POR FAVOR, APAGUEN El WI-FI ANTES DE IRSE A DORMIR

Si tienes un lector de señales, verás que en tu propio dormitorio puedes llegar a tener y por tanto “sentir” hasta veinte señales diferentes de Wi-Fi, unas más intensas que otras pero todas suman.

Si todos apagamos estas señales, routers de Wi-Fi, cuando no las necesitamos estamos haciendo un bien a nosotros mismos y a nuestros vecinos y semejantes, todo un catálogo de vecindad, educación, solidaridad ambiental, salud y si no crees que esas microondas afecten a tu cuerpo, al menos hazlo para ahorrar energía, bajará tú factura de la luz.

A restaurantes, bares, discotecas, tiendas, supermercados, oficinas, sitios oficiales, etc. apaguen los routers del Wi-Fi cuando cierren el negocio, y lo vuelven a encender al día siguiente cuando abran de nuevo. Muchas de esas señales, cuando uno ha de descansar en pleno derecho, se acumulan de estos lugares.

También lo pueden hacer para ahorrar en la factura de energía.

Ya podrían hacer los gobiernos una campaña para tal efecto. Es parte de la educación ambiental. Eso que tanto se lleva, lo de ambiental, lo de la educación, algo menos.

¡Ahorra energía, regala salud!

Gracias.

G.R.M.

¿Aumentarán drásticamente las muertes relacionadas con las vacunas este invierno?

Mike Whitney • 9 de octubre de 2021 • 4.100 palabras https://www.unz.com/

“Me preocupa la posibilidad de que las nuevas vacunas destinadas a crear inmunidad contra la proteína pico del SARS-CoV-2 tengan el potencial de causar lesiones microvasculares en el cerebro, corazón, hígado y riñones de una manera que no parece ser evaluada en las pruebas de seguridad “. Dr. J. Patrick Whelan

“Estamos lidiando con el mal. En caso de que no lo hayas notado “. Robert W Malone, MD, Twitter

Pregunta: ¿Por qué todos deben vacunarse?

Respuesta: para salvar vidas. Las vacunas proporcionan inmunidad que ayuda en la lucha contra las enfermedades.

Pregunta: ¿Entonces las vacunas previenen la infección?

Respuesta: No exactamente, pero las vacunas brindan inmunidad temporal que generalmente dura alrededor de 6 meses.

Pregunta – ¿Entonces qué?

Respuesta: Bueno, entonces los expertos en salud pública recomiendan que las personas elegibles, en particular las personas mayores y las personas inmunodeprimidas, reciban un “refuerzo”.

Pregunta – Entonces, ¿otra inyección?

Respuesta: sí.

Pregunta: ¿Se ha adaptado el refuerzo a la nueva variante “Delta” que se ha extendido por los EE. UU. Y el mundo?

Respuesta: No, no lo ha hecho. Es la misma vacuna que antes.

Pregunta: ¿ Entonces la inmunidad será de corta duración?

Respuesta: Sí, aunque no podemos estar completamente seguros. No se han realizado ensayos clínicos sobre los refuerzos.

Pregunta– ¿Qué? Entonces, ¿estamos volando a ciegas?

Respuesta: sí. Como dije, no ha habido ensayos clínicos adicionales para los refuerzos, por lo que nadie lo sabe con certeza.

Pregunta: ¿ Pero he oído que cuantas más personas inyectamos, más adaptable se vuelve el virus, lo que hace que la vacuna sea menos efectiva?

Respuesta: eso es cierto. La vacunación masiva con una vacuna “permeable”, que no neutraliza completamente la infección, aplica una “presión selectiva” sobre el virus que promueve la aparición de variantes. Los inmunólogos lo saben desde hace mucho tiempo, de hecho, algunos lo llaman “Virología 101”. El vacunólogo canadiense Dr. Byram Bridle explicó esto en una entrevista reciente. Esto es lo que dijo:

“No tenemos que mirar más allá de … la aparición de resistencia a los antibióticos … El principio es este: si tiene una entidad biológica que es propensa a la mutación , y el SARS-CoV-2, como todos los coronavirus, es propenso a la mutación, y usted Si aplica una presión selectiva de enfoque estrecho que no es letal, y lo hace durante un largo período de tiempo, esta es la receta para impulsar la aparición de nuevas variantes.

Eso es exactamente lo que estamos haciendo. Nuestras vacunas se centran en una sola proteína (pico) del virus, por lo que el virus solo tiene que alterar una proteína, y las vacunas no se acercan a proporcionar inmunidad esterilizante “. ( “Las mentiras detrás de la pandemia de los no vacíos” , vervetimes.com)

Pregunta: ¿Entonces las vacunas están impulsando las variantes?

Respuesta: sí.

Pregunta: ¿Tan pronto veremos la aparición de una variante resistente a las vacunas?

Respuesta: Sí, lo haremos.

Pregunta: ¿ Pero no saben esto los fabricantes de vacunas?

Respuesta: ¿ Quiere decir, “no entienden la relación básica entre la infección viral y las vacunas”? Ellos si.

Pregunta: ¿Entonces por qué lo están haciendo?

Respuesta: Buena pregunta, pero la respuesta requiere mucha investigación y bastantes conjeturas. Todo lo que diré es que los autores de esta campaña de vacunación masiva nos están conduciendo intencionalmente hacia una crisis aún mayor.

Pregunta: Bien, entonces, ¿qué vamos a hacer cuando nos encontremos con una variante resistente a las vacunas?

Respuesta– No puedo contestar eso, pero –a juzgar por la experiencia pasada– se desarrollará otra inyección experimental que el público se verá obligado a tomar.

Pregunta– ¿Pero qué pasa con la seguridad? ¿Podemos estar seguros de que estos nuevos brebajes híbridos son seguros?

Respuesta: la seguridad nunca ha sido una prioridad máxima, ni la inmunidad. El objetivo nunca fue la “inmunidad colectiva”, sino la “vacunación colectiva”. Uno de los portavoces más influyentes de la campaña actual lo resumió con bastante claridad cuando dijo: “Debemos vacunar a los siete mil millones de personas” del planeta. Las autoridades de salud pública nunca se han desviado de ese objetivo original.

Pregunta– Pero si el objetivo es vacunar a todos en la tierra, entonces las vacunas deben ser seguras, ¿verdad?

Respuesta: No, de hecho, las vacunas representan una seria amenaza para la salud y la vida. Son peligrosos.

Pregunta: ¿Está seguro de que no está exagerando, después de todo, casi 2 mil millones de personas ya han sido vacunadas y solo un pequeño porcentaje de ellas se enfermó gravemente o murió? ¿Quizás estás exagerando el peligro?

Respuesta: Las vacunas son un ataque a la infraestructura crítica del cuerpo, el sistema vascular y, en particular, el delgado tapiz de células que recubren las paredes de los vasos sanguíneos. Las vacunas desencadenan hemorragias, coágulos de sangre y enfermedades autoinmunes. En mi opinión, son una forma bastante sencilla de infligir daños severos a los sistemas y órganos esenciales que uno necesita para sobrevivir. Es por eso que el Dr. Vladimir Zelenko se refiere a ellos como “inyecciones de muerte por veneno”, lo que parece ser una evaluación precisa. Sin embargo, tiene razón al decir que “sólo un pequeño porcentaje de las personas se enferma gravemente o muere” inmediatamente después de la inyección. Pero eso es solo porque la vacuna funciona más como una bomba de tiempo que como un veneno. Pero es probable que el impacto sea igualmente devastador a largo plazo. Eche un vistazo a este extracto de un artículo de los médicos por la ética de Covid:

“A la luz de la respuesta de anticuerpos recientemente caracterizada contra el SARS-CoV-2, cuando los anticuerpos se adhieren a las células endoteliales productoras de picos en las paredes de los vasos después de la administración de la vacuna, se puede esperar que las proteínas del complemento activadas se adhieran a las células endoteliales y perforen sus membranas celulares. La muerte subsiguiente de las células endoteliales expondrá el tejido debajo del epitelio, lo que iniciará dos eventos importantes. Inducirá la coagulación de la sangre y hará que las paredes de los vasos tengan fugas. Este mecanismo patogénico se ha documentado en biopsias tomadas de pacientes infectados con SARS-CoV-2. Esos estudios han descrito un “síndrome de lesión microvascular catastrófica mediado por la activación del complemento”

… Como parte de la respuesta inmune de la proteína pico del SARS-CoV-2. Es precisamente esta respuesta inmune la que las vacunas COVID-19 buscan inducir . Estas interacciones entre la vacuna y el sistema inmunológico son consistentes con eventos adversos que involucran ruptura capilar visible debajo de la piel que han sido documentados e informados luego de la vacunación COVID-19 ”. ( “Los peligros de las vacunas y las vacunas de refuerzo Covid-19 “, Los médicos por la ética de Covid)

Repito: un “síndrome de lesión microvascular catastrófica mediado por la activación del complemento “.

Pregunta: ¿Qué significa eso en inglés sencillo?

Respuesta: Significa que la vacuna crea una situación en la que su cuerpo ataca brutalmente su propio sistema circulatorio generando coágulos de sangre y vasos sanguíneos con fugas. ¿Crees que puedes vivir con un sistema vascular dañado? ¿Crees que disfrutarás de una vida larga y feliz con un sistema inmunológico que está programado para atacar y matar las células sanas que ahora producen la “proteína pico” patógena? Si es así, entonces por cuánto tiempo; ¿Cuánto tiempo crees que puedes sobrevivir a ese tipo de guerra interna? ¿2 años? ¿5 años? ¿10 años?

Pregunta: su análisis suena muy conspirativo. Si las vacunas hacen lo que dices que hacen, entonces las personas que están impulsando esta campaña (vacunación masiva) deben saberlo, ¿verdad? Deben tener una comprensión básica de los peligros que plantean estas inyecciones.

Respuesta: por supuesto que sí. ¿Cómo podrían no saberlo? ¿Crees que las personas más ricas y poderosas del planeta cerrarían arbitrariamente la economía global, encerrarían a todos en sus hogares, suprimirían los medicamentos que salvan vidas y censurarían a cualquiera que desafíe la narrativa oficial si no supiera exactamente qué es la vacuna y qué se podría esperar que hiciera?

Ellos saben. No están simplemente “tirando los dados”. Tienen un plan y lo están implementando. Eso está claro.

En cuanto a la afirmación de “conspiración”, los hechos hablan por sí mismos. ¿Se llevaron a cabo numerosos simulacros y ejercicios de mesa durante la última década que incluyeron a las principales agencias de Intel, las grandes farmacéuticas, las élites activistas, el Departamento de Defensa, los medios de comunicación y la OMS?

Si habia.

¿Y estos simulacros básicamente proyectaron los mismos resultados y escenarios que vemos hoy en día, en particular la omisión de gobiernos representativos, los poderes mejorados de los políticos en conflicto, la aplicación de los mandatos de vacunas y la imposición de una estrategia pandémica sin precedentes que fue sorprendentemente similar en todos los casos y países donde se impuso?

Si de nuevo.

¿Se amenaza ya a los no vacunados con represalias si se resisten a la inoculación? ¿Los gobiernos ya están avanzando con pasaportes de vacunas, moneda digital, sistemas de crédito social, centros de detención y vigilancia intensificada?

Sí lo son.

¿Algo de esto le parece aleatorio o se acerca más a la definición real de “conspiración” que es: “un plan maligno, ilegal, traicionero o subrepticio formulado en secreto por dos o más personas”?

El hecho de que los medios de comunicación ridiculicen a los “teóricos de la conspiración” no cambia el hecho de que las conspiraciones, de hecho, tienen lugar. Los últimos dos años solo ayudan a subrayar ese hecho. Prácticamente nada se ha dejado al azar. Nuestro futuro y el futuro de la humanidad están siendo dirigidos por fuerzas poderosas que aún no hemos identificado con éxito. Es espeluznante. (Ver: RFK jr. En el evento 201 )

Y aquí hay algo más para reflexionar, ya que estamos en el tema de las “conspiraciones”. Creo que es muy probable que la vacuna se haya desarrollado mucho antes del brote del virus.

Pregunta: ¿Por qué importaría eso?

Respuesta: en realidad, es bastante importante, porque ayuda a ilustrar que la “solución” precedió al problema, la “gallina antes que el huevo”. En otras palabras, la investigación de armas biológicas de EE. UU. Probablemente tenía como objetivo crear una sustancia que socavaría constantemente (y eventualmente mataría) a un número incalculable de personas que tendrían que ser eliminadas para reducir las emisiones de carbono, aliviar el agotamiento de los recursos escasos y revertir la destrucción. del medio natural. ¿Crees que el Pentágono y la CIA tienen programas de contingencia como ese? ¿Crees que las élites globalistas podrían apoyar una política como esa?

De hecho, lo harían, y descaradamente lo implementarían en nombre de “salvar a la humanidad” o alguna otra tontería por el estilo. Tenga en cuenta que la población mundial a principios de siglo (1900) era de unos minúsculos 1.600 millones. A partir de 2021, el número se ha disparado a 7,9 mil millones. Y, según las proyecciones de las Naciones Unidas, esa cifra aumentará a aproximadamente 11 mil millones para 2100.

¿Crees que las élites mundiales se van a quedar quietas y no hacer nada mientras los peligros “percibidos” de la disminución de los combustibles fósiles y el aumento de las temperaturas continúan aumentando? ¿Crees que, tal vez, después de años de llamamientos apasionados para “hacer algo con el clima”, finalmente se llegó a un consenso en 2019 allanando el camino para un esquema agresivo de “gestión de la población”?

Por supuesto, se trata de hombres “civilizados” que nunca recurrirían a nada tan vulgar como cámaras de gas o pelotones de fusilamiento. Oh no; buscarían un método subrepticio para adelgazar la manada sin que la manada supiera realmente lo que estaba pasando. Necesitarían un remedio que les ayude a lograr su objetivo al mismo tiempo que invocan una negación plausible. (Entran: Fauci y los programas secretos de armas biológicas.) Y si la verdad alguna vez saliera a la luz, entonces persuadirían al público de que solo estaban actuando en el mejor interés de la humanidad al tratar de prevenir la inexorable carrera hacia un clima catastrófico. crisis. ¿Suena familiar?

Debería. Si el mundo se está calentando o no es discutible, pero lo que no es discutible es cuán perfectamente encaja el furor climático con la agenda política autoritaria de los globalistas. No hay nada de coincidencia en ello.

En cualquier caso, las travesuras de ganancia de función en Wuhan probablemente fueron solo los toques finales a un plan que se había hecho y desempolvado años antes en los think tanks y las confabulaciones globalistas donde los ricos y poderosos se reúnen para decidir la mejor forma de moldear. el mundo para cumplir con sus propias especificaciones estrechas. Mi conjetura es que el sistema de administración de proteínas de pico (también conocido como la vacuna Covid-19) se había creado años antes y solo requería una luz verde para ser liberado en el mundo.

Pregunta : Parece que nos hemos desviado de nuevo. ¿Podemos volver a los impulsores por un minuto? Dice que no hubo ensayos clínicos adicionales. ¿Significa eso que los refuerzos no fueron aprobados formalmente por la FDA?

Respuesta: No fueron aprobados formalmente por la FDA. Fueron aprobados bajo la Autorización de Uso de Emergencia (EUA) al igual que las vacunas. Pero eso no significa que los riesgos sean los mismos. Ellos no están. Los refuerzos son significativamente más peligrosos que las vacunas, como señala este clip de Médicos por la ética de Covid:

“Explicamos aquí que las vacunas de refuerzo son excepcionalmente peligrosas, de una manera sin precedentes en la historia de las vacunas. Esto se debe a que aumentar repetidamente la respuesta inmune aumentará repetidamente la intensidad del autoataque .

Las inyecciones repetidas de “vacunas” basadas en genes (es decir, “refuerzo”) están destinadas a intensificar y reproducir este evento básico dondequiera que aparezca la proteína de pico recién expresada en el revestimiento del vaso…. La lesión vascular mediada por el complemento que ocurre en múltiples sitios en todo el cuerpo tendrá efectos potencialmente devastadores no solo en la salud del individuo vacunado, sino también en el embarazo y la fertilidad….

Las moléculas de proteína de pico, que se sabe que se liberan en el torrente sanguíneo poco después de la vacunación, se unirán a las plaquetas y las marcarán como objetivos para la unión de anticuerpos. El ataque posterior … debe esperarse que cause la destrucción de las plaquetas, … ¿qué sucederá cuando las “vacunas” se filtren de los vasos sanguíneos dañados y lleguen a los órganos del cuerpo? ¿La captación de genes y la producción de picos marcarán entonces todos y cada uno de los tipos de células para su destrucción por los linfocitos asesinos? ¿Estamos a punto de presenciar el nacimiento de un mundo completamente nuevo de enfermedades autoinmunes? ” ( Doctores por la ética de Covid)

¿Qué parte de la cita anterior hace que parezca que los refuerzos son buenos para su salud y bienestar en general?

Nada de eso, ¿verdad? Y así como vimos un fuerte aumento en los casos, hospitalizaciones y muertes después del lanzamiento de campañas de vacunación masiva en todo el mundo, ahora estamos viendo el mismo fenómeno que se desarrolla en Israel con los impulsores. (Vea este increíble video de 2 minutos del estadístico Joel Smalley sobre Muertes después de la vacunación )

Y recuerde, ni los refuerzos ni las vacunas permanecen en el músculo del brazo (deltoides) como dijeron las compañías farmacéuticas. Ingresan al torrente sanguíneo unos 30 minutos después de la inyección y se diseminan por todo el cuerpo a través del sistema circulatorio. Pero debido a que la vacuna es un modelo para producir proteína de pico y no la proteína en sí; es capaz de evadir el sistema inmunológico y penetrar en las células antes de ser detectado. Esto es lo que hace que la proteína de pico inyectada sea más peligrosa que el pico en Covid-19. El virus debe entrar por la nariz o la garganta antes de incubarse y entrar en el sistema vascular, pero el pico de la vacuna encuentra una ruta más directa a través de la inyección. Aquí está el Dr. Byram Bridle de nuevo:

“’Sabemos desde hace mucho tiempo que la proteína de pico es patógena…. Es una toxina. Puede causar daños en nuestro cuerpo si está en circulación. Ahora, tenemos pruebas claras de eso. . . la vacuna en sí, más la proteína, ingresa a la circulación sanguínea ‘”.

