Una teoría de la conspiración loca que se puede probar. Covid-21

A crazy conspiracy theory that can be tested. Covid-21

¿Y si la siguiente hoja de ruta loca de la teoría de la conspiración se hace realidad?

Esta hoja de ruta fue “filtrada” por un ex-miembro del Partido Verde de Alemania (David Siber). Hace que la lectura impactante, pero muy cerca de palomas con uno filtrado de Canadá. No tengo un enlace a la primera filtración porque se publica en un canal de Telegram que sigo (David Siber’s). Sin embargo, realmente no creo que la validez de su fuente importe en ningún lugar tan cerca como de su posible poder predictivo.

Mi traducción de la filtración alemana (supongo que fue una fuga de septiembre/octubre, como la canadiense):

  1. Introducir el segundo bloqueo. Los cierres secundarios deben extenderse desde las ciudades hasta las áreas circundantes de una manera arrastrándose. Fecha límite: finales de noviembre de 2020.
  2. Establecimiento de centros de aislamiento en todos los estados y municipios federales. Fecha límite: finales de diciembre de 2020.
  3. Las cifras diarias de infecciones por COVID-19 están aumentando tan rápidamente que las autoridades están alcanzando los límites de su capacidad de prueba. Fecha límite: finales de noviembre de 2020.
  4. Bloqueo completo y final (restricciones más estrictas que el primer bloqueo). Fecha límite: finales de diciembre de 2020 – a partir de enero de 2021.
  5. Reforma del programa de prestaciones por desempleo y Hartz IV hacia la renta básica universal. Fecha límite: primer trimestre de 2021 – es decir, a finales de marzo de 2021.
  6. Mutación del virus COVID-19 en un virus más peligroso llamado COVID-21, que inicia una tercera oleada de infecciones con una alta tasa de mortalidad y mayores tasas de infección. Fecha límite: antes de febrero de 2021.
  7. Las nuevas infecciones diarias de COVID-21 abruman a las clínicas y hospitales. Fecha límite: trimestre 1 – trimestre 2 2021.
  8. Introducción del tercer encierro con más restricciones a la vida pública restante. Se prohibirá viajar entre estados federales e incluso ciudades. Fecha límite: trimestre 2 2021.
  9. Introducir a todos en un programa de ingresos básicos universales. Fecha límite: mediados del trimestre 2 2021.
  10. Una gran inestabilidad económica conduce al colapso de las cadenas de suministro y, por lo tanto, a la escasez de bienes en las tiendas. Fecha límite: trimestre 2 – trimestre 3 2021.
  11. Operaciones del ejército interno dentro de las principales ciudades y en autopistas. El objetivo es evitar el movimiento y los viajes de los ciudadanos y proporcionar apoyo logístico en las ciudades. Fecha límite: antes del trimestre de 2021.
  12. Se da a los ciudadanos la oportunidad de cancelar todos los préstamos personales en el marco del llamado “Programa Mundial de Restablecimiento de la Deuda”. El Estado recibe los recursos financieros necesarios del FMI (Fondo Monetario Internacional). Para adherirse a este programa, los ciudadanos deben transferir todos los derechos de propiedad a los bienes existentes y también a todos los futuros. Además, el ciudadano se compromete a aceptar las vacunas COVID-19 y COVID-21 sin resistencia. Con el nuevo pase de vacunación, se levantan todas las restricciones a cada ciudadano que cumpla con las normas. Los ciudadanos que se oponen a la vacunación y al programa de pago de la deuda se convertirán en un “riesgo para la salud de los demás”. Sólo serán liberados de las restricciones de bloqueo después de aceptar el programa de pago de la deuda y permitirse vacunarse. 

Bill Gates aparece en el video vinculado a arriba. Afirma rotly que “pandemia 2” será peor que “pandemia 1”. El video también muestra a él y a su esposa Melinda luciendo extrañamente complacidos con la perspectiva de la variante más mortífera aún por venir. ¿Cómo puede saber estas cosas? ¿Por qué la prensa no está en todas estas afirmaciones extraordinarias? ¿Quién es responsable de estos horarios posiblemente filtrados? ¿Los horarios son creíbles?

Independientemente de las posibles respuestas a tales preguntas, una teoría es buena si puede ser falsificada. Las predicciones claras cumplen ese criterio aquí. ¿Qué pasa con The Great Reset, “Build Back Better” que se utiliza simultáneamente en todo el mundo de habla inglesa, un medio de comunicación de masas de una sola melodía en todo el mundo y predicciones más transparentes sobre futuras mutaciones de virus y letalidad de un ex jefe de una gran compañía de software, si este conjunto de predicciones (declaraciones) comenzara a hacerse realidad – y parecen ser ya – , que probaría la “teoría de la conspiración”, ¿no? ¿Qué otra explicación podría explicar todos estos hechos?

