empresas están fallando, las tiendas están cerrando y se impide que la gente viva, viaje, trabaje y ore. Las desastrosas consecuencias psicológicas de esta operación ya se están viendo, comenzando con los suicidios de empresarios desesperados y de nuestros hijos, segregados de amigos y compañeros de clase, que se les dice que sigan sus clases mientras se sientan en casa solo frente a una computadora.

En la Sagrada Escritura, san Pablo nos habla de “el que se opone” a la manifestación del misterio de la iniquidad,el kath-kon (2 Tes 2, 6-7). En el ámbito religioso, este obstáculo para el mal es la Iglesia, y en particular el papado; en el ámbito político, son los que impiden el establecimiento del Nuevo Orden Mundial.

Como ahora está claro, el que ocupa la Cátedra de Pedro ha traicionado su papel desde el principio para defender y promover la ideología globalista, apoyando la agenda de la iglesia profunda, que lo eligió de sus filas.

Señor Presidente, usted ha declarado claramente que desea defender a la nación : Una Nación bajo Dios,libertades fundamentales y valores innegociables que se niegan y luchan contra hoy. Eres tú, querido Presidente, quien es “el que se opone” al estado profundo, el asalto final de los hijos de las tinieblas.

Por esta razón, es necesario que todas las personas de bien sean persuadidas de la importancia de la época de la inminente elección: no tanto por el bien de este o de ese programa político, sino por la inspiración general de vuestra acción que mejor encarna , en este contexto histórico particular, ese mundo, nuestro mundo, que quieren cancelar por medio del encierro. Vuestro adversario es también nuestro adversario: es el enemigo de la raza humana, el que es “un asesino desde el principio” (Jn 8, 44).

A tu alrededor están reunidos con fe y coraje aquellos que te consideran la guarnición final contra la dictadura mundial. La alternativa es votar por una persona que es manipulada por el estado profundo, gravemente comprometida por escándalos y corrupción, que hará a los Estados Unidos lo que Jorge Mario Bergoglio está haciendo a la Iglesia, el Primer Ministro Conte a Italia, el Presidente Macron a Francia, el Primer Ministro Sánchez a España, y así sucesivamente. La naturaleza chantajable de Joe Biden, al igual que la de los prelados del “círculo mágico” del Vaticano, lo expondrá a ser utilizado sin escrúpulos, permitiendo que los poderes ilegítimos interfieran tanto en la política interna como en los equilibrios internacionales. Es obvio que aquellos que lo manipulan ya tienen a alguien peor que él listo, con quien lo reemplazarán tan pronto como surja la oportunidad.

Y sin embargo, en medio de este panorama sombrío, surge este avance aparentemente imparable del “Enemigo Invisible”, un elemento de esperanza. El adversario no sabe amar, y no entiende que no sea suficiente asegurar un ingreso universal o cancelar hipotecas para subyugar a las masas y convencerlas de que sean marcadas como ganado. Este pueblo, que durante demasiado tiempo ha soportado los abusos de un poder odioso y tiránico, está redescubriendo que tiene un alma; entiende que no está dispuesto a intercambiar su libertad para la homogeneización y cancelación de su identidad; está empezando a entender el valor de los lazos familiares y sociales, de los lazos de fe y cultura que unen a las personas honestas. Este Gran Restablecimiento está destinado a fracasar porque los que lo planearon no entienden que todavía hay gente dispuesta a tomar las calles para defender sus derechos, para proteger a sus seres queridos, para dar un futuro a sus hijos y nietos. La inhumanidad nivelada del proyecto globalista se destrozará miserablemente frente a la firme y valiente oposición de los hijos de la Luz. El enemigo tiene a Satanás de su lado, Aquel que sólo sabe odiar. Pero de nuestro lado, tenemos al Señor Todopoderoso, el Dios de los ejércitos dispuestos para la batalla, y la Santísima Virgen, que aplastará la cabeza de la antigua Serpiente. “Si Dios es para nosotros, ¿quién puede estar contra nosotros?” (Rm 8:31).

Señor Presidente, usted es muy consciente de que, en esta crucial hora, los Estados Unidos de América se consideran el muro defensor contra el que se ha desatado la guerra declarada por los defensores del globalismo. Pon tu confianza en el Señor, fortalecido por las palabras del apóstol Pablo: “Puedo hacer todas las cosas en Aquel que me fortalece” (Flp 4, 13). Ser un instrumento de la Divina Providencia es una gran responsabilidad, por la cual sin duda recibirás todas las gracias de estado que necesitáis, ya que están siendo fervientemente implorados para vosotros por las muchas personas que te apoyan con sus oraciones.

Con esta esperanza celestial y la seguridad de mi oración por vosotros, por la Primera Dama y por vuestros colaboradores, con todo mi corazón os envío mi bendición.

¡Dios bendiga a los Estados Unidos de América!

+ Carlo Maria Viganò

Teta Arzobispo de Ulpiana

Ex Nuncio Apostólico en los Estados Unidos de América


Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

COVID-21 ¿Película basada en hechos reales?

Traigo aquí un supuesto correo-e de un político del Partido Liberal Canadiense. Como el virus decían que supuestamente declinaría en la época estival y así no ha sido, ya me espero cualquier cosa. Tal texto puede ser una realidad en la estrategia, las tácticas pueden variar dependiendo de muchos factores. Lean como ficción y entiendan como realidad fronteriza que nos ha tocado ver, leer y escuchar en el limbo de la percepción vital. El guion de la película está escrito…

De una fuente anónima:

Comité Estratégico de LPC LeakInboxLPC leaker <LPC_leaker@protonmail.com>1:47 PM (7 horas hace )toHello,

Mensaje Original ‐‐‐‐‐‐‐

El sábado 10 de octubre de 2020 1:38 PM,


escribió: Querido *******, Quiero proporcionarle información muy importante. Soy miembro del comité dentro del Partido Liberal de Canadá. Me siento dentro de varios grupos de comités, pero la información que estoy proporcionando proviene del comité de Planificación Estratégica (que es dirigido por la PMO).

Necesito empezar diciendo que no soy feliz haciendo esto, pero tengo que
hacerlo. Como canadiense y lo que es más importante como padre que quiere un futuro mejor no sólo para mis hijos, sino también para otros niños. La otra razón por la que estoy haciendo esto es porque aproximadamente el 30% de los miembros del comité no están satisfechos con la dirección que esto llevará a Canadá, pero nuestras opiniones han sido ignoradas y planean avanzar hacia sus metas. También han dejado muy claro que nada detendrá los resultados previstos.

La hoja de ruta y el objetivo fueron establecidos por la PMO y es el siguiente: – Fase en las restricciones de bloqueo secundario sobre una base de rodadura, comenzando con las principales áreas metropolitanas primero y expandiéndose hacia el exterior.

Se espera para noviembre de 2020.

Apresurar la adquisición (o construcción de) instalaciones de aislamiento en todas las provincias y territorios.

Se espera para diciembre de 2020.

– Los nuevos casos diarios de COVID-19 aumentarán más allá de la capacidad de las pruebas, incluyendo aumentos en las muertes relacionadas con COVID después de las mismas curvas de

crecimiento. Se espera para finales de noviembre de 2020. – Bloqueo secundario completo y total (mucho más estricto que la primera y segunda restricciones de fase rodante).

Previsto para finales de diciembre de 2020

– principios de enero de 2021 – Reforma y ampliación del programa de desempleo que se convertirá en el programa de renta básica universal. Se espera para el primer trimestre de 2021.

– Mutación COVID-19 proyectada y/o coinución con virus secundarios(denominado COVID-21)dando lugar a una tercera onda con una tasa de mortalidad mucho mayor y una mayor tasa de infección.

Se espera para febrero de 2021.

– Los nuevos casos diarios de hospitalizaciones COVID-21 y muertes relacionadas con COVID-19 y COVID-21 superarán la capacidad de los centros de atención médica. Esperado Q1 – Q2 2021.

– Se implementarán restricciones de bloqueo mejoradas (denominadas Tercer Bloqueo). Se impondrán restricciones de viaje completas (incluidas las interridades y las interesoreidades). Se espera el segundo trimestre de 2021. – Transición de individuos al programa universal de renta básica.

Se espera a mediados del segundo trimestre de 2021. – Projected cadena de suministro descomponeciones, escasez de inventario, gran inestabilidad económica.

Se espera a finales del segundo trimestre de 2021. – Despliegue de personal militar en las principales áreas metropolitanas, así como en todas las carreteras principales para establecer puestos de control de viaje.

Restringir el viaje y el movimiento. Proporcionar apoyo logístico a la zona. Se espera para el tercer trimestre de 2021.

Junto con eso, se pidió a la comisión de Planificación Estratégica que diseñara una forma eficaz de hacer la transición de los canadienses para hacer frente a un esfuerzo económico sin precedentes.

Uno que cambiaría el rostro de Canadá y alteraría para siempre la vida de los canadienses. Lo que se nos dijo fue que para compensar lo que era esencialmente un colapso económico a escala internacional, que el gobierno federal iba a ofrecer a los canadienses un alivio total de la deuda.

Así es como funciona: el gobierno federal ofrecerá eliminar todas las deudas personales (hipotecas, préstamos, tarjetas de crédito, etc.) que todos los fondos serán proporcionados a Canadá por el FMI bajo lo que se conocerá como el programa de Restablecimiento Mundial dela Deuda .

A cambio de la aceptación de esta condonación total de la deuda, el individuo perdería la propiedad de todos y cada uno de los bienes y activos para siempre.

La persona también tendría que aceptar participar en el calendario de vacunación COVID-19 y COVID-21, que proporcionaría a la persona un viaje sin restricciones y una vida sin restricciones incluso bajo un bloqueo completo (mediante el uso de la identificación con foto conocida como HealthPass de Canadá).

Los miembros del Comité preguntaron quién se convertiría en el propietario de los bienes y activos perdidos en ese escenario y qué sucedería con los prestamistas o instituciones financieras, simplemente nos dijeron “el programa de Restablecimiento Mundial de la Deuda manejará todos los detalles”.

Varios miembros del comité también cuestionaron lo que les pasaría a las personas si se negaban a participar en el programa World Debt Reset, o el HealthPass, o el calendario de vacunación, y la respuesta que obtuvimos fue muy

preocupante. Esencialmente nos dijeron que era nuestro deber asegurarnos de que se nos ocurrió un plan para asegurar que eso nunca sucedería. Nos dijeron que era en el mejor interés para los individuos participar.

Cuando varios miembros del comité presionaron implacablemente para obtener una respuesta, nos dijeron que aquellos que se negaran vivirían primero bajo las restricciones de bloqueo indefinidamente.

Y que en un corto período de tiempo a medida que más canadienses pasaran al programa de condonación de la deuda, los que se negaran a participar se considerarían un riesgo para la seguridad pública y serían reubicados en instalaciones de aislamiento.

Una vez en esas instalaciones se les darían dos opciones, participarían en el programa de condonación de deudas y serían liberados, o permanecerían indefinidamente en la instalación de aislamiento bajo la clasificación de un grave riesgo para la salud pública y tener todos sus activos confiscados.

Así que como pueden imaginar después de escuchar todo esto se convirtió en una discusión acalorada y se intensificó más allá de cualquier cosa que he presenciado
antes. Al final, la OMG insinuó que todo el programa avanzará sin importar quién esté de acuerdo o no. Que no será sólo Canadá, sino que, de hecho, todas las naciones tendrán hojas de ruta y agendas similares.

Que tenemos que aprovechar las situaciones que tenemos ante nosotros para promover el cambio a una escala más grande para el mejoramiento de todos. Los miembros que se opusieron y los que plantearon cuestiones clave que surgirían de tal cosa fueron completamente ignorados. Nuestras opiniones e inquietudes fueron ignoradas. Simplemente nos dijeron que lo hiciéramos.

Todo lo que sé es que no me gusta y creo que va a colocar a los canadienses en un futuro oscuro.

COVID-21 Movie based on real events?

I bring here an alleged e-mail from a politician from the Canadian Liberal Party. As they said the virus would supposedly decline in the summer season and it has not, I expect anything. Such text can be a reality in strategy, tactics can vary depending on many factors. Read as fiction and understand as a border reality that we have had to see, read and hear in the limbo of vital perception. The script for the film is written …


La hoja de ruta de Covid-19: Hacia el caos económico mundial y la destrucción social

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación del virus no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

Por el profesor Michel Chossudovsky Global Research, 13 de octubre de 2020

Ahora se confirma sin lugar a dudas que la prueba de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizada para estimar casos positivos COVID-19 no tiene sentido. No puede detectar ni identificar el virus. Lo que detecta son partículas o fragmentos de numerosos virus, incluyendo el resfriado común (corona beta) y la gripe estacional (virus A y B)

PCR- Positivo no implica Covid-19 Positivo. Las estadísticas derivadas de la prueba de ITP no miden los “casos confirmados”. La prueba del ITP no proporciona las estadísticas requeridas (por los responsables de la formulación de políticas y las autoridades sanitarias nacionales) para evaluar el número de personas infectadas.

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación de la infección viral no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

La prueba de PCR es la pistola humeante. ¿por qué?

Debido a que la prueba de PCR es defectuosa e inválida como medio para identificar la propagación del virus, lo que significa que TODAS LAS DECISIONES PRINCIPALES tomadas por la OMS y los gobiernos nacionales desde finales de enero de 2020 (apoyadas por estadísticas defectuosas) no son válidas. Además, los informes oficiales, incluida la OMS, confirman que Covid-19 no es un virus asesino, tiene características similares a la gripe estacional.

El propósito de este artículo es examinar cómo estas decisiones de gran alcance, invariablemente basadas en mentiras y estadísticas erróneas, han contribuido a un estado de caos económico, social y político en todo el mundo, lo que ha llevado al cierre y cierre de 190 economías nacionales de los Estados miembros de las Naciones Unidas. Sólo tres países, entre ellos Bielorrusia, Nicaragua y Suecia, se negaron a cerrar su economía nacional.

El cierre de las economías nacionales se presentó como un medio para hacer frente al “Virus Asesino” y “Salvar Vidas”. Está muy documentado, sus impactos han llevado al desempleo masivo y a la pobreza en todo el mundo.

Anexo al presente artículo: Detalles relativos a la prueba RT-PCR

Para obtener más detalles sobre la prueba PCR, haga clic aquí

La hoja de ruta hacia el caos económico y la destrucción social

18 de octubre de 2019. 201 Ejercicio de simulación pandémica

El coronavirus fue nombrado inicialmente 2019-nCoV por la OMS, el mismo nombre que el adoptado en el ejercicio de simulación del 18 de octubre de 2019 201 bajo los auspicios de la Escuela de Salud John Hopkins Bloomberg, Centro para la Seguridad de la Salud (un evento patrocinado por la Fundación Gates y el Foro Económico Mundial). (Evento 201)

7 de enero de 2020: Las autoridades chinas “identificaron un nuevo tipo de virus” que (según los informes oficiales) fue aislado el 7 de enero de 2020.

20-24 de enero: Reuniones del Foro Económico Mundial en Davos. El papel de los poderosos intereses financieros

Los intereses financieros dominantes, las fundaciones multimillonarias y las instituciones financieras internacionales desempeñaron un papel clave en la puesta en marcha de la Emergencia de Salud Pública de la OMS (PHEIC). La decisión no fue tomada por la OMS.

En la semana anterior a esta histórica decisión de la OMS. El PHEIC fue objeto de “consultas” en el Foro Económico Mundial (WEF), Davos (21-24 de enero). El Director General de la OMS, Dr. Tedros, estuvo presente en Davos. Estas consultas fueron fundamentales para influir en la decisión histórica de la OMS del 30 de enero.

¿Hubo un conflicto de intereses definido por la OMS? El mayor donante de la OMS es la Fundación Bill y Melinda Gates, que junto con el WEF y el CEPI ya había anunciado en Davos el desarrollo de una vacuna Covid-19 antes del histórico 30 de enero de la PHEIC.

28 de enero de 2020: El Centro para el Control y la Prevención de Enfermedades (CDC) de los Estados Unidos confirmó que el virus de la novela corona había sido aislado. Hasta la fecha, el proceso de identificación del virus no se ha hecho público.

30 de enero de 2020: La Emergencia de Salud Pública de Preocupación Internacional (PHEIC) de la OMS

La primera etapa de esta crisis fue lanzada por la OMS el 30 de enero. Aunque oficialmente no fue designada como una “Pandemia”, sin embargo contribuyó a encabezar la campaña del miedo.

Desde el principio, las estimaciones de “casos positivos confirmados” han sido parte de un “Juego de Números”.

En algunos casos las estadísticas simplemente no se mencionaban y en otros casos los números se inflaban con el fin de crear pánico.

El número de “casos confirmados” basado en estimaciones erróneas (PCR) utilizadas para justificar esta decisión de alcance lejano fue ridículamente bajo.

La población mundial fuera de China es del orden de 6.400 millones. El 30 de enero de 2020 fuera de China había:

83 casos en 18 países, y sólo 7 de ellos no tenían antecedentes de viajes en China. (véase OMS,30 de enero de 2020).

El 29 de enero de 2020, el día anterior al lanzamiento del PHEI(registrado por la OMS), hubo 5 casos en los Estados Unidos, 3 en Canadá, 4 en Francia, 4 en Alemania.

No había una “base científica” que justificara el lanzamiento de una emergencia mundial de salud pública.

Captura de pantalla de la tabla de la OMS, 29 de enero de 2200,

un día antes de la decisión de la OMS de declarar una emergencia mundial de salud pública

Esos números ridículamente bajos (no mencionados por los medios de comunicación) se utilizaron para encabezar una campaña de miedo en todo el mundo.

31 de enero de 2020: Decisión del presidente Trump de suspender los viajes aéreos con China

Mientras que la OMS “no recomendó restricciones a los viajes o al comercio”, los cinco llamados “casos confirmados” en los Estados Unidos fueron suficientes para “justificar” la decisión del presidente Trump el 31 de enero de suspender los viajes aéreos a China mientras precipitaba una campaña de odio contra los chinos étnicos en todo el mundo occidental.

Esta histórica decisión del 31 de enero allanó el camino hacia la interrupción del comercio internacional de productos básicos, así como las restricciones mundiales a los viajes aéreos.

Y esos “casos confirmados” defectuosos fueron en su mayor parte utilizando la prueba RT-PCR estándar.

20-21 de febrero de 2020. Datos de Covid en todo el mundo fuera de China: el crucero Diamond Princess

Si bien China informó de un total de 75.567 casos de COVID-19, (20 de febrero) los casos confirmados fuera de China eran abismáticamente bajos y las estadísticas basadas en gran parte en la prueba de ITP utilizada para confirmar la “propagación mundial del virus” eran cuestionables, por decir lo menos. Además, de los 75.567 casos en China, un gran porcentaje se había recuperado. Y las cifras de recuperación no fueron reconocidas por los medios de comunicación.

El día de la histórica conferencia de prensa del Dr. Tedros (20 de febrero de 2020) el número registrado de casos confirmados fuera de China fue de 1073 de los cuales 621 eran pasajeros y tripulantes en el Diamond Princess Cruise Ship (atrapado en aguas territoriales japonesas).

Desde un punto de vista estadístico, la decisión de la OMS que señalaba una posible “difusión del virus en todo el mundo” no tenía sentido.

El 20 de febrero, el 57,9% de los “casos confirmados” de Covid-19 en todo el mundo eran de la Diamond Princess, apenas representativa de una “tendencia estadística” mundial. La historia oficial es la siguiente:

  • Un pasajero con sede en Hong Kong que había desembarcado de la Princesa Diamante en Hong Kong el 25 de enero desarrolló neumonía y fue positivo para la novela coronavirus el 30 de enero.
  • Se informó que había viajado el 10 de enero a Shenzhen en China continental (que limita con los nuevos territorios de Hong Kong).
  • La Princesa Diamante llegó a Yokohama el 3 de febrero. Se impuso una cuarentena al estudio de la serie de cruceros Ver NCBI.
  • Muchos pasajeros se enfermaron debido al confinamiento en el barco.
  • Todos los pasajeros y la tripulación de la Princesa Diamante emprendieron la prueba de PCR.
  • El número de casos confirmados aumentó a 691 el 23 de febrero.

Desde el punto de vista de la evaluación de las tendencias estadísticas mundiales, los datos no se levantan. Sin los datos de Diamond Princess, los llamados casos confirmados en todo el mundo fuera de China el 2o de febrero habrían sido del orden de 452, de una población de 6.400 millones de habitantes.

Examine el gráfico de la OMS a continuación. El azul indica los casos confirmados sobre la Diamond Princess (transporte internacional) (que llegó a Yokohama el 3 de febrero de 2020), muchos de los cuales estuvieron enfermos, confinados en sus habitaciones durante más de dos semanas (cuarentena impuesta por Japón). Todos los pasajeros y la tripulación realizaron la prueba RT-PCR (que no detecta ni identifica Covid-19).

No hace falta decir que estos supuestos datos fueron fundamentales para encabezar la campaña del miedo y el colapso de los mercados financieros en el transcurso del mes de febrero. (ver sección a continuación)

Fuente OMS, 28 de febrero de 2020

La crisis financiera de febrero de 2020. El choque corona 2020

Del 20 al 21 de febrero de 2020 se cumple el inicio del colapso financiero de 2020.

20 de febrero de 2020: En una conferencia de prensa celebrada el jueves 20 de febrero por la tarde (hora del AEC) en una reunión informativa en Ginebra, el Director General de la OMS. El Dr. Tedros Adhanom Ghebreyesus, dijo que era

“preocupado de que la posibilidad de contener el brote de coronavirus se “cerrara” …

“Creo que la ventana de oportunidad sigue ahí, pero que la ventana se está estrechando.”

Estas declaraciones de “shock and awe” contribuyeron a aumentar la campaña del miedo, a pesar del hecho de que el número de casos confirmados fuera de China era extremadamente bajo.

Oficialmente 1073 casos en todo el mundo.

Excluyendo a la Diamond Princess, 452 los llamados “casos confirmados” en todo el mundo fuera de China, para una población de 6.400 millones registradas por la OMS el 20 de febrero, 15 en los Estados Unidos, 8 en Canadá, 9 en el Reino Unido.

Se registraron un mayor número de casos fuera de China en Corea del Sur (153 casos según la OMS) e Italia (registrados por las autoridades nacionales).

Datos de la OMS registrados en febrero de 2020 al comienzo del llamado Covid Financial Crash (derecha)

La declaración del Dr. Tedros (basada en conceptos y estadísticas defectuosos) puso las bases para el colapso financiero de febrero provocado por información privilegiada, conocimiento previo, comercio de derivados, ventas en corto y una gran parte de las operaciones de los fondos de cobertura.

Quien tuviera conocimiento previo (información privilegiada) de la declaración del Director General de la OMS del 20 de febrero habría cosechado importantes beneficios monetarios.

¿Hubo un conflicto de intereses? La OMS recibe fondos de la Fundación Gates. Y Bill Gates tiene “60% de sus activos invertidos en acciones [incluyendo acciones y fondos de índices]”, según un informe de la CNBC de septiembre de 2019.

El desplome bursátil iniciado el 20 de febrero, conocido como el Accidente coronavirus 2020,fue categorizado como:

“la caída más rápida en los mercados bursátiles globales en la historia financiera, y el desplome más devastador desde el accidente de Wall Street de 1929.”

La causa de la crisis financiera fue (según los analistas), V. El Virus. La propagación del virus fuera de China.

La campaña de miedo del “virus asesino” junto con las oportunas “advertencias” del Dr. Tedros sobre la necesidad de implementar una pandemia mundial sirvieron indeleblemente a los intereses de los especuladores institucionales y fondos de cobertura de Wall Street. El desplome financiero condujo a un cambio importante en la distribución de la riqueza del dinero. (ver análisis a continuación)

En la semana siguiente al anuncio de la OMS del 20 al 21 de febrero,el Dow Jones se derrumbó un 12% (CNBC, 28 de febrero de 2020). Según los analistas, la caída de la DJIA fue el resultado de la propagación mundial del virus. Una declaración sin sentido en contradicción con el (pequeño) número de estimaciones positivas de la OMS Covid, la mayoría de las cuales se basaron en la prueba de PCR defectuosa.El lunes 24 de febrero, tras la reapertura de los mercados bursátiles, hubo una caída sin precedentes en el Dow Jones atribuible a los “peligros inminentes” que“Covid estaba extendiendo en todo el mundo creando incertidumbres en los mercados financieros”..Las existencias cayeron bruscamente el lunes (24 de febrero) a medida que aumentaba el número de casos de coronavirus fuera de China,lo que avivó los temores de una prolongada desaceleración económica mundial debido a la propagación del virus. El promedio industrial Dow Jones cerró 1.031,61 puntos menos, o un 3,56%, en 27.960,80.” (CNBC) (sin cursivas en el apartado de inglés)

Promedio industrial Dow Jones Diciembre 2019 – Marzo 2020

También el 24 de febrero, Trump solicitó una ayuda de emergencia de 1.250 millones de dólares.

Según la BBC, los mercados bursátiles mundiales vieron fuertes caídas “debido a las preocupaciones sobre el impacto económico del virus”, lo que sugiere que el virus era “la “mano” invisible responsable de la disminución de los mercados financieros.

COVID-19 fue identificado por poco como el catalizador de la crisis financiera.

¿Quién estaba detrás de este catalizador? ¿Quién estuvo detrás de la campaña de miedo que contribuyó a desencadenar el caos y la incertidumbre en los mercados financieros?

11 de marzo de 2020: La pandemia Covid-19, encierro, cierre de 190 economías nacionales

El Director General de la OMS había puesto las bases en su Conferencia de Prensa del 21 de febrero. “el mundo debería hacer más para prepararse para una posible pandemia de coronavirus”. La OMS ha pedido a los países que estén “en una fase de preparación”.

El 11 de marzo de 2020: la OMS declaró oficialmente una pandemia mundial en un momento en que había 18.000 casos confirmados y 4291 muertes de una población mundial total fuera de China del orden de 6.400 millones de personas. ¿Qué te dicen estas “estadísticas”?

Inmediatamente después del anuncio del 11 de marzo de la OMS, la campaña del miedo se puso en marcha. Al igual que en el caso del accidente del 20 al 21 de febrero, la declaración del 11 de marzo del Director General de la OMS había puesto las bases. Los mercados bursátiles se desplomaron en todo el mundo. A la mañana siguiente, el Dow (DJIA) se desplomó un 9,99% (una disminución de 2.352,60 para cerrar en 21.200,62). El Jueves Negro, 12 de marzo de 2020, fue “el peor día del Dow” desde 1987. Se había producido una transferencia masiva de la salud de la riqueza financiera en favor de los multimillonarios estadounidenses.