Una vez que eso sucede, la proteína de pico puede combinarse con los receptores de las plaquetas sanguíneas y con las células que recubren nuestros vasos sanguíneos. Por eso, paradójicamente, puede provocar tanto coagulación sanguínea como hemorragia. “Y, por supuesto, el corazón está involucrado, como parte del sistema cardiovascular… Por eso estamos viendo problemas cardíacos. La proteína también puede atravesar la barrera hematoencefálica y causar daño neurológico.…

‘En resumen, … cometimos un gran error. No nos dimos cuenta hasta ahora. No nos dimos cuenta de que al vacunar a las personas las estamos inoculando inadvertidamente con una toxina ”. ..
… la proteína de pico, por sí sola, es casi enteramente responsable del daño al sistema cardiovascular , si entra en circulación. De hecho, si se inyecta la proteína de pico purificada en la sangre de los animales de investigación, se produce todo tipo de daños en el sistema cardiovascular y puede atravesar la barrera hematoencefálica y provocar daños en el cerebro “. ( Científica de vacunas: ‘Hemos cometido un gran error’ ”, Mujer conservadora)

Desde que Bridle hizo estas afirmaciones en un programa de entrevistas de radio, ha sido salvajemente acosado, ridiculizado y expulsado de la Universidad donde trabajaba. Aún así, no se ha retractado de su declaración a pesar de los altos costos para él y su reputación.

El error que cometió Bridle fue pensar que sus colegas y compañeros aplaudirían su investigación. Pensó ingenuamente que los defensores de la vacunación masiva reconocerían su error y harían un esfuerzo por corregirlo. Nunca imaginó que la vacuna fue diseñada para funcionar exactamente como lo hace, penetrando en las células huésped y produciendo un patógeno citotóxico que provoca una fuerte respuesta inmune de uno mismo que conduce a una mayor aniquilación del sistema vascular.

El tratamiento de Bridle dice mucho sobre las personas que están manejando la pandemia, el alcance de su poder y sus objetivos completamente malignos. (Por favor, mire este video del Dr. Nathan Thompson: “Me quedé boquiabierto cuando examiné el sistema inmunológico de alguien después del segundo pinchazo”, que muestra cómo la vacunación puede conducir a la autoinmunidad e “infecciones progresivas”)

Pregunta : creo que nos hemos desviado de nuevo. Has hablado mucho sobre la proteína de pico y su efecto en los vasos sanguíneos, pero mucho de esto suena teórico. ¿Tiene alguna evidencia sólida de que las vacunas están causando daños graves en los tejidos?

Respuesta: sí. Dos profesores de patología alemanes, Arne Burkhardt y Walter Lang, han proporcionado los resultados de las autopsias que realizaron a diez personas que murieron tras ser inyectadas con la vacuna Covid-19. Aquí hay un breve extracto de un artículo sobre lo que encontraron:

“Durante los últimos meses, el patólogo de Reutlingen y el profesor Walter Lang han examinado microscópicamente material de tejido del fallecido. … En cinco de los diez casos mencionados anteriormente, los dos médicos califican la conexión entre la muerte y la vacunación como muy probable, en dos casos como probable. Aún no se ha evaluado un caso. Los otros dos casos se clasificaron como poco claros / posibles o “más bien coincidentes”.

En cuanto a las causas de muerte, Burkhardt señaló que la miocarditis linfocítica, el diagnóstico más común . … Los médicos sospechan que otros efectos secundarios de la vacunación corona con posibles consecuencias de muerte son fenómenos autoinmunes, reducción de la capacidad inmunitaria, aceleración del crecimiento del cáncer, “endotelitis” de daño vascular, vasculitis, perivasculitis y “aglutinación” de eritrocitos .. ..

Burkhardt y sus colegas han estado investigando durante los últimos meses. Dijo que solo podía pensar en una cosa al ver los resultados: “una revuelta de linfocitos”, potencialmente en todos los tejidos y órganos . Se encontraron linfocitos en una amplia variedad de tejidos como el hígado, los riñones, el bazo hasta el útero y tumores, que atacaron masivamente el tejido allí….

Burkhardt concluyó que los políticos dicen: “Si no quieres ser vacunado, tienes que afrontar las consecuencias, pero todos los que se vacunan también tienen que afrontar las consecuencias”. Estos todavía son en gran parte desconocidos. “Hasta ahora, solo se han documentado los primeros hallazgos, pero preocupantes, que se investigarán más a fondo con respecto a su patogénesis”, dijo Burkhardt.

Los hallazgos confirman la afirmación del Prof. Dr. Peter Schirmacher de que en más de 40 cadáveres sometidos a autopsia que murieron dentro de las dos semanas posteriores a la vacunación Covid-19, alrededor de un tercio murió a causa de la vacuna ”. (‘<a ”title =” https://freewestmedia.com/2021/09/22/lymphocyte-riot-patologists-investigate-deaths-after-corona-vaccination/ ”href =” https://freewestmedia.com/ 2021/09/22 / patólogos-antidisturbios-de-linfocitos-investigan-muertes-después-de-la-vacuna-corona / ”> disturbios-de-linfocitos ‘: patólogos investigan muertes después de la vacunación-Corona”, Free West Media)

Bien, repasemos. ¿Qué encontraron los médicos?

1– Encontraron en un gran porcentaje de las autopsias “la conexión entre muerte y vacunación (era) muy probable”.

2- Encontraron que “esa miocarditis linfocítica, (era) el diagnóstico más común. “(La miocarditis linfocítica es una afección poco común en la que la inflamación del músculo cardíaco (miocarditis) es causada por la acumulación de glóbulos blancos (linfocitos). Los síntomas pueden incluir dolor en el pecho, palpitaciones cardíacas, fatiga y dificultad para respirar (disnea), especialmente al hacer ejercicio o acostado. En otras palabras, la vacuna de proteína de punta da como resultado una inflamación grave y una inmunosupresión al mismo tiempo. Es el doble golpe).

3– Encontraron evidencia de un “disturbio de linfocitos”, potencialmente en todos los tejidos y órganos . Se encontraron linfocitos en una amplia variedad de tejidos, como el hígado, los riñones, el bazo hasta el útero y tumores, que atacaron masivamente el tejido allí “. (Nota: los linfocitos son glóbulos blancos en el sistema inmunológico que entran en acción para luchar contra los invasores o las células infectadas por patógenos. Un “disturbio de linfocitos” sugiere que el sistema inmunológico se ha vuelto loco tratando de contrarrestar los efectos de miles de millones de proteínas de pico ubicadas en las células En el torrente sanguíneo. A medida que se agotan los linfocitos, el cuerpo se vuelve más susceptible a otras infecciones, lo que puede explicar por qué una gran cantidad de personas ahora contraen virus respiratorios a fines del verano).

4– Descubrieron que existen múltiples riesgos graves para la salud relacionados con la vacuna Covid-19.

Las autopsias proporcionan evidencia sólida de que las vacunas, de hecho, crean un daño tisular significativo.
Pregunta final: ¿Cómo ves que esto se desarrolle?

Respuesta : Esperaría ver signos de angustia ya en este invierno-primavera, aunque los datos se recopilarán bajo el título de “mortalidad por todas las causas” en lugar de las muertes por Covid-19. También deberíamos ver un fuerte aumento en los paros cardíacos, miocarditis y accidentes cerebrovasculares que deberían romper drásticamente con su línea de tendencia de 5 años. Dado que la vacuna causa un deterioro generalizado de la salud en general, las indicaciones de daño deben notarse en cualquier número de dolencias, desde enfermedades neurodegenerativas hasta parálisis de Bell.

Esto no es tanto una predicción como un reconocimiento de lo que ya estamos viendo. Eche un vistazo a este tweet reciente de la patóloga de diagnóstico del Reino Unido, la Dra.Claire Craig, y verá lo que quiero decir:

Dr. Clare Craig @ ClareCraigPath

Exceso de muertes para la semana que finaliza el 10 de septiembre de 2021:

24% más muertes por insuficiencia cardíaca que el valor inicial

19% cardiopatía isquémica

16% enfermedad cerebrovascular (accidentes cerebrovasculares)

18% otras enfermedades circulatorias

¿Por qué está pasando esto? ¿Por qué el repentino aumento de los ataques cardíacos, las enfermedades cardíacas, las enfermedades vasculares y los accidentes cerebrovasculares? ¿Qué hicimos de manera diferente en 2021 que en los años anteriores?

Vacunamos a la mayor parte de la población, eso es lo que hicimos de manera diferente. Y ahora vamos a ver qué efecto tiene en las muchas dolencias relacionadas con las vacunas como paro cardíaco, miocarditis, embolia pulmonar, trombosis, daño renal agudo, daño hepático, parálisis de Bell, mielitis transversa, anafilaxia, síndrome inflamatorio multisistémico, espontáneo aborto y síndrome de dificultad respiratoria aguda. Todos estos aparecen en el “Sistema de notificación de eventos adversos de las vacunas” (VAERS), al igual que es probable que aparezcan en futuras hospitalizaciones. Por lo tanto, será necesario un juego de manos bastante agresivo por parte del gobierno para manipular los datos o barrer el asunto debajo de la alfombra.

¿Y cómo afectará este diluvio de enfermedades inesperadas al sistema de salud pública, que podría extenderse hasta el punto de ruptura? ¿Se puede evitar un desastre? Consulte este extracto de un artículo reciente del UK Telegraph:

“Si bien el enfoque permanece firmemente fijo en Covid-19, una segunda crisis de salud está surgiendo silenciosamente en Gran Bretaña. Desde principios de julio, ha habido miles de muertes en exceso que no fueron causadas por coronavirus. Según los expertos en salud, esto es muy inusual para el verano. Aunque se espera un exceso de muertes durante los meses de invierno, cuando el clima frío y las infecciones estacionales se combinan para ejercer presión sobre el NHS, el verano generalmente pasa por una pausa.

Este año es un valor atípico preocupante.

Según la Oficina de Estadísticas Nacionales (ONS), desde el 2 de julio ha habido un exceso de 9,619 muertes en Inglaterra y Gales, de las cuales el 48 por ciento (4,635) no fueron causadas por Covid-19.

Entonces, si todas estas personas adicionales no mueren de coronavirus, ¿qué las está matando?

Los datos de Public Health England (PHE) muestran que durante ese período se registraron 2.103 muertes adicionales por enfermedad cardíaca isquémica, 1.552 por insuficiencia cardíaca, así como 760 muertes adicionales por enfermedades cerebrovasculares como accidente cerebrovascular y aneurisma y 3.915 por otras enfermedades circulatorias. .

Las infecciones respiratorias agudas y crónicas también aumentaron con 3.416 menciones en los certificados de defunción más de lo esperado desde principios de julio, mientras que se han producido 1.234 muertes por enfermedades extra urinarias, 324 por cirrosis y enfermedades hepáticas y 1.905 por diabetes….

“Parece que el invierno ya está aquí, en lugar de que se acerca. Es peor este año de lo que creo recordar en cualquier momento de los últimos 20 años “. ( “Miles de personas más de lo habitual están muriendo … pero no es de Covid “, Telegraph)

Naturalmente, los medios de comunicación van a culpar del aumento de la enfermedad a la pandemia o los “tratamientos retrasados”, pero la gente puede sacar sus propias conclusiones. Lo que el Telegraph llama una emergencia “no relacionada con Covid” es tan probable que sea una lesión relacionada con la vacuna como no. Lo que quiero decir es simple: los coágulos de sangre, el sangrado y la autoinmunidad no son asuntos triviales; son una indicación de que la infraestructura vital del cuerpo se ha visto comprometida y, quizás, gravemente dañada. Esto se manifestará en la mortalidad por todas las causas y en datos más amplios de salud pública.Una parte considerable de estas enfermedades estará directamente relacionada con la inyección de un patógeno potencialmente letal en el torrente sanguíneo de millones de personas que fueron engañadas deliberadamente sobre la seguridad del producto. Ahora veremos los primeros resultados de ese experimento. Que Dios nos ayude.

Fuente: https://www.unz.com/mwhitney/will-vaccine-linked-deaths-rise-sharply-this-winter/

Nota de las termitas del cielo: Algunas vacunas son sueros inocuos, otras llevan proteína de pico y otras, al menos, contienen óxido de grafeno (GO). Un experimento Trilateral...

¡No diga ni MU!

Sólo tiene que cambiar Delta por MA, ME, MI, MO, MU. Puede elegir. O esperar.

La falsa “variante Delta” y la cuarta ola: ¿otro confinamiento? ¿Próxima crisis financiera? ¿Sabotaje económico y social en todo el mundo?

Por el Prof. Michel Chossudovsky Global Research, 04 de septiembre de 2021

Publicado por primera vez el 11 de agosto de 2021

Introducción

¿Se prevé un nuevo confinamiento mundial como un medio para combatir la variante “peligrosa” de Covid titulada “Delta”?

La campaña del miedo ha vuelto a ponerse en marcha.

Permítanme repasar brevemente la historia de esta crisis.

Hay una secuencia de mentiras descaradas e invenciones utilizadas para justificar decisiones políticas de gran alcance en el transcurso de los últimos 18 meses.

La mayor mentira, que es firmemente reconocida tanto por la opinión científica como por la OMS, es que la prueba RT-PCR utilizada para “detectar” la propagación del virus (así como las variantes) no solo es defectuosa sino TOTALMENTE INVÁLIDA. (Michel Chossudovsky, Capítulo III)

Desde el principio, en enero de 2020, todas las decisiones políticas de gran alcance confirmadas y presentadas al público como un “medio para salvar vidas” se basaron en casos positivos de RT-PCR defectuosos e inválidos junto con datos falsos de mortalidad relacionados con muertes relacionadas con Covid-19: “La causa subyacente de muerte” es Covid-19 “más a menudo o no”. No se requiere autopsia

Estas “estimaciones” del Covid se utilizaron para justificar el confinamiento, el distanciamiento social, la mascarilla, la prohibición de reuniones sociales, eventos culturales y deportivos, el cierre de la actividad económica.

La crisis estuvo marcada por varias etapas importantes:

1. Crisis en los viajes aéreos y el transporte internacional

La convocatoria de una emergencia de salud pública de importancia internacional (ESPII) por parte del Director General de la OMS el 30 de enero fue fundamental para lanzar la crisis coronal. Hubo 83 casos positivos fuera de China de una población de 6.400 millones. No hubo emergencia:Irónicamente, se utilizó la prueba RT-PCR defectuosa e inválida para estimar esos 83 casos positivos.

Al día siguiente, el presidente Trump ordenó el cierre de los viajes aéreos con China, lo que marcó el inicio de una crisis en los viajes aéreos y el transporte internacional que ha extendido su control durante un período de 18 meses que ha llevado a la quiebra de las compañías aéreas en todo el mundo, la destrucción de la industria turística, una gran crisis en el comercio de productos básicos, etc. Este fue un acto deliberado para dar a conocer la desaparición de Air Travel Worldwide. Hubo 5 casos positivos en los Estados Unidos, que se utilizaron para justificar la decisión de Trump el 31 de enero de 2020.

2. La crisis financiera de febrero del 20 de febrero de 2020

Fue la crisis financiera más grave de la historia mundial, superando con creces la de 1929. Ocurrió inmediatamente después de las “advertencias” de la OMS de que una pandemia de covid-19 era inminente, encabezando así la campaña del miedo. Había amplia evidencia de “conflicto de intereses” y fraude, incluido el conocimiento previo, la información privilegiada, etc., lo que resultó en una concentración masiva de la riqueza monetaria por parte de un puñado de multimillonarios. Ese mismo día, millones de personas en todo el mundo perdieron sus ahorros de por vida. ¿Cuál fue la justificación de las declaraciones de conmoción y asombro de la OMS? Esta amenaza inminente se basó en 1078 (defectuosos) casos positivos de COVID RT-PCR fuera de China.

3. Apenas tres semanas después, el confinamiento del 11 de marzo de 2020 con 44.279 casos en todo el mundo fuera de China se utilizó para justificar el confinamiento domiciliario, el distanciamiento social y el cierre de la actividad económica en todo el mundo, lo que llevó a la pobreza y el desempleo masivo.

Y luego, a principios de noviembre, fue el lanzamiento de la “vacuna asesina” mrnmn que ha resultado en una tendencia de mortalidad y morbilidad. Vea las últimas cifras a continuación.


UE/EEE/Suiza hasta el 28 de agosto de 2021: 23 252 muertes relacionadas con la inyección de Covid-19 y 2 166 285 lesiones, según la base de datos EudraVigilance.

Reino Unido hasta el 18 de agosto de 2021: 1,609 muertes relacionadas con la inyección de Covid-19 y 1,165,636 lesiones,según el esquema de tarjeta amarilla de MHRA.

EE.UU. hasta el 20 de agosto de 2021:1 3.627 muertes relacionadas con la inyección de Covid-19 y 2.932.001 lesiones,según la base de datos VAERS.

TOTAL para la UE/Reino Unido/EE.UU.: 38.488 muertes relacionadas con la inyección de Covid-19 y 6.263.922 lesiones notificadas al 30 de agosto de 2021.

Nota Bene: Es importante tener en cuenta que las cifras oficiales anteriores (informadas a las autoridades sanitarias) no son más que un pequeño porcentaje de las cifras reales. Además, las personas continúan muriendo (y sufriendo lesiones) a causa de las inyecciones con cada día que pasa. Ver Declaración D4CE


La variante Delta y “La Cuarta Ola”

Y ahora, a partir de mayo-junio de 2021, tenemos la variante Delta. Es el nuevo tema de conversación.

Los supuestos peligros de la variante Delta se están utilizando para acelerar el programa de vacunación, así como la imposición del pasaporte de vacunación.

“Una cuarta ola” ya ha sido anunciada.