Si mi lógica es sólida, entonces compartir esta información con todos y el sol es de suma importancia. Me gustaría que este horario fuera el producto de un loco en alguna parte, pero las cosas han estado más allá de la locura durante ocho meses, así que creo que esto merece atención.

Econosophy and other musings: A crazy conspiracy theory that can be tested (thdrussell.blogspot.com)

La Agenda Secreta del Banco Mundial y el FMI

Por Peter Koenig

El Banco Mundial y el Fondo Monetario Internacional (FMI) trabajan de la misma mano – sin problemas. No sólo están prestando regularmente enormes sumas de dinero a regímenes de terror de todo el mundo, sino que chantajean a las naciones pobres para que acepten condiciones draconianas impuestas por Occidente. En otras palabras, el BM y el FMI son culpables de los abusos más atroces contra los derechos humanos.

No se podía decir, cuando se lee sobre la entrada del Banco Mundial la noble frase, “Nuestro sueño es mundial libre de pobreza”. A esta hipocresía sólo puedo añadir, “… Y nos aseguramos de que siga siendo un sueño”. Esto dice ambas cosas, la mentira y el carácter criminal de las dos Instituciones Financieras Internacionales, creadas bajo la Carta de las Naciones Unidas, pero instigadas por los Estados Unidos.

El frente de estas instituciones es brillante. Lo que le parece a las inversiones en infraestructura social, en escuelas, sistemas de salud, necesidades básicas como agua potable, saneamiento, incluso protección del medio ambiente, sobre todo “Alivio de la pobreza”, es decir, un mundo libre de pobreza. Pero lo falso que es esto hoy en día y ya estaba en los años 1970 y 1980 es asombroso. Poco a poco la gente está abriendo los ojos a una realidad abyecta, de explotación y coerción y chantaje total. Y eso, bajo los auspicios de las Naciones Unidas. ¿Qué le dice sobre el sistema de las Naciones Unidas? ¿En qué manos están las Naciones Unidas? – La organización mundial fue creada en San Francisco, California, el 24 de octubre de 1945, justo después de la Segunda Guerra Mundial, por 51naciones, comprometidas con el mantenimiento de la paz y la seguridad internacionales, el desarrollo de relaciones amistosas entre las naciones y la promoción del progreso social, mejores niveles de vida y derechos humanos.

La ONU reemplazó a la Sociedad de Naciones que formaba parte del Acuerdo de Paz después de la Primera Guerra Mundial, el Tratado de Versalles. Entró en vigor el 10 de enero de 1920, tenía su sede en Ginebra, Suiza, con el propósito de desarme, prevenir la guerra a través de la seguridad colectiva, resolver disputas entre países, mediante la diplomacia de negociación y mejorar el bienestar mundial. En retrospectiva, es fácil ver que todo el sistema de las Naciones Unidas se estableció como una farsa hipócrita, haciendo creer a la gente que sus poderosos líderes sólo querían la paz. Estos poderosos líderes eran todos occidentales; el mismo que menos de 20 años después de la creación de la noble Sociedad de Naciones, comenzó la Segunda Guerra Mundial.

*

Esta pequeña introducción proporciona el contexto para lo que eventualmente se convertiría en el resultado de las Naciones Unidas para el robo global, para las naciones empobrecidas, en todo el mundo, para la explotación de las personas, para los abusos contra los derechos humanos y para palear enormes cantidades de activos desde el fondo, desde el pueblo hasta la oligarquía, la élite corporativa cada vez más pequeña, las llamadas Instituciones de Bretton Woods.

En julio de 1944, más de 700 delegados de 44 Naciones Aliadas (aliados con los ganadores de la Segunda Guerra Mundial, incluida la Unión Soviética) se reunieron en el Mount Washington Hotel, situado en Bretton Woods, New Hampshire, Estados Unidos, para regular el orden monetario y financiero internacional después de la Segunda Guerra Mundial. Seamos seguros, esta conferencia se llevó a cabo bajo los auspicios de los Estados Unidos, el auto-declarado ganador de la Segunda Guerra Mundial, y a partir de ahora el maestro sobre el orden financiero del mundo, que no era inmediatamente visible, una agenda oculta a simple vista.