Las instrucciones de confinamiento se transmitieron a 193 Estados miembros de las Naciones Unidas.Los políticos son los instrumentos de poderosos intereses financieros. ¿Se justificó esta decisión de gran alcance como un medio para combatir el Virus?

Sin precedentes en la historia, aplicada casi simultáneamente en un gran número de países, sectores enteros de la economía mundial fueron desestabilizados. Las pequeñas y medianas empresas fueron conducidas a la bancarrota. El desempleo y la pobreza son desenfrenados.

En algunos países han estallado las hambrunas. Los impactos sociales de estas medidas son devastadores. Los impactos en la salud (mortalidad, morbilidad) de estas medidas, incluida la desestabilización del sistema de atención sanitaria nacional (en numerosos países) superan con creces los atribuidos a Covid-19. (Para más detalles ver artículo del autor aquí,

Enriquecimiento multimillonario. La apropiación y redistribución de la riqueza

La riqueza multimillonaria ha aumentado drásticamente desde principios de febrero. Hay tres fases distintas, que están directamente relacionadas con la crisis de la corona, cada una de las cuales está marcada por cambios importantes en la distribución de la riqueza global.

  1. La crisis financiera iniciada el 20 de febrero propiciaba una redistribución dramática de la riqueza monetaria y la propiedad de los activos financieros. El conocimiento previo, la información privilegiada y el comercio especulativo desempeñaron un papel clave. ¿Hubo conocimiento previo de la declaración del Dr. Tedros de la OMS del 20 de febrero?
  2. El cierre y cierre del 11 de marzo de las economías nacionales de 190 Estados miembros de la ONU, que desencadenaron las quiebras tanto de las pymes como de las pymes en todo el mundo. El evento del 11 de marzo también estuvo marcado por la caída de los mercados bursátiles en todo el mundo, comenzando el jueves negro 12 de marzo de 2020.
  3. La tercera etapa del enriquecimiento multimillonario se refiere a la aplicación de la llamada “Segunda Ola”, que consiste en desencadenar una nueva ola de quiebras.

La redistribución de la riqueza en favor de la clase multimillonaria se confirma mediante un estudio de IPS relativo al cierre de la economía mundial.

La riqueza combinada de los multimillonarios estadounidenses aumentó en 850.000 millones de dólares desde el 18 de marzo de 2020,lo que supone un aumento de más del 28 por ciento. (Esta estimación no tiene en cuenta el aumento de la riqueza durante el período anterior al 18 de marzo, que estuvo marcado por una serie de desplomes bursátiles).

El 18 de marzo de 2020, los multimillonarios estadounidenses habían combinado una riqueza de 2.947 billones de dólares. Para el 8 de octubre, su riqueza ha aumentado a 3,8 billones de dólares (3.798 millones de dólares para ser exactos).

A nivel mundial, los multimillonarios son grandes ganadores durante la pandemia de Covid-19. Según un reciente informe de UBS, los aproximadamente 2.189 multimillonarios mundiales tienen actualmente 10,2 billones de dólares. Se trata de un aumento estimado de 1,5 billones de dólares durante la pandemia que examinan los datos multimillonarios de UBS y Forbes de 2019.

La siguiente tabla identifica el aumento de la riqueza personal de los cinco multimillonarios estadounidenses más ricos (del 18 de marzo al 17 de junio de 2020). (No esbozada en el cuadro, la riqueza de los multimillonarios estadounidenses aumentó en otros 266.000 millones de dólares de junio a octubre de 2020).

Reflexionemos ahora brevemente sobre la Segunda Ola que ahora se impone a millones de personas.

La segunda ola

Septiembre-Octubre 2020. El establecimiento financiero ha dado instrucciones a los gobiernos para que apliquen lo que equivale a un segundo programa de bancarrota utilizando el pretexto y la justificación de que el número de casos positivos de Covid ha aumentado.

Con toda probabilidad, esta segunda oleada conducirá a un nuevo proceso de apropiación y concentración de la riqueza.

Al mismo tiempo, hay una tendencia hacia las formas totalitarias de gobierno.

Todas las formas de actividad social se ven afectadas incluyendo reuniones familiares, bodas y funerales, reuniones públicas, por no hablar del cierre de escuelas, universidades, museos, eventos deportivos y culturales. Ahora se están aplicando medidas del estado policial para hacer cumplir el cumplimiento. ¡Y la gente acepta!

Al comienzo de la Segunda Ola, el proceso de posponer la reapertura de la economía mundial contribuirá indeleblemente a acabar con las pequeñas y medianas empresas (regionales y locales) de todo el mundo, al tiempo que precipitará la quiebra de sectores enteros de la economía mundial, incluidas las aerolíneas, las cadenas hoteleras y la industria turística. Esto, a su vez, conducirá a la apropiación de activos reales por parte de poderosos intereses financieros.

La campaña del miedo ha vuelto a estar en marcha.

Las estadísticas oficiales basadas en estimaciones erróneas y manipuladas de los llamados casos positivos “confirmados” de Covid constituyen la base para justificar estas medidas diabólicas.

V el virus se presenta como la amenaza. Pero el virus no tiene un impacto directo en las variables económicas clave.

Lo que está en juego no tiene precedentes: es una agenda neoliberal global llevada a cabo por gobiernos corruptos en nombre del establishment financiero.

El sentido común nos dice que el cierre de la economía global destruye la vida de las personas.

Interrumpir la campaña del miedo constituye el primer paso hacia la reversión de la marea

Para más detalles sobre los impactos económicos. Artículo relacionado

Combatir el virus: El desempleo masivo no es la solución

Por el Prof. Michel Chossudovsky, 05 de octubre de 2020

Michel Chossudovsky, Profesor de Economía


La prueba de reacción en cadena de la transcripción inversa-polimerasa (RT-PCR)

La prueba estándar utilizada para detectar / identificar SARS-2 en todo el mundo es la prueba de reacción en cadena de transcripción inversa-polimerasa(RT-PCR) que se utiliza para estimar y tabular el número de casos covid-19 positivos confirmados. (Esta no es la única prueba utilizada. Las observaciones a continuación se refieren únicamente al ITP estándar).

Según el Premio Nobel, la Dra. Kary Mullis, que inventó la prueba de PCR:

“PCR detecta un segmento muy pequeño del ácido nucleico que forma parte de un virus en sí. El fragmento específico detectado está determinado por la elección un tanto arbitraria de las imprimaciones de ADN utilizadas que se convierten en los extremos del fragmento amplificado.”

La prueba de PCR nunca tuvo la intención de identificar el virus.

La prueba pcR estándar aplicada en relación con Covid-19 no detecta ni identifica el virus. Lo que detecta son fragmentos de varios virus, según el reconocido inmunólogo suizo Dr. B. Stadler. Según el Dr. Pascal Sacré, “estas pruebas detectan partículas virales, secuencias genéticas, no todo el virus”

“Fragmentos de virus positivos” no significa“SARS-2 positivo” (o Covid-19 Positivo). La prueba de PCR puede recoger fragmentos de virus de la gripe (A, B) así como coronavirus beta fríos comunes (por ejemplo, OC43, HKU1). Lo que han hecho los gobiernos es dar al ITP positivo una sola etiqueta, a saber, Covid-19, cuando en realidad la prueba positiva de ITP podría ser el resultado de otros virus, incluidos los relacionados con la gripe o el resfriado común coronavirus, que (según los CDC) tienen síntomas similares a Covid-19.

Una vez establecida y aceptada la etiqueta Covid-19 Positive, está sujeta a numerosas formas de manipulación, por no hablar de la falsificación de certificados de defunción.

Qué es Covid-19, SARS-2. ¿Cómo se prueba? ¿Cómo se mide? La campaña del miedo no tiene base científica

Por el Prof. Michel Chossudovsky, 08 de octubre de 2020La fuente original de este artículo es Global ResearchDerechos de autor © Prof. Michel Chossudovsky, Global Research, 2020

Interpretación Errónea del Virus Parte II: Principio y Fin de la Crisis del Coronavirus

Por Dr. Stefan Lanka

Artículo original publicado en la revista: Wissenschafftplus
Enlace al artículo original: https://wissenschafftplus.de/uploads/article/wissenschafftplus-fehldeutung-virus-teil-2.pdf Fuente de la traducción al español: desconocido.

La definición del SARS y del coronavirus o covid-19 significa que se considera que la neumonía atípica es el cuadro clínico que caracteriza a la enfermedad. Si se pueden detectar patógenos conocidos en la neumonía, ésta se considera típica, si no atípica. Uno de los dos hechos decisivos para el SARS y la crisis del coronavirus es que al menos el 20- 30% de todas las neumonías son atípicas. Las causas de la neumonía atípica son claramente conocidas y por lo tanto NO deben presentarse como la causa de un virus desconocido.

Este hecho es suprimido por los infectólogos y virólogos y es la base del miedo y el pánico actuales, porque se crea la impresión entre los afectados, el público y los políticos, de que la neumonía atípica sería especialmente peligrosa y a menudo mortal porque todavía no hay medicamentos ni vacunas para la supuesta nueva enfermedad.

Desde el momento en que se ofrece un procedimiento de prueba para el supuesto nuevo virus, que, oculto por los implicados, también prueba “positivamente” a personas sanas, el número de casos aumenta automáticamente. Inicialmente, las personas con neumonía típica también serán examinadas, luego más y más personas con otras enfermedades.

Esto se considera una prueba práctica de la propagación del virus. Automáticamente, más y más de otras enfermedades se añaden a la enfermedad original “neumonía atípica” y este “síndrome” se muestra como “la nueva enfermedad viral”.

El otro hecho decisivo, no sólo para el SARS y la crisis del coronavirus, es que los virólogos que afirman que los virus causan enfermedades, están suprimiendo una situación obvia abiertamente mentirosa por razones comprensibles.

El método de prueba de virus que se ofrece es un método de detección genética. No aíslan de un virus las secuencias de genes que utilizan para la prueba de detección. Aíslan secuencias genéticas que se liberan típicamente en mayores cantidades cuando los tejidos y las células mueren. Estas secuencias genéticas, generalmente cortas, y componentes del metabolismo humano, constituyen la base para el trabajo de laboratorio posterior.

Sin embargo, con la ayuda de programas informáticos, los virólogos sólo pueden construir mentalmente largas cadenas de material genético a partir de muchas secuencias cortas de genes. Estas son entonces producidas como verdaderas cadenas de ADN viral. Esta es la razón por la que los resultados positivos de las pruebas se obtienen repetidamente incluso en individuos sanos probados.

Para evitar refutarse a sí mismos, estos virólogos ignoran constantemente dos reglas prescritas por la ciencia. Uno es verificar sistemáticamente todas las afirmaciones por sí mismas. La otra es probar todos los supuestos y métodos utilizados mediante experimentos de control.

Si realizaran los experimentos de control, descubrirían que TODAS las secuencias genéticas cortas, que sólo unen mentalmente, para formar una cadena genética viral se originan en el metabolismo humano y no en el exterior, de un supuesto virus.

El impulso de la crisis del coronavirus fue desencadenado por un mensaje de un joven oftalmólogo el 30/12/2019 en Internet, que se difundió de forma inmediata y muy rápidamente. Éste dijo a sus amigos que varias personas estaban en cuarentena en su hospital, que se confirmaron siete casos de SARS, que se cuidaran y protegieran.

El profesor Christian Drosten, de la Charité de Berlín, se enteró de ello e inmediatamente comenzó a elaborar procedimientos de prueba para los virus del SARS antes de que estuviera claro y pudiera determinarse si el informe de China sobre el SARS era verdadero y estaba probado, y especialmente antes de que los virólogos chinos publicaran sus resultados.

Los virólogos autorizados de la Comisión de Control de Enfermedades de China (CCDC) publicaron sus resultados el 24 de enero de 2020 y el 3 de febrero de 2020.

Informan sobre el aislamiento de muchas secuencias genéticas cortas, que, cuando se ensamblan, podrían representar una cadena genética de un nuevo tipo de virus. Los autores señalan expresamente -y todos los demás virólogos implicados hasta la fecha- que aún no se han realizado los experimentos absolutamente necesarios que permitan afirmar que se trata efectivamente de una cadena genética de un virus causante de enfermedades.

Por el contrario: los virólogos chinos incluso señalan explícitamente que la cadena genética construida tiene hasta un 90% de similitud con las cadenas genéticas de los inofensivos y por decenios de antigüedad, reivindicados corona virus en los murciélagos.

El 21/01/2020 (¡3 días antes de la primera publicación de la CCDC!) la OMS recomendó a todas las naciones usar el procedimiento de prueba desarrollado por el Prof. Drosten. Al afirmar que había desarrollado un procedimiento de prueba fiable para el virus, que se estaba extendiendo rápidamente en China, el profesor Drosten, haciendo caso omiso de las normas claramente definidas de la labor científica, que forman parte de su contrato de trabajo, y violando las leyes del pensamiento y la lógica de la virología, ha desencadenado y causado el aumento y la globalización del pánico epidémico chino.

1. El comienzo de la crisis del Coronavirus

Cuando el joven oftalmólogo Li Wenliang informó a siete médicos de Wuhan a través de WhatsApp el 30/12/2019 de que varias personas estaban en cuarentena en su hospital, que se habían confirmado siete casos de SARS, y que debían tener cuidado y protegerse, no tenía la intención de causar pánico.

Si lo hubiera hecho, habría publicado el anuncio en Internet y advertido al público. Uno de los siete destinatarios de este mensaje privado de WhatsApp publicó una “captura de pantalla”, es decir, una foto del mensaje, en Internet sin ser consciente de las posibles consecuencias. Por supuesto, esta información se difundió muy rápidamente dentro de China y luego en todo el mundo.

Este mensaje desencadenó una ola de temor, pánico e indagaciones a las autoridades sanitarias chinas y al gobierno debido al pánico causado por una crisis de SARS en 2003, que la Organización Mundial de la Salud (OMS) clasificó como “amenaza mundial” el 12 de marzo de 2003.

En consecuencia, el Gobierno de Beijing envió una “fuerza de reacción rápida” integrada por epidemiólogos y virólogos del Centro de Control de Enfermedades de China a Wuhan el 31 de diciembre de 2019 para apoyar a las autoridades sanitarias locales y a la provincia circundante de Hubei. El objetivo era comprobar y verificar las afirmaciones de un brote de una epidemia. Si efectivamente se hubiera producido un brote, la situación debería controlarse adecuadamente.

En la primera publicación autorizada de los autores del CCDC sobre los resultados de su investigación, “A New Coronavirus from Patients with Pneumonia in China, 2019”, no se informa de una acumulación de pacientes con neumonía de causa desconocida.

Informan que los pacientes encontrados pueden ser agrupados en un “grupo” con características comunes. La característica común era la visita más o menos frecuente de un mercado mayorista de mariscos en Wuhan. Lo pequeño que era el grupo de pacientes con neumonía atípica puede verse por el hecho de que el CCDC tomó frotis y líquidos del tracto respiratorio inferior de sólo cuatro pacientes, para buscar patógenos conocidos y desconocidos.

Mientras tanto, el pánico en Wuhan y sus alrededores aumentó extremadamente. Ni siquiera las medidas adoptadas por la policía, que el 3 de enero de 2020 pidió al oftalmólogo Li Wenliang que se comprometiera por escrito firmando una declaración punible de cese y desistimiento para no difundir nada más sobre un posible brote de SARS, pudieron frenar la dinámica de pánico que se había desarrollado y que empeoraba peligrosamente.

El 10/01/2020 Wenliang, y poco después también sus padres, desarrollaron los síntomas de la neumonía. Li Wenliang se aisló porque estaba convencido de que había sido infectado con el virus del SARS el día anterior por un paciente ocular. Esto también aumentó el pánico.

Los doctores que lo atendieron realizaron un gran número de pruebas diferentes, todas las cuales resultaron negativas. A medida que su estado de salud se deterioraba y cada vez más personas mostraban la simpatía del público por su destino, las pruebas se continuaron hasta que una primera prueba de SARS, el 30/01/2020, se consideró “positiva”. El desastre del creciente pánico del SARS, que mutó en la crisis mundial del coronavirus, siguió su curso.

Li Wenliang difundió este resultado en Internet con las siguientes palabras: “Hoy las pruebas de ácido nucleico han dado un resultado positivo, el polvo se ha asentado, finalmente diagnosticado”.

Este anuncio aumentó el pánico ya existente. Todo se descontroló por completo cuando publicó su declaración firmada de cese y desistimiento del 03/01/2020 en Internet. Esta publicación de su declaración de cesación, que era peligrosa para él, fue y sigue siendo considerada por todas las personas presas del pánico, como prueba de que hay una nueva epidemia de SARS, porque un médico, que a su vez está afectado, sigue informando y advirtiendo al público a pesar de la amenaza de sanciones.

El pánico aumentó aún más porque la salud de Li Wenliang se deterioró a pesar del uso intensivo de una variedad de sustancias antibióticas y el público participó regularmente de esto. La situación estaba al borde de la escalada porque el informe de su muerte fue más que caótico y contradictorio.

Esta fue y sigue siendo la razón central por la que el público chino y mundial asumió que se había producido otro brote de SARS en Wuhan, pero que se había redefinido como una nueva epidemia, una pandemia con un nuevo nombre, Covid-19.

2. Una, de dos posibles causas del miedo de Li Wenliang

El temor del oftalmólogo Li Wenliang se basa en los acontecimientos de 2003 en China, cuando los científicos occidentales afirmaron que se había producido una acumulación de neumonía atípica en el sur de China. Dos días después de la creación mental de una cadena genética del supuesto nuevo virus (SARS-CoV-1), en la que el Prof. Drosten estuvo significativamente involucrado, el Prof. Drosten ofreció un supuesto procedimiento de prueba para este supuesto virus.

Aproximadamente 800 personas con neumonía atípica, es decir, neumonía en la que no se detectan patógenos conocidos, pero que resultó “positiva” con la prueba del Prof. Drosten, murieron, por lo tanto -posiblemente de forma incorrecta y sobre tratada- con el diagnóstico de SARS en lugar de “neumonía atípica”.

La base de que el temor al SARS se mantuviese y aumentara hasta 2019, son dos publicaciones de 2013 y 2017 que dieron lugar a especulaciones sobre la posibilidad de que aparecieran nuevos coronavirus del SARS. Los autores de ambas publicaciones afirman que los murciélagos sanos proporcionan pruebas de la existencia de secuencias genéticas cortas que pueden ser interpretadas como componentes de un virus.

Estas secuencias genéticas cortas tendrían similitudes con las secuencias genéticas cortas que se declararon componentes del supuesto coronavirus del SRAS-1 (SARS-CoV-1) en 2003.

SARS significa Síndrome Respiratorio Agudo Severo, que es otra descripción de los síntomas de la neumonía atípica.

Se dice que estas hebras genéticas mentales (ficticias, transformadas en realidad) son capaces de desarrollarse en la realidad y formar un virus real. Este virus, que se afirma está en murciélagos y otros animales salvajes pero que sigue siendo inofensivo, podría saltar a los humanos a través de la mordedura, el contacto o el consumo y convertirse en un asesino mortal.

En los seres humanos, este inofensivo virus podría, a través de cambios (mutaciones), convertirse en un coronavirus del SARS que es realmente nuevo y podría causar una enfermedad. Tal acontecimiento y la consiguiente oleada de enfermedades, como la neumonía atípica, deben esperarse en cualquier momento.

Hasta la fecha, los virólogos no han podido aislar un virus del SARS de un paciente, un murciélago, otro animal o en el laboratorio, ni han podido detectar una cadena genética intacta y completa de un virus del SARS. Hasta la fecha no se ha podido confirmar la suposición de los virólogos de que existen de hecho cadenas genéticas virales que están construidas de la misma manera que las cadenas genéticas compuestas de secuencias genéticas cortas.

Hay otras formas en que aún no se ha demostrado la existencia y la presencia de una cadena genética completa de un virus del SARS, aunque desde hace mucho tiempo se dispone de técnicas estándar muy sencillas para determinar la longitud de las secuencias genéticas.

Los temores alimentados masivamente por tales afirmaciones falsas fueron la base de los temores del oftalmólogo Li Wenliang, así como de otros médicos e infectólogos no sólo en Wuhan.

Estas alegaciones son la razón por la que los epidemiólogos y virólogos de la CCDC, a partir del 31 de diciembre de 2019, se centraron en encontrar secuencias de genes similares que se definieron como componentes del coronavirus del SARS en 2003 (véanse las explicaciones que figuran a continuación).

3. La segunda de las posibles causas de miedo de Li Wenliang

Las crisis del SARS y del Coronavirus comenzaron con la afirmación en los medios de comunicación de que hay una acumulación de pacientes con neumonía atípica. Esta alegación nunca fue corroborada. Sólo se afirmó que la neumonía atípica que se produjo podía explicarse por la suposición de la aparición de un nuevo virus, porque algunas de las personas con neumonía atípica tenían contacto con los mercados de animales.

Para poder confirmar la suposición de que un virus desconocido podría ser la causa de la neumonía atípica, se suprimieron los hechos conocidos descritos en la literatura médica y científica. De hecho, hay varios y amplios espectros de causas no infecciosas de neumonía atípica. Por varias razones, esta neumonía atípica tiene más probabilidades de ser mortal que la típica.

Las causas son, entre otras, la inhalación de vapores, disolventes y sustancias tóxicas. La entrada de alimentos, bebidas o contenidos estomacales en los pulmones en caso de dificultades para tragar o de la pérdida del conocimiento también puede causar una neumonía extremadamente grave (neumonía por aspiración).

El agua por sí sola es suficiente, si entra en los pulmones de las personas que se están ahogando, para causar una neumonía atípica grave. Otra causa es el reconocido espectro de disfunciones inmunológicas, como las alergias y las reacciones auto-inmunes. También se sabe que la radiación desencadena una inflamación de los pulmones en el cáncer, que no puede distinguirse de la típica neumonía.

La neumonía congestiva es particularmente conocida en las personas mayores. Éstas se desarrollan debido a la retención de agua (edema), a la permanencia prolongada en cama, a la debilidad del corazón y/o de los riñones, que puede conducir a una ventilación y circulación sanguínea inadecuadas en los pulmones, y como consecuencia directa de la inflamación de los pulmones, es decir, de la neumonía atípica.

Lógicamente, una combinación de causas subyacentes también causa neumonía atípica. Una neumonía atípica puede convertirse rápidamente en una neumonía típica si se produce una colonización secundaria del pulmón inflamado. Esta es la razón por la que el porcentaje de neumonía atípica es probablemente más alto que el 20-30% estimado.

En los estudios de las cinco personas documentadas en las dos publicaciones pertinentes a la crisis del coronavirus, no se investigaron la posible presencia o la historia, los signos, los mecanismos y los efectos de estas causas conocidas de la neumonía atípica. Los virólogos no suelen hacerlo de todos modos, y los miembros de la CCDC no pudieron hacerlo ni siquiera en las circunstancias de pánico.

Excluir la mención de la neumonía atípica demuestra una grave negligencia médica e impide el tratamiento correcto de los pacientes. Por consiguiente, los afectados corren el riesgo de que se les manipule mal con un cóctel de sustancias antibióticas ricas en efectos secundarios, que es capaz de causar de forma independiente la muerte de los pacientes, especialmente en caso de sobredosis. El pánico puede ser incluso fatal en muy poco tiempo, no sólo en el caso de problemas cardiovasculares.

La respuesta a la pregunta crucial de si se ha detectado realmente un nuevo virus o si sólo se emiten piezas cortas y endógenas de material genético como componentes de un virus o se interpretan erróneamente como tales, es decisiva para que la crisis del coronavirus pueda terminar rápidamente. Al igual que con el H1N1, los responsables de la crisis del coronavirus dicen que ésta sólo se puede acabar con la vacunación. Sin embargo, la idea de la vacunación ha sido refutada tanto como la de los virus.

Para la evaluación y clasificación de los acontecimientos que rodearon el desencadenamiento y el mantenimiento de la crisis del coronavirus es útil el recuerdo de la pandemia de gripe porcina de 2009, que ya ha sido olvidada.

La mayoría de la población en ese momento estaba preparada para vacunarse contra los supuestos virus de la gripe porcina. Luego hubo un retraso en la entrega anunciada de las vacunas. Las vacunas no podían llenarse en jeringas listas para usar, ya que los nuevos potenciadores de ingredientes activos utilizados por primera vez dañaban la mezcla de la vacuna y la inutilizaban. Por esta razón, la vacuna se llenó en ampollas para 10 personas cada una, a las que sólo se permitió añadir los potenciadores de la sustancia activa poco antes del acto de la vacunación.

Durante este tiempo se supo que los potenciadores del principio activo, llamados adyuvantes, sin los cuales una vacuna no podría desarrollar su efecto, son nuevos y no han sido probados. Se supo que estos novedosos amplificadores de drogas consisten en nanopartículas. Se sabe que las nanopartículas son muy reactivas debido a su diminuto tamaño y, por lo tanto, se utilizan como catalizadores en muchas reacciones químicas. En los procesos técnicos, por ejemplo, hacen que las superficies se comporten de forma completamente diferente a la que se puede conseguir con los métodos convencionales.

Entonces se supo que la Canciller alemana Angela Merkel y las Fuerzas Armadas alemanas iban a recibir esta vacuna, pero sin el novedoso potenciador de sustancias activas de nanopartículas, mientras que la policía y la población iban a recibir la vacuna con las nanopartículas no probadas.

Como resultado, el 93% de la población rechazó la vacuna producida para ellos. Sólo al 7% de los alemanes se les ha administrado esta vacuna.

El metabolismo humano no puede metabolizar y excretar nanopartículas. Debido a esta negativa por parte de casi toda la población, la gripe porcina en realidad desapareció de la noche a la mañana siguiente, como por arte de magia, de los medios de comunicación al basurero y las vacunas al alto horno.

(Se permite una pequeña polémica: sorprendentemente, el virus de la gripe porcina H1N1 despegó al galope de los cerdos, ya no infectó a otras personas, no enfermó a los infectados y su presencia en los medios de comunicación se detuvo inmediatamente. Tal vez el virus de la gripe porcina se ha convertido en virus de la gripe de los peces, para nadar por los ríos en los cuerpos de los salmones, sólo para atacar de nuevo con fuerza concentrada en el mercado de pescado en Wuhan).