¿Está un segundo confinamiento mundial en la mesa de dibujo, que requiere quedarse en casa con confinamiento, distanciamiento social y el cierre de la actividad económica junto con otra crisis financiera devastadora similar a la que ocurrió el Jueves Negro 12 de marzo de 2020?

Las variantes mortales sostenidas por la desinformación de los medios y la ciencia falsa

La desinformación de los medios de comunicación es un arma mortal que sostiene las 24 semanas del día, los 7 días de la semana, la ilusión de una peligrosa variante delta del SARS-2.

Identificada por primera vez el año pasado en la India, la variante Delta del SARS-CoV-2 “se cree que ha impulsado la segunda ola mortal de infecciones este verano en la India”. Según la llamada “opinión científica”, ahora se dice que se está extendiendo por todo el mundo, a unos 80 países.

“Aquí está el trato: la variante Delta es más contagiosa, es más mortal y se está propagando rápidamente por todo el mundo, dejando a las personas jóvenes no vacunadas más vulnerables que nunca”.

Eso es mentira. El virus original categorizado por la OMS y los CDC como “similar a la influenza estacional” no es un virus asesino. Además, las variantes del virus son siempre “menos vigilantes” y “menos peligrosas” que el virus original.

La “solución” propuesta por Joe Biden es “la vacuna asesina”, que ya en el transcurso de los últimos siete meses ha resultado en innumerables muertes y lesiones.

“Por favor, vacúnese si aún no lo ha hecho. Dejemos esta tensión antes de que sea demasiado tarde”. (sin cursivas en el original)

Las autoridades sanitarias afirman ahora que los nuevos casos de la variante Delta B1.617,aumentan el riesgo de hospitalización en 2,7 veces.

¿Cuál es la “ciencia” detrás de estas afirmaciones?

El infame “modelo matemático” de ferguson ¿Hacia una “cuarta ola”? Combatiendo “D la peligrosa variante Delta”. El “Modelo Matemático de Confinamiento”

Imagen de la derecha: Neil Ferguson (Fuente: Financial Times)

El modelo matemático de Ferguson de marzo de 2020 basado en “predicciones” de 600.000 muertes en el Reino Unido raya en el ridículo. Es más que una mentira. Es un crimen de lesa humanidad. Fue utilizado por el establishment financiero como una justificación para desencadenar el caos económico y social en todo el mundo. Los esfuerzos de Ferguson han sido generosamente financiados por la Fundación Bill y Melinda Gates.

La devastación económica y social del llamado confinamiento de marzo de 2020 está fuera de toda descripción: 190 estados miembros de las Naciones Unidas aceptaron “cerrar” su economía nacional junto con la máscara facial, el distanciamiento social y la derogación de los derechos humanos fundamentales.

La intención declarada era proteger a las personas contra V el virus. El confinamiento del 11 de marzo fue seguido por el “colapso financiero” del Jueves Negro (12 de marzo de 2020), que creó estragos en los mercados bursátiles de todo el mundo. El confinamiento del 11 de marzo de 2020 fue anunciado como un medio para contener la supuesta “pandemia”. Tontería.

“Modelo matemático” en apoyo de una “cuarta ola”

Y ahora se está presentando un segundo “modelo matemático” autorizado para “justificar” otro confinamiento.

El mismo “científico” (Ferguson) ha sido llamado a diseñar un nuevo “modelo matemático” que se está utilizando para justificar un “confinamiento de la cuarta ola”.

La “suposición” errónea detrás del ejercicio de modelado es que la variante Delta es “mortal”.

“Un nuevo modelo para el comité de expertos SAGE del gobierno [al que pertenece Ferguson] ha puesto de relieve el riesgo de una “tercera ola sustancial” de infecciones y hospitalizaciones, …”. El panorama oficial es “ahora más pesimista”. (Informe de la BBC, junio de 2021, énfasis añadido).

Según el profesor Neil Ferguson:

“la variante Delta del coronavirus es entre un 30% y un 100% más transmisible que la variante anteriormente dominante”. (citado por The Guardian).

¿De dónde obtiene Ferguson sus datos y estimaciones? ¿La prueba RT-PCR defectuosa e inválida?

Lo que no menciona es que las variantes del virus son siempre “menos vigilantes” y “menos peligrosas” en comparación con el virus original. ¿Y cómo establece la “identidad” del virus original?

Tanto los funcionarios británicos como los del Reino Unido están insinuando la posibilidad de un confinamiento de la Cuarta Ola, programado tentativamente para el próximo otoño.

Según el director médico de Gran Bretaña, el profesor Chris Whitty (miembro del Comité SAGE)

“El NHS necesita prepararse para otro invierno difícil por delante ,con la posibilidad de un nuevo “aumento muy significativo de Covid”.

Según el subgrupo de modelado SPI-M del panel SAGE del gobierno (al que pertenecen Whitty y Ferguson):

“habría que reintroducir las restricciones”. … la variante Delta planteaba un “mayor riesgo de hospitalizaciones”

Estos anuncios son frívolos. Su intención es justificar medidas políticas drásticas (confinamiento, mascarilla, distanciamiento social, cierre de la actividad económica, interrupción de los servicios de salud), así como la aceleración del programa de vacunación y la represión del movimiento de protesta.

Además, las declaraciones de los funcionarios de salud británicos, estadounidenses y de la UE sobre la llamada propagación de “la variante más infecciosa del Delta” ahora también se están utilizando para justificar la implementación de políticas de confinamiento de la “Cuarta Ola” a nivel internacional en un gran número de países.

El Foro Económico Mundial al rescate

El Foro Económico Mundial (WEF), que representa a las élites financieras, desempeñó un papel clave en el lanzamiento del confinamiento del 11 de marzo de 2020. Y ahora lo que están diciendo es que es probable que ocurra otra devastadora crisis económica y social mundial a raíz de la pandemia de Covid-19.

El WEF ahora apunta a:

“Unciberataque con características similares a las de COVID”, que promete ser mucho más devastador y caótico que la pandemia de Covid-19.

El “Concepto 2021” del Foro Económico Mundial. Escenario de polígono cibernético

En los últimos acontecimientos, el Foro Económico Mundial (WEF) que copatrocinó el Evento 201, la simulación de mesa de la pandemia de coronavirus junto con John Hopkins y la Fundación Gates en octubre de 2019, ahora está involucrado en otro ejercicio estratégico titulado Concepto 2021. Este último se describe como una “iniciativa internacional de desarrollo de capacidades destinada a aumentar la resiliencia cibernética global. No es una simulación de mesa comparable al Evento 201.

El año pasado se llevó a cabo en el apogeo del confinamiento a través de videoconferencia. Este año, la Conferencia de 2021 “discutió los“riesgos clave de la digitalización”.

Los participantes en el Ejercicio del Polígono Cibernético incluyeron compañías de alta tecnología como IBM, numerosos bancos e instituciones financieras, compañías de Internet, agencias de seguridad cibernética, medios corporativos y gubernamentales, grupos de expertos, agencias de aplicación de la ley, incluida Interpol, con representantes de 48 países. El ejercicio es un medio obvio para asegurar socios confiables y desarrollar alianzas estratégicas. En este sentido, había numerosos representantes de Rusia y países de la antigua Unión Soviética, incluidos los principales intereses bancarios rusos, las empresas de comunicaciones y medios de comunicación. En total, 42 socios. Ningún socio corporativo / gubernamental de China.

También hubo un programa de entrenamiento con 200 equipos de 48 países.

Vídeo del WEF

Klaus Schwab, fundador y Director Ejecutivo del WEF y arquitecto del “Gran Reinicio” describe el escenario de crisis de la siguiente manera:

 El aterrador escenario de un ataque cibernético integral podría detener por completo el suministro de energía, el transporte, los servicios hospitalarios, nuestra sociedad en su conjunto. La crisis de COVID-19 se vería a este respecto como una pequeña perturbación en comparación con un ciberataque importante”. (sin cursivas en el original)

Jeremy Jurgens, Director General del WEF:

“Creo que habrá otra crisis. Será más significativo. Será más rápido de lo que hemos visto con COVID. El impacto será mayor y, como resultado, las implicaciones económicas y sociales serán aún más significativas”. (sin cursivas en el original)

Las implicaciones de estas audaces “predicciones” que representan los intereses del establishment financiero son de gran alcance.

Lo que describen es un escenario de caos económico y social que implica la interrupción de los sistemas de comunicaciones, Internet, las transacciones financieras y monetarias (incluido SWIFT), la red eléctrica, el transporte global, el comercio de productos básicos, etc., así como probables “dislocaciones geopolíticas”.

La sesión de apertura (julio de 2021) del Cyber Polygon 2021 fue conducida (video a continuación) por el Primer Ministro de la Federación Rusa Mikhail Mishustin junto con el Director General del WEF Klaus Schwab.

¿Es este escenario un ensayo general para una próxima crisis cibernética?

¿Por qué se excluyó a China del Ejercicio del Polígono Cibernético? Los principales socios eran del antiguo bloque soviético.

Vídeo. La sesión de apertura (julio de 2021).

La simulación realizada en julio de 2021 se titula Cyber Polygon 2021

¿Es un “Escenario de Ciberataque” contemplado por el establishment financiero?

Si bien no se puede especular, el asunto debe abordarse.

La variante Delta

¿Se utilizará la “mortal” variante Delta como pretexto para justificar el lanzamiento de una nueva fase de la crisis del coronavirus, lo que resultará en un nuevo proceso de enriquecimiento multimillonario junto con el aumento de las deudas públicas y privadas, la inflación, el desempleo y la pobreza?

Además, en esta coyuntura de una crisis en desarrollo, los gobiernos y los medios de comunicación están ahora involucrados en una campaña de miedo centrada en gran medida en las variantes “mortales” del SARS-CoV-2.

Con el fin de salvar vidas, las autoridades sanitarias están insinuando que si las Variantes no se controlan, se debe contemplar un confinamiento importante.

Esta narrativa se basa en mentiras y distorsiones descaradas. No hay evidencia científica derivada de la prueba RT-PCR defectuosa e inválida que se utiliza para sostener la “evidencia” de estas “variantes” mortales del SARS-CoV-2.

¿Es la agenda Covid parte de un proyecto hegemónico de Estados Unidos?

¿Es la crisis del covid diseñada por el establishment financiero parte de un proyecto hegemónico, relacionado con el control sobre sectores estratégicos de la economía global como lo describe el director general del WEF, Klaus Schwab?

¿Es un acto de guerra económica?

Es “imperialismo con rostro humano”, comprometido con “salvar vidas”.

Visiblemente, es parte de la agenda de política exterior del presidente Joe Biden. Tiene implicaciones geopolíticas y estratégicas.

La inteligencia estadounidense y el Pentágono (incluido DARPA), así como la OTAN, están directa o indirectamente involucrados en la crisis del coronavirus. Cyber Warfare ya está en la mesa de dibujo.

El confinamiento del 11 de marzo de 2020 que llevó al cierre de las economías nacionales en todo el mundo también ha sido fundamental para desestabilizar a varios países que se clasifican como “Enemigos de Estados Unidos”.

No hay necesidad de que Washington imponga sanciones fragmentas a Irán, Venezuela y Cuba. Estos países han respaldado la narrativa del covid. Han aceptado la “sanción final”,es decir, el cierre de su economía nacional como un medio para combatir “V el virus”.

La situación en Cuba es particularmente dramática. Como resultado del confinamiento de marzo de 2020, la industria turística de Cuba, que constituye la principal fuente de divisas del país, se destruye. Desde la década de 1980, los ingresos de divisas del turismo se han utilizado para importar alimentos. Y ahora, como resultado del cierre de la industria turística, Cuba está experimentando una grave escasez de alimentos.

Sin embargo, el gobierno cubano ha aceptado la “Gran Mentira” y ha respaldado el confinamiento que literalmente está destruyendo los logros de la Revolución Cubana.

Y desafortunadamente los intelectuales progresistas están totalmente ciegos. No solo apoyan la narrativa de Covid, sino que no entienden cómo las políticas de confinamiento de Covid, así como la mortal vacuna de ARNm, se están utilizando para desestabilizar y destruir países uno tras otro. Estos países ahora están totalmente controlados por los acreedores occidentales y las fundaciones multimillonarias.

Caos económico y social diseñado. ¿No es eso parte de un proyecto hegemónico estadounidense?

Bastilla 2.0: “Cambio de régimen real”

¿Cuál es la solución? Las complejidades de esta crisis deben abordarse, incluidas las estructuras de poder del capitalismo global.

Lo que también debe entenderse son los astutos mecanismos, incluidas las amenazas y los sobornos, que se utilizan sistemáticamente para tomar el control no solo de los políticos corruptos, sino de todo el tejido gubernamental de lo que solían ser “países soberanos”.

¿Se contempla un segundo confinamiento mundial? Debemos asegurarnos de que no se lleve a cabo, lo que significa que debemos enfrentarnos a los poderes de la llamada “gobernanza global”.

Los movimientos de protesta deben cuestionar la legitimidad tanto de los actores financieros como de los políticos en altos cargos:

La legitimidad de los políticos y sus poderosos patrocinadores corporativos debe ser cuestionada, incluidas las medidas del estado policial adoptadas para hacer cumplir el cierre de la actividad económica, la imposición de un pasaporte de vacuna digital, así como el uso de la máscara facial, el distanciamiento social, etc.

Esta red debe establecerse (a nivel nacional e internacional) en todos los niveles de la sociedad, en ciudades y pueblos, lugares de trabajo, parroquias. Los sindicatos, las organizaciones de agricultores, las asociaciones profesionales, las asociaciones empresariales, los sindicatos de estudiantes, las asociaciones de veteranos, los grupos eclesiásticos serían llamados a integrar este movimiento.

La primera tarea sería desactivar la campaña del miedo y la desinformación de los medios, así como poner fin al programa de vacunación contra el Covid de las grandes farmacéuticas.

Los medios corporativos deben ser desafiados directamente, sin apuntar específicamente a los periodistas convencionales, muchos de los cuales han recibido instrucciones de cumplir con la narrativa oficial. Este esfuerzo requeriría un proceso paralelo a nivel de base, de sensibilización y educación de los conciudadanos sobre la naturaleza del virus, los impactos de la vacuna y el confinamiento.

“Difundir la palabra” a través de las redes sociales y los medios de comunicación en línea independientes se llevará a cabo teniendo en cuenta que Google y Facebook son instrumentos de censura.

La creación de tal movimiento, que desafía enérgicamente la legitimidad de las élites financieras, así como las estructuras de autoridad política a nivel nacional, no es una tarea fácil. Requerirá un grado de solidaridad, unidad y compromiso sin precedentes en la historia mundial.

También requerirá romper las barreras políticas e ideológicas dentro de la sociedad (es decir, entre partidos políticos) y actuar con una sola voz.

También debemos entender que el “proyecto corona” es una parte integral de la agenda imperial de los Estados Unidos. Tiene implicaciones geopolíticas y estratégicas. También requerirá eventualmente desbancar a los arquitectos de esta diabólica “pandemia” y acusarlos de crímenes contra la humanidad. (Michel Chossudovsky, diciembre de 2020. Con algunos cambios menores)

Lo que se requiere es un “verdadero cambio de régimen”, la restauración de la democracia y lo que antes se llamaba “El Estado de Bienestar”.

La solidaridad debe prevalecer. Una tarea compleja y un compromiso por delante para toda la humanidad.

Sobre el autor

Michel Chossudovsky es un autor galardonado, profesor de Economía (emérito) en la Universidad de Ottawa, fundador y director del Centro de Investigación sobre la Globalización (CRG), Montreal, editor de Global Research.

Ha realizado investigaciones de campo en América Latina, Asia, Oriente Medio, África subsahariana y el Pacífico y ha escrito extensamente sobre las economías de los países en desarrollo con un enfoque en la pobreza y la desigualdad social. También ha realizado investigaciones en Economía de la Salud (Comisión Económica de las Naciones Unidas para América Latina y el Caribe (CEPAL), UNFPA, CIDA, OMS, Gobierno de Venezuela, John Hopkins International Journal of Health Services (1979, 1983)

Es autor de doce libros, entre ellos The Globalization of Poverty y The New World Order (2003), America’s “War on Terrorism” (2005), The Globalization of War, America’s Long War against Humanity (2015).

Es colaborador de la Enciclopedia Británica. Sus escritos han sido publicados en más de veinte idiomas. En 2014, fue galardonado con la Medalla de Oro al Mérito de la República de Serbia por sus escritos sobre la guerra de agresión de la OTAN contra Yugoslavia. Se puede contactar con él en crgeditor@yahoo.com

Véase Michel Chossudovsky, Nota biográfica

Artículos de Michel Chossudovsky sobre la investigación global

*

Nota para los lectores: Haga clic en los botones de compartir arriba o abajo. Síguenos en Instagram, @crg_globalresearch. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etc.

Fuente: https://www.globalresearch.ca/fake-delta-variant-fourth-wave-another-lockdown-upcoming-financial-crash-worldwide-economic-social-sabotage/5751819

Una profecía autocumplida: colapso sistémico y simulación de pandemias

Comentario de este blog: Esta guerra está llena de espigas, digo de aristas que las mantiene y erige un mismo tallo. Siempre he dicho que no se trataba de dinero, que ya lo poseían, que era otra cosa, como más poder o una especie de poder eterno, un juego de dioses, o más terrenal, un “capitalismo feudal” y un nuevo “neuro-capitalismo sanitario”. Con todo, hay que ir mirando con microscopio todas estas aristas, entre ellas, el colapso económico, por los que tienen el dinero pero más aún, por los que no lo tienen. Estamos en Guerra. El Globalismo contra el pueblo. Artículo importante.

POR FABIO VIGHI

Un año y medio después de la llegada de Virus, algunos pueden haber comenzado a preguntarse por qué las élites gobernantes generalmente sin escrúpulos decidieron congelar la máquina global de obtener ganancias frente a un patógeno que se dirige casi exclusivamente a los improductivos (mayores de 80 años). ¿Por qué tanto celo humanitario? Cui bono? Solo aquellos que no están familiarizados con las maravillosas aventuras de GloboCap pueden engañarse a sí mismos pensando que el sistema eligió cerrarse por compasión. Seamos claros desde el principio: los grandes depredadores del petróleo, las armas y las vacunas no podrían preocuparse menos por la humanidad.