El FMI fue creado oficialmente para “regular” las monedas occidentales, llamadas convertibles, aquellas que se suscribieron para aplicar las reglas del nuevo estándar de oro, es decir, US$ 35 / Onza Troya (alrededor de 31,1 gramos). Tenga en cuenta que el patrón oro, aunque aplicable por igual a 44 naciones aliadas estaba vinculado al precio del oro nominado en dólares estadounidenses,no basado en una cesta del valor de las 44 monedas nacionales. Esto ya era razón suficiente para cuestionar el futuro sistema. Y cómo va a salir. Pero nadie cuestionó el arreglo. Difícil de creer, sin embargo, el de todos estos economistas nacionales, ninguno se atrevió a cuestionar la naturaleza traicionera de la configuración del patrón oro.

El Banco Mundial, o el Banco de Reconstrucción y Desarrollo (IBRD), se creó oficialmente para administrar el Plan Marshall para la Reconstrucción de Europa destruida por la guerra. El Plan Marshall fue una donación de los Estados Unidos y fue nombrado en honor al Secretario de Estado de los Estados Unidos George Marshall, quien lo propuso en 1947. El plan dio 13.200 millones de dólares en ayuda exterior a los países europeos que habían sido devastados física y económicamente por la Segunda Guerra Mundial. Se iba a implementar de 1948 a 1952, que por supuesto era un tiempo demasiado corto, y se extendió hasta principios de la década de 1960. En los términos actuales, el plan Marshall valdría unas 10 veces más, o unos 135 mil millones de dólares EE.UU.

El Plan Marshall era y sigue siendo un Fondo Rotatorio, devuelto por los países en cuestión, para que pudiera ser cedido. El dinero del Plan Marshall fue prestado varias veces y, por lo tanto, fue muy eficaz. La contraparte europea del Fondo Marshall administrado por el Banco Mundial fue un banco de reciente creación creado bajo el Ministerio de Finanzas alemán, el Banco Alemán de Reconstrucción y Desarrollo (KfW – acrónimo alemán de “Kreditanstalt f’r Wiederaufbau”).

KfW, como contraparte europea del Banco Mundial sigue existiendo y se dedica principalmente a proyectos de desarrollo en el Sur Global, ahora principalmente con fusores del Gobierno alemán y tomados prestados de los mercados de capitales alemanes y europeos. KfW a menudo coopera en proyectos conjuntos con el Banco Mundial. Hoy en día todavía hay un Departamento especial dentro de KfW que se ocupa exclusivamente del dinero del Fondo del Plan Marshall. Estos fondos todavía rotatorios se utilizan para prestar a las regiones pobres del sur de Europa, y también para apuntalar las economías de Europa del Este, y se utilizaron especialmente para integrar a la antigua Alemania Oriental en la actual “Gran Alemania”.

Dos elementos del Plan Marshall son particularmente llamativos y dignos de mención. En primer lugar, el plan de reconstrucción creó un lazo, una dependencia entre los Estados Unidos y Europa, la misma Europa que fue destruida en gran medida por las fuerzas aliadas occidentales, mientras que básicamente la Segunda Guerra Mundial fue ganada en gran medida por la Unión Soviética, los enormes sacrificios de la URSS, con un estimado de 25 a 30 millones de muertes. Por lo tanto, el Plan Marshall también fue diseñado como un escudo contra la Rusia comunista, es decir, la URSS.

Mientras que oficialmente la Unión Soviética era un aliado de las potencias occidentales, Estados Unidos, Reino Unido y Francia, en realidad la URSS comunista era un archienemigo del oeste, especialmente de los Estados Unidos. Con el dinero del Plan Marshall, Estados Unidos compró la alianza europea, una dependencia que no ha terminado hasta el día de hoy, y que todavía está impidiendo a Europa establecer relaciones normales con Rusia, a pesar de que la Unión Soviética ha desaparecido hace tres décadas. La guerra fría subsiguiente después de la Segunda Guerra Mundial contra la URSS, también basada en mentiras flagrantes, fue un testimonio directo de otra farsa propagandística occidental, que hasta el día de hoy, la mayoría de los europeos aún no han captado.

En segundo lugar, la imposición estadounidense de un fondo de reconstrucción con sede en dólares estadounidenses no sólo estaba creando una dependencia del dólar europeo, sino que también estaba sentando las bases para una moneda singular, eventualmente para invadir Europa – lo que sabemos hoy, se ha convertido en el euro. El euro no es más que el hijo adoptivo del dólar, ya que fue creado bajo la misma imagen que el dólar estadounidense: es una moneda fiduciaria, respaldada por nada. La Europa Unida, o ahora llamada Unión Europea, nunca fue realmente una unión. Nunca fue una idea europea, pero presentada por los Servicios Secretos de los Estados Unidos disfrazados de unos cuantos honchos europeos traicioneros. Y cada intento de crear una Europa Unida, una Federación Europea, con una Constitución Europea, similar a los Estados Unidos, fue amargamente saboteado por los Estados Unidos, principalmente a través del topo estadounidense en la UE, a saber, el Reino Unido.