Los epidemiólogos, infectólogos y virólogos implicados han aprendido del fracaso de la planificación de la pandemia, que no culminó con la vacunación. Analizaron las causas y publicaron sus conclusiones y recomendaciones para el futuro en el número 12 de diciembre de 2010 del Bundesgesundheitsblatt (Gaceta Federal de Salud). El significativo título de este número: “Pandemias. Lecciones aprendidas” Lo que significa tanto como: ¡Las lecciones que hemos aprendido de la debacle de la gripe porcina H1N1!

Algunos de los artículos de este número están disponibles en Internet, pero no los más importantes. Las principales recomendaciones para la gestión de la pandemia son:

• Asegurarse de que los expertos no se contradigan entre sí en los debates públicos.

• Participación temprana de los medios de comunicación social y de los líderes. – Control de la red Internet. Esto con el fin de evitar que las reivindicaciones y las críticas pongan en peligro el consenso y la aceptación de las medidas en la política y la sociedad.

¡Estas recomendaciones ya se han aplicado con éxito! Se censura en Internet, se excluye a los críticos con insultos, entre otras cosas. Los argumentos obligatorios que refutan la suposición de la pandemia y que han pasado al dominio público simplemente no se abordan. Sólo un experto, el Prof. Drosten, es escuchado en los medios y en la política. La única “crítica” que se le hizo, expresada por un virólogo especializado en VIH, tuvo la función de reforzar la afirmación central de la existencia de un nuevo virus, el SARS-CoV-2.

4. La globalización del pánico por los virus chinos del SARS y la creación de la crisis del coronavirus por el Prof. Drosten

El profesor Christian Drosten, de la Charité de Berlín, afirma que desde el 1/01/2020 ha desarrollado un método de detección genética con el que puede detectar con fiabilidad la presencia del nuevo coronavirus en los seres humanos.

Para a) poder comprender qué supuestos y qué acciones constituyen la base de las afirmaciones del Prof. Drosten y b) comprobar si sus conclusiones de haber desarrollado un procedimiento de prueba seguro para el nuevo coronavirus están lógica y científicamente probadas o no, o incluso refutadas, es necesario explicar los términos y técnicas utilizadas, presentar su argumentación y analizar las dos publicaciones decisivas a las que se refiere el Prof. Drosten.

¿Cómo se definen un virus y un coronavirus?

¿Cómo se definen las secuencias en este contexto? – ¿Cómo funcionan los métodos de detección de secuencias llamadas PCR, RT-PCR y RT-PCR en tiempo real?

¿Cuándo se puede emitir la detección de la presencia de secuencias en humanos como prueba de la presencia de un virus?

¿Cómo se demuestra científicamente la existencia de un virus?


– En la ciencia, un virus se define por su material genético específico, que es único para ese virus.

– El material genético de un virus también se conoce como la cadena genética viral, la molécula genética viral o su genoma. – El material genético viral de un virus contiene las distintas secuencias genéticas para la formación de las distintas proteínas virales, conocidas como genes virales.

– El material genético de un virus puede consistir en ADN o ARN.

– Los virus corona se definen por el hecho de que consisten en una molécula específica de ARN rodeada por una envoltura.

– El material genético de un determinado virus se define por su longitud determinada con precisión y la determinación exacta de la estructura de la cadena del genoma viral.

– La composición del material genético de un virus resulta de la determinación exacta del número y la secuencia específica de los cuatro bloques de construcción que componen un material genético. Los cuatro bloques de construcción de un material genético se llaman nucleótidos. – El proceso de determinar la secuencia específica de los cuatro componentes básicos de un material genético se denomina secuenciación.

– El resultado de la determinación de la secuencia de los componentes básicos de una sustancia hereditaria se denomina secuencia o secuencia genética.

– Los virus patógenos se definen por el hecho de que su secuencia es única y no se da en organismos sanos. – Para detectar y determinar la presencia del material genético de un virus, de acuerdo con las leyes del pensamiento y la lógica que precede a toda ciencia como regla fundamental, este virus debe ser aislado y estar presente en forma pura para que las propias secuencias de genes de la célula no se malinterpreten como componentes de un virus.

– Sólo es posible determinar la secuencia de una sustancia genética si está presente en forma de ADN. – Para determinar la secuencia de una sustancia genética que está presente en forma de ARN, primero debe ser convertida bioquímicamente en ADN.

– El proceso de conversión de una sustancia genética de ARN en ADN se denomina “transcripción inversa” y se abrevia como “RT”.

Las técnicas utilizadas por el Prof. Drosten y las primeras conclusiones

– La presencia y la longitud de un material genético se determina separándolo longitudinalmente en un campo eléctrico. Los trozos cortos migran más rápido, los más largos más lentamente. Al mismo tiempo, para determinar la longitud del material genético a examinar, se añaden piezas de material genético de longitud conocida de diferentes longitudes. Esta fiable técnica estándar para detectar y determinar la longitud del material genético se llama “electroforesis en gel”.

– Si la concentración de un determinado material genético es demasiado baja para ser detectada por la técnica de “electroforesis en gel”, puede ser multiplicada a voluntad por la técnica de multiplicación ilimitada de ADN, llamada Reacción en Cadena de la Polimerasa. De esta manera, el ADN indetectable puede hacerse visible en la electroforesis en gel. Este es un requisito previo para hacer accesible el material genético para investigaciones posteriores, especialmente para la posterior determinación decisiva de su longitud y secuencia. Este método también se conoce como PCR para abreviar.

El inventor de la técnica de la PCR, Kary Mullis, que fue galardonado con el Premio Nobel de Química en 1993 por este invento, señaló desde el principio que este, su método desarrollado para el análisis en sala blanca en las fábricas de chips de ordenador es muy propenso a errores. En su discurso del Premio Nobel, que está documentado en la página del Comité del Premio Nobel, también señaló que no hay ninguna prueba verificable, en realidad científica, de que la sustancia genética conocida como genoma del VIH desencadene realmente una inmunodeficiencia o una de las diversas enfermedades que se agrupan de manera inadmisible bajo el término “SIDA” y se tratan con quimioterapia altamente tóxica. Señaló que sólo hay consenso entre los científicos participantes en que el “VIH” desencadenaría una inmunodeficiencia.

Para poder reproducir un ADN con la técnica de PCR, se requiere el conocimiento de la composición, la secuencia del ADN. Esto se debe a que un ADN sólo puede propagarse por PCR si fragmentos cortos de genes producidos artificialmente se unen al principio y al final del ADN, que corresponden exactamente a la secuencia del principio y del final del ADN que se va a propagar. Estos cortos trozos de ADN producidos artificialmente se llaman, por lo tanto, primers, las moléculas iniciadoras de la PCR. Tienen una media de entre 24 y 30 nucleótidos de largo (los bloques de construcción del material genético).

Así pues, la PCR no puede utilizarse para detectar secuencias o virus desconocidos. Sólo la determinación de la secuencia de un virus permite desarrollar una prueba de PCR para la detección de la secuencia de un gen originado en un virus. – En los primeros días de la PCR, sólo era posible determinar la cantidad de ADN amplificado mediante electroforesis en gel después de que se hubiera detenido la reacción de amplificación de la PCR. Mientras tanto, se añaden ciertos colorantes a las enzimas y sustancias necesarias para la PCR. La detección de estos tintes durante el curso de la PCR muestra aproximadamente qué concentraciones de ADN reproducido artificialmente se produjeron y cuánto ADN estaba realmente presente aproximadamente al comienzo de la PCR. Dado que la cantidad de ADN producido artificialmente puede determinarse aproximadamente mientras la técnica de PCR sigue funcionando, esta extensión de la técnica de PCR se denomina “PCR en tiempo real”. Por lo tanto, una “PCR en tiempo real” que va precedida de otro paso, la conversión de ARN en ADN mediante “transcripción inversa” (RT), se denomina “RTPCR en tiempo real”.

– El Prof. Drosten utiliza la técnica de “RT-PCR en tiempo real” en la prueba que ha desarrollado para la detección del nuevo virus corona. Con ese fin, ha seleccionado secuencias genéticas cortas de un conjunto de datos de Internet del 1/01/2020 que se atribuyen a los virus del SARS. Sobre la base de esas secuencias de fragmentos genéticos cortos, que se interpretan como posibles componentes de los virus del SARS, él diseñó las secuencias de cebadores de la PCR decisivas para la PCR a fin de detectar el virus “todavía” desconocido en China con su “RT-PCR en tiempo real”.

Cuando aparecieron en Internet compilaciones preliminares de secuencias el 10/01/2020 y el 12/01/2020, que posteriormente fueron modificadas y publicadas el 24/01/2020 y el 3/02/2020, esto representó el resultado de los dos primeros intentos de identificar el virus aún desconocido. Con este fin, los virólogos de la CCDC usaron programas de computadora para ensamblar teóricamente las secuencias de fragmentos cortos de genes en una posible cadena genética.

En ambas publicaciones, los virólogos de la CCDC afirman que no hay evidencia de que estas sugerencias de secuencias puedan realmente causar enfermedades. El 10/01/2020 y el 12/01/2020, las propuestas de secuencias chinas eran todavía provisionales y no se habían sometido todavía al estricto proceso de revisión prescrito científicamente.

El hecho de que la Organización Mundial de la Salud (OMS) recomiende la prueba de detección PCR desarrollada por el Prof. Drosten para la detección del nuevo virus el 21/01/2020, incluso antes de la publicación de las publicaciones de las dos primeras propuestas de secuencias chinas, demuestra un primer hecho: El Prof. Drosten utilizó datos no verificados científicamente para su prueba de PCR rápidamente globalizada del 2019-nCoV, que fue rebautizada como SARS-CoV-2 el 7 de febrero de 2020 con la participación del mismo Prof. Drosten.

El cambio de nombre el 7 de febrero de 2020 de la designación de “nCoV” a “SARS-CoV-2”, una mera presunción de virus posiblemente defectuoso o inofensivo, en un patógeno peligroso, dio a la opinión pública la impresión de que se había descubierto un virus real del SARS en China, que causa una enfermedad peligrosa, a saber, el SARS, y mató al nuevo ídolo de China, Li Wenliang, que empequeñeció a la dirección del partido.

El Prof. Drosten y sus colegas del Grupo de Nomenclatura de Virus cumplieron así las expectativas de la población, que estaba aterrorizada hasta la médula: “finalmente diagnosticado”, “finalmente diagnosticado”. Esta expectativa fue despertada por el impulso del pánico masivo desencadenado por el Dr. med. Li Wengling y aparentemente cumplido por el Prof. Drosten.

El factor decisivo en la evaluación de este acto es el hecho de que en aquel momento todos los virólogos directamente implicados testificaron -y todavía testifican hoy- que no hay pruebas de que este nuevo virus cause realmente la enfermedad. ¿O sólo ocurre en paralelo en enfermedades, en procesos de curación, después de procesos de curación, en algunas personas sanas, en muchas personas sanas o en todas las personas?

Esto demuestra que el Prof. Drosten ha cruzado la línea claramente reconocible de la acción científicamente justificada en un fraude reconocible y trascendental. También no podrá salir de esto utilizando una revista para la publicación de su procedimiento de prueba del 23/01/2020 que no comprueba las declaraciones hechas en ella antes de ir a la imprenta.

5. Las preguntas decisivas para un rápido final de la crisis del Coronavirus

La cuestión central y decisiva es si el Prof. Drosten ha cumplido con su deber científico, que forma parte de su contrato de trabajo, consigo mismo y verifica sistemáticamente todas las afirmaciones hechas en su publicación sobre el método de detección que desarrolló y las declaraciones públicas basadas en él.

Este deber científico central da lugar a tres preguntas centrales:

¿Comprobó el Prof. Drosten si las secuencias de genes que forman la base de su procedimiento de prueba y que le fueron proporcionadas por virólogos chinos son en realidad secuencias que se originan en un virus?

¿Llevó a cabo el Prof. Drosten los experimentos de control que son obligatorios en la ciencia y que prueban si las secuencias que utilizó realmente se originan en un virus? ¿Llevó a cabo los experimentos de control que prueban si las secuencias que utiliza, que atribuye al nuevo virus, son en realidad secuencias que no son secuencias que se producen en todos los metabolismos, tal vez incluso en plantas, como las papayas de Tanzanía o que se producen en mayor número en el metabolismo de las enfermedades?

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su método de prueba, con el que sólo detecta áreas parciales de 2 (dos) genes del genoma de un total de 10 (diez) genes del coronavirus, detecta un virus completo, activo y causante de la enfermedad? ¿Y no sólo fragmentos de un virus, después de una supuesta batalla exitosa del sistema inmunológico o la presencia de virus “defectuosos” o “incompletos” o “inofensivos” en nuestro material genético, que son típicos y constituyen el 50% de las masas genéticas de nuestros cromosomas?

Las respuestas son el resultado de la realización documentada del Prof. Drosten durante el desarrollo del procedimiento de la prueba y de la no realización documentada del Prof. Drosten hasta hoy. El virólogo Prof. Drosten, que desarrolló el método de detección del nuevo coronavirus (primero llamado 2019-nCoV y luego, a partir del 7/02/2020 llamado SARS- CoV-2), describe el desarrollo del método de prueba en una publicación publicada el 23/01/2020 en la página 3 de este artículo, en la columna de la izquierda, a 8 líneas de distancia, describe el primer y decisivo paso de su enfoque:

“Antes del anuncio público de las secuencias del virus de 2019-nCoV, nos basamos en los informes de los medios de comunicación social que anunciaban la detección de un virus similar al SARS. Por lo tanto, asumimos que un CoV relacionado con el SARS estuvo involucrado en el brote”.

Esto significa que el Prof. Drosten y sus colaboradores han asumido, basándose en los informes de los medios de comunicación social, que un coronavirus relacionado con el SARS podría estar implicado en el supuesto brote de neumonía atípica. En ese momento no se disponía de datos clínicos que apoyaran esa hipótesis. ¿Cuál era su siguiente paso?

“Descargamos todas las secuencias completas y parciales (longitud media >400 nucleótidos) de virus relacionados con el SARS que estaban disponibles en el GenBank el 1 de enero de 2020.”

Continúa en la columna derecha de la página 3, tercera fila desde la parte superior:

“Alineamos estas secuencias [Nota mía, SL: contra una secuencia estándar dada del virus del SARS] y utilizamos las secuencias alineadas para desarrollar nuestras pruebas (Figura S1 en el suplemento de esta publicación).

“Tras la publicación de la primera secuencia de 2019 nCoV en virological.org, seleccionamos tres pruebas basadas en lo bien que se ajustaban al genoma de 2019 nCoV (Figura 1). (“Descargamos todas las secuencias completas y parciales (si >400 nt) de virus relacionados con el SARS disponibles en el GenBank antes del 1 de enero de 2020 […] Estas secuencias fueron alineadas y la alineación se utilizó para el diseño del ensayo (Figura suplementaria S1).

De sus explicaciones se pueden extraer respuestas, conclusiones y consecuencias claras:

¿Comprobó el Prof. Drosten si las secuencias de genes, que son la base de su procedimiento de prueba y que fueron proporcionadas por virólogos chinos, son en realidad secuencias de un virus? ¡La respuesta es NO! No pudo comprobar si las secuencias proporcionadas eran de un virus, porque las dos publicaciones decisivas que describían la extracción de las secuencias de genes que utilizó no estaban disponibles para él antes de que su prueba fuera lanzada al mercado.

¿Llevó a cabo el Prof. Drosten los experimentos de control obligatorios en la ciencia para probar si las secuencias que usó realmente se originaron de un virus? ¿Llevó a cabo los experimentos de control para averiguar si las secuencias que utilizó, que atribuyó al nuevo virus, son en realidad secuencias que se producen en cualquier metabolismo, tal vez incluso en las plantas, o que se producen de forma metabolizada en las enfermedades?

La respuesta es: ¡NO! Ni él, ni los virólogos de la CCDC, ni otros han llevado a cabo de forma demostrable estos experimentos de control necesarios hasta el día de hoy, y si lo han hecho, no los han publicado. Para estos cruciales experimentos de control, deben utilizarse secuencias genéticas cortas del metabolismo de individuos sanos para secuenciarlos. Estas cortas secuencias genéticas, como las de los enfermos, deben ser ensambladas con los mismos programas informáticos para formar una larga cadena genética de un virus. Este experimento nunca se llevó a cabo o nunca se publicó. Ni siquiera se menciona este experimento de control obligatorio, que resulta de las leyes del pensamiento y la lógica de la virología – para controlar consistentemente los propios resultados. En el momento en que este experimento se lleva a cabo y se publica, la crisis del coronavirus termina inmediatamente.

El otro experimento de control resultante de la lógica científica es el ensayo intensivo, mediante el procedimiento PCR desarrollado (RT-PCR en tiempo real), con muestras clínicas de personas con enfermedades distintas de las atribuidas al virus y utilizando muestras de personas, animales y plantas sanas para comprobar si estas muestras no dan también resultados “positivos”.

Estos nuevos experimentos de control, que son lógicamente necesarios para validar un procedimiento de prueba, es decir, para comprobar si es válido y tiene alguna importancia, aún no se han realizado y ni siquiera se ha afirmado que se hayan realizado. Por consiguiente, los inventores y productores de estos procedimientos de prueba se han asegurado, mediante la información apropiada en los rótulos, por ejemplo, que la prueba sólo debe utilizarse para fines de estudio y no es adecuada para fines de diagnóstico.

Puedo predecir con certeza que las personas que liberan mayores cantidades de secuencias genéticas del tipo de tejido de los epitelios escamosos, por ejemplo, los pacientes renales, darán “positivo” con la PCR desarrollada por el Prof. Drosten a más tardar cuando su cantidad de frotis se multiplique y se concentre un poco. Es muy probable que incluso todos los organismos puedan dar positivo.

Hago un llamamiento a bioquímicos, bioinformáticos, virólogos y especialistas en cultivos celulares para que lleven a cabo estos experimentos de control, los publiquen y me informen sobre ellos. He diseñado un experimento de control que excluye de entrada la excusa de que el material de muestra utilizado ha sido contaminado con el virus del SARS Cov-2 antes o durante el experimento de control.

Los costos de la realización de los experimentos de control están cubiertos si se permite que yo y observadores neutrales estemos presentes durante la realización de los experimentos de control y se documenta cada paso. Por favor, póngase en contacto con la editorial para que se ponga en contacto. Los resultados pondrán fin a la crisis del coronavirus inmediatamente. No sirve de nada si sólo presento los resultados de los experimentos de control.

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su procedimiento de prueba, con el que sólo detecta áreas parciales de sólo 2 (dos) genes del genoma de un total de 10 (diez) genes del virus del Corona, detecta un virus completo, activo y causante de enfermedad y no sólo fragmentos de un virus después de una supuesta batalla exitosa del sistema inmunológico o debido a la presencia de numerosos virus “defectuosos”, “incompletos” e “inofensivos” en nuestro material genético?

El Prof. Drosten no consideró estas preguntas lógicas en absoluto, porque no aparecen en ninguna parte de sus publicaciones y afirmaciones. La detección de sólo secuencias genéticas cortas de una cadena genética larga de un virus nunca puede probar la presencia de un virus intacto y por lo tanto reproducible. Para poder calificar de válida una prueba de PCR de este tipo, habría que realizar primero estudios cuyos resultados demuestren que la detección de secuencias genéticas cortas prueba automáticamente la presencia de una cadena genómica completa e intacta de un virus. Esos estudios lógicamente convincentes aún no se han realizado ni mencionado.

Al comienzo de la crisis del coronavirus, la principal viróloga, la Prof. Karin Mölling, una destacada experta en el campo de los virus asociados a las células, inofensivos, incompletos o defectuosos conocidos como endógenos, describió las medidas adoptadas como injustificadas. Ha demostrado en publicaciones y en un libro, que la mitad del material genético de los humanos, es decir, la mitad de las secuencias de la que están formados nuestros cromosomas consiste en secuencias genéticas inactivas y defectuosas de virus.

Lo que no sabe, o está ocultando, es que el metabolismo produce constantemente una gran cantidad de secuencias genéticas de ARN de cualquier composición, que no aparecen en forma de secuencias de ADN en los cromosomas.

Este hecho pone en tela de juicio las afirmaciones de existencia de todos los virus ARN, como los coronavirus, el virus del Ébola, el VIH, el virus del sarampión y los virus del SARS.

Este hecho es también la base por la que, con los experimentos de control, se pone fin inmediatamente no sólo a la crisis del coronavirus, sino también al miedo y al mal manejo por parte de toda la virología de los supuestos virus de la enfermedad. Puedo asegurarle que las causas reales y los fenómenos de infección atribuidos a los virus han sido probados en el sentido “positivo” de la palabra “ciencia”.



Wrong Interpretation of the Virus Part II: Beginning and End of the Coronavirus Crisis



Centenares de médicos y profesionales de la salud de todo el mundo, reunidos en el Colectivo “United Health Professionnals” publicaron el mes pasado un extenso comunicado (en francés y en inglés) en el que piden que se detenga de inmediato “el clima de terror, la sinrazón, la manipulación y las mentiras” ligadas a “la mayor estafa sanitaria del siglo XXI”. En el comunicado, hecho público en diferentes idiomas a través de Change.org, los firmantes dicen “‘alto’ a todas las medidas demenciales y desproporcionadas que se han tomado desde un principio para luchar contra el (coronavirus) SARS-CoV-2 (encierro, bloqueo de la economía y la educación, distanciamiento social, uso de mascarillas para todos, etc.) porque están completamente injustificadas, no se basan en ninguna evidencia científica y violan los principios básicos de la medicina basada en la evidencia. Por otro lado, por supuesto, apoyan medidas razonables, como las recomendaciones de lavarse las manos, estornudar o toser en el codo, utilizar un pañuelo desechable, etc”. 

Los firmantes iniciales del documento, más casi el millar de profesionales que lo han hecho a través de Change.org, recuerdan que la Humanidad se ha enfrentado en numerosas ocasiones a nuevos virus, y que no es cierto que en esta ocasión sea distinto por un mayor contagio del Covid. “Es absolutamente falso. Una simple comparación con otros virus deja ver que la contagiosidad del SARS-CoV-2 es moderada. Son enfermedades como el sarampión las que pueden describirse como altamente contagiosas. Por ejemplo, una persona con sarampión puede infectar hasta a 20 personas, mientras que una persona infectada con este coronavirus solo infecta a 2 o 3: 10 veces menos que el sarampión”.

Los profesionales de la salud de Europa y América que hasta el momento se han sumado al comunicado niegan, además, la premisa mayor: “Es absolutamente falso que el Covid-19 sea mucho más mortal que otros virus”. Solo en comparación con la gripe, explican estos expertos, y si tenemos en cuenta el período comprendido entre el 1 de noviembre de 2019 y el 31 de marzo de 2020, hubo a nivel mundial 860.000 casos y 40.000 muertes de Covid-19, mientras que la gripe en el mismo período de cinco meses, infectó, en promedio, a 420 millones de personas y mató a 270.000. Además, la tasa de letalidad anunciada por la OMS (3,4%) estaba “muy sobreestimada y fue rechazada desde el principio por eminentes expertos en epidemiología. Pero, incluso aceptando esta tasa de letalidad, vemos que este coronavirus es tres veces menos mortal que el de 2003 (10%) y 10 veces menos mortal que el de 2012 (35%)”.

Los firmantes del documento explican que es absolutamente falso que el Covid-19 conlleve la saturación de los hospitales. “La saturación sólo afecta a algunos hospitales, pero se hace creer a la gente que todo el sistema hospitalario está saturado o que la saturación es inminente, cuando hay miles de hospitales en algunos países. ¿Es razonable y verdadero atribuir, por ejemplo, a 1.000 o 2.000 hospitales una situación que solo afecta a 4 o 5 hospitales? Tampoco es de extrañar que algunos hospitales estén saturados por ser centros epidémicos (como la región de la Lombardía en Italia o Nueva York en Estados Unidos). No hay que olvidar que los hospitales de muchos países se han visto desbordados (incluidos los cuidados intensivos) en anteriores epidemias de gripe y que en esas épocas se hablaba también de ‘tsunami’ de pacientes en los hospitales, ‘hospitales saturados’, carpas levantadas fuera de los hospitales, ‘zonas de guerra’, ‘hospitales colapsados’ y un ‘estado de emergencia’. Y, sin embargo, no confinamos países enteros, no bloqueamos la economía mundial, no paralizamos el sistema educativo, no practicamos el distanciamiento social y no les dijimos a las personas sanas que usaran mascarillas”.

Los firmantes del documento, todos ellos médicos y profesionales de la salud de múltiples países del mundo, explican que “las medidas demenciales” que se han tomado tienen “catastróficas consecuencias que ya han comenzado a aparecer: suicidio de personas angustiada como se ha reportado en China, desarrollo de patologías psiquiátricas, paralización de los itinerarios educativos de los escolares y estudiantes universitarios, impactos negativos y peligros en los animales, desatención de otras enfermedades (especialmente crónicas) y aumento de su mortalidad, violencia doméstica, pérdidas económicas, desempleo, crisis económica importante (pocas personas saben que la crisis económica de 2007-2008 conllevó el suicidio de al menos 13.000 personas sólo en Europa y América del Norte), graves consecuencias para la agricultura, desestabilización de países y paz social y riesgo de estallido de guerras. Un editorial publicado en el European Journal Of Clinical Investigation denunció, desde el principio, las daños de las medidas extremas tomadas sin fundamento en evidencias, información exagerada sobre la peligrosidad real del virus y difusión de noticias falsas (incluso por revistas prestigiosas). Algunos incluso llegaron a comparar esta pandemia con la de la gripe de 1918, lo que es una mentira y una manipulación, ya que aquella mató a 50 millones de personas, cosa que no tiene absolutamente nada que ver con la tasa de muertos de este coronavirus”.

Los profesionales firmantes del llamamiento señalan que “compartimos la opinión de los expertos que denuncian el hecho de que no se hace distinción entre personas que han muerto ‘por’ el virus y personas que han muerto ‘con’ el virus (con patologías concomitantes), el hecho de que la causa de la muerte se atribuya al SARS-CoV-2 sin una prueba o autopsia y que se presione a los médicos para que marquen el Covid-19 como la causa de la muerte, a pesar de que el paciente haya muerto por otras causas. Esto lleva a una sobreestimación del número de muertes y constituye una manipulación escandalosa de las cifras porque durante las epidemias de gripe estacional, por ejemplo, no se obra de la misma manera. Incluso más del 20% de los pacientes con Covid-19 también están coinfectados con otros virus respiratorios. Después de la reevaluación, solo el 12% de los certificados de defunción en un país europeo (Italia) mostraron una causa directa del coronavirus. El director de los CDC (Centres for Disease Control and Prevention, Centros para el Control y la Prevención de Enfermedades) de un país de América del Norte reconoció el 31 de julio que los hospitales tenían un incentivo financiero perverso para inflar las cifras de muertes por coronavirus”.