Sigue el dinero

En tiempos pre-Covid, la economía mundial estaba al borde de otro colapso colosal. Aquí hay una breve crónica de cómo se estaba acumulando la presión:

Junio 2019: En su Informe Económico Anual, el Banco de Pagos Internacionales (BPI), con sede en Suiza, el “Banco Central de todos los bancos centrales”, hace sonar las alarmas internacionales. El documento destaca “el sobrecalentamiento […] en el mercado de préstamos apalancados”, donde “los estándares de crédito se han ido deteriorando” y “las obligaciones de préstamos garantizados (CLO) han aumentado, lo que recuerda el fuerte aumento de las obligaciones de deuda garantizada [CDO] que amplificaron la crisis subprime [en 2008]”. En pocas palabras, el vientre de la industria financiera está una vez más lleno de basura.

9 agosto 2019: El BPI publica un documento de trabajo en el que pide “medidas de política monetaria no convencionales” para “aislar a la economía real de un mayor deterioro de las condiciones financieras”. El documento indica que, al ofrecer “crédito directo a la economía” durante una crisis, los préstamos de los bancos centrales “pueden reemplazar a los bancos comerciales en la concesión de préstamos a las empresas”.

15 de agosto de 2019: Blackrock Inc., el fondo de inversión más poderoso del mundo (que administra alrededor de $ 7 billones en fondos de acciones y bonos), publica un libro blanco titulado Lidiar con la próxima recesión. Esencialmente, el documento instruye a la Reserva Federal de los Estados Unidos a inyectar liquidez directamente en el sistema financiero para evitar “una recesión dramática”. Una vez más, el mensaje es inequívoco: “Se necesita una respuesta sin precedentes cuando la política monetaria se agota y la política fiscal por sí sola no es suficiente. Esa respuesta probablemente implicará ‘ir directo'”: “encontrar formas de poner el dinero del banco central directamente en manos de los gastadores del sector público y privado” mientras se evita la “hiperinflación”. Los ejemplos incluyen la República de Weimar en la década de 1920, así como Argentina y Zimbabwe más recientemente”.

22-24 de agosto de 2019: Los banqueros centrales del G7 se reúnen en Jackson Hole, Wyoming, para discutir el documento de BlackRock junto con medidas urgentes para prevenir el colapso que se avecina. En las proféticas palabras de James Bullard, presidente de la Reserva Federal de San Luis: “Solo tenemos que dejar de pensar que el próximo año las cosas van a ser normales”.

15-16 de septiembre de 2019: La recesión se inaugura oficialmente por un aumento repentino en las tasas de repos (del 2% al 10,5%). ‘Repo’ es la abreviatura de ‘acuerdo de recompra’, un contrato en el que los fondos de inversión prestan dinero contra activos colaterales (normalmente valores del Tesoro). En el momento del intercambio, los operadores financieros (bancos) se comprometen a recomprar los activos a un precio más alto, generalmente de la noche a la mañana. En resumen, los repos son préstamos garantizados a corto plazo. Son la principal fuente de financiación para los comerciantes en la mayoría de los mercados, especialmente en la galaxia de los derivados. La falta de liquidez en el mercado de repos puede tener un efecto dominó devastador en todos los principales sectores financieros.

17 de septiembre de 2019: La Fed comienza el programa monetario de emergencia, inyectando cientos de miles de millones de dólares por semana en Wall Street, ejecutando efectivamente el plan “directo” de BlackRock. (Como era de esperar, en marzo de 2020 la Fed contratará a BlackRock para gestionar el paquete de rescate en respuesta a la “crisis de COVID-19”).

19 de septiembre de 2019: Donald Trump firma la Orden Ejecutiva 13887, que establece un Grupo de Trabajo Nacional de Vacunas contra la Influenza cuyo objetivo es desarrollar un “Plan nacional de 5 años (Plan) para promover el uso de tecnologías de fabricación de vacunas más ágiles y escalables y acelerar el desarrollo de vacunas que protejan contra muchos o todos los virus de la influenza”. Esto es para contrarrestar “una pandemia de gripe”, que, “a diferencia de la gripe estacional […] tiene el potencial de propagarse rápidamente por todo el mundo, infectar a un mayor número de personas y causar altas tasas de enfermedad y muerte en poblaciones que carecen de inmunidad previa”. Como alguien adivinó, la pandemia era inminente, mientras que en Europa también estaban en marcha los preparativos (ver aquí y aquí).

18 de octubre de 2019: En Nueva York, se simula una pandemia zoonótica global durante el Evento 201, un ejercicio estratégico coordinado por el Centro de Bioseguridad Johns Hopkins y la Fundación Bill y Melissa Gates.

21-24 de enero de 2020: La reunión anual del Foro Económico Mundial tiene lugar en Davos, Suiza, donde se discuten tanto la economía como las vacunas.

23 de enero de 2020: China pone Wuhan y otras ciudades de la provincia de Hubei en confinamiento.

11 de marzo de 2020: El director general de la OMS llama al Covid-19 una pandemia. El resto es historia.

Unir los puntos es un ejercicio bastante simple. Si lo hacemos, podríamos ver surgir un esquema narrativo bien definido, cuyo resumen sucinto dice lo siguiente: los bloqueos y la suspensión global de las transacciones económicas tenían la intención de 1) Permitir que la Fed inundara los mercados financieros enfermos con dinero recién impreso mientras aplazaba la hiperinflación; y 2) Introducir programas de vacunación masiva y pasaportes sanitarios como pilares de un régimen neofeudal de acumulación capitalista. Como veremos, los dos objetivos se funden en uno solo.

En 2019, la economía mundial estuvo plagada de la misma enfermedad que había causado la crisis crediticia de 2008. Se estaba asfixiando bajo una montaña insostenible de deuda. Muchas empresas públicas no podían generar suficientes beneficios para cubrir el pago de intereses de sus propias deudas y se mantenían a flote sólo mediante la adopción de nuevos préstamos. Las “empresas zombis” (con baja rentabilidad interanual, caída de la facturación, márgenes reducidos, flujo de caja limitado y balance altamente apalancado) estaban aumentando en todas partes. El colapso del mercado de repos de septiembre de 2019 debe ubicarse dentro de este frágil contexto económico.

Cuando el aire está saturado de materiales inflamables, cualquier chispa puede causar la explosión. Y en el mágico mundo de las finanzas, tout se tient:un aleteo de las alas de una mariposa en un determinado sector puede hacer que todo el casa de naipes se derrumbe. En los mercados financieros impulsados por préstamos baratos, cualquier aumento en las tasas de interés es potencialmente catastrófico para los bancos, los fondos de cobertura, los fondos de pensiones y todo el mercado de bonos del gobierno, porque el costo de los préstamos aumenta y la liquidez se agota. Esto es lo que sucedió con el ‘repocalypse’ de septiembre de 2019: las tasas de interés se dispararon a 10.5% en cuestión de horas, estalló el pánico afectando a futuros, opciones, divisas y otros mercados donde los operadores apuestan pidiendo prestado a los repos. La única forma de desactivar el contagio era arrojando tanta liquidez como fuera necesario al sistema, como helicópteros que arrojan miles de galones de agua en un incendio forestal. Entre septiembre de 2019 y marzo de 2020, la Fed inyectó más de 9 billones de dólares en el sistema bancario, lo que equivale a más del 40% del PIB estadounidense.

Por lo tanto, la narrativa dominante debe revertirse: el mercado de valores no colapsó (en marzo de 2020) porque se tuvieron que imponer confinamientos; más bien, hubo que imponer confinamientos porque los mercados financieros estaban colapsando. Con los confinamientos llegó la suspensión de las transacciones comerciales, que drenó la demanda de crédito y detuvo el contagio. En otras palabras, la reestructuración de la arquitectura financiera a través de una política monetaria extraordinaria dependía de que se apagara el motor de la economía. Si la enorme masa de liquidez inyectada en el sector financiero hubiera alcanzado transacciones sobre el terreno, se habría desatado un tsunami monetario con consecuencias catastróficas.

Como afirma la economista Ellen Brown, fue “otro rescate”, pero esta vez “al amparo de un virus”. Del mismo modo, John Titus y Catherine Austin Fitts señalaron que la “varita mágica” Covid-19 permitió a la Fed ejecutar el plan “directo” de BlackRock, literalmente: llevó a cabo una compra sin precedentes de bonos del gobierno, mientras que, en una escala infinitesimalmente menor, también emitió “préstamos COVID” respaldados por el gobierno a las empresas. En resumen, solo un coma económico inducido proporcionaría a la Fed el espacio para desactivar la bomba de tiempo que se está desvaneciendo en el sector financiero. Examinado por la histeria colectiva, el banco central de los Estados Unidos tapó los agujeros en el mercado de préstamos interbancarios, esquivando la hiperinflación, así como el “Consejo de Supervisión de la Estabilidad Financiera” (la agencia federal para monitorear el riesgo financiero creado después del colapso de 2008), como se discute aquí. Sin embargo, el plan de “ir directo” también debe enmarcarse como una medida desesperada, ya que solo puede prolongar la agonía de una economía global cada vez más rehén de la impresión de dinero y la inflación artificial de los activos financieros.

En el corazón de nuestra situación se encuentra un callejón sin salida estructural insuperable. La financiarización apalancada en la deuda es la única línea de vuelo del capitalismo contemporáneo, la inevitable ruta de escape hacia adelante para un modelo reproductivo que ha alcanzado su límite histórico. Los capitales se dirigen a los mercados financieros porque la economía basada en el trabajo es cada vez menos rentable. ¿Cómo llegamos a esto?

La respuesta se puede resumir de la siguiente manera: 1. La misión de la economía de generar plusvalía es tanto el impulso para explotar la fuerza de trabajo como para expulsarla de la producción. Esto es lo que Marx llamó la “contradicción en movimiento” del capitalismo. [1] Si bien constituye la esencia de nuestro modo de producción, esta contradicción hoy es contraproducente, convirtiendo la economía política en un modo de devastación permanente. 2. La razón de este cambio de fortuna es el fracaso objetivo de la dialéctica trabajo-capital: la aceleración sin precedentes en la automatización tecnológica desde la década de 1980 hace que se expulse más fuerza de trabajo de la producción que (re)absorbida. La contracción del volumen de salarios significa que el poder adquisitivo de una parte creciente de la población mundial está disminuyendo, con la deuda y la miseria como consecuencias inevitables. 3. A medida que se produce menos plusvalía, el capital busca rendimientos inmediatos en el sector financiero apalancado por la deuda en lugar de en la economía real o invirtiendo en sectores socialmente constructivos como la educación, la investigación y los servicios públicos.

La conclusión es que el cambio de paradigma en curso es la condición necesaria para la supervivencia (distópica) del capitalismo, que ya no es capaz de reproducirse a través del trabajo asalariado masivo y la utopía consumista concomitante. La agenda de la pandemia fue dictada, en última instancia, por la implosión sistémica: la caída de la rentabilidad de un modo de producción que la automatización desenfrenada está haciendo obsoleto. Por esta razón inmanente, el capitalismo depende cada vez más de la deuda pública, los bajos salarios, la centralización de la riqueza y el poder, un estado de emergencia permanente y las acrobacias financieras.

Si ‘seguimos el dinero’, veremos que el bloqueo económico atribuido desviadamente al Virus ha logrado resultados nada despreciables, no solo en términos de ingeniería social, sino también de depredación financiera. Rápidamente destacaré cuatro de ellos.

1) Como se anticipó, ha permitido a la Fed reorganizar el sector financiero imprimiendo un flujo continuo de miles de millones de dólares de la nada; 2) Ha acelerado la extinción de las pequeñas y medianas empresas, permitiendo a los grandes grupos monopolizar los flujos comerciales; 3) Ha deprimido aún más los salarios laborales y ha facilitado ahorros significativos de capital a través del “trabajo inteligente” (que es particularmente inteligente para aquellos que lo implementan); 4) Ha permitido el crecimiento del comercio electrónico, la explosión de big tech y la proliferación del dólar farmacéutico, que también incluye la muy despreciada industria del plástico, que ahora produce millones de nuevas máscaras faciales y guantes cada semana, muchos de los cuales terminan en los océanos (para deleite de los “nuevos distribuidores verdes”). Solo en 2020, la riqueza de los aproximadamente 2.200 multimillonarios del planeta creció en 1,9 billones de dólares,un aumento sin precedentes históricos. Todo ello gracias a un patógeno tan letal que, según datos oficiales, solo el 99,8% de los infectados sobreviven (ver aquí y aquí),la mayoría de ellos sin experimentar ningún síntoma.

Hacer el capitalismo de manera diferente

El motivo económico del whodunit Covid debe situarse en un contexto más amplio de transformación social. Si rascamos la superficie de la narrativa oficial, un escenario neofeudal comienza a tomar forma. Masas de consumidores cada vez más improductivos están siendo reglamentados y dejados de lado, simplemente porque Mr Global ya no sabe qué hacer con ellos. Junto con los subempleados y los excluidos, las clases medias empobrecidas son ahora un problema que debe manejarse con el palo de los confinamientos, los toques de queda, la vacunación masiva, la propaganda y la militarización de la sociedad, en lugar de con la zanahoria del trabajo, el consumo, la democracia participativa, los derechos sociales (reemplazados en el imaginario colectivo por los derechos civiles de las minorías) y las “vacaciones bien merecidas”.

Por lo tanto, es delirante creer que el propósito de los confinamientos es terapéutico y humanitario. ¿Cuándo se ha preocupado el capital por la gente? La indiferencia y la misantropía son los rasgos típicos del capitalismo, cuya única pasión real es la ganancia, y el poder que viene con ella. Hoy en día, el poder capitalista se puede resumir con los nombres de los tres fondos de inversión más grandes del mundo: BlackRock, Vanguard y State Street Global Advisor. Estos gigantes, que se encuentran en el centro de una enorme galaxia de entidades financieras, gestionan una masa de valor cercana a la mitad del PIB mundial y son accionistas importantes en alrededor del 90% de las empresas que cotizan en bolsa. A su alrededor gravitan instituciones transnacionales como el Fondo Monetario Internacional, el Banco Mundial, el Foro Económico Mundial, la Comisión Trilateral y el Banco de Pagos Internacionales, cuya función es coordinar el consenso dentro de la constelación financiera. Podemos asumir con seguridad que todas las decisiones estratégicas clave – económicas, políticas y militares – están al menos fuertemente influenciadas por estas élites. ¿O queremos creer que Virus los ha tomado por sorpresa? Más bien, el SARS-CoV-2 , que, según la admisión de los CDC y la Comisión Europea, nunca ha sido aislado ni purificado, es el nombre de un arma especial de guerra psicológica que se desplegó en el momento de mayor necesidad.

¿Por qué deberíamos confiar en un mega cártel farmacéutico (la OMS) que no se encarga de la “salud pública”, sino de comercializar productos privados en todo el mundo a las tasas más rentables posibles? Los problemas de salud pública se derivan de las pésimas condiciones de trabajo, la mala nutrición, el aire, el agua y la contaminación de los alimentos, y sobre todo de la pobreza desenfrenada; sin embargo, ninguno de estos “patógenos” está en la lista de preocupaciones humanitarias de la OMS. Los inmensos conflictos de intereses entre los depredadores de la industria farmacéutica, las agencias médicas nacionales y supranacionales, y los cínicos ejecutores políticos, es ahora un secreto a voces. No es de extrañar que el día en que el COVID-19 fue clasificado como una pandemia, el WEF, junto con la OMS, lanzó la Plataforma de Acción Covid, una coalición de “protección de la vida” dirigida por más de 1.000 de las empresas privadas más poderosas del mundo.

Lo único que importa para la camarilla que dirige la orquesta de emergencias sanitarias es alimentar la maquinaria lucrativa, y cada movimiento está planeado para este fin, con el apoyo de un frente político y mediático motivado por el oportunismo. Si la industria militar necesita guerras, la industria farmacéutica necesita enfermedades. No es casualidad que la “salud pública” sea, con mucho, el sector más rentable de la economía mundial, en la medida en que las grandes farmacéuticas gastan aproximadamente tres veces más que las grandes petroleras y el doble que las grandes tecnológicas en cabildeo. La demanda potencialmente interminable de vacunas y brebajes genéticos experimentales ofrece a los cárteles farmacéuticos la perspectiva de flujos de ganancias casi ilimitados, especialmente cuando están garantizados por programas de vacunación masiva subsidiados con dinero público (es decir, por más deuda que caerá sobre nuestras cabezas).

¿Por qué todos los tratamientos contra el Covid han sido prohibidos o saboteados penalmente? Como admite cándidamente la FDA, el uso de vacunas de emergencia solo es posible si “no hay alternativas adecuadas, aprobadas y disponibles”. Un caso de verdad oculto a plena vista. Además, la actual religión de la vacuna está estrechamente vinculada al aumento del dólar farmacéutico, que, al alimentarse de pandemias, está listo para emular las glorias del ‘petrodólar’, permitiendo a los Estados Unidos continuar ejerciendo la supremacía monetaria global. ¿Por qué toda la humanidad (¡incluidos los niños!) inyectar “vacunas” experimentales con efectos adversos cada vez más preocupantes pero sistemáticamente minimizados, cuando más del 99% de los infectados, la gran mayoría asintomáticos, se recuperan? La respuesta es obvia: porque las vacunas son el becerro de oro del tercer milenio, mientras que la humanidad es material de explotación de “última generación” en modalidad de conejillo de indias.

Ante este contexto, la puesta en escena de la pantomima de emergencia triunfa a través de una manipulación inaudita de la opinión pública. Cada “debate público” sobre la pandemia está descaradamente privatizado,o más bien monopolizado por la creencia religiosa en comités técnico-científicos financiados por las élites financieras. Toda “discusión libre” está legitimada por la adhesión a protocolos pseudocientíficas cuidadosamente purgados del contexto socioeconómico: uno “sigue a la ciencia” mientras finge no saber que “la ciencia sigue al dinero”. La famosa declaración de Karl Popper de que la “ciencia real” solo es posible bajo la égida del capitalismo liberal en lo que él llamó “la sociedad abierta”,[1] ahora se está haciendo realidad en la ideología globalista que anima, entre otros, la Open Society Foundation de George Soros. La combinación de “ciencia real” y “sociedad abierta e inclusiva” hace que la doctrina Covid sea casi imposible de desafiar.