Estados Unidos no quería una Europa fuerte, tanto económica como posiblemente con el tiempo también militarmente (pop. 450 millones de la UE, frente a US pop. 330 millones; 2019 PIB de la UE US$ 20,3 billones equivalentes, frente al PIB de EE.UU. 21,4 billones. La mayoría de los economistas estarían de acuerdo en que una moneda común para un grupo de países sueltos no tiene futuro, no es sostenible. No existe una Constitución común, por lo tanto, no hay un objetivo común, financiera, económica y militarmente. Una moneda común no es sostenible a largo plazo en estas circunstancias inestables. Esto es más que visible sólo 20 años después del euro. La eurozona es un desastre desesperado. En el Banco Central Europeo (BCE), también una creación inspirada en la FED y el Tesoro de los Estados Unidos. El BCE no tiene realmente ninguna función del Banco Central. Es más bien un perro de observación. Porque cada país miembro de la UE todavía tiene su propio Banco Central, aunque con una soberanía drásticamente reducida que los países de la eurozona concedieron al BCE, sin recibir ningún derecho equivalente.

De los 27 miembros de la UE, sólo 19 forman parte de la zona euro. Aquellos países que no forman parte de la Eurozona, es decir, la República Checa, Dinamarca, Hungría, Suecia, y más, han preservado su política financiera soberana y no dependen del BCE. Esto significa que si Grecia hubiera optado por no participar en la Eurozona cuando se vieron afectados por la “crisis” fabricada en 2008/2009, Grecia estaría ahora en camino hacia la recuperación completa. No habrían sido objeto de los caprichos y dictados del FMI, la infame troika, la Comisión Europea (CE), el BCE y el FMI, pero podrían haber optado por organizar su deuda internamente, ya que la mayor parte de la deuda era deuda interna, sin necesidad de endeudarse del extranjero.

En un referéndum de rescate de 2015, la población griega votó abrumadoramente en contra del rescate, lo que significa contra la nueva deuda gigantesca. Sin embargo, el entonces presidente griego Tsipras, siguió adelante como si el referéndum nunca hubiera tenido lugar y aprobó el enorme rescate a pesar de casi el 70% del voto popular en su contra.

Esto es una clara indicación de fraude, que no estaba pasando juego limpio. Tsipras y / o sus familias pueden haber sido coaccionados para aceptar el rescate – o de lo contrario. Tal vez nunca sepamos la verdadera razón por la que Tsipras vendió a su pueblo, el bienestar del pueblo griego a los oligarcas detrás del FMI y el Banco Mundial, y los puso en abyecta miseria, con el mayor desempleo en Europa, pobreza desenfrenada y tasas de suicidio disparadas.

Grecia puede servir de ejemplo sobre cómo pueden llevar a otros países de la UE si no se “comportan”, lo que significa adherirse a las reglas de oro no escritas de obediencia a los maestros del dinero internacional.

Esto da miedo.

*

Y ahora, en estos tiempos de covid, es relativamente fácil. Los países pobres, en particular en el Sur Mundial, ya endeudados por el plandemic, están aumentando su deuda externa para satisfacer a sus poblaciones necesidades básicas. O eso te hacen creer. Gran parte de la deuda acumulada por los países en desarrollo es deuda interna o interna, como la deuda del Norte Global. Realmente no necesita instituciones de préstamos extranjeras para eliminar la deuda local. ¿O ha visto a uno de los países ricos del Norte Global pedir prestado al FMI o al Banco Mundial para dominar su deuda? – Difícilmente.

Entonces, ¿por qué caería el Sur Global? Corrupción parcial, coacción parcial y chantaje parcial. – Sí, el chantaje, uno de los crímenes más grandes internacionales imaginables, fue cometido por las principales instituciones financieras internacionales de las Naciones Unidas, el BM y el FMI.

Por ejemplo, el mundo entero se pregunta cómo es que un enemigo invisible, un virus coronazo a los 193 países miembros de la ONU a la vez, por lo que el Dr. Tedros, Director General de la OMS, declara el 11 de marzo una pandemia -sin razón alguna ya que sólo hubo 4.617 casos en todo el mundo-, pero el resultado previsto fue un bloqueo mundial total el 16 de marzo de 2020. Sin excepciones. Había algunos países que no se lo tomaban tan en serio, como Brasil, Suecia, Bielorrusia, algunos países africanos, como Madagascar y Tanzania, desarrollaron sus propias reglas y se dieron cuenta de que el uso de máscaras hacía más daño que bien, y el distanciamiento social destruiría el tejido social de sus culturas y las generaciones futuras.