“Les decimos a los Gobiernos: levantad todas las restricciones y obligaciones a los ciudadanos (estado de emergencia, uso obligatorio de la mascarilla, distanciamiento social, etc.) porque son estúpidas y puramente dictatoriales y no tienen nada que ver con la medicina o la higiene o la preservación de la salud pública. No hay ninguna razón científica o médica para que los ciudadanos no enfermos usen una mascarilla. El doctor Pascal Sacré, anestesiólogo-reanimador, dijo: ‘obligar a todos a usarlas todo el tiempo, mientras la epidemia desaparece, es una aberración científica y médica’. El profesor Didier Raoult dice: ‘La decisión de confinar, como la decisión de usar mascarillas… no se basan en datos científicos…’. Las Dra. Lisa Brosseau y Margaret Sietsema, expertas en protección respiratoria, dicen: ‘No recomendamos exigir al público en general que no tenga síntomas de la enfermedad Covid-19 que usen con regularidad mascarillas de tela o quirúrgicas porque: no hay ninguna evidencia científica de que sean efectivas para reducir el riesgo de transmisión del SARS-CoV-2… ‘. El profesor Maël Lemoine también precisó que el cambio de discurso sobre las mascarillas es ‘político, no científico’. 

En algunos países asiáticos, las personas usan mascarillas durante todo el año (para protegerse de la contaminación, entre otras cosas). ¿Este uso generalizado de mascarillas en estos países les impide que tengan epidemias de coronavirus? ¿Este uso generalizado de mascarillas en estos países evita que cada año tengan epidemias de gripe u otros virus respiratorios? La respuesta es, por supuesto, no. Por otro lado, con los 8 millones de toneladas de plástico que ya se vierten en los océanos cada año, las mascarillas y guantes añaden una nueva amenaza y constituyen una contaminación particularmente peligrosa para nuestra salud y para la vida silvestre. Solo en Italia, si solo el 1% de las mascarillas actualmente en uso fueran arrojadas a la naturaleza, 10 millones de mascarillas terminarían en el océano cada mes. Además, las mascarillas quirúrgicas tardan hasta 450 años en descomponerse. Por lo tanto, decimos a los gobiernos: alto a estas medidas ilegales y peligrosas de uso obligatorio de mascarillas”.

“Decimos que es necesaria una reforma total de la OMS. Los éxitos de la OMS son indiscutibles: se han salvado millones de vidas gracias a los programas de vacunación contra la viruela y se ha reducido el consumo de tabaco en todo el mundo. Pero el mayor problema de la OMS es que durante varios años ha sido financiada en un 80% por empresas (especialmente farmacéuticas) y donantes privados (en concreto, la “filantrópica” undación Bill y Melinda Gates) y los escándalos se van acumulando: falsa alarma sobre el H1N1 bajo la influencia de los grupos de presión farmacéuticos, inquietante complacencia hacia el glifosato que la OMS había declarado seguro a pesar de las víctimas del herbicida, ceguera ante las consecuencias de la contaminación vinculada a las empresas petroleras en África, minusvaloración de la mortalidad humana de los desastres nucleares de Chernobyl a Fukushima y los desastres del uso de municiones de uranio empobrecido en Irak o los Balcanes, no reconocimiento de la ‘Artemisia’ para proteger los intereses de las empresas farmacéuticas a pesar de su probada eficacia en el tratamiento de la malaria.

La independencia de la organización se ve comprometida tanto por la influencia de los grupos de presión industriales, especialmente farmacéuticos, como por los intereses de sus estados miembros, en particular China. El presidente de un país dijo: ‘Creo que la Organización Mundial de la Salud debería avergonzarse de sí misma porque se han convertido en portavoz de China’. La institución ginebrina, que había subestimado la amenaza del ébola (más de once mil muertos) también está acusada de desatender las enfermedades tropicales en pos de mercados más jugosos. Una encuesta realizada en 2016 (La OMS en las garras de los grupos de presión) proporcionó una radiografía edificante de la OMS al dibujar el retrato de una estructura debilitada, sujeta a múltiples conflictos de intereses. Esta investigación ha demostrado cuánto y cómo predominan los intereses privados sobre los problemas de salud pública en la OMS. No es aceptable que el dinero que la financia provenga principalmente de un único empresario, y que esté infiltrada por ‘lobbies’”.

“Recientemente, la OMS se desacreditó aún más al caer en la trampa de Lancet Gate cuando un simple estudiante podría haber descubierto que era un estudio fraudulento. En el momento de la gripe H1N1, el Dr. Wolfgang Wodarg, presidente del Comité de Salud de la Asamblea Parlamentaria del Consejo de Europa, criticó la influencia de la industria farmacéutica en los científicos y funcionarios de la OMS, diciendo que ha llevado a una situación en la que ‘innecesariamente millones de personas sanas estaban en riesgo por vacunas mal probadas’ (…) También culpó a la OMS de alimentar los temores de una ‘falsa pandemia’, lo llamó ‘uno de los mayores escándalos médicos de este siglo’ y pidió que se abriera una investigación. 

De hecho, la OMS ha cambiado los criterios para declarar una pandemia (así como la gravedad) bajo la influencia de los grupos de presión farmacéuticos para que puedan vender vacunas a países de todo el mundo. Según un informe de la Asamblea Parlamentaria del Consejo de Europa sobre el manejo de la gripe H1N1, la OMS incurrió en ‘el desperdicio de importantes fondos públicos y la existencia de temores injustificados relacionados con los riesgos para la salud… Se han identificado graves lagunas con respecto a la transparencia de los procesos de toma de decisiones relacionados con la pandemia, lo que suscita preocupaciones sobre la posible influencia que la industria farmacéutica podría haber ejercido en las decisiones clave relacionadas con la pandemia. La Asamblea teme que esta falta de transparencia y rendición de cuentas debilite la confianza de los ciudadanos en las opiniones de las principales organizaciones de salud pública’”.

“Decimos que se debe abrir una investigación y que se interrogue a ciertos funcionarios de la OMS, en particular al que ha estado promoviendo el confinamiento internacional, lo que es una herejía desde el punto de vista médico y una estafa que ha llevado al mundo por mal camino. De hecho, el 25 de febrero de 2020, el jefe de la misión internacional de observación del coronavirus en China elogió la respuesta de Beijing a la epidemia. Dijo que China ha tenido éxito con métodos ‘anticuados’, enfatizó que ‘el mundo necesitaba las lecciones de China’, de las que se debía aprender y que si él tuviera el Covid-19, buscaría tratamiento gustosamente en China. Otra vez, también describió a China como ‘muy abierta’ y ‘muy transparente’. ¿Cómo podemos creer estas declaraciones? ¿Cómo puede alguien creer que si él tuviera COVID-19 iría a China para recibir tratamiento? ¿Cómo puede alguien creer que el mundo debería inspirarse en China y que la lucha contra la epidemia debería hacerse ‘con métodos anticuados’? Lo que es alucinante es que consiguió hacer tragar sus mentiras al mundo entero. Porque, lamentablemente, desde sus declaraciones y el informe que supervisó (donde podemos leer que los métodos chinos son: ‘ágiles y ambiciosos’), los países del mundo han puesto en marcha medidas desproporcionadas y han seguido ciegamente a la OMS confinando sus poblaciones. 

El miedo y la psicosis se han propagado al presentar el SARS-CoV-2 como un virus muy peligroso o de mortalidad masiva, cuando no lo es en absoluto. Afortunadamente, una entrevista con el vicedirector de la OMS, Bruce Aylward mostró una parte significativa de la verdad y el conflicto de intereses de la OMS con China cuando una periodista le preguntó sobre la negativa de la adhesión de Taiwán (que está en conflicto con China) por la OMS: fingió no escuchar la pregunta y, cuando se le volvió a hacer, ¡cortó la comunicación! (el vídeo ha sido visto más de 8 millones de veces). Él también dijo a fines de febrero: ‘Actualmente, solo hay un medicamento que creemos que podría tener alguna efectividad real: el Remdesivir’. ¿Cómo puede decir eso incluso antes de que salgan los resultados? ¿Y por qué lo dijo?


“Los canadienses electos en la Cámara de los Comunes incluso convocaron a este funcionario de la OMS a comparecer después de que rechazara las invitaciones a testificar ante el Comité Permanente de Salud. Incluso el líder interino del Partido Conservador Canadiense ha cuestionado la exactitud de los datos de la OMS sobre el Covid-19. De hecho, decir que China ha reducido el número de casos o gestionado bien la epidemia y aplanado la curva gracias al confinamiento es pura mentira, y no se basa en ninguna evidencia porque nadie es capaz de dar la cifra del número de casos o muertes en China si no hubiera impuesto el confinamiento. Además, meses después: ¡el mundo descubrió que esos números ni siquiera eran ciertos! Recientemente, tres países africanos expulsaron a funcionarios de la OMS porque, según algunos de estos estados, estaban falsificando el número de casos inflándolos”.

Los científicos firmantes del comunicado concluyen señalando que “las personas que están detrás de este encierro, de la psicosis y el terror global, cuando ven la avalancha de gente hacia las tiendas, la gente discutiendo por harina o papel higiénico, las distancias de un metro como si fuera la peste, personas confinadas como si fueran animales, calles desinfectadas, policías golpeando a los ciudadanos que salen, drones y helicópteros movilizados, personas que salen con salvoconductos, la utilización de mascarillas a pesar del final de la epidemia y el hecho de que la gente no esté enferma, no se excluye que se rían de la facilidad con la que han manejado países enteros cuyos ciudadanos son manejados como borregos … 

La locura ha llegado al punto de que en algunos países las playas han sido desinfectadas con lejía, se ha prohibido la barba y bigote a los bomberos, se ha instalado plexiglás en todas partes (incluso en las aulas de las escuelas) como si fuese la Peste Negra, se detuvo un tren porque una persona no llevaba la mascarilla puesta, familias privadas de ver a sus muertos (como si el virus fuera a saltar de su cuerpo y morderlos), septuagenarios multados por haber salido a tirar la basura y ¡hasta se han ‘aislado’ monedas y billetes procedentes del extranjero! ¿Cómo han podido los países aceptar caer en este nivel de locura, estupidez y dictadura? Especialmente aquellos que dicen ser democráticos. 

Todo esto por un virus que causa el 85% de las formas leves y del que se recupera más del 99% de las personas infectadas. 

La OMS instó al mundo a copiar la respuesta de China al Covid -19 y lo ha logrado: todos los países del mundo, siguiendo ciegamente a la OMS, se han convertido en una copia certificada de China. Solo unos pocos países se han negado a imitar tontamente a otros, como Suecia o Bielorrusia, por lo que pueden ser elogiados. 

El presidente de un país europeo tenía razón al decir: ‘Esto es solo una psicosis más peligrosa que el propio virus’”.

(Visto en https://www.prevencia.net/)




Hasta ahora, la incidencia de leucemia infantil, derrames cerebrales, cánceres de todo tipo y otras enfermedades producidas por las radiaciones de las ondas de telefonía móvil, habían quedado medio solapadas debido a varios factores: la falta de estudios oficiales concluyentes, el soborno de las operadoras y el silencio de los medios de comunicación. Añadiría quizá un cuarto factor: la falta de formación e información de los usuarios. A estas alturas y con los datos en la mano no es difícil concluir que somos una sociedad de irresponsables que solo se preocupa por lo inmediato, por lo lúdico y las distracciones, en definitiva, por el “pan y circo”. No es un juicio, y mucho menos una condena, sino una descripción de la realidad.

Información sobre ello hay para dar y regalar. El estudio CERENAT, del 2014, fue publicado en “Ocupational Environnement Medicine” y concluye que el uso del móvil, aunque sea solo durante treinta minutos, duplica o triplica el riesgo de padecer un tumor cerebral. Pero casi nadie se ha enterado.

En el 2018, el Instituto Ramazzini también vinculó el padecimiento de schwannoma maligno de corazón y el glioma al teléfono móvil. Por su parte, el macroestudio del National Toxicology Program del Instituto Nacional para la Salud y Seguridad Ambiental de Estados Unidos constata las evidencias de carcinogenidad y daños cardiacos por el uso de la radiación del móvil. Pero esto no se cuenta.

En cuanto al sector más joven de la población, la Comisión Europea tiene en su poder el estudio Mobi-Kids, un trabajo muy interesante realizado en catorce países con niños y adolescentes de edades comprendidas entre los siete y los veinticuatro años, que vincula la relación entre los tumores cerebrales y la telefonía móvil. La exdirectora de epidemiología del Instituto Nacional de la Salud y la Investigación médica de Francia, manifiesta que la Agencia Internacional para la Investigación del Cáncer (IARC, por sus siglas en inglés) podría elevar la clasificación de “probablemente cancerígeno” por su mecanismo de neurotoxicidad. Pero esto se silencia.

La implantación de la red 5G ha vuelto a abrir el debate sobre la peligrosidad de los campos electromagnéticos, sobre todo, cuando se empezaron a relacionar estas radiaciones con el desarrollo de los virus, extremo en el que coinciden varios investigadores. Veamos someramente en qué consiste la 5G, por qué es peligrosa, quiénes lo dicen y en qué se basan. Se trata de una supertecnología que implica el uso de altas frecuencias, entre 53 y 58 GHz, las cuales tienen mayor capacidad para penetrar en toda la materia viva. Las personas con sensibilidad electromagnética (CEM) tendrán que meterse en una burbuja para sobrevivir, y no estamos exagerando. Muchos científicos han dado la voz de alarma, entre ellos, Ceferino Maeztu, director del laboratorio de bioelectromagnetismo del Centro de Tecnología Biomédica dependiente de la Universidad Politécnica de Madrid. La preocupación es compartida por David Carpenter, coautor del informe internacional “Bioinitiativa” y director del Instituto de Salud y Medio Ambiente de Nueva York, centro colaborador de la OMS. Según sus palabras “ya es imposible decir que las radiofrecuencias no producen cáncer”. Pero de esto no se informa a los ciudadanos.

Los científicos no adscritos al sistema coinciden en que cada vez habrá más casos de leucemia infantil, infertilidad, cardiopatías, enfermedades neurológicas, psiquiátricas, cognitivas y más cánceres de todo tipo, especialmente, cerebrales. Pero está prohibido hablar de esto.

La doctora Magda Havas, profesora de ciencias ambientales de las universidades canadienses de Toronto y Trent hace tiempo que alertó sobre la aparición de un tercer tipo de diabetes, desencadenada por la contaminación electromagnética. Silencio ante esto.

La tecnología 5G ya está implantada en varios países. En España se está instalando y piensan tener todo listo en diciembre. Habrá que hacer un seguimiento por zonas y observar la incidencia de ingresados. En algunos lugares, como Suiza, se paralizó su instalación y, curiosamente, han tenido mucha menos incidencia de Covid, no han estado confinados y no utilizan mascarilla. Según tomamos de una ficha técnica, la 5G es “una tecnología inalámbrica que, en lugar de emitir cientos de vatios de radiaciones de microondas, emitirá haces con una potencia efectiva de hasta decenas de miles de vatios de radiación de onda milimétrica, con lo cual se pretende que 20.000 satélites en órbita baja irradien cada centímetro cuadrado del planeta”. Lo aterrador de esto es que las pruebas de esta tecnología han provocado una repentina muerte de miles de aves, aparte de los síntomas humanos de fatiga, hipoxia, trombosis, desorientación e inquietud, y otros. Tampoco sobre esto es consciente el ciudadano.

La ONU y su organismo la OMS, así como la UE, el Consejo de Europa, los gobiernos de todas las naciones y los medios de comunicación tienen en su poder el dosier que los científicos conocedores de estos efectos devastadores para la vida humana y la del planeta han elaborado y enviado. Nosotros lo hemos recibido en su día y publicamos al respecto. Es una declaración de alarma, en la que solicitan que se paralice con carácter de urgencia el despliegue de la red inalámbrica 5G, incluida la red 5G de los satélites espaciales. La razón es el incremento de la exposición a la radiación de radiofrecuencia de las telecomunicaciones, la cual se acumula a las que ya están implantadas: 2G, 3G y 4G. Inciden en su perjuicio para el medio ambiente y tachan la 5G de un experimento que tiene a la sociedad como conejillo de Indias, lo cual podría definirse como un crimen contra la humanidad, si nos atenemos a la letra del Derecho Internacional.


Pero ¿y si no fuera la 5G la causante de la Covid-19, y el quid estuviera en las antenas ya instaladas desde las que se está irradiando? Es una nueva hipótesis y muy interesante. Hace muchos meses que leo y escucho todo lo alternativo que se publica sobre el desarrollo de esta epidemia y sus múltiples flecos. Este nuevo planteamiento añade una nueva pieza al fresco de la epidemia. La hipótesis de trabajo es del doctor español, afincado en Francia, José Luis Sevillano. La entrevista que le hizo José Miguel, del canal Apellido Obligatorio, de donde tomo estos datos, dio la vuelta al mundo y así le conocimos.

El doctor Sevillano, desde su propia experiencia con enfermos de Covid en los últimos meses, y haciendo uso de la epidemiología y la radiología médica, ha llegado a unas conclusiones provisionales que deben tenerse en cuenta. La ciencia se basa en la observación y en la comprobación, por tanto, esto es pura ciencia. Al cabo de unas semanas de examinar pacientes con síntomas Covid, el doctor observó que una buena parte de ellos vivía en una zona concreta y esto le llamó la atención. Ante la duda de si pudiera haber algún foco en ese entorno que estuviese causando la enfermedad, decidió inspeccionar el lugar y comprobó que había una antena de telefonía móvil. En la localidad hay tres en total y aún no existe la red 5G.

Con esta pista en la mano, la deducción no fue difícil, máxime conociendo la radiología médica y la cronología de los efectos que causa que, coincidentemente, son los mismos que se están viendo en los enfermos de Covid en sus diferentes fases. También la 5G produce estos efectos, pero en la zona no está desplegada. ¿Podría ser se estuviera irradiando en tiempos determinados desde esas antenas? Dejamos la pregunta en el aire.

En una irradiación, cuanto más potente sea la emisión, mayor es el daño causado, y este depende de tres factores: la proximidad al foco, el tiempo de exposición y la edad de la persona. Existe un cuarto factor radiomédico que es la radiosensibilidad, es decir, la reacción del tejido humano ante la misma radiación, ya que no todos los tejidos reaccionan igual.

Oficialmente, la Covid-19 es una enfermedad respiratoria aguda grave, producida por el Sars-Cov-2. Sin embargo, el doctor Sevillano, como muchos otros profesionales de la salud, entre ellos la brillante doctora María José Martínez Albarracín, sostiene que no es una enfermedad respiratoria, sino una enfermedad inflamatoria sistémica, esto es, “afecta a todo el organismo, es decir, desde un pelo a las uñas de los pies”. Por eso se habla de endotelitis, miocarditis, arteritis, embolias, infartos o incluso dermatitis, amén de síntomas neurológicos, como mareos, vértigos, cefaleas, nerviosismo, agitación o pérdida de conciencia. ¿Puede un virus ser el causante de todo esto o habría que dirigir el foco a una radiación electromagnética como causa de esta complicada enfermedad?

El doctor Sevillano, con su nomenclatura particular, nos habla de los diferentes cuadros de los pacientes diagnosticados de Covid-19. Los hiperagudos son aquellos que mueren en cuestión de horas o que incluso caen redondos en la calle asfixiados. Hemos visto algunas de estas imágenes, sobre todo, en países de Hispanoamérica. “Cuando una persona es sometida a una radiación electromagnética en proximidad de alta o media energía, es fácil que muera en poco tiempo, a las pocas horas o a los pocos días. Puede ser que muera ahogada, por efecto de las ondas electromagnéticas o de la hemoglobina. La hemoglobina tiene átomos de hierro y esto supondría una desnaturalización de estas proteínas o un bloqueo de la liberación del intercambio de oxígeno”, asegura el doctor Sevillano, y añade que, personalmente, no ha tenido casos de este tipo, quizá porque las antenas de la localidad de Francia donde vive, se encuentran a unos trescientos metros de distancia. Como hemos expresado, cuanto más lejos, menor es el daño. Cosa distinta es cuando la antena se encuentra en el tejado de enfrente. Esto se denomina efecto gradiente, que no se da si el causante es un agente biológico. Habría que investigar si estos casos extremos de muerte fulminante, están relacionados con las antenas. También ha habido muertes súbitas por fallo en el sistema de conducción eléctrica del corazón, cosa que también se da en los casos de radiación.

Los cuadros agudos de Covid se presentan en dos o tres días y cursan con vómitos, diarreas, tos seca, fiebre y disnea, o sea, dificultad para respirar. Según la explicación de la radiación electromagnética, esto ocurre porque “los primeros tejidos afectados por una radiación son los que tienen mayor índice mitótico, es decir, aquellos que se reproducen más rápidamente porque están expuestos a mayores agresiones. Son los epitelios, o sea, las cubiertas respiratoria y digestiva principalmente. Estas células están habituadas a que al menor traumatismo se eliminan, se caen, se pelan, es decir, hay que intercambiarlas rápido, están hechas para eso. Cuando el cuerpo recibe una agresión, es lo primero que se elimina. Así, cuando se ataca con una radiación electromagnética se tiene tos seca no reproductiva, se vomita y se tiene diarrea porque todos los epitelios del digestivo y el respiratorio se están eliminando”. El doctor pone el ejemplo de la película The Widowmaker, basada en la historia real del K-19, en la que los marineros vomitaban tras acercarse al reactor nuclear. Esto ocurre en cuestión de horas o de días.

En la fase aguda, el cuerpo se deshace de todo el material de desecho, por la vía respiratoria y digestiva. Algunas personas pueden recuperarse en esta etapa sin más complicaciones, pero en cambio otras, aparte de toser, su pulmón empieza a encharcarse por una reacción natural ante la agresión. La inflamación produce una vasodilatación que hace que todo el líquido de los vasos del pulmón pase al espacio respiratorio, donde se hace el intercambio gaseoso. Muchos de estos pacientes pasan a la fase de neumonía bilateral, intersticial. Como no pueden respirar, sobre todo al principio de la epidemia, que andaban tan perdidos, se les reanimaba e intubaba, “y salían o no salían”.

La siguiente fase es la inflamación de otras cubiertas del tejido intersticial, los tejidos más profundos y más difíciles de atacar. Son los endotelios, es decir, el revestimiento de los vasos sanguíneos, arterias, venas, vasos linfáticos, todos los conductos del cuerpo. Se habla de endotelitis, porque cuando se hacían las autopsias veían que las arterias y, sobre todo, las venas estaban llenas de trombos, pero no porque hubiese nada en la sangre que los estuviera produciendo, sino porque el endotelio se estaba “barriendo”, como el epitelio de los tractos respiratorio y digestivo que acabamos de explicar. El endotelio es el segundo tejido más radiosensible del organismo y cuando se daña propicia los fenómenos de coagulación.

A las dos o tres semanas, pueden aparecer pericarditis y derrames pleurales, que a falta de un test positivo, sobre todo en personas de edad, suelen atribuirse a insuficiencias cardiacas. Cuando los endotelios del pulmón y el corazón, esto es, las membranas que los cubren, están dañados producen agua, la cual causa derrames pleurales y pericárdicos. También pueden aparecer infartos de miocardio y cerebrales.

Para José Luis Sevillano la evolución de la enfermedad no tiene una fácil explicación si tomamos como origen un agente biológico, en este caso un virus. En cambio, todo queda mucho más diáfano si se tiene en cuenta la cronología de una irradiación.

En cuanto a la fase crónica aún no se conoce. Se habla de fibrosis pulmonar. La fibrosis pulmonar está descrita en todos los cuadros de irradiación por radioterapia como neumonitis por radiación. Los síntomas son fiebre, tos seca y dificultad para respirar. Esta secuela puede aparecer al cabo de meses o incluso de años.

Esta investigación no debe caer en saco roto, y alguien debería ponerse manos a la obra para despejar toda sombra de duda. El doctor está esperando que más médicos se unan para establecer protocolos de futuro ante nuevos rebrotes. Ahora bien, personalmente, sigo creyendo que la red 5G está unida íntimamente a la Covid y que forman parte del mismo plan, y lo mismo los famosos chemtrails, de los que nadie habla. Todo está en el HAARP, que solo unos cuantos “locos” conocen. Es perfectamente compatible con el bombardeo electromagnético que, supuestamente, se estaría emitiendo desde las antenas “antiguas”. Hay que llegar al fondo de esto. Es muy preocupante que nos estén dando gato por liebre, lo que equivale a decir que desde el sistema de salud se puedan estar haciendo pasar cuadros radiológicos por cuadros virales. Para ello hacen falta muchos cómplices y ya no estaríamos hablando de desconocimiento, sino de traición a los ciudadanos. ¡Médicos del mundo, no consistáis esto!

Magdalena del Amo
(Fuente: https://www.periodistadigital.com/)

Reblogueado de https://astillasderealidad.blogspot.com/2020/10/medico-denuncia-la-correlacion-entre.html


Until now, the incidence of childhood leukemia, strokes, cancers of all kinds and other diseases caused by radiation from mobile phone waves, had been partially overlapped due to several factors: the lack of conclusive official studies, the bribery of the operators and the silence of the media. I would perhaps add a fourth factor: the lack of user training and information. At this point and with the data in hand, it is not difficult to conclude that we are an irresponsible society that only cares about the immediate, the playful and distractions, in short, about the “bread and circuses.” It is not a trial, much less a conviction, but a description of reality.

Information about it is there to give and give away. The CERENAT study, from 2014, was published in “Occupational Environnement Medicine” and concludes that the use of a mobile phone, even for only thirty minutes, doubles or triples the risk of suffering from a brain tumor. But hardly anyone has found out.

In 2018, the Ramazzini Institute also linked malignant heart schwannoma and glioma to mobile phones. For its part, the macro-study of the National Toxicology Program of the National Institute for Environmental Health and Safety in the United States confirms the evidence of carcinogenicity and heart damage due to the use of mobile radiation. But this is not counted.