Para el COVID-19, entonces, podríamos imaginar la siguiente agenda. Se prepara una narrativa ficticia basada en un riesgo epidémico presentado de tal manera que promueva el miedo y el comportamiento sumiso. Lo más probable es que se trata de un caso de reclasificación diagnóstica. Todo lo que se necesita es un virus de la gripe epidemiológicamente ambiguo, sobre el que construir una historia agresiva de contagio relacionable con áreas geográficas donde el impacto de las enfermedades respiratorias o vasculares en la población anciana e inmunocomprometa es alto, tal vez con el agravante de la fuerte contaminación. No hay necesidad de recuperar mucho, dado que las unidades de cuidados intensivos en los países ‘avanzados’ ya habían colapsado en los años previos a la llegada del Covid, con picos de mortalidad para los que nadie había soñado con exhumar la cuarentena. En otras palabras, los sistemas de salud pública ya habían sido demolidos y, por lo tanto, preparados para el escenario de pandemia.

Pero esta vez hay un método en la locura: se declara un estado de emergencia, que desencadena el pánico, causando a su vez la obstrucción de hospitales y residencias de ancianos (con alto riesgo de sepsis), la aplicación de protocolos nefastos y la suspensión de la atención médica. Et voilà, ¡el virus asesino se convierte en una profecía autocumplida! La propaganda que se extiende por los principales centros de poder financiero (especialmente América del Norte y Europa) es esencial para mantener el “estado de excepción” (Carl Schmitt), que se acepta inmediatamente como la única forma posible de racionalidad política y existencial. Poblaciones enteras expuestas al intenso bombardeo mediático se rinden a través de la autodisciplina, adhiriéndose con grotesco entusiasmo a formas de “responsabilidad cívica” en las que la coerción se transforma en altruismo.

Todo el guión de la pandemia, desde la ‘curva de contagio’ hasta las ‘muertes por Covid’, se basa en la prueba PCR, que fue autorizada para la detección del SARS-CoV-2 por un estudio elaborado en tiempo récord por encargo de la OMS. Como muchos ya sabrán, la falta de fiabilidad diagnóstica de la prueba PCR fue denunciada por su propio inventor, el premio Nobel Kary Mullis (lamentablemente fallecida el 7 de agosto de 2019), y recientemente reiterada por, entre otros, 22 expertos de renombre internacional que exigieron su eliminación por claros defectos científicos. Obviamente, la solicitud cayó en oídos sordos.

La prueba PCR es el motor de la pandemia. Funciona a través de los infames ‘umbrales de ciclo’: cuantos más ciclos haces, más falsos positivos (infecciones, muertes por Covid) produces, como incluso el gurú Anthony Fauci admitió imprudentemente cuando afirmó que los hisopos no valen nada por encima de los 35 ciclos. Ahora, ¿por qué durante la pandemia se realizaron rutinariamente amplificaciones de 35 ciclos o más en laboratorios de todo el mundo? Incluso el New York Times, ciertamente no una guarnda de peligrosos negadores del Covid, planteó esta pregunta clave el verano pasado. Gracias a la sensibilidad del hisopo, la pandemia se puede encender y apagar como un grifo, lo que permite al régimen de salud ejercer un control total sobre el “monstruo numerológico” de los casos y muertes por Covid, los instrumentos clave del terror cotidiano.

Todo este alarmismo continúa hoy, a pesar de la flexibilización de algunas medidas. Para entender por qué, deberíamos volver al motivo económico. Como se ha señalado, varios billones de efectivo recién impreso han sido creados con unos pocos clics de un ratón por los bancos centrales e inyectados en los sistemas financieros, donde en gran parte han permanecido. El objetivo de la ola de impresión era tapar las calamitosas brechas de liquidez. La mayor parte de este “dinero del árbol mágico” todavía está congelado dentro del sistema bancario en la sombra, las bolsas de valores y varios esquemas de moneda virtual que no están destinados a ser utilizados para el gasto y la inversión. Su función es únicamente proporcionar préstamos baratos para la especulación financiera. Esto es lo que Marx llamó “capital ficticio”, que continúa expandiéndose en un bucle orbital que ahora es completamente independiente de los ciclos económicos en el suelo.

La conclusión es que no se puede permitir que todo este efectivo inunde la economía real, ya que esta última se sobrecalentaría y desencadenaría la hiperinflación. Y aquí es donde Virus sigue siendo útil. Si inicialmente sirvió para “aislar la economía real” (para citar nuevamente el documento del BIS), ahora supervisa su reapertura tentativa, caracterizada por la sumisión al dogma de la vacunación y los métodos cromáticos de regimentación masiva, que pronto pueden incluir bloqueos climáticos. ¿Recuerdas cómo nos dijeron que solo las vacunas nos devolverían nuestra “libertad”? De manera demasiado predecible, ahora descubrimos que el camino hacia la libertad está lleno de “variantes”, es decir, iteraciones de Virus. Su propósito es aumentar el “recuento de casos” y, por lo tanto, prolongar los estados de emergencia que justifican la producción de dinero virtual de los bancos centrales destinado a monetizar la deuda y financiar los déficits. En lugar de volver a los tipos de interés normales, las élites optan por normalizar la emergencia sanitaria alimentando el fantasma del contagio. Por lo tanto, la tan publicitada “reducción” (reducción del estímulo monetario) puede esperar, al igual que Pandexit.

En la UE, por ejemplo, el «programa de compras de emergencia pandémica» del Banco Central Europeo de 1,85 billones de euros, conocido como PEPP, se prevé que continúe hasta marzo de 2022. Sin embargo, se ha insinuado que podría necesitar extenderse más allá de esa fecha. Mientras tanto, la variante Delta está causando estragos en la industria de viajes y turismo, con nuevas restricciones (incluida la cuarentena) que interrumpen la temporada de verano. Una vez más, parece que estamos atrapados dentro de una profecía autocumplida (especialmente si, como el premio Nobel Luc Montagnier y muchos otros han insinuado, las variantes, por leves que sean, son la consecuencia de agresivas campañas de vacunación masiva). Cualquiera que sea el caso, el punto fundamental es que el Virus sigue siendo necesario para el capitalismo senil, cuya única posibilidad de supervivencia depende de generar un cambio de paradigma del liberalismo al autoritarismo oligárquico.

Si bien su crimen está lejos de ser perfecto, los orquestadores de este golpe global deben, sin embargo, ser acreditados con una cierta brillantez sádica. Su prestidigitación tuvo éxito, tal vez incluso más allá de las expectativas. Sin embargo, cualquier poder que apunte a la totalización está destinado al fracaso, y esto se aplica también a los sumos sacerdotes de la religión Covid y a los títeres institucionales que han movilizado para desplegar el psyop de emergencia sanitaria. Después de todo, el poder tiende a engañarse a sí mismo acerca de su omnipotencia. Aquellos sentados en la sala de control no se dan cuenta de hasta qué punto su dominio es incierto. Lo que no ven es que su autoridad depende de una “misión superior”, a la que permanecen parcialmente ciegos, a saber, la auto reproducción anónima de la matriz capitalista. El poder de hoy reside en la máquina lucradora cuyo único propósito es continuar su viaje imprudente, lo que podría conducir a la extinción prematura del Homo sapiens. Las élites que han estafado al mundo en la obediencia al Covid son la manifestación antropomórfica del autómata capitalista, cuya invisibilidad es tan astuta como la del propio Virus. Y la novedad de nuestra era es que la “sociedad encerrada” es el modelo que mejor garantiza la reproducibilidad de la máquina capitalista, independientemente de su destino distópico.

Notas:

[1] Karl Marx, Grundrisse (Londres: Penguin, 1993), 706.

[2] Karl Popper, The Open Society and its Enemies,2 volúmenes (Princeton: Princeton UP, 2013).

Fuente: http://thephilosophicalsalon.com/a-self-fulfilling-prophecy-systemic-collapse-and-pandemic-simulation/

Martinica y Guadalupe: Las existencias de ivermectina se requisan para forzar la vacunación

Un poco demasiado resistente para Olivier Véran, Guadalupe y Martinica no tienen prisa por ser inyectados con un producto en su fase de prueba. En medio del clima de mentiras, los antillanos no se han librado. Todo lo contrario. Así lo denuncia el diputado martinicano Jean-Philippe Nilor en un vídeo publicado en Facebook: “Un día después de la visita relámpago de dos ministros, hay algunas preguntas por responder. Obviamente, estos ministros no vendieron a ver, a entender, ni a escuchar… pero para darnos un discurso bien afinado, bien preparado desde París. Y este discurso cumple dos grandes objetivos. La primera es hacernos sentir culpables. Es por nosotros, porque no estamos suficientemente vacunados. El segundo objetivo es promover la acción de Francia como si viniera a salvarnos a los irresponsables. El Ministro de Salud va aún más allá, despotricando contra los funcionarios electos que no transmiten claramente el discurso a favor de la vacunación forzada, y estos funcionarios electos deben ser considerados responsables de la situación. Pero, ¿Quién es responsable de la gestión de los hospitales? ¿Quién es responsable de que estos hospitales de Martinica y Guadalupe tengan menos personal? ¿Quién es responsable de que al comienzo de la crisis nos hayamos quedo sin oxígeno? ¡La gente ha muerto por falta de oxígeno! Quién es el responsable, aunque existan protocolos con Ivermectina, zinc… que reducen el riesgo de desarrollar una forma grave de la enfermedad? ¿Por qué hoy, en Martinica y Guadalupe, nos encontramos sin existencias de Ivermectina? ¿Por qué? Y en lugar de reabastecer las farmacias con Ivermectina u otros medicamentos alternativos, enviamos doscientos soldados que, irónicamente, no están vacunados. No necesitamos lecciones de nadie, especialmente de aquellos más altos que no hacen nada para evitar que la situación se deteriore, aquellos más arriba que impiden que los cuidadores traten a las personas. Nou là, nou doubout! Tchimbé raid pa moli! (“¡Aquí estamos, páranos! ¡Espera, no flaquees!”).

La ivermectina parece ser el enemigo a batir, peor que el Covid-19. https://www.facebook.com/plugins/video.php?href=https%3A%2F%2Fwww.facebook.com%2F297068797117195%2Fvideos%2F235615711769090%2F&show_text=0&width=560

Así que las existencias de Ivermectina han sido requisadas. Ahora llega el testimonio de una mujer que vive en Martinica. “Todas las existencias de Ivermectina han sido requisadas por el Estado, a través de la gendarmería, en todas las farmacias.

Porque los médicos estaban empezando a recetar Ivermectina, azitromicina y todos los protocolos que impiden que las personas sean hospitalizadas. Esta es la situación real en Martinica. Se hace todo lo posible para escalar las cosas, para que podamos convertirnos en un ejemplo y puedan decir: “Look, no están vacunados, y se están muriendo!”. Esto es falso, ya que somos la región 17 de Francia en términos de tasa de mortalidad, es decir, en el penúltimo lugar, donde hay menos mortalidad. Así que el confinamiento es un castigo político, porque la gente no se vacuna aquí. Otra cosa que no te dicen en Francia es que tenemos una gran epidemia de dengue. La gente se está muriendo de dengue y lo achaca al Covid. Así que no te preocupes! En Martinica, los muertos no están ensuciando las calles”.

Como comprenderán, todo está muy bien organizado para que el caos se arraiga en las Antillas, para justificar la vacunación y silenciar a los recalcitrantes. Y todo con la ayuda maliciosa de unos medios de comunicación dispuestos a contar las muertes que producen.

                                                                *** 

Martinicans protestan contra la vacunación obligatoria contra el COVID-19 (TeleSur)

Martinicanos explican por qué son hostiles a la vacunación contra el “Covid-19”

Fuentes: https://lemediaen442.fr/en-martinique-et-en-guadeloupe-requisition-des-stocks-divermectine-pour-forcer-a-la-vaccination/

https://yvymaraey.blogspot.com/2021/08/martinique-and-guadeloupe-ivermectin.html

La narrativa sin sentido predominante del Coronavirus, desacreditada en 10 o 26 minutos

Doctor Thomas Binder

Todo prójimo enfermo y todo familiar de prójimo fallecido tiene mi más profunda empatía pero, ante todo, también tiene derecho a conocer la verdad.

Me gustaría presentar la realidad de la crisis de la corona, entrar en su cronología y confrontar sus numerosos mitos y absurdos intelectuales con la cientificidad. Los estudios más importantes están vinculados en el texto. Se puede encontrar más información científica, incluidos enlaces a otros estudios importantes, en las páginas de inicio de “Aletheia – Medicine and Science for Proportionality”, el “Corman-Drosten Review Report” y “Doctors for Covid Ethics”, de los cuales soy un miembro.

Epidemia de pruebas de PCR, 2006

Como médicos y científicos responsables, en el caso de infecciones diagnosticadas mediante pruebas rápidas de PCR en el contexto de una supuesta epidemia de alcance nacional o pandemia de alcance internacional, siempre debemos considerar la posibilidad de una pseudoepidemia o epidemia deTests.

El 27 de enero de 2007, el New York Times, virtualmente la biblia de los periodistas en cuya integridad todavía se podía confiar en ese momento, publicó un importante artículo titulado: ‘Faith in Quick Test Leads to Epidemic That Wasn’t’; “La fe en las pruebas rápidas conduce a una epidemia que no fue”.

El Dr. Herndon, internista de un centro médico en el estado estadounidense de New Hampshire, tose incesantemente durante quince días a partir de mediados de abril de 2006. Pronto, un especialista en enfermedades infecciosas tiene la inquietante idea de que esto podría ser el comienzo de una tos ferina. epidemia. A finales de abril, otros miembros del personal del hospital también estaban tosiendo. La tos intensa y persistente es un síntoma principal de la tos ferina. Y si se trata de tos ferina, el brote debe ser contenido de inmediato porque la enfermedad puede ser fatal para los bebés en el hospital y provocar una neumonía peligrosa en pacientes ancianos frágiles.

Es el comienzo de un extraño episodio en el centro médico: la historia de la epidemia que no lo fue. Durante meses, casi todos los involucrados creen que hay un gran brote de tos ferina en el centro médico con consecuencias de gran alcance. A casi 1.000 miembros del personal se les realiza una prueba rápida de PCR y se les apartó del trabajo hasta que se obtuviesen los resultados; 142 personas, el 14,2% de las examinadas, incluido el Dr. Herndon, dan positivo en la prueba de PCR rápida, por lo que se les diagnostica tos ferina. Miles, incluidos muchos niños, reciben antibióticos y una vacuna como protección. Las camas de hospital se retiran de servicio como medida de precaución, incluso algunas en la unidad de cuidados intensivos.

Meses después, todos los que aparentemente padecen tos ferina se quedan atónitos al saber que en cultivos bacterianos, el estándar de oro diagnóstico para la tos ferina, la bacteria que causa la tos ferina no se pudo detectar en una sola muestra. Toda la locura fue una falsa alarma.

La supuesta epidemia de tos ferina no había tenido lugar en la realidad, sino solo en las mentes de los involucrados, provocada por la fe ciega en una prueba de PCR rápida altamente sensible que se había vuelto tan moderna. En verdad, todos los que habían caído enfermos habían padecido un resfriado inofensivo. Los infecciosos y epidemiólogos habían dejado de lado su experiencia y sentido común y habían ignorado descaradamente este diagnóstico diferencial más probable del síntoma de tos.

Muchas de las nuevas pruebas moleculares son rápidas pero técnicamente exigentes. Cada laboratorio las elabora a su manera como las denominadas ‘cervezas caseras’. Por lo general, no están disponibles comercialmente y rara vez hay buenas estimaciones de sus tasas de error. Su alta sensibilidad hace que sean probables los falsos positivos. Cuando se hacen las pruebas a cientos o miles de personas, como sucedió aquí, los resultados falsos positivos pueden dar la apariencia de una epidemia.

Un infectólogo dijo: En ese momento tuve la sensación de que esto nos daba una sombra de lo que podría ser durante una epidemia de gripe pandémica.

Y un epidemiólogo explicó: Uno de los aspectos más preocupantes de la pseudoepidemia es que todas las decisiones parecían tan sensatas en ese momento.

La locura de una pseudoepidemia o una epidemia de Tests parecía perfectamente normal para muchos involucrados.

Le recomiendo que lea este artículo publicado en el New York Times en 2007 y se pregunte: “¿No deberíamos haber aprendido mucho de esto para el futuro?”

Escándalo de la gripe porcina, 2009

Como médicos y científicos responsables, en una supuesta o real epidemia de ámbito nacional o pandemia de alcance internacional debemos recordar siempre las presuntas o reales epidemias o pandemias anteriores. Aquí está el último.

En la primavera de 2009, un virus de influenza sumamente contagioso y peligroso, el H1N1, parece amenazar a la humanidad. La enfermedad que causa es clínicamente indistinguible de la gripe estacional y se llama gripe porcina.

Expertos como el virólogo alemán Prof. Christian Drosten difundieron escenarios de terror prediciendo millones de muertes en todo el mundo. En mayo, la OMS flexibiliza los criterios para declarar una pandemia por razones que nunca se han explicado. Elimina la peligrosidad del patógeno causante de la definición de pandemia. Ahora, la propagación rápida y masiva de un patógeno comparativamente inofensivo en al menos dos regiones de la OMS es suficiente. Cualquier endemia, cada ola estacional de cualquier gripe o virus del resfriado, sin importar cuán inofensivo sea, puede llamarse pandemia. Inmediatamente, la OMS declara una pandemia de H1N1 el 11 de junio.

Los políticos se toman en serio las advertencias de los expertos y de la OMS. Sin consultar a la población, están adquiriendo cientos de millones de paquetes de medicamentos antivirales costosos y escasamente efectivos y cientos de millones de dosis de vacunas aprobadas apresuradamente que, después de todo, se producen utilizando métodos convencionales.