Pero el estado satánico y oscuro no quería tener nada que ver con los países “independientes”. Todos ellos tuvieron que seguir el dictado desde muy arriba, desde las Puertas, Rockefeller, Soroses, et al elite, pronto para ser reforzados por Klaus Schwab, sirviendo como el secuaz jefe del Foro Económico Mundial (WEF). De repente, se ve en Brasil, un aumento drástico en nuevos “casos”, sin preguntas, pruebas masivas, no importa que las infames pruebas de PCR no valen nada, según los científicos más serios – ver “La prueba COVID-19 RT-PCR: Cómo engañar a toda la humanidad. Usando una “Prueba” para encerrar a la Sociedad (por Pascal Sacré – 5 de noviembre de 2020) (sólo los científicos vendidos y corruptos, los pagados por las autoridades nacionales, seguirían insistiendo en las pruebas RT-PCR). El brasileño Bolsonaro se enferma con el virus y el recuento de muertes aumenta exponencialmente, a medida que la economía brasileña se desmorona.

¿Coincidencia? Apenas.

En los países del Banco Mundial y/o el FMI, ofreciendo ayuda masiva principalmente alivio de la deuda, ya sea como subvenciones o como préstamos a bajo interés. Pero con enormes ataduras: Debe seguir las reglas establecidas por la OMS, debe seguir las reglas sobre las pruebas masivas en materia de vacunación, cuando estén disponibles, vacunación de mandatarias – si se ajusta a estas y otras reglas específicas de cada país, como dejar que las corporaciones occidentales toquen sus recursos naturales, continuar privatizando su infraestructura social y servicios – puede recibir asistencia del BM y el FMI.

Ya en mayo de 2020, el Grupo del Banco Mundial anunció que sus operaciones de emergencia para luchar contra el COVID-19 ya habían llegado a 100 países en desarrollo, hogar del 70% de la población mundial con préstamos de 160 mil millones de dólares ee.UU. más. Esto significa, para hoy, 6 meses más tarde y en medio de la “Segunda Ola”, el número de países y el número de préstamos o subvenciones de “alivio” debe haber aumentado exponencialmente, habiendo llegado a cerca de los 193 países miembros de la ONU. Lo que explica cómo todos, literalmente todos los países, incluso los países africanos más importantes, como Madagascar y Tanzania, entre los más pobres de los pobres, han sucumbido a la coacción o chantaje de las infames instituciones de Bretton Woods.

Estas instituciones no tienen disputas en la generación de dólares, ya que el dólar es dinero fiduciario, no respaldado por ninguna economía, sino que puede ser producido literalmente desde el aire caliente y prestado a los países pobres, ya sea como deuda o como subvención. Estos países, a partir de ahora y por la presión de las instituciones financieras internacionales, dependerán para siempre de los maestros occidentales de la salvación. Covid-19 es la herramienta perfecta para que los mercados financieros palanen activos de abajo a arriba.

Con el fin de maximizar la concentración de las riquezas en la parte superior, tal vez una o dos o incluso tres nuevas ondas covid pueden ser necesarias. Todo eso está planeado, el WEF ya ha previsto los próximos escenarios, por su libro tiránico “Covid-19 – El Gran Reinicio”. Está todo dispuesto. Y nuestros intelectuales occidentales lo leen, lo analizan, lo critican, pero no lo destrozamos, lo dejamos pararse y observamos cómo se mueve la palabra en la dirección Restablecer. Y el plan es ejecutado debidamente por el Banco Mundial y el FMI, todo bajo el pretexto de hacer el bien para el mundo.

¿Qué es diferente del papel del Banco Mundial y el FMI ante el plandemic covid? – Nada. Sólo la causa de la explotación, el indevolcimiento, la esclavitud. Cuando Covid llegó se hizo fácil. Antes de eso y hasta finales de 2019, los países en desarrollo, en su mayoría ricos en recursos naturales como los codiciados occidentales, el petróleo, el oro, el cobre y otros minerales, como las tierras raras, serían abordados por el BM, el FMI o ambos.

Podrían recibir alivio de la deuda, los llamados préstamos de ajuste estructural, sin importar si realmente necesitaban o no esa deuda. Hoy en día estos préstamos vienen en todos los nombres, formas, formas y colores, literalmente como las revoluciones de color, por ejemplo, a menudo como operaciones de apoyo presupuestario – simplemente los llamo cheques en blanco – nadie controla lo que está sucediendo con el dinero. Sin embargo, los países tienen que reestructurar sus economías, racionalizar sus servicios públicos, privatizar el agua, la educación, los servicios de salud, la electricidad, las carreteras, los ferrocarriles y otorgar concesiones extranjeras para la explotación de los recursos naturales.