As for the youngest sector of the population, the European Commission has in its possession the Mobi-Kids study, a very interesting study carried out in fourteen countries with children and adolescents between the ages of seven and twenty-four, which links the relationship between brain tumors and mobile phones. The former director of epidemiology at the French National Institute of Health and Medical Research, states that the International Agency for Research on Cancer (IARC, for its acronym in English) could raise the classification of “probably carcinogenic” due to its neurotoxicity mechanism . But this is silenced.

The implementation of the 5G network has reopened the debate on the dangerousness of electromagnetic fields, especially when these radiations began to be related to the development of viruses, an end in which several researchers agree. Let’s see briefly what 5G consists of, why it is dangerous, who says it and what they are based on. It is a super-technology that involves the use of high frequencies, between 53 and 58 GHz, which have a greater capacity to penetrate all living matter. People with electromagnetic sensitivity (EMF) will have to get into a bubble to survive, and we are not exaggerating. Many scientists have sounded the alarm, among them Ceferino Maeztu, director of the bioelectromagnetism laboratory at the Center for Biomedical Technology under the Polytechnic University of Madrid. The concern is shared by David Carpenter, co-author of the international report “Bioinitiativa” and director of the New York Institute for Health and Environment, a WHO collaborating center. In his words “it is impossible to say that radio frequencies do not cause cancer.” But citizens are not informed of this.

Scientists not attached to the system agree that there will be more and more cases of childhood leukemia, infertility, heart disease, neurological, psychiatric, cognitive diseases and more cancers of all kinds, especially brain. But it is forbidden to talk about this.

Dr. Magda Havas, a professor of environmental sciences at the Canadian universities of Toronto and Trent, has long warned of the appearance of a third type of diabetes, triggered by electromagnetic pollution. Silence at this.

5G technology is already implemented in several countries. In Spain it is being installed and they plan to have everything ready in December. It will be necessary to do a follow-up by areas and observe the incidence of admitted. In some places, such as Switzerland, their installation was paralyzed and, curiously, they have had much less incidence of Covid, they have not been confined and do not use a mask. As we take from a datasheet, 5G is “a wireless technology that, instead of emitting hundreds of watts of microwave radiation, will emit beams with an effective power of up to tens of thousands of watts of millimeter wave radiation, thereby 20,000 satellites in low orbit are expected to radiate every square centimeter of the planet ”. The scary thing about this is that testing of this technology has resulted in the sudden death of thousands of birds, apart from human symptoms of fatigue, hypoxia, thrombosis, disorientation and restlessness, and others. The citizen is not aware of this either.

The UN and its body the WHO, as well as the EU, the Council of Europe, the governments of all nations and the media have in their possession the dossier that scientists aware of these devastating effects on human life and that of the planet have drawn up and shipped. We have received it in its day and we publish about it. It is a declaration of alarm, in which they request that the deployment of the 5G wireless network, including the 5G network of space satellites, be stopped as a matter of urgency. The reason is the increase in exposure to radiofrequency radiation from telecommunications, which is added to those that are already implemented: 2G, 3G and 4G. They affect their detriment to the environment and cross out 5G as an experiment that has society as a guinea pig, which could be defined as a crime against humanity, if we abide by the letter of International Law.


But what if 5G were not the cause of Covid-19, and the crux was in the antennas already installed from which it is being irradiated? It is a new and very interesting hypothesis. For many months I have been reading and listening to everything alternative that is published about the development of this epidemic and its many fringes. This new approach adds a new piece to the fresco of the epidemic. The working hypothesis is that of the Spanish doctor, based in France, José Luis Sevillano. The interview that José Miguel, from the Surname Obligatorio channel, from which he took this data, went around the world and that’s how we met him.

Dr. Sevillano, from his own experience with Covid patients in recent months, and using epidemiology and medical radiology, has reached some provisional conclusions that must be taken into account. Science is based on observation and verification, therefore, this is pure science. After a few weeks of examining patients with Covid symptoms, the doctor observed that a good part of them lived in a specific area and this caught his attention. Doubting whether there could be any source in that environment that was causing the disease, he decided to inspect the place and found that there was a mobile phone antenna. In the town there are three in total and the 5G network does not yet exist.

With this clue in hand, the deduction was not difficult, especially knowing medical radiology and the chronology of the effects it causes, which, coincidentally, are the same as those seen in Covid patients in their different phases. 5G also produces these effects, but it is not deployed in the area. Could it be that it was radiating at certain times from those antennas? We leave the question in the air.

In an irradiation, the more powerful the emission, the greater the damage caused, and this depends on three factors: the proximity to the source, the exposure time and the age of the person. There is a fourth radiomedical factor which is radiosensitivity, that is, the reaction of human tissue to the same radiation, since not all tissues react the same.

Officially, Covid-19 is a serious acute respiratory disease, caused by Sars-Cov-2. However, Dr. Sevillano, like many other health professionals, including the brilliant Dr. María José Martínez Albarracín, maintains that it is not a respiratory disease, but a systemic inflammatory disease, that is, “it affects the entire organism, it is say, from a hair to the toenails ”. That is why we speak of endothelitis, myocarditis, arteritis, emboli, heart attacks or even dermatitis, in addition to neurological symptoms, such as dizziness, vertigo, headaches, nervousness, agitation or loss of consciousness. Can a virus be the cause of all this or should the focus be directed to electromagnetic radiation as the cause of this complicated disease?

Dr. Sevillano, with his particular nomenclature, tells us about the different pictures of patients diagnosed with Covid-19. The hyperacute are those who die in a matter of hours or even fall round the street asphyxiated. We have seen some of these images, especially in Latin American countries. “When a person is subjected to electromagnetic radiation in high or medium energy proximity, it is easy for him to die in a short time, a few hours or a few days. It may be that he dies from drowning, caused by electromagnetic waves or hemoglobin. Hemoglobin has iron atoms and this would mean a denaturation of these proteins or a blockage of the release of oxygen exchange ”, says Dr. Sevillano, adding that, personally, he has not had cases of this type, perhaps because the antennas of the town in France where you live, are about three hundred meters away. As we have expressed, the further away, the less the damage. A different thing is when the antenna is on the opposite roof. This is called the gradient effect, which does not occur if the cause is a biological agent. It would be necessary to investigate whether these extreme cases of sudden death are related to antennas. There have also been sudden deaths due to failure in the electrical conduction system of the heart, which is also the case in radiation cases.

Acute Covid pictures appear in two or three days and present with vomiting, diarrhea, dry cough, fever and dyspnea, that is, difficulty breathing. According to the explanation of electromagnetic radiation, this occurs because “the first tissues affected by radiation are those with the highest mitotic index, that is, those that reproduce more quickly because they are exposed to greater aggressions. They are the epithelia, that is, the respiratory and digestive covers mainly. These cells are used to the fact that at the slightest trauma they are eliminated, they fall off, they peel, that is, they have to be exchanged quickly, they are made for that. When the body receives an attack, it is the first thing that is eliminated. Thus, when you attack with electromagnetic radiation you have a non-reproductive dry cough, you vomit and you have diarrhea because all the digestive and respiratory epithelia are being eliminated ”. The doctor uses the example of the movie The Widowmaker, based on the true story of the K-19, in which the sailors vomited after approaching the nuclear reactor. This happens in a matter of hours or days.

In the acute phase, the body gets rid of all waste material, through the respiratory and digestive routes. Some people can recover in this stage without further complications, but others, apart from coughing, their lungs begin to flood due to a natural reaction to the aggression. The inflammation produces a vasodilation that causes all the fluid in the lung vessels to pass into the respiratory space, where gas exchange takes place. Many of these patients progress to the phase of bilateral, interstitial pneumonia. Since they cannot breathe, especially at the beginning of the epidemic, when they were so lost, they were resuscitated and intubated, “and they came out or they didn’t come out.”

The next phase is the inflammation of other coverings of the interstitial tissue, the deeper and more difficult tissues to attack. They are the endotheliums, that is, the lining of the blood vessels, arteries, veins, lymphatic vessels, all the ducts of the body. There is talk of endothelitis, because when the autopsies were done they saw that the arteries and, above all, the veins were full of thrombi, but not because there was nothing in the blood that was producing them, but because the endothelium was being “swept”. as the epithelium of the respiratory and digestive tracts that we have just explained. The endothelium is the second most radiosensitive tissue in the body and when it is damaged it favors coagulation phenomena.

After two or three weeks, pericarditis and pleural effusions may appear, which in the absence of a positive test, especially in the elderly, are usually attributed to heart failure. When the endotheliums of the lung and heart, that is, the membranes that cover them, are damaged they produce water, which causes pleural and pericardial effusions. Myocardial and cerebral infarcts can also appear.

For José Luis Sevillano the evolution of the disease does not have an easy explanation if we take as its origin a biological agent, in this case a virus. On the other hand, everything is much more transparent if the chronology of an irradiation is taken into account.

As for the chronic phase, it is not yet known. There is talk of pulmonary fibrosis. Pulmonary fibrosis is described in all radiotherapy irradiation conditions as radiation pneumonitis. Symptoms are fever, dry cough, and shortness of breath. This sequel can appear after months or even years.

This investigation should not fall on deaf ears, and someone should get down to business to dispel any shadow of doubt. The doctor is waiting for more doctors to come together to establish future protocols for new outbreaks. Now, personally, I still believe that the 5G network is closely linked to the Covid and that they are part of the same plan, and the same are the famous chemtrails, which nobody talks about. Everything is in HAARP, which only a few “crazy” know. It is perfectly compatible with the electromagnetic bombardment that, supposedly, would be emitting from the “old” antennas. You have to get to the bottom of this. It is very worrying that they are giving us a hoot, which is to say that the health system may be passing radiological pictures through viral pictures. For this, many accomplices are needed and we would no longer be talking about ignorance, but about betrayal of the citizens. Doctors of the world, do not consist of this!

¿Te acuerdas de un invierno sin un resfriado común?

Reflexiones sobre la crisis del coronavirus y cómo seguir adelante a partir de ahora.

Dr. Daniel Jeanmonod

En el contexto de la actual ola de pánico mundial del COVID-19 abrumadora, este texto tiene como objetivo proporcionar, sobre una base científica diferenciada, una visión diferente de la crisis del coronavirus que la que todavía se presenta de manera predominante en los principales medios de comunicación y es utilizada por muchos gobiernos. y sus expertos para mantener las medidas de protección impuestas a poblaciones enteras.

Se presentarán tanto datos científicos como propuestas basadas en ellos, reuniendo lo que muchos científicos, médicos, economistas y abogados ya han afirmado en los últimos meses. La ola de pánico y el posterior alarmismo no han permitido hasta hoy que estas voces se escuchen lo suficiente. La presente contribución específica se referirá al papel potencialmente nocivo e incluso fatal de las emociones en el contexto de la pandemia de COVID-19.

El Dr. Joel Kettner, profesor de Ciencias de la Salud Comunitaria en la Universidad de Manitoba y Director Médico del Centro Internacional de Enfermedades Infecciosas declaró en marzo de 2020 :

Nunca había visto nada como esto… no hablo de la pandemia, porque he visto 30 de ellas, una cada año… Pero nunca he visto esta reacción, y estoy tratando de entender por qué… ”

El Dr. David Jones declaró recientemente, con respecto a la crisis de la corona, en el New England Journal of Medicine :

La historia sugiere que, en realidad, corremos un riesgo mucho mayor de tener miedos exagerados y prioridades fuera de lugar ”.

Los virus del resfriado común invaden el planeta cada año causando múltiples “pandemias” anuales predominantemente benignas (usando como el Dr. Kettner el término pandemia para definir una distribución viral mundial, sin considerar su peligrosidad). De hecho, producen, en una gran mayoría ( hasta el 99,5% ) de sus infecciones, síntomas leves o nulos como dolor de garganta, secreción / congestión nasal, tos, estornudos o dolor de cabeza.

Representan la enfermedad infecciosa humana más común, los adultos suelen tener dos o tres infecciones por año y los niños incluso más. Están implicados más de 200 tipos de virus, los principales son rino, corona, adeno y enterovirus, así como influenza, parainfluenza, sincitial respiratorio humano y metapneumovirus. Pueden volverse peligrosos principalmente para personas frágiles, enfermas y ancianas, y su letalidad puede llegar hasta el 8% en los hogares de ancianos ( Ioannidis ).

Al igual que el virus de la influenza, mutan regularmente para contrarrestar la protección obtenida por la población humana gracias a su inmunización. Los virus del resfriado común y la influenza producen infecciones del tracto respiratorio (ITR), que son fatales para 2,6 millones de seres humanos por año en todo el mundo ( Roussel ).


Algunas epidemias o pandemias virales del resfriado común (y la gripe) son más fuertes que otras. Duran al menos dos meses, subiendo, estabilizándose y retrocediendo espontáneamente. El episodio pandémico COVID-19 tiene como origen el virus SARS-CoV-2, la última mutación corona. En muchos puntos, obedece a las características típicas de las infecciones por resfriado común.

Por ejemplo, en Italia, el 95% de las muertes ocurrieron en pacientes que padecían de una a tres o más morbilidades preexistentes, y la edad media de los pacientes fallecidos era de 82 años . Esta edad media de mortalidad está muy cerca de la esperanza de vida media de los países desarrollados, por ejemplo, europeos (83,6 años para Suiza).

Muchos estudios han indicado recientemente que al menos el 80% de las infecciones por COVID-19 son de hecho asintomáticas, lo que lleva a una tasa final de letalidad por infección corregida (IFR) de entre 0,1 y 0,2% . Esto es comparable a una pandemia de gripe.


Recientemente, ha surgido la evidencia de que la respuesta inmunológica del organismo humano sigue al menos 4 mecanismos, tres usando anticuerpos y un cuarto un tipo de linfocito, la célula T. Boyman y sus colaboradores estiman que los porcentajes publicados de presencia de anticuerpos positivos en varias poblaciones se pueden multiplicar por 5 (por ejemplo, un resultado del 15% equivale a una inmunización de la población del 60%).

Esto va bien con la evidencia presentada anteriormente de un gran número de infecciones con pocos o ningún síntoma, y ​​representa un porcentaje capaz de proporcionar la denominada inmunidad colectiva.

También se está acumulando firmemente más evidencia de que las inmunizaciones cruzadas entre diferentes cepas corona son frecuentes, de modo que los seres humanos ya infectados anteriormente por otra cepa corona estarán protegidos contra el riesgo de contraer una forma grave e incluso podrían permanecer asintomáticos (ver aquí , aquí , aquí y aquí ).

Esto puede explicar la gran cantidad de formas benignas o incluso asintomáticas en los niños, que comparten sus cargas de virus de manera frecuente y eficiente gracias a sus comportamientos de juego e interacción cercanos.

El hecho de que se pueda desarrollar una cantidad suficiente y eficiente de inmunidad colectiva en la población humana actual encaja bien con la presencia de curvas completas de número de muertes diarias (número de muertes por día) del episodio epidémico de COVID-19 en un gran número de países. De hecho, las curvas de número de muertes diarias han comenzado su regresión desde principios de abril en muchos países del mundo.

Estas curvas manifiestan la dinámica típica de los sistemas biológicos autoorganizados en desequilibrio, desarrollados en este caso entre la población humana y un virus [ 1 ]: la población humana reacciona inmunizando contra el virus, que para su próxima invasión desarrolla una mutación que permite para colonizar nuevamente los organismos humanos.

Para seguir teniendo nuevos huéspedes humanos, tiene sentido que el virus sea letal solo para una pequeña proporción de ellos y mute para contrarrestar la inmunización colectiva humana. Como se mencionó en la Introducción, los virus del resfriado común están continuamente presentes entre nosotros, con fluctuaciones estacionales, y las pruebas positivas recolectadas hoy bien pueden representar la cantidad de presencia viral estacional (ver más abajo).

Las mutaciones y propagaciones virales, así como la inmunización de la población humana, son parte de nuestra realidad biológica planetaria desde que sabemos. La inmunidad obtenida actualmente permite constatar que la mutación corona del SARS-CoV-2 es ahora bien conocida por la población humana, eliminando así el riesgo de una “segunda ola” severa, perfilada repetidamente estos días.

La temerosa expectativa de una “segunda ola” tan severa descansa en la historia de la gripe española: no hay base para una comparación adecuada entre entonces y hoy: en ese momento, no había antibióticos, y la gripe, peor que el resfriado común virus, mata las células de la mucosa, abriendo los tejidos pulmonares a la agresión de bacterias, con estimaciones de hasta el 97% de las muertes en 1918 causadas por sobreinfecciones bacterianas [ 2 ].

Para cuestionar aún más este temor de la “segunda ola”, hay evidencia de la presencia de otra epidemia viral entre las dos guerras mundiales, que causó una infección cerebral y proporcionó una explicación adicional para la presencia de más de un pico.


El recuento de pruebas de PCR positivas, que se presentan regularmente en los medios y que los políticos utilizan actualmente para reinstalar medidas, no es un marcador adecuado para tal fin. Debe usarse solo para contextos de diagnóstico basados ​​en pacientes.

Como se describió anteriormente, los virus del resfriado común están presentes todos los años en la población humana, con máximos invernales. Como hasta hace poco no han recibido mucha atención por parte de virólogos y epidemiólogos, no tenemos idea de cómo se distribuyen exactamente y fluctúan a lo largo de todo el año.

Por lo tanto, no disponemos de datos de referencia o de normas sobre la situación habitual para compararlos con las pruebas positivas registradas ahora: no hay forma de afirmar que los datos actuales sean normales o anormales. Por lo tanto, carece de base científica para introducir la obligación de usar máscaras en diferentes actividades al aire libre y al aire libre, particularmente en un momento en que muchos países presentan una curva de mortalidad diaria completa.

El número de pruebas positivas, que depende directamente del número de pruebas que se realicen, nunca debe utilizarse, sino solo el porcentaje de pruebas positivas. Por el momento, por ejemplo, el porcentaje de pruebas positivas en Suiza es del 3,1% .

Este pequeño porcentaje comprenderá, además de las infecciones activas, una serie de falsos positivos de la prueba de PCR (resultados erróneamente positivos de la prueba), pruebas positivas por reacción a fragmentos virales no infecciosos residuales y otras adicionales debidas a la reacción cruzada con otras cepas corona. .

Como mencionó recientemente el Prof. Gupta , solo la tasa de mortalidad (dada por las cifras de muertes diarias y por el exceso de mortalidad de la población) es realmente relevante para monitorear una situación pandémica. Usar pruebas positivas para hacer esto representa un enfoque científicamente poco sólido. Un enfoque que mantiene una activación permanente de amenaza y miedo en la población.


Al igual que otros virus, incluido el virus de la influenza, la infección por coronavirus puede activar, en un pequeño porcentaje de personas infectadas, una sobrerrespuesta inflamatoria e inmunológica (autoinmune), denominada “tormenta de citocinas”. Éste puede conducir a daños transitorios o potencialmente mortales en los tejidos de los pulmones , y es el mecanismo que origina diferentes trastornos autoinmunes.

En experimentos con animales, se ha demostrado que el estrés activa la muerte celular en el cerebro límbico (conductual / emocional) (ver aquí , aquí y aquí ).

En los seres humanos, hay evidencia firme de que los correlatos de estrés con la aparición de muchas enfermedades [ 3 ] [ 4 ] [ 5 ], incluyendo auto-inmunes queridos .

Un cerebro humano emocional estresado (paralímbico) puede volverse hiperactivo , alterar los tejidos corporales y causar la muerte celular a través de sus múltiples vías de salida.

Estos pueden activar mecanismos excitotóxicos, oxidativos, autoinmunes, inflamatorios, endocrinos y vegetativos. Por lo tanto, las emociones humanas negativas como el miedo, la tristeza y la ira están en condiciones de poner en peligro la salud humana, hasta un nivel fatal . Esto ha sido descrito en el campo de la antropología a través de la descripción de la evolución potencialmente fatal después de la práctica chamánica de los hombres kurdaitcha llamada “señalar el hueso” . Consiste en señalar a la víctima un hueso ritual que activa una letal “lanza del pensamiento” que le induce a la muerte, sin gran sufrimiento, durante días o semanas.

Este ritual puede haber servido a los hombres kurdaitcha a lo largo de los milenios cuando un miembro de su comunidad se volvía peligroso. El poder de una idea y su emoción relacionada, es decir, el miedo y la convicción de la necesidad de morir, se ejemplifica aquí de la manera más impresionante.

También se pueden citar, entre muchas otras enfermedades basadas en el estrés, la miocardiopatía por estrés de Takotsubo o síndrome del corazón roto.

Una integración del factor psicoemocional, tan importante en la medicina humana en general, se vuelve inmensamente relevante en el contexto de la crisis de la corona: las evoluciones dramáticas hasta fatales (ver más abajo) deben ser consideradas como causadas por el aislamiento social y las medidas de confinamiento que conducen a la reducción / supresión de la libertad democrática y los derechos y actividades humanos básicos. Aquí se proponen tres factores para co-influir directamente en la cantidad de casos críticos y muertes:

  1. el nivel de referencia de ansiedad en una población humana determinada
  2. la supresión de la libertad mediante la limitación de los derechos humanos democráticos
  3. la supresión de interacciones humanas básicas mediante el aislamiento y el confinamiento.

La ruptura de los lazos sociales es un problema grave para todas las sociedades de primates, y en los primates no humanos, el aislamiento en sí mismo puede conducir a la muerte.

El análisis de la mortalidad de una población con el objetivo de comprobar si existe el llamado exceso de mortalidad, permite documentar si una determinada epidemia es particularmente peligrosa y, por lo tanto, provoca una tasa de muertes inusual. En algunos países o regiones, efectivamente se han registrado picos de mortalidad excesiva, que han retrocedido por completo desde mediados de mayo .

Tenemos que integrar que un porcentaje del exceso de mortalidad secundaria relacionado con el COVID-19 se deberá 1) al estrés, principalmente miedo y pánico, asociado a la amenaza de pandemia, pero también 2) a las consecuencias del bloqueo general aplicado y medidas de aislamiento.

Solo por mencionar algunos: desestabilización psicosocial y económica con aumentos de violencia, estados ansio-depresivos y suicidios, descompensación de la fragilidad de la salud por aislamiento social, desestabilización de individuos psiquiátricos y dementes, reducción de la atención médica a toda la población (principalmente en el dominios de la atención del cáncer y los trastornos cardiovasculares) y la reducción de la calidad de la atención en los hogares y hospitales.

Después de haber sobrecargado hospitales y consultorios médicos, la gente los rehuía y se mostraba reacia a visitarlos, se quedaba en casa y corría el riesgo de evoluciones peligrosas y muerte sin las intervenciones terapéuticas adecuadas.

Además, los gobiernos bloquearon los tratamientos electivos y las intervenciones en los hospitales, con el riesgo de una mayor morbilidad y mortalidad. Estudios recientes indican una mayor mortalidad de la técnica de intubación, que inicialmente fue promulgada ampliamente por los médicos chinos, en comparación con el suministro mucho menos drástico de oxígeno mediante máscara o tubo nasal . El bloqueo general impidió también una optimización de la protección de los asilos de ancianos, donde, como se esperaba, ocurrieron la mayoría de las muertes.

Se puede esperar que el exceso de mortalidad como consecuencia de las medidas de bloqueo general , ya en la actualidad , esté en el rango de los 100 mil (por ejemplo, entre muchos otros, 10,000 muertes adicionales por demencia no causadas por COVID en el Reino Unido).

Se deben hacer dos últimos comentarios sobre la letalidad / exceso de mortalidad de COVID-19:

  1. En muchos países se han implementado diferentes métodos de certificación cuestionables hasta totalmente inadecuados (por ejemplo, certificados de defunción COVID-19 basados ​​en sospecha, sin pruebas ni autopsias), lo que ha dado lugar a valores de letalidad inapropiadamente altos.
  2. un análisis italiano ha demostrado que 88% de todas las muertes atribuidas al virus SARS-CoV-2 ocurrió de hecho en presencia de, pero no debido a que, por lo tanto las expresiones a morir de o a morir con el virus.

Aquí hay que integrar un contexto multicausal que conduce a un problema fatal, siendo el virus la gota de agua que hace que el jarrón se desborde [ 6 ] para personas frágiles, enfermas y ancianas, debido a condiciones premórbidas, combinaciones virales 46 y sobreinfecciones bacterianas [ 2 ].


Las medidas generales de confinamiento / encierro y aislamiento han llevado a la distribución mundial por los medios de imágenes y situaciones aterradoras, por ejemplo, familias chinas encerradas (¡con pernos y tornillos!) En sus apartamentos, calles muertas de Wuhan barridas con desinfectantes, pacientes rodeados de extraterrestres. médicos y enfermeras totalmente enmascarados y disfrazados, control policial que mantiene el cierre total de las aldeas del norte de Italia, etc.

Cualquier ser humano llevado a la unidad de cuidados intensivos y al darse cuenta de que ya no es libre para dejar toda esta pesadilla, para volver a casa con su familia, experimentó sin ninguna duda el peor estrés emocional posible: estar atrapado indefenso en una vida. -Situación amenazante.

El miedo a no sobrevivir, la soledad desesperada y el pánico invaden el cerebro emocional, los mecanismos de defensa caen y pueden abrir el camino a una infección viral en toda regla potencialmente mortal . El confinamiento puede aumentar además la vulnerabilidad del organismo humano a nuevos patógenos, como pudo haber sido el caso del confinamiento de guerra al final de la Primera Guerra Mundial durante el desarrollo de la pandemia de gripe de 1918 .

La evidencia de la relevancia y la eficiencia muy parcial de las medidas generales de confinamiento la proporciona la ausencia de un mayor número de muertos experimentado por Suecia, que tiene una tasa de mortalidad incluso más baja que países como el Reino Unido y España, donde estas medidas se aplicaron en gran medida.

La aplicación de medidas generales de distanciamiento y confinamiento conduce inevitablemente a una gran cantidad de decisiones cuestionables o incluso inmanejables. El tema de la adopción de medidas más o menos estrictas crea inevitablemente fracturas dentro de los grupos sociales.

Peor aún, diferentes medidas, que tienen un mínimo o incluso ningún sentido, han sido impuestas por los estados y empujadas por personas y grupos temerosos, invadiendo la libertad democrática y los derechos humanos básicos. Es evidente que no es deseable que la gente se vea limitada, controlada o amenazada por el gobierno que ha elegido.