Los críticos que describen el virus como comparativamente inofensivo son ridiculizados o ignorados inicialmente. Finalmente, los científicos, en Europa especialmente el microbiólogo y epidemiólogo de infecciones alemán Prof. Sucharit Bhakdi y el neumólogo y político alemán Dr. Wolfgang Wodarg, captan la atención en los medios de comunicación y la política. La locura global que ya amenazaba en ese momento puede evitarse justo a tiempo.

En todo el mundo, entre 150 y 600 mil personas murieron con o por el H1N1, que resultó ser menos peligroso que la influenza estacional. En consecuencia, la preparación para la vacunación fue baja. Sin embargo, solo en Suecia, unos 700 niños contrajeron narcolepsia incapacitante, enfermedad del sueño, causada por vacunas innecesarias e inseguras aprobadas apresuradamente. Solo en Suiza, se vendieron o regalaron 1,8 millones de dosis de vacunas en el extranjero y se eliminaron 8,9 millones.

Apenas hubo cobertura mediática del escándalo de la gripe porcina. El éxito temporal del pánico alimentado por los medios se debió principalmente a la interconexión de los expertos, la industria farmacéutica, la OMS y los políticos de la salud. Al final, las autoridades sanitarias aparentemente abrumadas se habían enamorado de una campaña de propaganda casi perfectamente orquestada.

Te recomiendo que veas el documental „Profiteure der Angst – das Geschäft mit der Schweinegrippe“; “Beneficiarios del miedo – El negocio de la gripe porcina”, producido en alemán por Arte en noviembre de 2009, y te preguntes: “¿No deberíamos haber aprendido mucho de esto para el futuro?”

‘Evento 201’: Simulación de la pandemia de Corona, 2019

La situación es amenazadora. Un nuevo virus corona se está extendiendo por todo el mundo. El número de casos en el panel de control de la Universidad Johns Hopkins está aumentando y aumentando. El peligroso virus altamente contagioso, inmunorresistente está paralizando el comercio y el transporte a nivel mundial y haciendo que la economía mundial caiga libremente.

Lo que suena como el supuesto brote de la supuesta pandemia de SARS-CoV-2 en la provincia china de Wuhan en diciembre de 2019, es el escenario del “Evento 201”.

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates, la Universidad Johns Hopkins y el WEF están organizando una simulación de pandemia con este nombre. Después de la gripe española, la gripe aviar y la gripe porcina, como patógeno no eligen otro virus de la gripe, sino un coronavirus que hasta ahora es completamente desconocido para los profanos, sobre todo para políticos y periodistas.

Esta simulación de una pandemia de corona que estalló en Sudamérica no es atendida por médicos, sino por representantes occidentales de los organizadores, la ONU, la OMS, gobiernos, autoridades y corporaciones globales de los campos de las altas finanzas, farmacéutica, logística, turismo. y los medios de comunicación, así como por el Dr. George Gao, virólogo y director de los CDC chinos, el equivalente chino de la Oficina Federal Suiza de Salud Pública (BAG).

Los participantes están de acuerdo en que una pandemia de corona es disruptiva, solo puede superarse mediante la cooperación gubernamental y privada global, las corporaciones globales relevantes para el sistema deben apoyarse financieramente, las empresas medianas deben sacrificarse si es necesario, las voces que se desvían de la narrativa prevaleciente deben ser censurada constantemente en los medios de comunicación social y de masas, y la pandemia solo se puede acabar con la vacunación de toda la población mundial.

La simulación termina con 65 millones de muertes en todo el mundo.

Te recomiendo que veas el documental „Event 201: Corona-Pandemie vom Reissbrett“; “Evento 201: La pandemia de Corona desde el tablero de dibujo”, producido en alemán con subtítulos en inglés por ExpressZeitung en junio de 2020, y te preguntes: “¿No deberían los medios de comunicación informar sobre esto en detalle?”

Corona escándalo, 2020

Dos meses y medio después, el 31 de diciembre de 2019, los CDC chinos, dirigidos por el Dr. George Gao, informan a la OMS 27 casos de neumonía de causa desconocida, de una población china de 1.400 millones. El 7 de enero de 2020, las autoridades sanitarias chinas identificaron un nuevo coronavirus como agente causante.

El 21 de enero de 2020, el profesor Christian Drosten et al. Presentar un artículo , con cuya receta los laboratorios pueden producir una prueba rápida de RT-PCR para la detección del virus denominada 2019-nCoV. Se acepta al día siguiente y se publica en la revista Eurosurveillance otro día después.

La OMS ya había publicado la prueba rápida Drosten RT-PCR en su sitio web una semana antes y la recomendó como el estándar de oro de diagnóstico mundial.

El 30 de enero, Drosten et al. publicó la justificación de la narrativa de la transmisión asintomática epidemiológicamente relevante de 2019-nCoV en la carta al editor del New England Journal of Medicine, virtualmente una de las biblias de nosotros los médicos en cuya integridad todavía podíamos confiar en ese momento, con el título ‘Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany’; “Transmisión de la infección por 2019-nCoV a partir de un contacto asintomático en Alemania”.

El 11 de febrero, la OMS nombra al nuevo virus corona SARS-CoV-2, la enfermedad que causa COVID-19; enfermedad del coronavirus. Lo hace en contra de la solicitud de los virólogos chinos. Prefirieron llamarlo HCoV-19, coronavirus humano, debido al peligro de que el nombre SARS-CoV-2 pudiera despertar temores infundados por su falta de similitud biológica y epidemiológica con el mucho más peligroso SARS-CoV-1.

El 11 de marzo, la OMS declara una pandemia de COVID. Mientras tanto, su Director General, el biólogo, inmunólogo y filósofo Dr. Tedros Adhanom Ghebreyesus, fue acusado de genocidio en Etiopía ante la Corte Penal Internacional en La Haya. La presunción de inocencia se aplica, por supuesto.

Ahora, casi todo está sucediendo como sucedió durante el escándalo de la gripe porcina en 2009, pero de una manera aún más lubricada. Expertos, en su mayoría médicos de laboratorio y biólogos que trabajan como virólogos o epidemiólogos, que nunca han examinado a nadie que padezca una infección respiratoria, y mucho menos tratado, declaran que el SARS-CoV-2 es prácticamente un extraterrestre del que no sabemos absolutamente nada y que debemos considerar extremadamente peligroso, hasta que en gran parte los mismos expertos hayan demostrado lo contrario en algún momento. En Suiza, se constituyen como ‘Grupo de Trabajo Científico Nacional Suizo COVID-19’ y se ofrecen al Consejo Federal Suizo como asesores científicos.

Los políticos ejecutivos y legislativos, así como las autoridades sanitarias federales y cantonales, todos aterrorizados por ellos, aceptan su oferta y parecen seguirlos tan ciegamente como el Consejo Federal aparentemente siguió ciegamente a la OMS cuando declaró la pandemia de COVID. A diferencia de cualquier club de nueve bolos, el consejo científico asesor ahora oficial del gobierno suizo a través de lo que se supone que es la mayor crisis de Suiza desde la Segunda Guerra Mundial no mantiene ningún registro de sus actividades.

El 16 de marzo, el Consejo Federal Suizo declara la ‘situación excepcional’, el nivel de peligro más alto de la ley epidémica, basado en exactamente cero evidencia científica,

Los medios de comunicación, incluida la emisora ​​pública suiza SRG, asumen la tercera parte de este conglomerado de ignorancia, arrogancia, incompetencia e irresponsabilidad organizada que se intensifican mutuamente. Ellos mismos, sin cerebro y sin corazón, martillean en nuestras cabezas durante todo el día:

Existe una pandemia de un virus corona killer transmisible asintomáticamente, altamente contagioso e incluso epidemiológicamente relevante. ¡Todo ser humano aparentemente sano y cordial puede ser tu ángel de la muerte!

A diferencia de 2009, los medios de comunicación censuran, desacreditan y difaman constantemente a los médicos y científicos que cuestionan, incluidas luminarias como John Ioannidis, profesor de medicina, epidemiología y salud pública en la Facultad de Medicina de la Universidad de Stanford, uno de los científicos más reconocidos y citados del mundo, especializado en fraude científico; el Prof. Sucharit Bhakdi y el Dr. Wolfgang Wodarg. Después de haber sido difamado, incluyendo presuntas amenazas a políticos y mi familia, por parte de un particular muy conocido por mí, fui brutalmente arrestado por una unidad antiterrorista en mi consulta y, después de que inmediatamente resultó que no había amenazado a nadie, simplemente la visión del mundo de gente enferma, fui enviado a un pabellón psiquiátrico cerrado durante seis días debido a ‘ponerme en peligro mientras estaba en la locura COVID’.

Los gobiernos de casi todos los países parecen haber olvidado sus planes epidémicos, que sabiamente preservan a los individuos, la sociedad y la economía. En obediencia ciega a la OMS y a los grupos de presión, llamados expertos, están implementando intervenciones no farmacológicas autodestructivas, incluidos bloqueos nunca antes considerados, siguiendo el modelo autoritario chino. Lo están haciendo casi a nivel mundial, al mismo tiempo.

Sin consultar a la población, obtienen miles de millones de dosis de inyecciones de ARNm y ADN de emergencia, que incluso son aprobadas temporalmente por Swissmedic. Esta tecnología se está utilizando ampliamente en humanos por primera vez. Casi en todo el mundo, la constitución, el estado de derecho, los derechos humanos, las libertades civiles, la ética, la cientificidad y el sentido común están siendo sacrificados a favor de un régimen autoritario cuasi global bajo el control de la OMS: ¡Quién controla a la OMS, controla mundo!

Todos los elementos de la narrativa corona predominante se inventan a partir del vacío libre de hechos

1. El SARS-CoV-2 no surgió en Wuhan en diciembre de 2019. Primero, en noviembre de 2020, un estudio de Milán mostró que el SARS-CoV-2 era endémico en Italia ya en septiembre de 2019, antes de la temporada de gripe 2019/20. Otros estudios mostraron lo mismo más tarde, por ejemplo en Francia.

2. No hay una epidemia de SARS-CoV-2 de alcance nacional, por lo tanto, no hay una pandemia. Esto ya es evidente por la falta de exceso de mortalidad cuando se corrige por demografía, y por la baja ocupación de las unidades de cuidados intensivos, cuyas capacidades, además, se han reducido enormemente desde abril de 2020.

3. La indicación para realizar pruebas, es decir, no solo en pacientes hospitalizados críticamente enfermos con necesidad de una terapia antiviral específica, en el sistema de vigilancia y en una cohorte de estudio, sino también para realizar pruebas incluso asintomáticas, antes llamadas personas sanas y, además de eso, es incorrecto realizar una prueba para uno solo de todos los virus respiratorios que deben considerarse en el diagnóstico diferencial de las infecciones respiratorias .

4. La prueba Drosten RT-PCR no es diagnóstica de una infección por SARS-CoV-2 ni de una enfermedad o muerte por COVID-19. El 27 de noviembre de 2020, un grupo internacional de 22 científicos de la vida, incluyéndome a mí, publicó una “Revisión externa por pares del documento Corman-Drosten”.

Explicamos que existen conflictos de interés, que la supuesta revisión por pares dentro de las 24 horas es absurda, y diez fallas científicas fundamentales. Esta publicación médica más importante de 2020, que difícilmente puede ser superada en términos de falta de cientificidad, nunca debería haberse publicado.

El protocolo de prueba Corman-Drosten RT-PCR se fabrica de manera deficiente y vaga, sin validación ni estandarización. Como resultado de la reacción cruzada con otros coronavirus, su especificidad de aproximadamente el 98,6%, y un corresaondiente umbral de 1,4% de falsos positivos, que ya es bajo en ausencia de virus, se reduce aún más hasta el 92,4%, correspondiente a un 7,6% de falsos positivos, durante la temporada de gripe. En todas partes, la prueba se realiza de manera diferente y con umbrales de ciclo demasiado altos. Aunque los estudios han demostrado que no hay virus cultivables presentes en muestras con un valor de Ct superior a 28, las pruebas aún se llevan a cabo con valores de umbral de ciclo superiores a 35. Sus resultados se informan en todo el mundo sin hacer referencia a los síntomas clínicos.

5. Los síntomas, hallazgos clínicos de laboratorio y radiológicos del COVID-19 no se pueden distinguir claramente de las enfermedades causadas por otros virus respiratorios.

6. No hay transmisión asintomática epidemiológicamente relevante de virus respiratorios. Mientras tanto, lo que aprendimos en la escuela de medicina también ha sido confirmado para el SARS-CoV-2 por numerosos estudios. El ‘contacto asintomático’ inventado por el profesor Drosten en la carta al editor del 30 de enero de 2020 fue muy sintomático: la paciente había suprimido sus síntomas con medicación.

Por lo tanto, todas las intervenciones no farmacológicas para personas asintomáticas, antes llamadas sanas, más allá de las medidas efectivas comprobadas para contener la propagación del SARS-CoV-2, la higiene y el autoaislamiento de las personas enfermas, son ineficaces.

7. La alta tasa de letalidad (CFR) del 2%, citada durante mucho tiempo, era engañosa. Todo estudiante de escuela primaria sabe que no es el CFR lo que es relevante, sino la tasa de letalidad por infección (IFR), que fácilmente puede reducirse en un factor de aproximadamente cien debido al número de casos no detectados.

8. La afirmación inicial de que el 5% de las personas infectadas necesitaría un tratamiento de cuidados intensivos fue incorrecta , por las mismas razones que todo estudiante de primaria comprende. Condujo a la adquisición de alrededor de 1.000 ventiladores y al aplazamiento de operaciones que no eran de emergencia pero que eran necesarias.

9. El SARS-CoV-2 no es un asesino en masa. La estimación realista más reciente del IFR global es del 0,15%, por debajo del 0,05% para los menores de 70 años. Después de reemplazar el número de fallecidos en 28 días con una prueba de PCR positiva por cualquier causa por el número de fallecidos por COVID-19, es incluso mucho menor, muy por debajo del de la influenza estacional.

10. Una epidemia no se propaga exponencialmente, sino según una función logística o de Gompertz.

11. Debido a la inmunidad básica y cruzada, solo alrededor del 10-20% de las personas contraen los virus de la corona y la influenza estacionales durante cada temporada de influenza. Es probable que exista inmunidad colectiva desde el final de la temporada Corona-19, en nuestras latitudes medias del norte en abril de 2020. Por lo tanto, una ‘enésima ola de un virus respiratorio’ también es una imposibilidad biológica.

12. Existe una profilaxis eficaz: por ejemplo, estilo de vida saludable, muchos contactos sociales y vitamina D3.

13. Existe una terapia eficaz, bien tolerada y de bajo costo: por ejemplo, budesonida tópica, dosis normales de hidroxicloroquina e ivermectina.

14. Las inyecciones experimentales seriadas de ARNm y ADN son innecesarias (IFR 0.15%; para menores de 70 años menor del 0.05%, incluso mucho menor después de reemplazar el número de fallecidos por cualquier causa dentro de los 28 días con una prueba de PCR positiva por el número de fallecidos de COVID-19, además SARS-CoV-2 está mutando permanentemente y en el sentido de que se vuelve más infeccioso y menos peligroso), ineficaces (según los estudios de registro , que no valen el papel en el que están escritos, las inyecciones de ARNm reducen el riesgo de enfermedad leve COVID-19 absolutamente (!) en <1%, no hay datos para cursos severos y en > 75 años), e inseguras (reacciones anafilácticas, tromboembolismo, trombocitopenia, CID y miocarditis a corto plazo, posible ADE a mediano plazo, posibles enfermedades autoinmunes, cáncer y otras a mediano-largo plazo).

¡El SARS-CoV-2 no es un extraterrestre! Es un miembro recién descubierto de la conocida familia de coronavirus beta. Por lo tanto, evidentemente ocurre estacionalmente de noviembre a abril y muta, sin intervención humana, de tal manera que se vuelve cada vez más contagioso pero menos peligroso. Debido a la inmunidad básica y cruzada existente, solo una fracción de la población se enferma. La enfermedad suele ser autolimitada y deja inmunidad, posiblemente de por vida, y mejor que la mejor vacuna que haya existido. En comparación, mata a pocas personas y, a diferencia de la influenza, a ningún niño.

Toda la narrativa de la corona predominante es una tontería. Justifica la locura inhumana y anticientífica que domina a nivel mundial. Esto se puede ocurrir con cualquier virus respiratorio: si dejamos de hacer pruebas a todas las personas con una prueba RT-PCR hipersensible y poco específica que reacciona de forma cruzada con otros virus por homología con un fragmento de ARN del SARS-CoV-2, y las hacemos para uno de, por ejemplo, la gripe o el metapneumovirus, inmediatamente tendremos una pandemia de pruebas de gripe o metapneumo.

Por cierto, todos los estudiantes de medicina de segundo año deben estudiar los conceptos básicos de epidemiología. Allí se aprende que cuando se declara una epidemia de alcance nacional, se debe conformar inmediatamente una cohorte de estudio representativa de la población. Se utiliza para controlar el número de casos, la gravedad de la enfermedad y el estado de inmunidad, en este caso determinando los anticuerpos y la inmunidad de las células T.

Aunque ha pasado más de un año desde que la OMS declaró la pandemia de COVID, no existe una cohorte de vigilancia tan representativa. Peor aún: de la semana 13 a la 44, la BAG también había detenido el sistema de vigilancia, completando así el vuelo ciego total.

La epidemia es en gran parte una epidemia de pruebas de PCR irreal, pero las medidas opresivas que ha producido son reales; amenazan nuestra libertad, nuestros medios de subsistencia e incluso nuestras vidas.

¡Estimados compañeros responsables!

Recuerden el juramento hipocrático (“Primero, no hagas daño, para evitar la tercera cura”) y la Declaración de Ginebra de la Asociación Médica Mundial:

No utilizaré mis conocimientos médicos para violar los derechos humanos y las libertades civiles, incluso bajo amenaza.

¡Queridos compañeros humanos responsables!