La mayor parte de este fraude –el fraude al “robar” los recursos nacionales, pasa sin ser visto por el público en general, pero los países se vuelven cada vez más dependientes de los paymasters occidentales – la soberanía de los pueblos y la soberanía institucional se ha ido. Siempre hay un corruptor y un corrupto. Desafortunadamente, siguen estando omnipresentes en el Sur Global. A menudo, por una porción de dinero, los países se ven obligados a votar con los Estados Unidos a favor o en contra de ciertas resoluciones de la ONU que son de interés para los Estados Unidos. Aquí vamos, el sistema corrupto de la ONU.

Y, por supuesto, cuando se crearon las dos organizaciones de Bretton Woods en 1944, el sistema de votación decidió que no es un país, un voto como en teoría es en la ONU, pero Estados Unidos tiene un derecho absoluto de veto en ambas organizaciones. Sus derechos de voto se calculan en función de su contribución de capital que deriva de una fórmula compleja, basada en el PIB y otros indicadores económicos. En ambas instituciones, el derecho de voto de los Estados Unidos y también el derecho de veto es de alrededor del 17%. Ambas instituciones tienen 189 países miembros. Ninguno de estos otros países tiene un derecho de voto superior al 17%. La UE lo habría hecho, pero los Estados Unidos nunca les permitieron convertirse en un país o una Federación.

*

Covid ha puesto al descubierto, si no antes, cómo estas instituciones financieras internacionales “oficiales” de Bretton Woods, constituidas por las Naciones Unidas, están plenamente integradas en el sistema de las Naciones Unidas, en el que la mayoría de los países todavía confían, tal vez por falta de algo mejor.

Pregunta, sin embargo: ¿Qué es mejor, un sistema corrupto hipócrita que proporciona la “apariencia”, o la abolición de un sistema distópico y el valor de crear uno nuevo, en nuevas circunstancias democráticas y con derechos soberanos por cada país participante?

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

Este artículo fue publicado originalmente en New Eastern Outlook.

Peter Koenig es economista y analista geopolítico. También es especialista en recursos hídricos y medio ambiente. Trabajó durante más de 30 años con el Banco Mundial y la Organización Mundial de la Salud en todo el mundo en los campos del medio ambiente y el agua. Da conferencias en universidades de Estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea como Global Research; ICH; Nueva Perspectiva Oriental (NEO) y más. Es autor de Implosion – Un Thriller Económico sobre Guerra, Destrucción Ambiental y Codicia Corporativa – ficción basada en hechos y en 30 años de experiencia en el Banco Mundial en todo el mundo.

Peter también es coautor del libro de Cynthia McKinney “When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis” (ClarityPress – 1 de noviembre de 2020)

Peter Koenig es investigador asociado del Centro de Investigación sobre la Globalización.

La fuente original de este artículo es Global Research. Derechos de autor © Peter Koenig, Global Research, 2020

The Secret Agenda of the World Bank and the IMF – Global ResearchGlobal Research – Centre for Research on Globalization

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.

Arzobispo Viganò: Carta abierta a Donald Trump, advierte sobre el “Gran Reinicio”.

DONALD J. TRUMP

Domingo, 25 de octubre de 2020

Presidente

Permítanme dirigirme a ustedes en esta hora en la que el destino de todo el mundo está siendo amenazado por una conspiración global contra Dios y la humanidad. Os escribo como arzobispo, como Sucesor de los Apóstoles, como antiguo nuncio apostólico en los Estados Unidos de América. Os escribo en medio del silencio de las autoridades civiles y religiosas. Que acepten estas palabras mías como la “voz de uno que grita en el desierto” (Jn 1, 23).

Como dije cuando les escribí mi carta en junio, en este momento histórico las fuerzas del Mal se alinean en una batalla sin cuartel contra las fuerzas del Bien; fuerzas del Mal que parecen poderosas y organizadas al oponerse a los hijos de la Luz, que están desorientados y desorganizados, abandonados por sus líderes temporales y espirituales.

Todos los días sentimos que los ataques se multiplican de aquellos que quieren destruir la base misma de la sociedad: la familia natural, el respeto por la vida humana, el amor al país, la libertad de educación y de los negocios. Vemos a los jefes de naciones y líderes religiosos atorándose a este suicidio de la cultura occidental y su alma cristiana, mientras que los derechos fundamentales de los ciudadanos y los creyentes son negados en nombre de una emergencia de salud que se está revelando cada vez más plenamente como instrumental para el establecimiento de una tiranía inhumana sin rostro.