Un ejemplo de una medida de bloqueo cuestionable son los cierres de escuelas. Esta medida no está basada en evidencias, es decir, no hay ningún estudio científico disponible que demuestre su eficacia, se ha introducido de un país a otro porque otro país lo había hecho antes.

Dejar que los niños interactúen en la escuela y en el patio de recreo (y dejar que los adultos activos trabajen y también interactúen) puede verse como la mejor manera de promover la inmunidad colectiva, que debe desarrollarse lo más rápido posible para reducir el tiempo de exposición de las personas mayores, frágiles y enfermas. .

Por casualidad y lo que es más importante, los niños y los adultos activos sanos tienen un riesgo absolutamente mínimo de estar en peligro por el SARS-CoV-2 . Por tanto, existen sólidas razones para dudar de la utilidad de la introducción de esta medida e incluso para considerarla contraproducente.

Encerrar a las personas en el interior y cerrar los espacios públicos y naturales, especialmente los parques de las ciudades, son medidas sin sentido: el contacto con la naturaleza y el aire puro y los movimientos son tan imprescindibles como ir al trabajo, son de suma importancia para la salud de todos, optimizando las defensas corporales contra las agresiones. Se ha exigido a la gente que mantenga la distancia en las calles, pero no se confiaba en que hiciera lo mismo en los parques o en las playas, donde había más espacio para mantener la distancia.

Encerrar a las personas en el interior ha sido una medida sin sentido y deletérea, y uno puede preguntarse cómo los habitantes de las grandes ciudades podrían enfrentarlo. Se ha escuchado de las experiencias de personas mayores encerradas en sus habitaciones en hogares de ancianos, recibiendo su comida frente a su puerta cerrada en ausencia del proveedor, y visitas de familias que se asemejan a una visita a la cárcel …

La supresión / limitación del acceso a los dominios médico y espiritual fue totalmente inapropiada, perjudicial e inhumana. No respetó los derechos humanos básicos del cuidado del cuerpo, la mente y el alma. No solo los pacientes con COVID-19, sino también todos los demás pacientes hospitalizados por otras razones, no pudieron obtener sus visitas.

En general, pero particularmente en medio de una crisis, el apoyo de los seres queridos satisface las necesidades sociales y espirituales que nunca deben ser tocadas o retiradas, corriendo el riesgo de alienar al ser humano de su entorno vital psicosocial y espiritual.

¿Por qué un familiar cercano que lo visita no puede aplicar las mismas precauciones de seguridad en el hospital que el personal médico? Y los servicios religiosos podrían haberse realizado con las mismas recomendaciones a distancia que para otras sesiones civiles, que se han mantenido por considerarse indispensables.

Las medidas generales de confinamiento, debido a su peligrosidad psicosocial, deben mantenerse solo en el contexto de una letalidad epidémica excepcionalmente alta. Ahora que está claro, al contrario de lo que ha propagado la OMS, que no estamos ante un virus asesino con una tasa de letalidad del 3,4% y, por tanto, 30 veces más mortal que la gripe, estas medidas impuestas deberían abandonarse por completo.

Obviamente, el aislamiento de las personas enfermas y las medidas habituales de precaución o aislamiento para reducir la transmisión viral alrededor de las personas ancianas, enfermas y frágiles siguen siendo relevantes como siempre.

Vista en el plano ético, la crisis de la corona resalta el hecho de que cualquier limitación considerada del derecho a la autodeterminación, la libertad y los derechos humanos básicos debería basarse en un análisis multidisciplinario sólido, profundo, abierto y equilibrado, con un claro positivo. relación riesgo / beneficio. Tendría que ser presentado a la gente y votado.

Con la crisis de la corona, hemos acumulado, en ausencia de tal análisis, daños colaterales severos, con medidas aplicadas contra una amenaza que no las justificaba.


El seguimiento de las personas infectadas puede cuestionarse tanto desde el punto de vista ético como desde el de la eficiencia.

Primero, el control de la población en sí mismo representa una brecha inaceptable en la esfera privada de los ciudadanos, y todo grupo humano debe defenderse de cualquier intento de limitar su libertad democrática.

En segundo lugar, la rapidez con la que los países europeos, por ejemplo, perdieron la pista de la cadena desde los “pacientes 1” en adelante, subraya una propagación viral extremadamente rápida y eficiente bien conocida, cuestionando la posibilidad de detenerla rastreando virus y portadores en la población humana.

Esto sucedió en el norte de Italia en cuestión de uno o dos días ya pesar de las medidas de confinamiento muy rápidas y extensas. Se han mencionado muchos ejemplos adicionales en los que no se pudieron encontrar explicaciones para la transmisión viral. Al igual que para las medidas de confinamiento (ver arriba), tal rastreo solo debería ser considerado en el caso de alta peligrosidad, ausente para COVID-19.

Finalmente, la OMS no recomienda el rastreo de contactos en el manejo de epidemias de influenza .


En el campo mundial intensivo y extenso de la crisis de la corona, es fundamental un estudio abierto, profundo, cuidadoso, multidimensional y, por lo tanto, imparcial de toda la situación con presentación de pros y contras y análisis de balance de riesgo / beneficio.

Esto no se proporcionó y no se han proporcionado diálogos abiertos entre diferentes puntos de vista de la situación. Los expertos científicos y médicos, principalmente microbiólogos y epidemiólogos, son los que brindan información relevante a los políticos. Tendrán que darse cuenta de que han tenido en sus manos el poder de modular el estado mental de todo el planeta humano, activando una poderosa reacción en cadena mundial de miedo y pánico.

Los medios tienen y aún transmiten una cantidad muy dominante de información que activa el pánico y mantiene el miedo en toda la población humana. Los hechos de la corona se distorsionan continuamente, números sacados del contexto epidemiológico habitual para inducir miedo.

La amenaza se ha mantenido hasta el día de hoy sobre la inminente posibilidad de reinstalaciones impuestas de medidas de protección, aislamiento y confinamiento y ampliamente retransmitida por los principales medios de comunicación, consolidando un estado de expectación temerosa y de amenaza y fatalidad a largo plazo. Ahora el pueblo debe quedar en paz y debe recuperar su autodeterminación.

Ha habido muy poco debate sobre el tema de la ética en relación con las limitaciones de la libertad, la libre determinación y los derechos humanos básicos. Recientemente, por ejemplo en Alemania y en nuestro país, los movimientos populares y políticos han comenzado a levantarse contra el insidioso riesgo para la democracia de una dictadura de salud impuesta por el estado.

Algunos epidemiólogos que gozan de posiciones de poder como asesores estatales han perfilado repetidamente pronósticos de muerte catastrófica, basándolos en modelos digitales y, afortunadamente, en gran medida más allá de la realidad biológica. En nuestro país, los pronósticos se produjeron efectivamente con un número de muertos entre 22.000 y 60.000 con pico en junio o julio , mientras que hasta el día de hoy el número de muertos en Suiza se sitúa entre 1.700 y 1.800.

Evidentemente, se han aplicado postulados de modelos cuestionables e incluso erróneos, pero estos expertos no parecen estar preparados para reconocer sus errores, con sus devastadoras consecuencias a nivel mundial.

En diferentes países se ha desarrollado un episodio preocupante relacionado con el tratamiento del COVID-19 con el fármaco hidroxicloroquina (HCQ), conocido desde hace años en el tratamiento de la malaria. Es muy interesante y probablemente directamente relevante que esta molécula haya sido reconocida desde hace años como eficaz también contra enfermedades autoinmunes (ver arriba). Al principio, colegas chinos , franceses ( dos veces ), alemanes y estadounidenses (nuevamente, dos veces ) han tratado a pacientes con COVID con HCQ y han publicado sus resultados positivos.

La evidencia de que el tratamiento con HCQ puede reducir la tasa de mortalidad hospitalaria está creciendo de manera constante , lo que plantea una pregunta central sobre la resistencia o incluso la prohibición de usar esta opción de medicación en algunos países.

Por ejemplo, un gobierno europeo y sus expertos, insistiendo en la necesidad de esperar estudios sólidos basados ​​en evidencia pero sin considerar la urgencia de la situación, prohibieron la prescripción de HCQ por parte de los médicos. Esto fue respaldado por un estudio en The Lancet, que afirma no solo la ausencia de beneficio con la ingesta de HCQ, sino también un aumento de las complicaciones cardíacas y una mayor mortalidad . Pronto, se presentó la evidencia de que esta publicación era fraudulenta y tuvo que ser retractada.

Aquí se deben hacer dos observaciones muy preocupantes:

1) se cuestiona la ética de publicación de grupos médicos y científicos que reclaman el más alto nivel de calidad científica, y

2) los gobiernos, al prohibir la prescripción de HCQ, han bloqueado la relación paciente-médico, éticamente fundamental e intocable.

Los expertos políticos y médicos se han presentado aquí bajo la peor luz posible. También debe destacarse que la disponibilidad actual de un medicamento de bajo costo contra el SARS-CoV-2 muestra todo el tema de la vacunación bajo una luz diferente, dejando tiempo para realizar una investigación adecuada hacia una vacunación segura y eficiente para personas frágiles, enfermas y ancianas, simplemente en cuanto a la gripe. De hecho, la letalidad de COVID-19 no implica ningún requisito para una vacunación de amplio espectro.

No es una locura preguntarse por un posible brote de SARS-CoV-2 en un laboratorio, ya que se han considerado posibles manipulaciones de laboratorio o errores de contención para la gripe porcina o incluso afirmados para la gripe aviar y la primera mutación corona del SARS60.

Es el papel de los expertos científicos y políticos descubrir y suprimir cualquier investigación sobre virus que pueda dar lugar a nuevas cepas potencialmente peligrosas, y la OMS debería hacer cumplir ese control en todo el mundo. Además, las reflexiones sobre el cuidado y el mantenimiento de los animales en todo el mundo son muy relevantes.


El miedo y el pánico por el COVID-19, avivado por comunicaciones científicas inexactas se extendieron por todo el planeta como un incendio forestal, provocando el caos que observamos todos los días en las noticias. La crisis de la corona ha sacado a la luz que el planeta humano tiene actualmente un alto nivel de ansiedad y debe ser tratado con delicadeza, ¡como un paciente humano en una fase sensible de su vida!

Sobre la base de los datos mencionados anteriormente, se puede afirmar que la pandemia de COVID-19 debería haberse tratado desde el principio como una pandemia de gripe habitual, con protección centrada en los frágiles, enfermos y ancianos, que habrían exigido y recibido los medidas de protección para sí mismos, pero sin obligaciones contraproducentes y limitación de sus actividades y libertad.

Las personas ancianas y debilitadas pueden exigir en cualquier momento medidas de aislamiento voluntarias de su entorno familiar, social y de enfermería. Los hogares de ancianos deben tener máscaras y desinfección de manos a disposición del personal y las familias, si los residentes desean protección. Los miembros del personal no deben trabajar en más de una casa. Se debe inducir a los residentes a salir y caminar (¡por ejemplo, en los parques de la ciudad que se mantienen abiertos!).

La restricción de la libertad y el aislamiento impuestos son inhumanos, contraproducentes y hasta letales para los residentes ancianos y debilitados. En Alemania, ciudadanos alemanes de entre 64 y 78 años dirigieron una petición a la Sra. Merkel, exigiendo autodeterminación y elección en temas relacionados con el final de la vida, y reclamando su preferencia por una muerte digna en medio de sus seres queridos. en lugar de un fallecimiento aislado y despiadado impuesto por el estado.

La propuesta aquí no es extender reproches sobre las medidas tomadas abruptamente y bajo una enorme presión por parte de los gobiernos durante los primeros dos o tres meses del desarrollo de la pandemia. Sin embargo, con los datos disponibles hoy y de hecho concluyentes al menos desde mayo, debe tenerse en cuenta que las medidas generales de confinamiento, aislamiento, distanciamiento y localización deben detenerse en todos los países donde se ha superado el pico de muertes diarias.

Las medidas generales de bloqueo contra COVID-19 ya han contribuido al exceso de mortalidad experimentado en diferentes países y discutido anteriormente. Mantenerlos sería inútil y perjudicial. Los niños y los adultos que trabajan deben interactuar para que la población humana obtenga lo antes posible una inmunidad colectiva suficiente, protegiendo así a los ancianos y frágiles.

La salida progresiva del encierro es una trampa emocional: regocijarse de que las cosas vuelvan a ser más normales se opone constantemente a la ansiosa expectativa de que el desbloqueo sea demasiado rápido, a pesar de la tranquilizadora evidencia científica mencionada anteriormente.

Los medios de comunicación deben transmitir información de todos los entornos y tendencias posibles. Sin embargo, han proporcionado a la población mundial una avalancha de información sesgada homogéneamente que mantiene el mensaje dominante que activa el pánico sobre una supuesta peligrosidad alta del COVID-19.

Con suerte, pronto recibirán el mensaje de no ejercer presiones sobre los políticos en el futuro, y de ser profundamente conscientes de que pueden contribuir a la activación mundial de poderosos mecanismos ansiogénicos, si no proporcionan información equilibrada de fuentes controladas.

Una “nueva normalidad” para nuestro futuro solo puede tener sentido si se centra en una comprensión más profunda de la dinámica integradora entre nosotros y los virus.

Como los virus necesitan que existamos, y como los procesos de la vida siempre parecen tener sentido, podemos considerar que la pesadilla del virus asesino planetario global seguirá siendo objeto de interés para los productores de películas y los aficionados a las emociones fuertes. De hecho, no hay forma de que podamos concebir la vida sin virus. Están en todas partes, alrededor del 50% de nuestro propio genoma es de origen viral, y bien pueden ser “más amigos que enemigos” [ 7 ].

Nuestro principal enemigo es el miedo activado por una ciencia sesgada y despiadada, por los medios propagandistas y por políticos temerosos. Las pandemias más antiguas, que son la fuente de profundos recuerdos de la plaga atávica, se debieron en la mayoría de los casos a bacterias y estaban estrechamente relacionadas con las precarias condiciones de vida humana.

La única pandemia viral catastrófica fue la gripe H1N1 de 1918, que mató a millones de personas, pero se desarrolló en las caóticas y malsanas secuelas de la Primera Guerra Mundial. El pánico no es una forma apropiada, ni siquiera factible, de integrar nuestra vida con los virus.

Traería un futuro lleno de temor por la próxima pandemia y la desestabilización del entorno psicológico y económico humano en todo el mundo. Un cambio de actitud profundo y definitivo debe suscitarse ahora en los contextos científicos y sociopolíticos adecuados, para evitar un futuro tan sombrío e indeseable.


1. Los virus corona son uno de los agentes virales del resfriado común que, al igual que la gripe, invade cada año todo el planeta. Causan pandemias anuales de infecciones del tracto respiratorio ampliamente generalizadas, en su mayoría benignas.

2. COVID-19, la infección causada por el SARS-CoV-2, la actual mutación corona, no es más letal que la gripe, con una tasa de mortalidad por infección del 0,1% al 0,2%.

3. Una inmensa mayoría (95%) de las evoluciones fatales ocurren en personas ancianas y frágiles con premorbilidades, con una edad promedio de muerte de 80 años o más.

4. Los estudios de anticuerpos, la inmunización cruzada con otras cepas corona y la finalización de la curva del número de muertos en muchos países son pruebas sólidas de que la población humana está desarrollando inmunidad colectiva contra el SARS-CoV-2. En este contexto, es improbable que se produzca una “segunda ola” severa de SARS-CoV-2. Más bien podemos esperar un nuevo episodio de resfriado como cada año, pero de intensidad regular o incluso débil gracias a la inmunidad colectiva ganada.

5. La prueba de PCR de la presencia de SARS-CoV-2 no proporciona ninguna evidencia de pronóstico confiable de su poder infeccioso y letalidad. El seguimiento del estado y la evolución de la pandemia viene dado únicamente por la evolución diaria de las muertes. En Suiza, como en muchos otros países, ya no existe un exceso de mortalidad atribuible a la pandemia de COVID-19. La tasa de pruebas positivas es baja (alrededor del 3%), y las pruebas tienen como siempre una tasa técnica de falsos positivos y reaccionan a fragmentos virales inactivos oa otras cepas corona.

6. Solo en un pequeño porcentaje de pacientes con COVID-19, el virus SARS-CoV-2 puede, al igual que el virus de la gripe, activar una sobrerrespuesta inmunológica e inflamatoria, causando en el peor de los casos una falla orgánica pulmonar fatal.

El estrés y las emociones como el miedo, la ira y la tristeza pueden 1) estimular esta respuesta exagerada, 2) causar la muerte celular en el cerebro emocional y 3) desencadenar en él hiperactividades deletéreas, con el resultado de daños celulares en los tejidos corporales.

Las medidas generales de aislamiento, distanciamiento y encierro, al limitar los contactos sociales, la libertad y los derechos humanos básicos, aumentan el número de muertos a través de un aumento de la desestabilización psicosocial y económica, el empeoramiento de las personas psiquiátricas y dementes y la reducción de la atención médica a toda la población. Por lo tanto, tenemos una causalidad combinada para un exceso de mortalidad de COVID-19, una parte significativa no se debe al virus SARS-CoV-2 en sí, sino a la ola de pánico mundial del COVID-19 y la introducción impuesta de medidas drásticas e inhumanas. .

7. No estamos ante el temido virus asesino planetario, a pesar del inapropiado mensaje inicial de la OMS y diferentes expertos. Los datos presentados hablan de una parada urgente de todas las medidas generales de encierro, distanciamiento y aislamiento. El mundo debería volver al enfoque apropiado y aplicado de forma rutinaria a los virus respiratorios: mantener medidas de protección óptimas para los ancianos, los frágiles y los enfermos, como todos hemos aprendido a hacer año tras año contra la gripe.

8. Los virus del resfriado común (y la gripe) son omnipresentes en el espacio (en todo el planeta) y en el tiempo (año tras año). Por tanto, son inevitables, pero afortunadamente provocan en su mayoría infecciones benignas. Solo necesitamos proteger específicamente a las poblaciones en riesgo cuando una ola viral se vuelve más fuerte de lo habitual.

Texto actualizado y ampliado a partir de la contribución “¡Piensa en profundidad, haz buena ciencia y no te asustes!”, De D. Jeanmonod, R. Jeanmonod y F. Neirynck, publicado por off-guardian.org el 7 de abril de 2020 .
Daniel Jeanmonod MD, profesor emérito de neurocirugía en la Universidad de Zürich y de fisiología y neurociencia en la Universidad de Nueva York

Referencias: –

[1] Smolin L. La vida del cosmos . Prensa de la Universidad de Oxford (1997).

[2] Raoult D. Épidémies, vrais danger et fausses alertes. De la grippe aviaire au COVID-19 . Michel Lafon (2020).

[3] Medicina holística Pelletier KR , del estrés a la salud óptima . Prensa Delacorte (1979)

[4] Pelletier KR Mind como Healer, Mind como Slayer . Allen y Unwin (1979)

[5] Simonton OC y col. Mejorarse de nuevo . Libros bantam (1978)

[6] Reiss K. y Bhakdi S. Corona Fehlalarm? Zahlen, Daten und Hintergründe . Goldegg Verlag (2020)

[7] Moelling K. Virus, más amigos que enemigos . Publicaciones científicas mundiales (2017).


Al fin algo de cordura: carta de médicos y profesionales de la salud belgas sobre COVID

Nosotros, médicos y profesionales de la salud belgas, deseamos expresar nuestra seria preocupación por la evolución de la situación en los últimos meses en torno al brote del virus SARS-CoV-2. Hacemos un llamado a los políticos para que estén informados de manera independiente y crítica en el proceso de toma de decisiones y en la implementación obligatoria de las medidas corona. Solicitamos un debate abierto, donde todos los expertos estén representados sin ningún tipo de censura. Después del pánico inicial que rodeó al covid-19, los hechos objetivos ahora muestran una imagen completamente diferente: ya no hay justificación médica para ninguna política de emergencia .

La actual gestión de crisis se ha vuelto totalmente desproporcionada y causa más daño que bien.

Pedimos el fin de todas las medidas y pedimos una restauración inmediata de nuestra gobernanza democrática y estructuras legales normales y de todas nuestras libertades civiles.

Libertades civiles

‘Pedimos la restauración inmediata de nuestras libertades civiles’

‘Una cura no debe ser peor que el problema’ es una tesis más actual que nunca en la situación actual. Sin embargo, observamos que el daño colateral que ahora se está causando a la población tendrá un mayor impacto a corto y largo plazo en todos los sectores de la población que el número de personas que ahora están protegidas del corona virus

En nuestra opinión, las actuales medidas sobre el corona y las estrictas sanciones por su incumplimiento son contrarias a los valores formulados por el Consejo Supremo de Salud de Bélgica, que, hasta hace poco, como autoridad sanitaria, siempre ha asegurado una medicina de calidad en nuestro país: “Ciencia – Experiencia – Calidad – Imparcialidad – Independencia – Transparencia”. (1)

Creemos que la política ha introducido medidas obligatorias que no están suficientemente fundamentadas científicamente, dirigidas unilateralmente, y que no hay suficiente espacio en los medios para un debate abierto en el que se escuchen diferentes puntos de vista y opiniones. Además, cada municipio y provincia tiene ahora la autorización para incorporar sus propias medidas, fundamentadas o no.

Además, la estricta política represiva sobre el corona contrasta fuertemente con la política mínima del gobierno en lo que respecta a la prevención de enfermedades, fortaleciendo nuestro propio sistema inmunológico a través de un estilo de vida saludable, una atención óptima con atención al individuo y la inversión en personal de atención. (2)

El concepto de salud

En 1948, la OMS definió la salud de la siguiente manera: “La salud es un estado de completo bienestar físico, mental y social y no meramente la ausencia de enfermedad u otro impedimento físico”. (3) La salud, por tanto, es un concepto amplio que va más allá de lo físico y también se relaciona con el bienestar emocional y social del individuo. Bélgica también tiene el deber, desde el punto de vista de la suscripción de los derechos humanos fundamentales, de incluir estos derechos humanos en su toma de decisiones cuando se trata de medidas adoptadas en el contexto de la salud pública. (4)

Las actuales medidas globales adoptadas para combatir el SARS-CoV-2 violan en gran medida esta visión de la salud y los derechos humanos. Las medidas incluyen el uso obligatorio de máscarillas  (también al aire libre y durante las actividades deportivas, y en algunos municipios, incluso cuando no hay otras personas en los alrededores), el distanciamiento físico, el aislamiento social, la cuarentena obligatoria para algunos grupos y las medidas de higiene.

La pandemia predicha con millones de muertes

Al comienzo de la pandemia, las medidas eran comprensibles y contaban con un amplio apoyo, incluso si había diferencias en la implementación en los países que nos rodean. La OMS predijo originalmente una pandemia que cobraría un 3,4% de víctimas, es decir, millones de muertes, y un virus altamente contagioso para el que no se disponía de tratamiento ni vacuna. Esto pondría una presión sin precedentes sobre las unidades de cuidados intensivos (UCI) de nuestros hospitales.

Esto condujo a una situación de alarma global, nunca vista en la historia de la humanidad: el “aplanamiento” de  la curva” estuvo representado por un bloqueo que cerró a toda la sociedad y la economía y puso en cuarentena a las personas sanas. El distanciamiento social se convirtió en la nueva normalidad antes de una vacuna de rescate.

Los hechos sobre covid-19

Gradualmente, la campana de alarma fue sonando desde muchas fuentes: los hechos objetivos mostraban una realidad completamente diferente. (5, 6)

El curso de covid-19 siguió el curso de una ola normal de infección similar a una temporada de gripe. Como cada año, vemos una mezcla de virus de la gripe siguiendo la curva: primero los rinovirus, luego los virus de influenza A y B, seguidos de los coronavirus. No hay nada diferente a lo que vemos normalmente.

John Magufuli

Presidente John Magufuli de Tanzania: “Incluso la papaya y las cabras están dando resultado corona positiva”

El uso de la prueba de PCR inespecífica, que produce muchos falsos positivos, mostró un panorama exponencial. Esta prueba se apresuró a realizar con un procedimiento de emergencia y nunca se autocomprobó seriamente. El creador advirtió expresamente que esta prueba estaba destinada a la investigación y no al diagnóstico. (7)

La prueba de PCR funciona con ciclos de amplificación de material genético: cada vez se amplifica una parte del genoma. Cualquier contaminación (por ejemplo, otros virus, restos de genomas de virus antiguos) puede dar como resultado falsos positivos. (8)

La prueba no mide cuántos virus hay en la muestra. Una infección viral real significa una presencia masiva de virus, la llamada carga de virus.Si alguien da positivo, esto no significa que esa persona en realidad esté clínicamente infectada, esté enferma o vaya a enfermarse . El postulado de Koch no se cumplió (“El agente puro que se encuentra en un paciente con quejas puede provocar las mismas quejas en una persona sana”).

Dado que una prueba de PCR positiva no indica automáticamente una infección activa o infectividad, esto no justifica las medidas sociales tomadas, que se basan únicamente en estas pruebas. (9, 10)


Si comparamos las oleadas de infección en países con políticas estrictas de bloqueo con países que no impusieron bloqueos (Suecia, Islandia…), vemos curvas similares. Por tanto, no existe ningún vínculo entre el bloqueo impuesto y el curso de la infección. El bloqueo no ha dado lugar a una tasa de mortalidad más baja.

Si miramos la fecha de aplicación de los bloqueos impuestos, vemos que los bloqueos se establecieron después de que el pico ya había pasado y el número de casos disminuyó. Por tanto, la caída no fue el resultado de las medidas adoptadas. (11)

Como cada año, parece que las condiciones climáticas (clima, temperatura y humedad) y la creciente inmunidad tienen más probabilidades de reducir la ola de infección.

Nuestro sistema inmunológico

Durante miles de años, el cuerpo humano ha estado expuesto diariamente a la humedad y a las gotitas que contienen microorganismos infecciosos (virus, bacterias y hongos).

La penetración de estos microorganismos se evita mediante un mecanismo de defensa avanzado: el sistema inmunológico. Un sistema inmunológico fuerte depende de la exposición diaria normal a estas influencias microbianas. Las medidas excesivamente higiénicas tienen un efecto perjudicial sobre nuestra inmunidad. (12, 13) Solo las personas con un sistema inmunológico débil o defectuoso deben protegerse mediante una higiene intensiva o un distanciamiento social.

La influenza reaparecerá en otoño (en combinación con el covid-19) y una posible disminución de la capacidad de recuperación natural puede provocar más víctimas.

Nuestro sistema inmunológico consta de dos partes: un sistema inmunológico congénito no específico y un sistema inmunológico adaptativo.