Despertad, poneos en pie y luchad, pacíficamente pero con firmeza; si no es por ti mismo, ¡por el futuro de Tus hijos y el de sus nietos!

https://www.thomasbinder.ch/post/la-narrativa-sin-sentido-predominante-de-corona-desacreditada-en-10-o-26-minutos

Esto hace saltar por los aires la estafa del Covid. Se acabó.

No creo que sea por dinero, en esto del Covid-19 hay algo más. Es la vacuna, o más bien, la vacunación ¿Qué hay en la vacuna? Lo que ellos quieran y cuando quieran. Pero antes de llegar a esta conclusión, lean.

Todas las patentes, todos los criminales, todas las empresas, y citas como esta: “La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: “necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso”.

Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC

https://www.bitchute.com/embed/GmcSTZv5FuPM/ (En inglés y alemán)

Ponentes:

Reiner Fuellmich, Dr. David Martin, Prof. Martin Schwab, Dr. Wolfgang Wodarg, Viviane Fischer

Reiner Fuellmich  00:09

Así que creo que es mejor si te presentas. Sé que eres el presidente de M-CAM International Innovation Risk Management, pero eso no le dice a mucha gente lo que realmente estás haciendo?

Dr David Martin  00:25

Sí, bueno, desde un punto de vista corporativo, desde 1998, hemos sido el mayor suscriptor del mundo de activos intangibles utilizados en finanzas en 168 países. Así que en la mayoría de los países de todo el mundo, nuestros sistemas de suscripción, que incluyen todo el corpus de todas las patentes, solicitudes de patentes, subvenciones federales, registros de adquisiciones, registros de gobierno electrónico, etc. Tenemos la capacidad no solo de rastrear lo que está sucediendo y quién está involucrado en lo que está sucediendo, sino que monitoreamos una serie de intereses temáticos para una variedad de organizaciones e individuos, así como para nuestro propio uso comercial, porque como probablemente sepa, mantenemos tres índices de renta variable global, que son los índices de renta variable de gran capitalización y mediana capitalización de mejor rendimiento en todo el mundo. Así que nuestro negocio es monitorear la innovación que está sucediendo en todo el mundo y específicamente monitorear la economía de esa innovación, el grado en que, ya saben, los intereses financieros están siendo atendidos, ya saben, los intereses corporativos están siendo dislocados, etc. Por lo tanto, nuestro negocio es el negocio de la innovación y sus finanzas.

Reiner Fuellmich  02:03

Reiner traduce. Bueno, lo conseguí. Sí.

Dr David Martin  02:53

Así que, obviamente desde el punto de vista de esta presentación, como saben, hemos revisado las más de 4000 patentes que se han emitido en torno al Coronavirus del SARS. Y hemos hecho una revisión muy exhaustiva de la financiación de todas las manipulaciones del Coronavirus que dieron lugar al SARS como un subclado de la familia beta del Coronavirus. Así que lo que quería hacer era darles una visión general rápida de la línea de tiempo porque no vamos a pasar por 4000 patentes en esta conversación, pero les he enviado a ustedes y a su equipo, un documento que es excepcionalmente importante. Esto se hizo público en la primavera de 2020. Este documento que usted tiene y puede ser publicado en el registro público es bastante crítico en el sentido de que tomamos la secuencia genética reportada, que al parecer fue aislada como un nuevo Coronavirus, indicada como tal por el ICTV, el Comité Internacional de Taxonomía de Virus de la Organización Mundial de la Salud, tomamos las secuencias genéticas reales que supuestamente eran nuevas y revisamos las que estaban disponibles en comparación con los registros de patentes que estaban disponibles a partir de la primavera de 2020. Y lo que encontramos, como verán en este informe, son más de 120 pruebas patentadas que sugieren que la declaración de un nuevo Coronavirus fue en realidad una falacia. No hubo nuevo Coronavirus. Hay innumerables modificaciones muy sutiles de las secuencias de Coronavirus que se han subido, pero no hubo un solo nuevo Coronavirus identificado en absoluto. De hecho, encontramos registros en los registros de patentes de secuencias atribuidas a la novedad que iban a patentes que se solicitaron ya en 1999. Entonces, esto no solo no era una novela, sino que en realidad no solo no ha sido novela, sino que no ha sido novela durante más de dos décadas. Pero tomemos un paso muy corto, y lo que haré es llevarlos en un viaje muy corto a través del panorama de las patentes para asegurarme de que la gente entienda lo que sucedió. Pero como saben, hasta 1999, el tema de Coronavirus vs V [VSV?] la actividad de patentamiento en torno al Coronavirus se aplicaba de manera única a las ciencias veterinarias. La primera vacuna patentada para coronavirus fue buscada por Pfizer. La aplicación de la primera vacuna para coronavirus, que fue específicamente esta proteína pico s. Así que exactamente lo mismo que supuestamente nos hemos apresurado a la invención. La primera solicitud se presentó el 28 de enero de 2000, hace 21 años. Así que la idea de que misteriosamente tropezamos en la forma de intervenir en las vacunas no solo es ridícula, es incrédula porque Timothy Millor, Sharon Klepfer, Albert Paul Reed y Elaine Jones el 28 de enero de 2000, presentaron lo que finalmente se emitió como la patente estadounidense 6372224, que era el virus de la proteína spike, una vacuna para el Coronavirus canino, que en realidad es una de las múltiples formas de Coronavirus. Pero como dije, el trabajo inicial hasta 1999 se centró en gran medida en el área de las vacunas para animales, los dos animales que recibieron la mayor atención fueron probablemente el trabajo de Ralph Barics sobre los conejos y la miocardiopatía del conejo que se asoció con problemas significativos entre los criadores de conejos, y luego el Coronavirus canino en el trabajo de Pfizer para identificar cómo desarrollar candidatos a diana de vacunas de proteína s y spike, dando lugar a la evidencia obvia que dice que ni el concepto de Coronavirus de una vacuna, ni el principio del Coronavirus en sí como un patógeno de interés con respecto al comportamiento de las proteínas spike es nada nuevo en absoluto. De hecho, tiene 22 años, según las solicitudes de patente. Lo que es más problemático, y lo que en realidad es el problema más atroz es que Anthony Fauci y el NIAID encontraron que la maleabilidad del Coronavirus era un candidato potencial para las vacunas contra el VIH. Así que el SARS en realidad no es una progresión natural de una modificación zoonética del Coronavirus. De hecho, muy específicamente en 1999 Anthony Fauci financió una investigación en la Universidad de Carolina del Norte Chapel Hill, específicamente para crear, y no puedes evitar, ya sabes, lamentar lo que estoy a punto de leer porque esto viene directamente de una solicitud de patente presentada el 19 de abril de 2002. Y ustedes escucharon correctamente la fecha de 2002 en la que el NIAID construyó una replicación infecciosa defectuosa del Coronavirus que estaba específicamente dirigida al epitelio pulmonar humano. En otras palabras, fabricamos el SRAS y lo patentamos el 19 de abril de 2002, antes de que se hubiera producido ningún supuesto brote en Asia, que, como saben, le siguió varios meses. Esa patente emitida es la patente estadounidense 7279327. Esa patente establece claramente en una secuenciación genética muy específica, el hecho de que sabíamos que el receptor ACE, el dominio de unión a ACE2, la proteína espiga s1 y otros elementos de lo que hemos llegado a conocer como este patógeno azote no solo se diseñó, sino que podría modificarse sintéticamente en el laboratorio, utilizando nada más que tecnologías de secuenciación de genes, tomando código informático y convirtiéndolo en un patógeno o un intermediario del patógeno. Y esa tecnología se financió exclusivamente en los primeros días como un medio por el cual podríamos aprovechar el Coronavirus como un vector para distribuir la vacuna contra el VIH. Les dejé traducir eso porque eso es mucho material.

Reiner Fuellmich  11:30

Bien. Reiner traduce. Bien.

Reiner Fuellmich  15:32

(inaudible) Sequoia Pharmaceuticals.

Dr David Martin  15:32

Bien. Así que la cosa empeora. Se nos pidió a mi organización que vigilara las violaciones de los tratados sobre armas biológicas y químicas en los primeros días del año 2000. Recordarán los eventos de ántrax en septiembre de 2001. Y fuimos parte de una investigación que dio lugar a la investigación del Congreso no solo sobre los orígenes del ántrax, sino también sobre lo que era un comportamiento inusual en torno al medicamento de ciprofloxacina Bayers, que era un medicamento utilizado como tratamiento potencial para el envenenamiento por ántrax. Y a lo largo del otoño de 2001, comenzamos a monitorear una enorme cantidad de patógenos bacterianos y virales que estaban siendo patentados a través de los NIH, NIAID, US AMRIID, el Programa de Enfermedades Infecciosas de las Fuerzas Armadas de los Estados Unidos y una serie de otras agencias internacionales que colaboraron con ellos. Y nuestra preocupación era que el Coronavirus estaba siendo visto no solo como un potencial agente manipulable para su uso potencial como vector de vacuna, sino que también estaba siendo considerado muy claramente como un candidato a arma biológica. Así que nuestro primer informe público sobre esto tuvo lugar antes del brote de SRAS en la última parte de 2001. Así que pueden imaginarse lo decepcionado que estoy de estar sentado aquí 20 años después de haber señalado 20 años antes que había un problema que se avecinaba en el horizonte con respecto al Coronavirus. Pero después del supuesto brote y siempre diré supuesto brote porque creo que es importante que entendamos que el Coronavirus como patógeno circulante dentro del modelo viral que tenemos en realidad no es nuevo en la condición humana y no es nuevo en las últimas dos décadas. En realidad ha sido parte de la secuencia de proteínas que circula durante mucho tiempo. Sin embargo, el supuesto brote que tuvo lugar en China en 2002, hasta 2003, dio lugar a una presentación muy problemática en abril de 2003 por parte del Centro para el Control y la Prevención de Enfermedades de los Estados Unidos. Y este tema es de importancia crítica para obtener el matiz muy preciso, porque además de archivar toda la secuencia genética en lo que se convirtió en coronavirus SARS, que en realidad es una violación de 35 US Code Sección 101. No se puede patentar una sustancia natural. La violación de la Sección 101 del Código de los Estados Unidos 35 fue el número de patente 7220852. Ahora bien, esa patente también tenía una serie de patentes derivadas asociadas a ella, estas son nuestras solicitudes de patente que se separaron porque eran de múltiples materias patentables. Pero estos incluyen la patente de EE.UU. 46592703p, que en realidad es una designación muy interesante, patente de EE.UU. 7776521. Estas patentes no solo cubrían la secuencia genética del Coronavirus SARS, sino que también cubrían los medios para detectarlo mediante RT-PCR. Ahora, la razón por la que eso es un problema es que si ambos poseen la patente sobre el gen en sí, y poseen la patente sobre su detección, tienen una ventaja cortante para poder controlar el 100 por ciento de la procedencia no solo del virus en sí, sino también de su detección, lo que significa que tienen todo el control científico y de mensajes. Y esta patente solicitada por los CDC supuestamente fue justificada por su equipo de relaciones públicas como buscada para que todos fueran libres de poder investigar el Coronavirus. El único problema con esa afirmación es que es una mentira y la razón por la que es una mentira es porque la oficina de patentes no una sino dos veces rechazó la patente sobre la secuencia genética como no patentable porque la secuencia genética ya estaba en el dominio público. En otras palabras, antes de que los CDCs solicitaron una patente, la oficina de patentes encontró un 99.9 por ciento de identidad con el Coronavirus ya existente registrado en el dominio público, y sobre el rechazo del examinador de patentes. Y después de tener que pagar una multa de apelación en 2006 y 2007, los CDC anularon el rechazo de las oficinas de patentes de su patente y finalmente en 2007 obtuvieron la patente sobre el Coronavirus SARS. Ahora, cada declaración pública que los CDC han hecho que dijo que esto era de interés público es falsificable por su propio soborno pagado a la oficina de patentes. Esto no es algo que es sutil, y para empeorar las cosas que pagaron una tarifa adicional para mantener su solicitud privada. La última vez que lo comprobé, si está tratando de hacer que la información esté disponible para la investigación pública, no pagaría una tarifa para mantener la información privada. Me hubiera gustado haber inventada cualquier cosa que acabo de decir, pero todo eso está disponible en el registro del archivo público de patentes que cualquier miembro del público puede revisar. Y el PAR Público, como se le llama en la Oficina de Patentes de los Estados Unidos, no sólo tiene la evidencia, sino los documentos reales que tengo en mi poder. Ahora, esto es críticamente importante. Es de vital importancia porque los verificadores de hechos han declarado repetidamente que el nuevo Coronavirus, designado como SARS CoV 2, es de hecho distinto de la patente de los CDC. Y aquí está el problema genético y el problema de las patentes. Si nos fijamos en la secuencia de genes que es presentada por los CDC en 2003, de nuevo en 2005 y luego de nuevo en 2006, lo que se encuentra es la identidad en algún lugar entre el 89 y el 99 por ciento de las superposiciones de secuencias que se han identificado en lo que se llama el nuevo subclado de SARS CoV 2. Lo que sabemos es que la designación central de SARS Coronavirus, que en realidad es el clado de la familia de los betacoronavirus y el subclado que se ha llamado SARS CoV 2 tienen que superponerse desde un punto de vista taxonómico. No se puede tener la designación del SRAS en una cosa sin que primero sea el SRAS. Así que la verificación de hechos falsos que se ha hecho diciendo que de alguna manera u otro CDC no tiene nada que ver con esta patente en particular, o este patógeno en particular, está más allá de la credibilidad literal de las secuencias publicadas. Y también está más allá de la credulidad cuando se trata de la taxonomía de ICTV porque establece muy claramente que este es de hecho un subclado del clado llamado Coronavirus SARS. Ahora, lo importante es el 28 de abril, y escuchen la fecha con mucha atención porque esta fecha es problemática. Tres días después de que los CDC presentaron la patente sobre el Coronavirus sars en 2003. Tres días más tarde, Sequoia Pharmaceuticals, una compañía que se estableció en Maryland, Sequoia pharmaceuticals el 28 de abril de 2003, presentó una patente sobre agentes antivirales de tratamiento y control de infecciones por coronavirus. Los CDC presentaron tres días antes, y luego el tratamiento estuvo disponible tres días después. Ahora, solo mantenga ese pensamiento por un segundo.

Dr David Martin  25:26

Bueno, ahí lo tienes. Esa es una buena pregunta porque Sequoia Pharmaceuticals y, en última instancia, Ablynx Pharmaceuticals se convirtieron en las tenencias propietarias de Pfizer, Crucell y Johnson and Johnson.

Reiner Fuellmich  25:43

uau.

Dr David Martin  25:45

Así que hágase una pregunta simple. ¿Cómo se tendría una patente sobre un tratamiento para una cosa que se había inventado tres días antes?

Reiner Fuellmich  25:55

Sí.

Dr David Martin  25:57

La patente en cuestión, la patente del 28 de abril de 2003 7151163,emitida a Sequoia Pharmaceuticals tiene otro problema. El problema es que se emitió y publicó antes de que se permitiera la patente de los CDC sobre coronavirus. Por lo tanto, el grado en que la información podría haber sido conocida por cualquier medio que no sea información privilegiada entre esas partes es cero. No es físicamente posible patentar una cosa que trata una cosa que no había sido publicada, porque los CDC habían pagado para mantenerla en secreto. Esta, mis amigos es la definición de conspiración criminal extorsión y colusión. Esto no es una teoría. Esto es una prueba. No se puede tener información en el futuro en forma [para] un tratamiento para una cosa que no existía.

Reiner Fuellmich  27:16

Esto bien podría estallar en un caso Rico, en última instancia.

Dr David Martin  27:20

Es decir, es un caso Rico. No se puede explotar, es un caso de Rico. Y el patrón Rico, que se estableció en abril de 2003 para el primer Coronavirus, se jugó exactamente en el mismo horario cuando vemos que el SARS CoV 2 aparece cuando tenemos a Moderna recibiendo la secuencia de proteínas spike por teléfono del centro de investigación de vacunas del NIAID antes de la definición del nuevo subclado. ¿Cómo tratas una cosa antes de que realmente la tengas?

Reiner Fuellmich  28:04

Tengo que traducir esto, ¿no puedes inventar esto? Definitivamente no. Reiner traduce.

Reiner Fuellmich  33:22

Sí, bueno, va a empeorar aquí.

Reiner Fuellmich  33:22

Oh no, no puede empeorar.

Dr David Martin  33:24

Oh, lo hace. El 5 de junio de 2008, que es una fecha importante porque en realidad es alrededor de la época en que DARPA el Programa de Investigación Avanzada de Defensa en los Estados Unidos se hizo activamente un interés en coronavirus como un arma biológica. 5 de junio 2008 Ablynx, que como usted sabe ahora es parte de Sanofi, presentó una serie de patentes que se dirigieron específicamente a lo que nos han dicho es la característica novedosa del virus SARS CoV 2. Y escucharon lo que acabo de decir, este es el 5 de junio de 2008.

Reiner Fuellmich  34:09

¿Encontraron qué?