Un plan global llamado Gran Reinicio está en marcha. Su arquitecto es una élite global que quiere someter a toda la humanidad, imponiendo medidas coercitivas con las que limitar drásticamente las libertades individuales y las de poblaciones enteras. En varias naciones este plan ya ha sido aprobado y financiado; en otros todavía está en una etapa temprana. Detrás de los líderes mundiales que son los cómplices y ejecutores de este proyecto infernal, hay personajes sin escrúpulos que financian el Foro Económico Mundial y el Evento 201,promoviendo su agenda.

El propósito del Gran Reinicio es la imposición de una dictadura de la salud con el objetivo de la imposición de medidas liberticidas, ocultas detrás de tentadoras promesas de asegurar un ingreso universal y cancelar la deuda individual. El precio de estas concesiones del Fondo Monetario Internacional será la renuncia a la propiedad privada y la adhesión a un programa de vacunación contra Covid-19 y Covid-21 promovido por Bill Gates con la colaboración de los principales grupos farmacéuticos. Más allá de los enormes intereses económicos que motivan a los promotores del Gran Restablecimiento,la imposición de la vacunación irá acompañada de la exigencia de un pasaporte sanitario y un DNI digital, con el consiguiente rastreo de contactos de la población de todo el mundo. Aquellos que no acepten estas medidas serán confinados en campos de detención o puestos bajo arresto domiciliario, y todos sus bienes serán confiscados.

Señor Presidente, me imagino que ya es consciente de que en algunos países se activará el Gran Restablecimiento entre finales de este año y el primer trimestre de 2021. Para ello, se prevén nuevos bloqueos, que se justificarán oficialmente con una supuesta segunda y tercera oleada de la pandemia. Ustedes son muy conscientes de los medios que se han desplegado para sembrar pánico y legitimar las limitaciones draconianas a las libertades individuales, provocando artísticamente una crisis económica mundial. En las intenciones de sus arquitectos, esta crisis servirá para que el recurso de las naciones al Gran Reinicio sea irreversible, dando así el golpe final a un mundo cuya existencia y muy memoria quieren cancelar por completo. Pero este mundo, señor Presidente, incluye personas, afectos, instituciones, fe, cultura, tradiciones e ideales: personas y valores que no actúan como autómatas, que no obedecen como máquinas, porque están dotados de un alma y un corazón, porque están unidos por un vínculo espiritual que extrae su fuerza de arriba, de ese Dios que nuestros adversarios quieren desafiar, tal como Lucifer hizo al principio de los tiempos con “suno serma”.

Muchas personas, como bien sabemos, están molestas por esta referencia al choque entre el Bien y el Mal y el uso de matices “apocalípticos”, que según ellos exaspera espíritus y agudiza las divisiones. No es de extrañar que el enemigo se enoje por ser descubierto justo cuando cree que ha llegado a la ciudadela que busca conquistar sin perturbaciones. Lo sorprendente, sin embargo, es que no hay nadie que haga sonar la alarma. La reacción del estado profundo a quienes denuncian su plan está rota e incoherente, pero comprensible. Justo cuando la complicidad de los medios de comunicación convencionales había logrado hacer la transición al Nuevo Orden Mundial casi indoloro y desapercibido, todo tipo de engaños, escándalos y crímenes están saliendo a la luz.

Hasta hace unos meses, era fácil desprestigorarse como “teóricos de la conspiración” aquellos que denunciaron estos terribles planes, que ahora vemos que se llevan a cabo hasta el más mínimo detalle. Nadie, hasta el pasado mes de febrero, hubiera pensado que, en todas nuestras ciudades, los ciudadanos serían arrestados simplemente por querer caminar por la calle, respirar, querer mantener sus negocios abiertos, querer ir a la iglesia el domingo. Sin embargo, ahora está sucediendo en todo el mundo, incluso en la Italia de postales que muchos estadounidenses consideran un pequeño país encantado, con sus monumentos antiguos, sus iglesias, sus ciudades encantadoras, sus pueblos característicos. Y mientras los políticos están atrincherados dentro de sus palacios promulgando decretos como sátrapas persas, las empresas están fallando, las tiendas están cerrando y se impide que la gente viva, viaje, trabaje y ore. Las desastrosas consecuencias psicológicas de esta operación ya se están viendo, comenzando con los suicidios de empresarios desesperados y de nuestros hijos, segregados de amigos y compañeros de clase, que se les dice que sigan sus clases mientras se sientan en casa solo frente a una computadora.