El sistema inmunológico inespecífico forma una primera barrera: piel, saliva, jugo gástrico, moco intestinal, células ciliadas vibratorias, flora comensal,… y evita la adhesión de microorganismos a los tejidos.

Nuestro sistema inmunológico puede vencer al covid 19

Nuestro sistema inmunológico encuentra naturalmente
sus defensas contra el covid-19

Si se adhieren, los macrófagos pueden hacer que los microorganismos se encapsulen y destruyan.

El sistema inmunológico adaptativo está formado por inmunidad de las mucosas (anticuerpos IgA, producidos principalmente por células en el intestino y el epitelio pulmonar), inmunidad celular (activación de células T), que puede generarse en contacto con sustancias extrañas o microorganismos, e inmunidad humoral (IgM y anticuerpos IgG producidos por las células B).

Investigaciones recientes muestran que ambos sistemas están muy enredados.

Parece que la mayoría de las personas ya tienen inmunidad congénita o general a, por ejemplo, la influenza y otros virus. Esto es confirmado por los hallazgos en el crucero Diamond Princess, que fue puesto en cuarentena debido a que algunos pasajeros murieron de covid-19. La mayoría de los pasajeros eran ancianos y se encontraban en una situación ideal de transmisión en el barco. Sin embargo, el 75% no parecía estar infectado. Entonces, incluso en este grupo de alto riesgo, la mayoría eran resistentes al virus.

Un estudio en la revista Cell muestra que la mayoría de las personas neutralizan el coronavirus mediante la inmunidad mucosa (IgA) y celular (células T), mientras experimentan pocos o ningún síntoma. (14)

Los investigadores encontraron hasta un 60% de reactividad del SARS-Cov-2 con las células T CD4 + en una población no infectada, lo que sugiere una reactividad cruzada con otros virus del resfriado (corona). (15)

Por lo tanto, la mayoría de las personas ya tienen una inmunidad congénita o cruzada porque ya estaban en contacto con variantes del mismo virus.

La formación de anticuerpos (IgM e IgG) por las células B solo ocupa una parte relativamente pequeña de nuestro sistema inmunológico. Esto puede explicar por qué, con un porcentaje de anticuerpos del 5-10%, puede haber una inmunidad de grupo de todos modos. La eficacia de las vacunas se evalúa precisamente en función de si tenemos o no estos anticuerpos. Esta es una tergiversación.

La mayoría de las personas que dan positivo en la prueba (PCR) no tienen quejas. Su sistema inmunológico es lo suficientemente fuerte. Fortalecer la inmunidad natural es un enfoque mucho más lógico. La prevención es un pilar importante, insuficientemente destacado: nutrición sana y completa, ejercicio al aire libre, sin mascarilla, reducción del estrés y contactos emocionales y sociales nutritivos.

Consecuencias del aislamiento social en la salud física y mental

El aislamiento social y el daño económico llevaron a un aumento de la depresión, la ansiedad, los suicidios, la violencia intrafamiliar y el abuso infantil. (16) Los estudios han demostrado que cuanto más compromisos sociales y emocionales tienen las personas, más resistentes son a los virus. Es mucho más probable que el aislamiento y la cuarentena tengan consecuencias fatales. (17)

Las medidas de aislamiento también han llevado a la inactividad física de muchas personas mayores debido a que se han visto obligadas a permanecer en el interior. Sin embargo, el ejercicio suficiente tiene un efecto positivo sobre el funcionamiento cognitivo, reduciendo los síntomas depresivos y la ansiedad y mejorando la salud física, los niveles de energía, el bienestar y, en general, la calidad de vida. (18) El miedo, el estrés persistente y la soledad inducidos por el distanciamiento social tienen una influencia negativa demostrada en la salud psicológica y general. (19) ¿

Un virus altamente contagioso con millones de muertes sin ningún tratamiento?

La mortalidad resultó ser muchas veces menor de lo esperado y cercana a la de una gripe estacional normal (0,2%) . (20)

El número de muertes por corona registradas, por lo tanto, todavía parece estar sobreestimado.

Número de muertos Covid-19

El número de muertos por covid-19 fue muy exagerado y sembró el pánico

Existe una diferencia entre la muerte por un corona y la muerte por otro  corona. Los seres humanos a menudo son portadores de múltiples virus y bacterias potencialmente patógenas al mismo tiempo. Teniendo en cuenta el hecho de que la mayoría de las personas que desarrollaron síntomas graves sufrieron patologías adicionales, no se puede simplemente concluir que la corona-infección fue la causa de la muerte. En la mayoría de los casos, esto no se tuvo en cuenta en las estadísticas.

Los grupos más vulnerables pueden identificarse claramente. La gran mayoría de los pacientes fallecidos tenían 80 años o más. La mayoría (70%) de los fallecidos, menores de 70 años, tenían algún trastorno subyacente, como sufrimiento cardiovascular, diabetes mellitus, enfermedad pulmonar crónica u obesidad. La gran mayoría de las personas infectadas (> 98%) no se enfermaron o apenas se enfermaron o se recuperaron espontáneamente.

Mientras tanto, existe una terapia asequible, segura y eficiente disponible para aquellos que muestran síntomas graves de enfermedad en forma de HCQ (hidroxicloroquina), zinc y AZT (azitromicina). Esta terapia aplicada rápidamente conduce a la recuperación y, a menudo, evita la hospitalización. Casi nadie tiene que morir ahora.

Esta terapia eficaz ha sido confirmada por la experiencia clínica de colegas en el campo con resultados impresionantes. Esto contrasta fuertemente con la crítica teórica (fundamentación insuficiente de estudios doble ciego) que en algunos países (por ejemplo, los Países Bajos) incluso ha llevado a la prohibición de esta terapia. Un metaanálisis en The Lancet, que no pudo demostrar un efecto de HCQ, fue retirado. Las fuentes de datos primarias utilizadas demostraron ser poco fiables y 2 de cada 3 autores estaban en conflicto de intereses. Sin embargo, la mayoría de las pautas basadas en este estudio se mantuvieron sin cambios … (48, 49)

Tenemos serias dudas sobre este estado de cosas.

En los EE. UU., Un grupo de médicos en el campo, que atienden a los pacientes a diario, se unieron en “los médicos de primera línea de Estados Unidos” y dieron una conferencia de prensa que ha sido vista millones de veces. (21, 51)

Prof. Didier Rauolt

EPIDEMIAS – Peligros reales y alertas falsas – De la gripe aviar a Covid-19

El profesor francés Didier Raoult del Institut d’Infectiologie de Marseille (IHU) también presentó esta prometedora terapia combinada ya en abril. El médico de cabecera holandés Rob Elens, que curó a muchos pacientes en su consulta con HCQ y zinc, llamó a sus colegas en una petición por la libertad de terapia. (22)

La evidencia definitiva proviene del seguimiento epidemiológico en Suiza: tasas de mortalidad en comparación con y sin esta terapia. (23)

A partir de las imágenes angustiosas de los medios de comunicación de SDRA (síndrome de dificultad respiratoria aguda), donde las personas se asfixiaban y recibían respiración artificial en agonía, ahora sabemos que esto fue causado por una respuesta inmune exagerada con coagulación intravascular en los vasos sanguíneos pulmonares. La administración de anticoagulantes y dexametasona y la evitación de la ventilación artificial, que se encontró que causa daño adicional al tejido pulmonar, significa que esta temida complicación tampoco es virtualmente fatal. (47)

Por lo tanto, no es un virus asesino, sino una afección que se puede tratar bien.


La propagación se produce por infecciones por goteo (solo para pacientes que tosen o estornudan) y aerosoles en habitaciones cerradas y sin ventilación. Por tanto, la contaminación no es posible al aire libre. Los estudios epidemiológicos y de rastreo de contactos muestran que las personas sanas (o portadores asintomáticos sometidos a pruebas positivas) son prácticamente incapaces de transmitir el virus. Las personas sanas, por tanto, no se ponen en peligro unas a otras. (24, 25) La transferencia a través de objetos (por ejemplo, dinero, carritos de la compra o de la compra) no está científicamente probada. (26, 27, 28)

Todo esto cuestiona seriamente toda la política de distanciamiento social y mascarillas bucales obligatorias para las personas sanas; no hay base científica para ello.


Las máscaras orales pertenecen a contextos donde tienen lugar contactos con grupos de riesgo comprobados o personas con problemas de las vías respiratorias superiores, y en un contexto médico / entorno de hospital-casa de retiro. Reducen el riesgo de infección por gotitas al estornudar o toser. Las mascarillas orales en individuos sanos son ineficaces contra la propagación de infecciones virales. (29, 30, 31)

Las mascarillas son ineficaces

Las mascarillas son ineficaces para el covid-19 y producen efectos secundarios nocivos para la salud

El uso de una máscara no está exento de efectos secundarios. (32, 33) La deficiencia de oxígeno (dolor de cabeza, náuseas, fatiga, pérdida de concentración) ocurre con bastante rapidez, un efecto similar al mal de altura. Todos los días vemos a pacientes que se quejan de dolores de cabeza, problemas de los senos nasales, problemas respiratorios e hiperventilación debido al uso de máscaras. Además, el CO2 acumulado provoca una acidificación tóxica del organismo que afecta nuestra inmunidad. Algunos expertos incluso advierten de un aumento de la transmisión del virus en caso de uso inadecuado de la máscara. (34)

Nuestro Código Laboral (Codex 6) se refiere a un contenido de CO2 (ventilación en los lugares de trabajo) de 900 ppm, máximo 1200 ppm en circunstancias especiales. Después de usar una máscara durante un minuto, este límite tóxico se supera considerablemente a valores que son de tres a cuatro veces superiores a estos valores máximos. Cualquiera que use una máscara se encuentra, por lo tanto, en una habitación extremadamente mal ventilada. (35)

Por lo tanto, especialistas reconocidos en seguridad no recomiendan a los trabajadores el uso inadecuado de máscaras sin un archivo completo de pruebas cardiopulmonares médicas.

Los hospitales tienen un ambiente estéril en sus quirófanos donde el personal usa máscaras y hay una regulación precisa de la humedad / temperatura con un flujo de oxígeno monitoreado adecuadamente para compensar esto, cumpliendo así con estrictos estándares de seguridad. (36) ¿

Una segunda oleada corona?

Ahora se está debatiendo una segunda ola en Bélgica, con un mayor endurecimiento de las medidas como resultado. Sin embargo, un examen más detenido de las cifras de Sciensano (último informe del 3 de septiembre de 2020) (37) muestra que, aunque ha habido un aumento en el número de infecciones desde mediados de julio, no hubo un aumento en los ingresos hospitalarios o muertes en ese momento. Por lo tanto, no se trata de una segunda ola de corona, sino de la denominada “química del caso” debido a un mayor número de pruebas. (50)

El número de ingresos hospitalarios o defunciones mostró un aumento mínimo de corta duración en las últimas semanas, pero al interpretarlo hay que tener en cuenta la reciente ola de calor. Además, la gran mayoría de las víctimas aún se encuentran en el grupo de población> 75 años.

Esto indica que la proporción de las medidas adoptadas en relación con la población activa y los jóvenes es desproporcionada con los objetivos previstos.

La gran mayoría de las personas “infectadas” con pruebas positivas se encuentran en el grupo de edad de la población activa, que no desarrolla ningún síntoma o simplemente presenta síntomas limitados, debido al buen funcionamiento del sistema inmunológico.

Así que nada ha cambiado, se acabó el pico.

Fortalecimiento de una política de prevención

Las medidas de la corona contrastan notablemente con la política mínima seguida por el gobierno hasta ahora, cuando se trata de medidas bien fundamentadas con beneficios para la salud comprobados como el impuesto al azúcar, la prohibición de los cigarrillos (electrónicos) y la elaboración de alimentos saludables, ejercicio. y redes de apoyo social económicamente atractivas y ampliamente accesibles. Es una oportunidad perdida para una mejor política de prevención que podría haber provocado un cambio de mentalidad en todos los sectores de la población con resultados claros en términos de salud pública. En la actualidad, solo el 3% del presupuesto sanitario se destina a la prevención. (2)

El juramento hipocrático


Los médicos están moralmente obligados a seguir el juramento hipocrático

Como médico, hicimos el Juramento Hipocrático:

“Sobre todo cuidaré a mis pacientes, promoveré su salud y aliviaré su sufrimiento”.

“Informaré a mis pacientes correctamente”.

“Incluso bajo presión, no usaré mis conocimientos médicos para prácticas que sean contra la humanidad”.

Las medidas actuales nos obligan a actuar contra este juramento.

Otros profesionales de la salud tienen un código similar.

El ‘ primum non nocere ‘, que todo médico y profesional de la salud asume, también se ve socavado por las medidas actuales y por la perspectiva de la posible introducción de una vacuna generalizada, que no está sujeta a extensas pruebas previas.


Los estudios de encuestas sobre vacunas contra la influenza muestran que en 10 años solo hemos logrado tres veces desarrollar una vacuna con una tasa de eficiencia de más del 50%. Vacunar a nuestros ancianos parece ineficaz. Más de 75 años, la eficacia es casi inexistente. (38)

Debido a la continua mutación natural de los virus, como también vemos todos los años en el caso del virus de la influenza, una vacuna es a lo sumo una solución temporal, que requiere nuevas vacunas cada vez después. Una vacuna no probada, que se implementa mediante un procedimiento de emergencia y para la cual los fabricantes ya obtuvieron inmunidad legal ante posibles daños, plantea serias preguntas. (39, 40) No deseamos utilizar a nuestros pacientes como conejillos de indias.

A escala mundial, se esperan 700.000 casos de daño o muerte como resultado de la vacuna. (41)

Si el 95% de las personas experimentan covid-19 prácticamente sin síntomas, el riesgo de exposición a una vacuna no probada es irresponsable.

El papel de los medios de comunicación y el plan oficial de comunicación

En los últimos meses, los fabricantes de periódicos, radio y televisión parecían estar casi acríticamente detrás del panel de expertos y del gobierno, allí donde es precisamente la prensa la que debe ser crítica y prevenir comunicación gubernamental unilateral. Esto ha llevado a una comunicación pública en nuestros medios de comunicación, que era más una propaganda que un informe objetivo.

En nuestra opinión, es tarea del periodismo llevar las noticias de la manera más objetiva y neutral posible, con el objetivo de encontrar la verdad y controlar críticamente el poder, y los expertos disidentes también tienen un foro en el que expresarse.

Esta visión está respaldada por los códigos deontológicos periodísticos. (42)

La historia oficial de que era necesario un bloqueo, que ésta era la única solución posible y que todos estaban detrás de este bloqueo, dificultaba que las personas con una visión diferente, así como los expertos, expresaran una opinión diferente.

Las opiniones alternativas fueron ignoradas o ridiculizadas. No hemos visto debates abiertos en los medios de comunicación, donde se puedan expresar diferentes puntos de vista.

Los medios propagan el pánico

Un medio poco ético propaga el pánico y censura la información objetiva

También nos sorprendieron los muchos videos y artículos de muchos expertos científicos y autoridades, que fueron y aún están siendo eliminados de las redes sociales. Creemos que esto no encaja con un Estado constitucional democrático libre, tanto más cuanto conduce a una visión de túnel. Esta política también tiene un efecto paralizante y alimenta el miedo y la preocupación en la sociedad. En este contexto, ¡rechazamos la intención de censurar a los disidentes en la Unión Europea! (43)

La forma en que los políticos y los medios de comunicación han retratado a covid-19 tampoco le ha hecho ningún bien a la situación. Los términos bélicos eran populares y no faltaba el lenguaje bélico. A menudo se ha mencionado una “guerra” con un “enemigo invisible” que debe ser “derrotado”. El uso en los medios de comunicación de frases como ‘héroes del cuidado en primera línea’ y ‘víctimas de la corona’ ha alimentado aún más el miedo, al igual que la idea de que estamos lidiando globalmente con un ‘virus asesino’.

El implacable bombardeo con cifras, que se desató sobre la población día tras día, hora tras hora, sin interpretar esas cifras, sin compararlas con las muertes por gripe en otros años, sin compararlas con las muertes por otras causas, ha inducido una verdadera psicosis de miedo en la población. Esto no es información, es manipulación.

Deploramos el papel de la OMS en esto, que ha pedido que la infodemia (es decir, todas las opiniones divergentes del discurso oficial, incluidas las de expertos con puntos de vista diferentes) sea silenciada por una censura de medios sin precedentes. (43, 44) ¡

Hacemos un llamado urgente a los medios de comunicación para que asuman sus responsabilidades aquí!

Exigimos un debate abierto en el que se escuche a todos los expertos.

Ley de emergencia versus derechos humanos

El principio general de buena gobernanza exige sopesar la proporcionalidad de las decisiones gubernamentales a la luz de los estándares legales más altos: cualquier interferencia del gobierno debe respetar los derechos fundamentales protegidos en el Convenio Europeo de Derechos Humanos (CEDH). La interferencia de las autoridades públicas solo está permitida en situaciones de crisis. En otras palabras, las decisiones discrecionales deben ser proporcionadas a una necesidad absoluta.

Las medidas actualmente adoptadas se refieren a la injerencia en el ejercicio, entre otras cosas, del derecho al respeto de la vida privada y familiar, la libertad de pensamiento, conciencia y religión, la libertad de expresión y la libertad de reunión y asociación, el derecho a la educación, etc. , y por tanto debe respetar los derechos fundamentales protegidos por el Convenio Europeo de Derechos Humanos (CEDH).

Estado de emergencia de Covid

No hay emergencia, no debe haber violaciones de los derechos de las personas.

Por ejemplo, de conformidad con el artículo 8 (2) del CEDH, la injerencia en el derecho a la vida privada y familiar solo está permitida si las medidas son necesarias en interés de la seguridad nacional, la seguridad pública y el bienestar económico del país. , la protección del orden público y la prevención de delitos, la protección de la salud o la protección de los derechos y libertades de los demás, el texto normativo en el que se base la injerencia debe ser suficientemente claro, previsible y proporcionado a los objetivos perseguidos. (45)

La pandemia predicha de millones de muertes pareció responder a estas condiciones de crisis, lo que llevó al establecimiento de un gobierno de emergencia. Ahora que los hechos objetivos muestran algo completamente diferente, la condición de incapacidad para actuar de otra manera (no hay tiempo para evaluar a fondo si hay una emergencia) ya no existe. El Covid-19 no es un virus del resfriado, sino una afección bien tratable con una tasa de mortalidad comparable a la de la gripe estacional. En otras palabras, ya no existe un obstáculo insuperable para la salud pública.

No hay estado de emergencia. Inmenso daño causado por las políticas actuales

Una discusión abierta sobre las medidas de corona significa que, además de los años de vida ganados por los pacientes de corona, también debemos tener en cuenta otros factores que afectan la salud de toda la población. Estos incluyen daños en el dominio psicosocial (aumento de la depresión, ansiedad, suicidios, violencia intrafamiliar y abuso infantil) (16) y daños económicos.

Si tenemos en cuenta este daño colateral, la política actual está fuera de toda proporción, el proverbial uso de un mazo para romper una nuez.

Nos sorprende que el gobierno invoque la salud como motivo de la ley de emergencia.

Como médicos y profesionales de la salud, ante un virus que, en términos de nocividad, mortalidad y transmisibilidad, se acerca a la influenza estacional, solo podemos rechazar estas medidas extremadamente desproporcionadas.

  • Por tanto, exigimos el fin inmediato de todas las medidas.
  • Estamos cuestionando la legitimidad de los expertos asesores actuales, que se reúnen a puerta cerrada.
  • A raíz de ACU 2020 46 pedimos un examen en profundidad del papel de la OMS y la posible influencia de los conflictos de intereses en esta organización. También estuvo en el centro de la lucha contra la “infodemia”, es decir, la censura sistemática de todas las opiniones disidentes en los medios de comunicación. Esto es inaceptable para un Estado democrático gobernado por el estado de derecho. (43)

Distribución de esta carta

Nos gustaría hacer un llamamiento público a nuestras asociaciones profesionales y compañeros cuidadores para que den su opinión sobre las medidas actuales.

Llamamos la atención y pedimos un debate abierto en el que los cuidadores puedan y se atrevan a hablar.

Con esta carta abierta, enviamos la señal de que el progreso en pie de igualdad hace más daño que bien, y pedimos a los políticos que se informen de forma independiente y crítica sobre la evidencia disponible, incluida la de expertos con diferentes puntos de vista, siempre que sea posible. basado en ciencia sólida – al implementar una política, con el objetivo de promover una salud óptima.

Con preocupación, esperanza y a título personal [firmamos esta carta].

Unas preguntitas para los covidianos

1) ¿Cómo es posible que, ante un virus que dicen que viene de fuera, las zonas donde más tránsito de personas hay del exterior, como Baleares y Canarias, sean precisamente las zonas donde menos muertos ha habido, y luego zonas a dónde no va casi nadie en invierno como la Rioja, Castilla la Mancha, Castilla y León o Aragón rural el bicho haya arrasado?.

2) ¿Cómo es posible que una pandemia que dicen ha surgido en China haya causado más muertes en Soria (o mejor dicho, en los asilos de ancianos de Soria, porque fuera de los mismos no ha pasado nada anormal) que tiene 20.000 habitantes que en Shanghai que tiene 20 millones, o que en Pekín?.

3) ¿Cómo es posible que en enero de 2020 hubiera 7.000 turistas chinos de la zona de Wuhan que visitaron Tailandia de turismo, y que en Tailandia, a día de hoy, con más de 60 millones de habitantes y una densidad de población elevadísima haya solo 58 muertos?.

4) ¿Cómo es posible que en el entorno de China no haya habido prácticamente muertos (Vietnam, Camboya, Mongolia, Turkmenistán, … todos ellos limítrofes con China cero muertos, sí, sí, ningún muerto en ninguno de ellos), luego tenemos Japón que no llega al millar de muertos, corea del Sur no llega a dos millares de muertos, Corea del Norte ninguno y Filipinas una cifra ridícula?.

5) ¿Cómo es posible que haya 20.000 muertes atribuídas al virus fantasma no aislado ni secuenciado de residencias de ancianos, y luego resulta que en los centros de día de ancianos, que están mucho más expuestos a un posible contagio, no haya apenas muertes?.

6) ¿Cómo es posible que haya residencias de ancianos con 70-80 ancianos muertos y luego resulta que en la población donde está radicada esa residencias solo han muerto uno, dos o incluso nadie por el virus? Es como si el virus tuviera un GPS.

7) ¿Cómo es posible que en España haya 29.000 muertos y en Portugal solo 1.000, y todo ello a pesar del libre tránsito de personas y mercancías a través de la frontera. En Gibraltar ni uno?. La libre circulación solo se interrumpió a partir del 15 de marzo cuando el virus ya estaba extendido lo cual el cierre tardío de la frontera no es disculpa para explicar esta caprichosa distribución.

8) ¿Cómo es posible que según la versión oficial todo Madrid se contagió por el 8-M y sin embargo el carnaval de Cádiz o Canarias, que acabaron ya entrado marzo, o las mascletadas de Valencia, que se prolongaron por lo menos hasta el 10 de marzo no dispararan los contagios? Además el Valencia CF jugó en Bérgamo a finales de febrero cuando allí supuestamente ya había una pandemia y fueron 3.000 aficionados muchos de los cuales fueron después a las mascletadas.

9)  ¿Cómo es posible que los tests de ampliación de polimerasa, supuestamente más fiables den positvo tomando muestras de papayas, aceite de motor de coche, animales varios y ¡hasta una milenaria momia egipcia!?.

10)  ¿Cómo es posible que países tan diversos como Bielorrusia, y varios africanos hayan denunciado sobornos de la OMS y del FMI para practicar contabilidad creativa y montar un circo covidiano como los países de Europa occidental y Sudamérica? ¿Qué hay de las denuncias de dinero a cambio de falsificar certificados de defunción que ocurren en no pocos países sudamericanos, en EE.UU., en Rumanía y en otros?

11) ¿Por qué aparecen ahora compras relacionadas con el covid-19 en la contabilidad de 2018?

12) ¿Cómo es posible que estén hablando de una vacuna para dentro de seis meses cuando una vacuna tarda no menos de seis años en desarrollarse? ¿Por que no hay vacuna contra el virus del sida después de casi 40 años? ¿Por que no hay vacuna contra el Sars-cov-1 o contra el Mers después de casi 20 años?

13) ¿Por qué cuando vas a donar sangre no te hacen pruebas para detectar el virus? ¿Por qué para las pruebas fraudulentas para detectar el virus te meten un palillo casi hasta el cerebro, cuando supuestamente es un virus tan contagioso que estornudas y puedes contagiar a 20 alrededor?

14) ¿Cómo es posible que países como Suecia, Bielorusia, Tailandia o Turquía (por citar solo algunos) que no han hecho nada para parar el virus tengan cifras de muertes tan bajas comparadas con España o Italia? En Bielorrusia hace dos semanas había un millón de personas manifestándose contra Lukashenko, sin bozales y todos pegaditos, hoy, a dos semanas vista, los hospitales deberían estar colapsados, y sin embargo están vacíos.

15) En España viven unos 330.000 ancianos internados en residencias, sobre un total de unos 9.200.000 mayores de 65 años que viven en nuestro país (consulte el INE), es decir no llegan al 4% los ancianos que viven en residencias. Aquí tiene una estimación de la población de ancianos que viven en residencias de ancianos, en 2019 eran unos 322.000, como cada año suele subir (porque la población envejece, con lo cual también sube la mortalidad) en 2020 serán unos 330.000. No llegan al 4% los ancianos que viven en residencias, son un 3.8% aproximadamente.


En las residencias de ancianos murieron unas 20.000 personas que fueron atribuídas al virus fantasma, de un total de 28.000 muertos, esto es un 70%. Se da la paradoja de que en centros de día de ancianos no hubo prácticamente muertes, ni tampoco en ninguna de las miles de asociaciones de mayores/jubilados/antiguos empleados que hay por todo el país.

En las residencias: 7% de muertos.

En los centros y clubs de bingo de jubilados (donde los mayores se pasan el día ahí metidos y luego van a comer, cenar y dormir a sus casa): 0,004% de muertos.

¿De verdad os estáis creyendo lo que cuentan los medios de desinformación? 
@Profesor Bacterio(Visto en  https://www.burbuja.info/) y Astillas de Realidad http://astillasderealidad.blogspot.com/2020/09/unas-preguntitas-para-los-creyentes.html?m=1



¡Maldita sea, el coronavirus existe!. No lo niego pero reniego de lo que se sabe del virus, o sea, nada. Sólo sé que no se nada por lo tanto todos tenemos derecho a especular sin ser tachados de “negacionista”.