En la Sagrada Escritura, san Pablo nos habla de “el que se opone” a la manifestación del misterio de la iniquidad,el kath-kon (2 Tes 2, 6-7). En el ámbito religioso, este obstáculo para el mal es la Iglesia, y en particular el papado; en el ámbito político, son los que impiden el establecimiento del Nuevo Orden Mundial.

Como ahora está claro, el que ocupa la Cátedra de Pedro ha traicionado su papel desde el principio para defender y promover la ideología globalista, apoyando la agenda de la iglesia profunda, que lo eligió de sus filas.

Señor Presidente, usted ha declarado claramente que desea defender a la nación : Una Nación bajo Dios,libertades fundamentales y valores innegociables que se niegan y luchan contra hoy. Eres tú, querido Presidente, quien es “el que se opone” al estado profundo, el asalto final de los hijos de las tinieblas.

Por esta razón, es necesario que todas las personas de bien sean persuadidas de la importancia de la época de la inminente elección: no tanto por el bien de este o de ese programa político, sino por la inspiración general de vuestra acción que mejor encarna , en este contexto histórico particular, ese mundo, nuestro mundo, que quieren cancelar por medio del encierro. Vuestro adversario es también nuestro adversario: es el enemigo de la raza humana, el que es “un asesino desde el principio” (Jn 8, 44).

A tu alrededor están reunidos con fe y coraje aquellos que te consideran la guarnición final contra la dictadura mundial. La alternativa es votar por una persona que es manipulada por el estado profundo, gravemente comprometida por escándalos y corrupción, que hará a los Estados Unidos lo que Jorge Mario Bergoglio está haciendo a la Iglesia, el Primer Ministro Conte a Italia, el Presidente Macron a Francia, el Primer Ministro Sánchez a España, y así sucesivamente. La naturaleza chantajable de Joe Biden, al igual que la de los prelados del “círculo mágico” del Vaticano, lo expondrá a ser utilizado sin escrúpulos, permitiendo que los poderes ilegítimos interfieran tanto en la política interna como en los equilibrios internacionales. Es obvio que aquellos que lo manipulan ya tienen a alguien peor que él listo, con quien lo reemplazarán tan pronto como surja la oportunidad.

Y sin embargo, en medio de este panorama sombrío, surge este avance aparentemente imparable del “Enemigo Invisible”, un elemento de esperanza. El adversario no sabe amar, y no entiende que no sea suficiente asegurar un ingreso universal o cancelar hipotecas para subyugar a las masas y convencerlas de que sean marcadas como ganado. Este pueblo, que durante demasiado tiempo ha soportado los abusos de un poder odioso y tiránico, está redescubriendo que tiene un alma; entiende que no está dispuesto a intercambiar su libertad para la homogeneización y cancelación de su identidad; está empezando a entender el valor de los lazos familiares y sociales, de los lazos de fe y cultura que unen a las personas honestas. Este Gran Restablecimiento está destinado a fracasar porque los que lo planearon no entienden que todavía hay gente dispuesta a tomar las calles para defender sus derechos, para proteger a sus seres queridos, para dar un futuro a sus hijos y nietos. La inhumanidad nivelada del proyecto globalista se destrozará miserablemente frente a la firme y valiente oposición de los hijos de la Luz. El enemigo tiene a Satanás de su lado, Aquel que sólo sabe odiar. Pero de nuestro lado, tenemos al Señor Todopoderoso, el Dios de los ejércitos dispuestos para la batalla, y la Santísima Virgen, que aplastará la cabeza de la antigua Serpiente. “Si Dios es para nosotros, ¿quién puede estar contra nosotros?” (Rm 8:31).

Señor Presidente, usted es muy consciente de que, en esta crucial hora, los Estados Unidos de América se consideran el muro defensor contra el que se ha desatado la guerra declarada por los defensores del globalismo. Pon tu confianza en el Señor, fortalecido por las palabras del apóstol Pablo: “Puedo hacer todas las cosas en Aquel que me fortalece” (Flp 4, 13). Ser un instrumento de la Divina Providencia es una gran responsabilidad, por la cual sin duda recibirás todas las gracias de estado que necesitáis, ya que están siendo fervientemente implorados para vosotros por las muchas personas que te apoyan con sus oraciones.

Con esta esperanza celestial y la seguridad de mi oración por vosotros, por la Primera Dama y por vuestros colaboradores, con todo mi corazón os envío mi bendición.

¡Dios bendiga a los Estados Unidos de América!

+ Carlo Maria Viganò

Teta Arzobispo de Ulpiana

Ex Nuncio Apostólico en los Estados Unidos de América

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.