Investigadores de biología celular y molecular de mucho prestigio: los coronavirus con temperaturas altas se inactivan*. Empezando por aquí, puedo pensar que el SARS-COV-2 no es un coronavirus o tiene muy poco que ver con esta familia de virus. Es posible que sólo tenga la carcaza con ensamble adquirido. ¿Una máscara necesaria?

¿Al darse en otoño-invierno se puede pensar que en verano estamos todos ya inmunizados? ¿No verdad? Algo no cuadra.

¿Qué virus no se desactivan con el calor y en verano? No se si habrá una larga lista, pero con estos bastan, el Ébola y el VIH.

Y en esta estamos, ¿virus en busca de enfermedad o enfermedad en busca de virus? Y el término medio según biólogos renombrados, es si un virus es la causa o la consecuencia de una enfermedad. Si es esta última, estamos matando moscas a cañonazos, entre ellas, la economía y la sociedad. Si no es el virus para acabar coronando la caída de ellas con causas y consecuencias.

Porque la vida es convivir con virus y bacterias. No hay nada que pueda crear el hombre que no esté en la naturaleza (también futurible). Diferente es que lo haga a destiempo o esta no lo necesite, ni ahora y quizás nunca, este es el verdadero horror y por lo visto el gran reto. Tanto para los de arriba, como para los de abajo.

En todo caso se puede ser negacionista de la pandemia y por tanto de la OMS, que no del virus (creado o no en laboratorio). Por cierto, si fuera así, ¿es posible que haya dos virus? No hablo de cepas.

El segundo capítulo de “Coronavirus Sésamo” deben sintonizarlo en sus receptores a través de su cerebro.

* ¿Puedo enfermar de gripe en verano? Pues supongo que sí, pero todos sabemos que no es lo habitual. ¿Pero podemos afirmar que si nos realizan un test PCR a toda la población en la temporada estival, podemos dar positivos asintomáticos en un tanto por ciento como se da en esa misma población en invierno con sintomáticos de la influenza? Esto desbarataría a la pandemia como tal, que no al virus. Es una duda razonable.




Damn, the coronavirus exists!. I do not deny it but I deny what is known about the virus, that is, nothing. I only know that I know nothing, therefore we all have the right to speculate without being branded a “denier”.

Renowned Cell and Molecular Biology Researchers: High-temperature coronaviruses are inactivated*. Starting here, I can think that SARS-COV-2 is not a coronavirus or has very little to do with this family of viruses. You may only have the housing with purchased assembly. A necessary mask?

When it occurs in autumn-winter, can we think that in summer we are all already immunized? No right? Something is wrong.

What viruses are not deactivated in the heat and in summer? I don’t know if there will be a long list, but these are enough, Ebola and HIV.

And here we are, virus looking for disease or disease looking for viruses? And the middle ground according to renowned biologists, is whether a virus is the cause or the consequence of a disease. If it is the latter, we are killing flies with cannon shots, including the economy and society. If it is not the virus to end up crowning their fall with causes and consequences.

Because life is living with viruses and bacteria. There is nothing that man can create that is not in nature (also futurible). It is different if he does it at the wrong time or it does not need it, not now and perhaps never, this is the true horror and apparently the great challenge. Both for those above, and for those below.

In any case, you can be a denier of the pandemic and therefore of the WHO, not the virus (created or not in the laboratory). By the way, if so, is it possible that there are two viruses? I’m not talking about strains.

The second chapter of “Coronavirus Sesame” you must tune into your receptors through your brain.

* Can I get the flu in the summer? Well I guess so, but we all know that it is not usual. But can we affirm that if we carry out a PCR test on the entire population in the summer season, we can give asymptomatic positives in as many percent as occurs in the same population in winter with symptoms of influenza? This would derail the pandemic as such, not the virus. It’s a reasonable doubt.


Greta_ThunbergSoros es un personaje ligado al fabianismo o Sociedad Fabiana, una especie de masonería socialista burguesa dispuesta a hacer caja y virar hacia una especie de izquierda manca de ese mismo brazo. Una lucha disfrazada de continente sin contenido. Un escaparate donde venden humanidad enfocada democráticamente a comprar con dinero de nuestro bolsillo un cambio político y cultural muy bien dirigido a unos sentimientos primarios de tan alta sensibilidad que es difícil no comprar, pero cuidado, el escaparate tiene trampa, si te fijas bien, en el reflejo de este, no ves a la cantidad al que va dirigido el mensaje y el producto, verás a tres o cuatro Soros sonriendo y repitiendo “compra, no hay otro producto mejor, y con el tiempo es que no habrá otro” y de alta calidad. Lo que es el globalismo unidireccional. Una patraña para convertir en apariencia a todos los hombres iguales con las mismas ideas pero con unos reyes que nos dictan hacia donde vamos y lo que queremos y deseamos. Siempre en beneficio de ese socialismo de palacio y mansiones. Una especie del ilustrado mandamiento “todo para el pueblo pero sin el pueblo” o lo que es lo mismo, “el escaparate es vuestro pero pasar por caja y yo te digo lo que te llevas”.

Aquí y ahora es donde aparece Greta Thunberg. Una actriz más de la factoría Fabiana producida por George Soros y Cia. Una película a la que estás obligado comprar la entrada.Soros_1

Y es que confundimos el cambio climático con la basura que todos producimos en demasía. ¿Hay cambio climático? Por supuesto que lo hay, siempre lo ha habido, es como negar que hay estaciones del año. Esto, a nivel macro, es lo que siempre ha pasado en el planeta tierra, siempre ha cambiado el clima, y seguirá cambiando.

Por supuesto que tenemos y debemos contaminar menos. Es parte de una buena educación.

Ahora bien, veamos parte del guion del film “La Greta de los Soros”. Dice la protagonista, la gran Greta sin Garbo: “La crisis climática no trata solo de medioambiente: la han creado los sistemas de opresión coloniales, racistas y patriarcales”.

Un guion donde se intuye que más que una película al mas estilo hollywoodiense, es un anuncio para televisión donde evidentemente se vende un producto: “El mundo de Fabián”, “Solo Soros” o “Las Gretas que vienen”.

Un universo tan plural como el reflejo del escaparate.



Soros is a character linked to Fabianism or Fabian Society, a kind of bourgeois socialist masonry willing to make a box and turn towards a kind of Manca left of that same arm. A fight disguised as a continent without content. A showcase where they sell humanity democratically focused to buy with money from our pocket a political and cultural change very well aimed at primary feelings of such high sensitivity that it is difficult not to buy, but be careful, the storefront has a trap, if you look closely, in the reflection of this, you do not see the amount to which the message and the product is directed, you will see three or four Soros smiling and repeating “buy, there is no better product, and over time it is that there will be no other” and of high quality. What is unidirectional globalism. A hoax to make all men equal in appearance with the same ideas but with some kings that dictate where we are going and what we want and want. Always for the benefit of that palace and mansion socialism. A kind of the enlightened command “all for the people but without the people” or what is the same, “the showcase is yours but go through the box and I tell you what you take.”
Here and now is where Greta Thunberg appears. One more actress from the Fabiana factory produced by George Soros y Cia. A film to which you are obliged to buy the ticket.
And we confuse climate change with the garbage that we all produce too much. Is there climate change? Of course there is, there always has been, it’s like denying that there are seasons. This, at the macro level, is what has always happened on planet earth, the weather has always changed, and will continue to change.
Of course we have and should pollute less. It is part of a good education.
Now, let’s see part of the script of the film “La Greta de los Soros”. The protagonist, the great Greta sin Garbo, says: “The climate crisis is not just about the environment: it has been created by colonial, racist and patriarchal oppression systems.”
A script where it is intuited that more than a movie in the most Hollywood style, it is an advertisement for television where a product is obviously sold: “The world of Fabian”, “Only Soros” or “The Gretas that come”.
A universe as plural as the reflection of the showcase.


MENAS (Menores Extranjeros No Acompañados)



¿Qué voy a decir de los MENAS? Cualquiera debería entrar en España y en Europa antes que ellos. Los MENAS NO, deberían ser expulsados en el momento que pisan tierra europea.

Pero ¡pobrecitos!. Lo primero que hay que decir, es que las mafias y cualquiera de ellos sabe que van a tener un trato preferente. También los padres, que vienen con ellos en los barcos y les dicen que digan que no tienen padres, que vienen solos, que digan que son MENAS y no conocen a nadie del pasaje.

Además, vienen a delinquir. ¡Sí, a delinquir y/o a vivir del cuento! y a ¡VIOLAR!.

¡Dejar entrar a los padres de familia que vienen con ganas de trabajar!, luego traerán a sus NENAS, perdón, MENAS y les darán una educación (es posible, depende de los progenitores, que de no ser así deberían abandonar a fuerza de ley Europa).

Los MENAS vienen todos a delinquir, sea por pasiva o por activa.Menas1

Y de “pobrecitos” nada, si tienen edad de fornicar tienen edad de trabajar.

Los NENAS musulmanes no los queremos en Europa, ¿os enteráis políticos? Luego los mandáis a vivir a barrios marginales o clase trabajadora donde sufren vuestra incompetente visión de la caridad, que debería empezar por vuestro ejemplo alojándolos en vuestra casa y barrio privilegiado, al lado del dormitorio de vuestras hijas.

Haya paz.


MENAS (Unaccompanied Foreign Minors)

What will I say about MENAS? Anyone should enter Spain and Europe before them. LESS NO, should be expelled at the time they step on European land.
But poor guys! The first thing to say is that the mafias and any of them know that they will have preferential treatment. Also the parents, who come with them on the boats and tell them to say they have no parents, that they come alone, to say that they are LESS and do not know anyone in the passage.
In addition, they come to commit crimes. Yes, to commit crimes and / or live the story! and to VIOLATE!
Let in the parents who come with the desire to work! Then they will bring their GIRLS, excuse me, MENAS and give them an education (it is possible, it depends on the parents, that if not they should abandon by force of law Europe).
MENES all come to commit crimes, whether passive or active.
And of “poor things” nothing, if they have the age of fornicating they have the age to work.
We Muslim women do not want them in Europe, do you know politicians? Then you send them to live in slums or working class where they suffer your incompetent vision of charity, which should start by your example by housing them in your house and privileged neighborhood, next to your daughters’ bedroom.
There is peace.


Las actividades de George Soros financiadas por los EE.UU.

De nuevo Soros y su “sociedad abierta” con ideas radicales de izquierdas.

Situaciones Difíciles y Conflictivas


Un informe de 30 páginas de Judicial Watch raport especial del 30 Noviembre 2018 acusa al gobierno de los EE.UU., de financiar las actividades de George Soros. (De interés consultar el documento y links correspondientes y hacerse una idea de la magnitud)

Judicial Watch promueve la transparencia, la integridad y la responsabilidad en el gobierno, la política y la ley. Realizamos nuestra misión a través de investigaciones, investigaciones, litigios y educación pública. Como parte de nuestras actividades educativas, producimos informes especiales sobre asuntos importantes de política pública para iluminar las operaciones del gobierno. Manifestación en Wall Street (OWS)

Este informe desvela las actividades de Open Society Foundations (OSF), que son financiadas parcialmente por los contribuyentes de los Estados Unidos. Soros, su fundación y sus afiliados promueven y promueven una agenda radical y progresista que busca desestabilizar gobiernos legítimos, borrar fronteras e identidades nacionales, atacar a políticos conservadores, financiar disturbios civiles…

Ver la entrada original 1.084 palabras más

ONGs contra EUROPA

openarmsNosotros contra nosotros. Seré muy breve. Resulta que unos burgueses aburridos crean una ONG, el Open Arms, que se dedica a traer a Europa personas que luego la quieren instalar en los barrios más desfavorecidos, pero estos de las ONGs luego duermen en buenas urbanizaciones donde nunca verán a estos (pobres) negros.

Esto se llama fabianismo, que no es más que un socialismo de la élite y políticos convertidos en tal. El mayor exponente es George Soros, magnate judío, que visitó hace poco a Pedro Sánchez, otro fabianista-socialista. Esto es, todo para el pueblo pero para mi un poco más. openarms1

El europeo de a pie no quiere inmigrantes musulmanes que no se adaptan. Está más que comprobado. Una cosa es Europa, que la representan los políticos y otra los europeos, que somos los que tenemos que aguantar a esta gentuza (políticos y migrantes), qué cosas tiene la democracia, ¿verdad?.

Luego he visto por la tele a un individuo diciendo que internet está llena de odio hacia esos migrantes. Lo decía por la cantidad y a veces la calidad y que había que acallar esta “barbarie” desde lo más alto y con toda la fuerza del Estado. ¿Perdona?.

Internet es la herramienta más fiel de lo que piensan los que deberíamos ser los dueños de esta nuestra Europa, esto es los europeos, el pueblo, perdón que ahora se topmantadice ciudadanos. No somos súbditos del Estado, ni con monarquía ni con república.

Políticos y burgueses fabianistas, no llenéis nuestros barrios de negros ni moros ni ningún grupo humano que no se adapte a Europa, a mi casa, a nuestra casa.


NGOs against EUROPE

Us against us I will be very brief. It turns out that boring bourgeois create an NGO, the Open Arms, which is dedicated to bringing people to Europe who then want to install it in the most disadvantaged neighborhoods, but these NGOs then sleep in good housing developments where they will never see these (poor) blacks

This is called Fabianism, which is nothing more than a socialism of the elite and politicians converted into such. The greatest exponent is George Soros, a Jewish magnate, who recently visited Pedro Sánchez, another Fabianist-Socialist. This is, everything for the town but for me a little more.

The European on foot does not want Muslim immigrants who do not adapt. It is more than proven. One thing is Europe, which represent politicians and other Europeans, we are the ones who have to put up with this mob (politicians and migrants), what things have democracy, right ?.

Then I saw on the TV an individual saying that the internet is full of hatred towards these migrants. I said this because of the quantity and sometimes the quality and that this “barbarism” had to be silenced from the top and with all the strength of the State. Forgives?.

Internet is the most faithful tool of what those of us who should be the owners of this Europe think, this is the Europeans, the people, forgiveness that is now said to be citizens. We are not subjects of the State, neither with monarchy nor with republic.

Fabian politicians and bourgeoisie, do not fill our neighborhoods with blacks or Moors or any human group that does not adapt to Europe, to my house, to our house.





Soros_OrbanEl sionista Soros cree (y seguro que así lo siente) que Hungría es un activo de Wall Street. Como buen sionista, el señor Soros no cree en soberanías ni sentimientos retroalimentados entre ciudadano y Estado. El sionismo y los judíos para concretar atinadamente, no tienen patria, es el caso de “amoldarla” a su antojo y para sus propios beneficios. Preséntese usted a las elecciones de ese su no-país.

De momento a Orbán lo quieren como presidente. Algo que Soros no comprende al creer que las personas son “moneda de cambio”.hungria_1

Invito a viajar a Hungría. País seguro y con una cultura asombrosa.

Quedan muchas cosas por hacer importantes en Europa, una de ellas es que la soberanía vaya de abajo a arriba, entonces llegará la nueva Europa, la Europa de ciudadanos libres, libres de deudas donde sólo ganan personas como Soros.

Haga Usted el Plan Kalergi en Israel. Deje a Europa en paz.Soros_1



The Zionist Soros believes (and certainly feels this way) that Hungary is a Wall Street asset. As a good Zionist, Mr. Soros does not believe in sovereignty or feedback between citizen and State. Zionism and Jews to concretely specify, have no homeland, is the case of “mold” at will and for their own benefits. Introduce yourself to the elections of that your non-country. For the moment Orbán want him as president. Something that Soros does not understand when he believes that people are “currency.” I invite you to travel to Hungary. Safe country and with an amazing culture. There are many important things to do in Europe, one of them is that sovereignty goes from bottom to top, then the new Europe will come, the Europe of free citizens, free of debts where only people like Soros win. Make the Kalergi Plan in Israel. Leave Europe alone.



Dugin y “neonazis”

runas_3Alexander Dugin confunde o lo han hecho confundir a propósito (y lo han conseguido) meter en el saco de sus “enemigos” al Nacional Socialismo (Socialismo Nacional) con la neblina del nombre “neonazis” sobre todo y por todo en el conflicto de Donbáss. Ahí la confusión. Las ramas impiden ver el bosque. Y el bosque lo riega alguien del Pantano: Soros. Judío, ¿y este apoya a los nazis (neos)? Unos compañeros de cama al menos sospechosos. Compañeros sí, pero no hay Nacional Socialismo por medio, es un ardid de conveniencia falsificado. Esto es, avivar el conflicto colocando actores que se deberían odiar atrayendo a la cercana Historia que guardan las naciones en recuerdos que el tiempo aún no ha curado, pero desfasados por la urgencia del cambio de los tiempos en que vivimos. Quiero decir, enfrentamiento Alemania-Rusia (II GM), Ucrania-Rusia (nazis contra soviéticos). El subconsciente existe, y tanto. Soros y el Pantano consiguen con esto un doble juego, al que ha entrado Dugin. Dugin está más cerca del Socialismo Nacional de lo que el cree, y viceversa. El verdadero, el SN que no está tergiversado por el Pantano. Yo apoyo a Dugin, pero soy consciente del error incrustado para hacer daño a ambas partes. Soros mata a dos pájaros de un tiro. A Dugin por “atacar” a la Europa “empantanada” y a los verdaderos Socialistas Nacionales, que aunque dicen ser la “vanguardia” de la lucha contra la Rusia neozarista de Putin, aprovechan (ellos solitos lo hacen) para dar una imagen de lo que no es un Socialista Nacional serio: una especie de ogro asesino sin piedad. ¿Quién gana con esto? Soros y el Pantano. ¿Quién pierde? Dugin y su cuarta teoría política, a la que me sumo. Y soy Socialista Nacional.

Aquí dejo la parte que comporta este escrito del artículo de Dugin:

Hoy en día el Pantano también tiene instrumentos extremos a los que está recurriendo cada vez más. Estos elementos extremos del globalismo transnacional y liberal son:

• Los extremistas de izquierda, anarquistas y ultra-liberales que desafían cualquier forma de orden,
• Los extremistas islámicos de todas las tendencias (en primer lugar, wahhabís y salafistas),
• Grupos chovinistas neonazis de xenófobos perversos.


por Alexander Dugin – El papel de la sexta columna La estructura del mundo de hoy es simple. Hay un – sigue siendo uno – polo dominante: el pantano, la élite globalista, el núcleo transnacional liberal. Actúa a través de: 1. Las redes liberales y de izquierda (en política, economía, cultura, tecnología, educación, arte). 2. […]

a través de La hegemonía y el ataque terrorista en San Petersburgo — La Cuarta Teoría Política (4TPes)

Dugin and “neo-Nazis”
Alexander Dugin confuses or has made him confuse (and have succeeded) in the sack of his “enemies” National Socialism with the mist of the name “neo-Nazis” especially and for everything in the conflict of Donbass . There the confusion. Branches prevent you from seeing the forest. And the forest is watered by someone from the Swamp: Soros. Jewish, and does this support the Nazis? At least suspicious bed fellows. Companions yes, but there is no National Socialism in the middle, it is a trick of falsified convenience. That is, to enliven the conflict by placing actors who ought to hate attracting the close history that the nations keep in memories that time has not yet healed, but outdated by the urgency of the change of the times in which we live. I mean, Germany-Russia (II GM), Ukraine-Russia (Nazi vs. Soviet) clash. The subconscious exists, and so much. Soros and the Swamp get with this a double game, to which Dugin has entered. Dugin is closer to National Socialism than he believes, and vice versa. The real one, the SN who is not misrepresented by the Swamp. I support Dugin, but I am aware of the embedded error to hurt both parties. Soros kills two birds with one stone. Dugin for “attacking” Europe “bogged down” and the true National Socialists, who claim to be the “vanguard” of the struggle against Putin’s neo-Nazi Russia, take advantage (they alone do) to give a picture of what He is not a serious National Socialist: a sort of ogre-murderer without mercy. Who wins with this? Soros and the Swamp. Who loses? Dugin and his fourth political theory, to which I add. And I’m a National Socialist. Here I leave the part that carries this writing of Dugin’s article:
Nowadays the Swamp also has extreme instruments to which it is appealing more and more. These extreme elements of transnational and liberal globalism are:
• Left-wing, anarchist and ultra-liberal extremists who defy any form of order,
• Islamic extremists of all walks of life (in the first place, Wahhabis and Salafists),
Neo-Nazi chauvinist groups of perverse xenophobes.


PanamapapersGeorge Soros (judío) tiene atragantado desde hace mucho tiempo a Putin. Soros y los Rockefeller (judíos también) financian al Consorcio Internacional de Periodistas de Investigación (ICIJ), los que han difundido los ya famosos “Papeles de Panamá”.

Citaré un párrafo de un pequeño gran ensayo titulado “Los conflictos en los Balcanes. La guerra civil en Yugoslavia y los intereses externos” (aquí) del licenciado y doctor argentino Marcelo Javier de los Reyes:

También se encuentran los intereses particulares, como los del “filántropo” George Soros, quien manifiesta un especial interés en el reconocimiento de Kosovo por parte de la comunidad internacional. El periodista español Joaquín Luna recuerda: “Hace tres años, la Fundación Soros invitó a un pequeño grupo de periodistas españoles para conocer el país y trasladar mensajes conciliatorios que contribuyesen al reconocimiento de España. A día de hoy nada ha cambiado”. Cabe mencionar que la fundación de Soros y sus organizaciones afines han estado detrás de las “revoluciones de colores” que se han producido desde Europa del este a Asia Central. Soros

Seguramente también andará detrás de las “primaveras árabes”. Y no digamos de Ucrania. Estos personajes juegan al parchís con países y con sus habitantes. Como se ve, no les importa las guerras, sus muertos y sus refugiados, o más bien, les importa ayudando a que se desestabilicen zonas para sus propios intereses.

Dos cuestiones. Una es la bienvenida a este destape de “celulosa panameña” y el que no tenga sus asuntos legalmente constituidos que caiga toda la ley sobre el. Sea persona física o jurídica (o ambas).

La segunda es aún más intrincada. Como se deduce, les da igual caiga quien caiga si tropieza el perseguido por ellos para que se dé contra el suelo. Los periodistas del Consorcio no saben que están manipulados, de su buena intención no hay que dudar, ahora bien, también es verdad que los medios a los que pertenecen se verán beneficiados en publicidades o ellos subirán de peldaños. Eso sí que lo saben.Rockefeller

En una tertulia de televisión, hablando de los “papeles” un periodista dijo por quién estaba financiado el Consorcio, al oír Soros y Rockefeller se hizo un silencio y en las caras de los demás contertulios se “leía”: ¡Judíos!, pero nadie se atrevió a decirlo, pues al día siguiente estarían buscando trabajo y además saben que jamás lo encontrarían.

¿Y Putin? pues eso, como el capital judío controla todos los medios (o casi) del planeta, Putin, sin estar en la lista de los “Panama papers” siguen diciendo que está en ellos, que algo quedará.

Es un nuevo capítulo de cómo quitarse a un rival de esa envergadura a través de los mass media y las redes sociales. Un experimento que lo volverán a repetir. No les importa a quien se lleven por delante si consiguen su fin. Se acabaron los asesinatos con veneno o radioactivos pues con las redes pueden tener un efecto contrario.

Ahora se “asesina” con lo que tienen a mano y les pertenece. Internet con el apoyo de la artillería de los mass media. Como un intrincado juego de mesa donde las casillas son países y los perdedores sus habitantes. Putin_1

Y que conste que nada tengo en contra de un judío de a pie. ¿Pero a quién le molesta que se diga que alguien es judío, si así es?

Y sigo con mi teoría del sándwich semítico (los hijos de Sem son tanto hebreos como árabes): La loncha de arriba los judíos, la de abajo el Islam, y Eurasia (meto a Rusia), el condumio para que prueben bocado.



George Soros (Jewish) makes choking longtime Putin. Soros and Rockefeller (also Jewish) finance the International Consortium of Investigative Journalists (ICIJ), which have spread the now famous “Panama Papers”.
I will quote a paragraph from a great little essay entitled “Conflicts in the Balkans The civil war in Yugoslavia and outside interests.” The lawyer and Argentine doctor Marcelo Javier de los Reyes:
There are also special interests, such as the “philanthropist” George Soros, who expressed a particular interest in the recognition of Kosovo by the international community. The Spanish journalist Joaquín Moon recalls: “Three years ago, the Soros Foundation invited a small group of Spanish journalists to know the country and move conciliatory messages that contribute to the recognition of Spain. Today nothing has changed. ” It is noteworthy that the Soros Foundation and related organizations have been behind the “color revolutions” that have occurred from Eastern Europe to Central Asia.

Surely he will walk behind the “Arab Spring”. Not to mention Ukraine. These characters play ludo with countries and their inhabitants. As you see, they do not care wars, their dead and refugees, or rather, helping them to care for their own interests areas are destabilized.

Two questions. One is welcome this unveiling of “Panamanian cellulose” and not have their legally constituted matters that fall all the law on. Whether natural or legal person (or both).

The second is more intricate. As is apparent, it does not care who falls when confronting the persecuted for them to be given the floor. Consortium journalists not know they are manipulated, their good intentions should not hesitate, however, it is also true that the media to which they belong will be benefited in advertising or they will go up steps. Now that they know it.

In a television talk show, talking about the “papers” said a journalist who was funded by the Consortium, hearing Soros and Rockefeller was silence and in the faces of the other cronies are “read”: Jews !, but no he dared to say, because the next day they would be looking for work and also know they never find.

And Putin? for that, as the Jewish capital controls all media (or almost) the planet, Putin, without being in the list of “Panama papers” keep saying that is in them, something will.

It is a new chapter on how to remove a rival of that size through the mass media and social networks. An experiment to repeat it again. They do not care who carried ahead if they get your order. murders with poison or radioactive because the networks may have the opposite effect ran out.

Now “killer” is what they have on hand and theirs. Internet with artillery support of the mass media. As an intricate board game where the boxes are losers countries and their inhabitants.

And for the record that I have nothing against a Jew walk. But who bothers to say that someone is Jewish, if so?

I continue with my theory of Semitic sandwich (the sons of Shem are both Jews and Arabs): The slice up the Jews, the bottom Islam and Eurasia (I put Russia), the condumio to prove bite.