Dr David Martin  34:10

Específicamente se dirigieron a lo que se llamó el sitio de escisión poli básica para el SARS Cov, la nueva proteína spike y el dominio de unión al receptor ACE2 que supuestamente es nuevo para el SARS CoV 2, y todo eso fue patentado el 5 de junio de 2008. Y esas patentes en secuencia se emitieron entre el 24 de noviembre de 2015, que fue la patente estadounidense 9193780. De modo que uno saliera después del aumento de la moratoria de la función. Ese se produjo después del brote de MERS en Oriente Medio, pero lo que se encuentra es que luego, en 2016, 2017, 2019, se emitió una serie de patentes que cubren no solo las hebras de ARN, sino también los subcomponentes de las hebras genéticas, a Ablynx y Sanofi. Y luego tenemos a Crucell. Tenemos Rubius Therapeutics. Tenemos Children’s Medical Corporation. Tenemos muchos otros que incluyen la Universidad Ludwig Maximillans en Munchen, Protein Sciences Corporation, Dana-Farber Cancer Institute, La Universidad de Iowa, la Universidad de Hong Kong, el Centro Nacional chino del Genoma Humano en Shanghai, todos los que se identifican en las solicitudes de patente que van desde 2008 hasta 2017. Cada atributo que supuestamente fue publicado de forma única por la publicación de referencia única, el nuevo murciélago Coronavirus, revela inserciones naturales de la s1 s2 al sitio de escisión de la proteína spike y posibles tres orígenes recombinantes del virus SARS CoV 2, el artículo que se ha utilizado rutinariamente para identificar el nuevo virus. Desafortunadamente, si realmente tomas lo que informan como novedoso, encuentras 73 patentes emitidas entre 2008 y 2019, que tienen los elementos que supuestamente eran novedosos en el SARS CoV 2, específicamente en lo que se refiere al sitio de escisión poli básico basado en tu dominio de unión al receptor y la proteína spike. Así que los componentes clínicamente nuevos de lo clínicamente único, clínicamente contagioso, ¿saben a dónde voy con esto? Bien. No hubo brote de SRAS, porque habíamos diseñado todos los elementos de eso. Y en 2016, el documento que se financió durante la moratoria de ganancia de función, que decía que el Coronavirus del SARS estaba listo para la emergencia humana escrito nada menos que por Ralph Baric, no solo estaba listo para la emergencia humana, sino que fue patentado para la explotación comercial 73 veces.

Reiner Fuellmich  38:07

Ralph Baric, creo que vi un videoclip con él dando un discurso en el que le dijo explícitamente a la audiencia que se puede ganar mucho dinero con esto.

Dr David Martin  38:17

Sí se puede. Y ha hecho mucho dinero haciendo esto.

Reiner Fuellmich  38:22

oh.

Dr David Martin  38:25

Así que para aquellos que quieran vivir en la ilusión de que de una manera u otra ese es el final de la historia, prepárese para una decepción mayor porque alguien sabía algo en 2015 y 2016, lo que dio lugar a mi cita favorita de toda esta pandemia. Y por eso no estoy siendo lindo. Mi cita favorita de esta pandemia fue una declaración hecha en 2015 por Peter Daszak. La declaración que fue hecha por Peter Daszak en 2015 informó en la Publicación de Prensa de las Academias Nacionales, 12 de febrero de 2016. Y cito: “necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. Los inversores responderán si ven ganancias al final del proceso”. fin de la cita.

Viviane Fischer  39:47

Eso es bastante impactante, porque pensé que –

Reiner Fuellmich  39:49

Eso es realmente quiero decir, Peter Doshi, no era él el uno –

Dr David Martin 39:49

– déjame leer eso de nuevo, solo porque no sé si podría perderme en la traducción. Así que déjenme seguir adelante y leerlo lentamente. Sí, y como a los estadounidenses les encanta hacer cuando hablan a una audiencia multilingüe, tal vez debería decirlo más fuerte. No lo haré. “Necesitamos aumentar la comprensión pública de la necesidad de contramedidas médicas, como una vacuna pan-Coronavirus. Un factor clave son los medios de comunicación y la economía seguirá el bombo. Tenemos que utilizar ese bombo a nuestro favor para llegar a los problemas reales. los inversionistas responderán si ven ganancias al final del proceso”. Fin de la cita.

Reiner Fuellmich  40:45

– no no no Peter Daszak.

Viviane Fischer  40:46

Oh Daszak?

Dr David Martin  40:47

Peter Daszak el jefe de Eco Health Alliance?

Reiner Fuellmich  40:49

Peter Doshi es el bueno.

Viviane Fischer  40:51

Sí, yo era sólo –

Dr David Martin  40:52

– Peter Daszak la persona que estaba corroborando de forma independiente la teoría de la fuga china no de laboratorio porque no había una fuga de laboratorio. Esta fue una bio-militarización intencional de proteínas espiga para inyectar en las personas para que sean adictas a una vacuna pan-Coronavirus. Esto no tiene nada que ver con un patógeno que se liberó y cada estudio que se ha lanzado para tratar de verificar una fuga de laboratorio es una pista falsa.

Viviane Fischer  41:26

¿Y realmente no hay nada que sea nuevo en esto?

Dr David Martin 41:29

nada. cero. 73 patentes sobre todo lo clínicamente novedoso. 73, todos emitidos antes de 2019. Y les voy a dar la bomba más grande de todas para demostrar que esto en realidad no fue una liberación de nada porque la Patente 7279327, la patente sobre la naturaleza recombinante de ese pulmón dirigido al Coronavirus, fue transferida misteriosamente de la Universidad de Carolina del Norte, Chapel Hill a los Institutos Nacionales de Salud en 2018. Ahora, aquí está el problema con eso. Bajo la Ley Bayh-Dole, el gobierno de los Estados Unidos ya tiene lo que se llama una disposición de derecho de margen. Eso significa que si se paga al gobierno estadounidense por la investigación, tienen derecho a beneficiarse de esa investigación a petición suya o a su antojo. Así que explique por qué, en 2017 y 2018, de repente los Institutos Nacionales de Salud tienen que tomar posesión de la patente que ya tenían derechos sobre la Universidad de Carolina del Norte, Chapel Hill. ¿Y cómo tenían que presentar un Certificado de Corrección para asegurarse de que era legalmente ejecutable? Porque hubo un error tipográfico en la referencia de concesión en la primera presentación. Por lo tanto, necesitaban asegurarse de que no solo lo hacían bien, sino que también debían asegurarse de que cada tipo de error gráfico que figuraba en la patente fuera correcto. Sobre la patente única requerida para desarrollar el mandato del Instituto de Investigación de Vacunas, que fue compartido entre la Universidad de Carolina del Norte, Chapel Hill en noviembre de 2019 y Moderna en noviembre de 2019 cuando UNC Chapel Hill, NIAID y Moderna comenzaron la secuenciación de una vacuna de proteína spike un mes antes de que ocurriera un brote.

Reiner Fuellmich  43:51

Tienes toda la evidencia, ¿verdad?

Dr David Martin  43:53

sí.

Reiner Fuellmich  43:55

Tendré que traducir esto. Así que todo es sobre dinero.

Dr David Martin 49:25

Siempre ha sido cuestión de dinero, y sólo para responder a una pregunta que se ha formulado un poco antes. El guion de esto fue escrito el 6 de enero de 2004.

Reiner Fuellmich  49:39

¿6 de enero de 2004? ¿Quién escribió el guion?

Dr David Martin  49:42

Merck, en una conferencia llamada SARS y bioterrorismo, bioterrorismo enfermedades infecciosas emergentes, antimicrobianos, terapéutica y moduladores inmunológicos. Merck introdujo la noción de lo que llamaron la nueva normalidad. Propio sustantivo de la nueva normalidad, que es el lenguaje que se convirtió en la campaña de marca que fue adoptada por la Organización Mundial de la Salud, la Junta de Monitoreo de la Preparación Global, que fue la junta en la que se sentaron juntos el Director del Centro para el Control de Enfermedades de China, el Dr. Elias de Bill Gates, de la Fundación Gates, y Anthony Fauci en esa junta directiva. Pero la primera introducción de la campaña de la nueva normalidad, que trataba de hacer que la gente aceptara una vacuna universal contra el pan-coronavirus, en realidad se adoptó el 6 de enero de 2004. Así que ha existido bastante tiempo. No voy a decir muchos más puntos, aparte de decir que estaba muy claro que Merck lo sabía, lamento que Moderna supiera que se iba a poner al frente de la línea con respecto al desarrollo de una vacuna en marzo de 2019. Y esta es una fecha muy importante, porque en marzo de 2019, por razones que no son transparentes, de repente modificaron una serie de solicitudes de patentes rechazadas, lo cual es un comportamiento muy extraño, pero modificaron una serie de solicitudes de patentes para hacer referencia específicamente a una liberación intencional o accidental, lo siento, su término liberación intencional de Coronavirus. Así que en marzo, enmendaron cuatro solicitudes de patente fallidas para comenzar el proceso de desarrollo de una vacuna contra el Coronavirus. Y empezaron a lidiar con un problema muy importante que tenían, que era que dependían de tecnología que no poseían. Dos compañías canadienses Arbutus Pharmaceuticals y Acuitas Pharmaceuticals en realidad poseen la patente sobre la envoltura de nanopartículas lipídicas que se requiere para administrar la inyección del fragmento de ARNm. Y esas patentes se han emitido tanto en Canadá como en los Estados Unidos y luego en todo el mundo en su equivalencia mundial de propiedad intelectual. Moderna sabía que no poseía los derechos y comenzó a tratar de negociar con Arbutus y Acuitas para obtener la resolución de la tecnología patentada de nanopartículas lipídicas disponible para ser puesta en una vacuna. Y sabemos, como hice referencia antes, que en noviembre, firmaron un acuerdo de investigación y cooperación de investigación y desarrollo con UNC Chapel Hill con respecto a conseguir que la proteína espiga se pusiera dentro de la nanopartícula lipídica para que realmente tuvieran una vacuna candidata antes de que tuviéramos un patógeno, supuestamente que estaba corriendo alrededor. Lo que hace que esa historia sea más problemática más allá de la naturaleza evidente de la misma es que sabemos que desde 2016 hasta 2019, en cada una de las reuniones de la junta del Consejo Asesor del NIAID, Anthony Fauci lamentó el hecho de que no pudo encontrar una manera de hacer que la gente aceptara la vacuna universal contra la influenza, que es lo que era su objetivo favorito. , estaba tratando de que la población se involucrara en este proceso. Y lo que se hace muy evidente con Peter Daszak Eco Health Alliance, UNC Chapel Hill y otros, y luego más específicamente, en marzo de 2019, en las solicitudes de patentes enmendadas de Moderna, vemos que hay una epifanía que dice: ¿Qué pasaría si hubiera una liberación accidental o intencional de un patógeno respiratorio? Y lo que hace que esa frase en particular sea problemática es que se recita exactamente en el libro Un mundo en riesgo, que es el escenario que armó la Organización Mundial de la Salud en septiembre de 2019. Así que meses antes hay un supuesto patógeno, que dice que necesitamos tener una experiencia global coordinada de la liberación de un patógeno respiratorio, que para septiembre de 2020, debe poner en marcha una capacidad universal para la gestión de las relaciones públicas, el control de multitudes y la aceptación de un mandato de vacuna universal. Eso fue septiembre de 2019. Y el lenguaje de una liberación intencional de un patógeno respiratorio se escribió en el escenario que cita “debe estar terminado para septiembre de 2020”.

Dr. Wolfgang Wodarg 55:44

Este era un texto para la sra. Brundtland estaba al frente de esta comisión, ¿no es así?

Dr David Martin  55:50

Bueno, esta es la declaración unificada de las juntas de monitoreo de preparación global. Hay una serie de personas que han tomado crédito y luego se han alejado del crédito por ello, pero sí, tienes razón.

Dr Wolfgang Wodarg  56:00

¿Estoy en lo cierto también cuando digo que también el receptor ACE2 que ya estaba descrito en las patentes antes de 2019?

Dr David Martin  56:11

Sí, tenemos 117 patentes con el mecanismo de focalización del receptor ACE2 específicamente para el Coronavirus SARS.

Dr Wolfgang Wodarg  56:20

Porque siempre dicen que esto es lo nuevo con el virus.

Dr David Martin  56:24

Ahora, no es nuevo, y no ha sido ni remotamente nuevo. Está en publicaciones que se remontan a 2008. En las conferencias sobre emplazamiento de armas que tuvieron lugar en Eslovenia, en Europa, en toda Europa y en toda la infraestructura de DARPA. Lo sabemos desde 2013. Es aislamiento y amplificación.

Viviane Fischer  56:49

Y esta, la enmienda que Merck hizo a esto, [donde] rechazaron las solicitudes de patente, entonces, ¿fue solo por el hecho de que es como deliberadamente, ya saben, como, poner en el medio ambiente o algo así, o agregaron algo más?

Dr David Martin  57:05

Pues bien, se trata de cuatro solicitudes de patente fallidas que se revitalizaron esencialmente en marzo de 2019. Y fue Moderna, me equivoco. Hablé de Merck, era Moderna, y traté de corregir que lamento que eso no salió adelante. Pero son las solicitudes de patente de Moderna las que fueron modificadas en marzo de 2019 para incluir la liberación intencional de un lenguaje de patógeno respiratorio.

Viviane Fischer  57:35

Si eso no hubiera sido rechazado por alguna razón, simplemente no estarían sentados allí básicamente.

Dr David Martin  57:41

No, hacen procesos similares a otras compañías farmacéuticas, donde se utilizan de hoja perenne y modifican continuamente las aplicaciones para disfrutar de las primeras fechas de prioridad disponibles. Pero es por eso que tienes que volver atrás y mirar la enmienda de los registros de solicitud para averiguar cuándo se puso en marcha el lenguaje de enmienda real. Pero sí, quiero decir, el hecho del asunto es, y como dije, no voy a ser belabour todos los datos de patentes, pero cualquier afirmación de que este patógeno es de alguna manera único o novedoso se desmorona en las secuencias de genes reales, que se publican en el registro de patentes, y luego más atrozmente se desmorona en el hecho de que tenemos Peter Daszak mismo afirmando que tenemos que crear publicidad pública para obtener el público para aceptar la contramedida médica de una vacuna pan-Coronavirus. Y lo que hace que eso sea más ridículo es el hecho de que, como sabemos, la Organización Mundial de la Salud había declarado el Coronavirus, ya saben, una especie de interés muerto. Es decir, dijeron que habíamos erradicado el Coronavirus como una preocupación. Entonces, ¿por qué haberlo erradicado en 2007 y 2008? ¿Por qué empezamos a gastar miles de millones de dólares a nivel mundial en una vacuna para una cosa que había sido erradicada por declaración en 2008? Ya saben, como que cae en la zona de la incredulidad, por decir lo menos.

Reiner Fuellmich  59:23

¿No significa eso también si se toma la totalidad de la evidencia, entonces esta es una herramienta el Coronavirus y las vacunas, esta es una herramienta, y el interés de DARPA en crear un arma biológica a partir de esto, esta es una herramienta para todo lo demás que se aferra a esto, incluido el control de la población, por ejemplo?

Dr David Martin  59:50

Bueno, escuchen, tenemos que dejar de caer incluso en la narrativa convencional en nuestra propia línea de cuestionamiento porque el hecho es que esto fue visto como una fuente biológica altamente maleable. No cabe duda de que en 2005 era, sin lugar a dudas, un arma preferida. Y la ilusión de que desafortunadamente seguimos viendo a personas muy bien intencionadas que quedan atrapadas en conversaciones sobre si estamos teniendo una vacuna para un virus. El hecho es que no lo estamos, estamos inyectando una secuencia de ARNm de proteína spike, que es una simulación por computadora, no se deriva de la naturaleza. Es una simulación por ordenador de una secuencia que se conoce y patenta desde hace años. Y lo que sabemos es que esa secuencia, como se informó, se informa a través de cosas como ustedes saben, las conversaciones telefónicas muy confiables que tuvieron lugar entre Moderna y el centro de investigación de vacunas por autoinforme, donde no sé si usted estaba en una llamada telefónica y escuchó ATTCCGGTTCCGABBB, ya sabes, ¿hay alguna posibilidad de que puedas obtener una carta de valor una consonante caída aquí o allá? La naturaleza ridícula de la historia de que esto es de alguna manera profiltivo o preventivo va en contra del 100 por ciento de la evidencia, porque la evidencia deja muy claro que no ha habido ningún esfuerzo por parte de ninguna compañía farmacéutica para combatir el virus. Se trata de conseguir que las personas se inyecten con la proteína espiga s1 que se sabe que es dañina. Así que la historia de portada es que si obtienes una expresión de una proteína espiga, vas a tener algún tipo de alivio sintomático general. Pero el hecho es que nunca ha habido una intención de vacunar a una población como la define el universo de vacunación. Y es importante, quiero decir, repasemos solo para que conste, cuando Anthony Fauci intentó desesperadamente que se publicaran algunas de sus citas, “vacunas de ARN sintético”, la oficina de patentes le rechazó sus propias patentes. Y quiero leer lo que le dijo la oficina de patentes. Cuando el propio Anthony Fauci del NIAID pensó que podía obtener una vacuna similar al ARNm patentada como vacuna. Y aquí está la cita, “estos argumentos son persuasivos en la medida en que un péptido antigénico estimula una respuesta inmune que puede producir anticuerpos que se unen a un péptido o proteína específica, pero no es persuasivo en lo que respecta a una vacuna”. Bien, esta es la oficina de patentes. No se trata de una especie de agencia de salud pública. Esta es la oficina de patentes. “La respuesta inmune producida por una vacuna debe ser algo más que una simple respuesta inmune, sino que también debe ser protectora. Como se señaló en la acción anterior de la Oficina, el arte reconoce que el término vacuna es un compuesto que previene la infección. El solicitante no ha demostrado que la vacuna reclamada instantáneamente cumpla ni siquiera con el estándar más bajo establecido en la especificación, y mucho menos con la definición estándar para ser operativa. En lo que respecta, por lo tanto, las reivindicaciones cinco, siete y nueve no están operativas, ya que la vacuna contra el VIH, que es en lo que estaba trabajando, no es una utilidad patentable”. Así que el propio Anthony Fauci fue informado por la oficina de patentes, que lo que estaba proponiendo como una vacuna no cumple con el estándar patentable, el estándar legal o el estándar clínico.

Prof. Martin Schwab 1:04:10

Oh, ¿podemos traducir esto para nuestra audiencia? Esto podría ser muy importante.

Reiner Fuellmich  1:04:20

Por cierto, David, ese es nuestro amigo, Martin Schwab, el profesor Martin Schwab de, es nuestro asesor legal más importante de la Universidad de Bielefeld.

Dr. David Martin 1:04:34

Oh, cierto.

Reiner Fuellmich  1:04:36

Es muy inteligente. Lo sé, David sé que muchos de nuestros espectadores están realmente sorprendidos. Lo veo en las respuestas. Uno de nuestros espectadores es nuestro especialista en pruebas PCR, el profesor Kemera. Ella no puede creer lo que está pasando aquí.

Dr David Martin  1:09:51

Bueno, la triste y sobria ironía es que planteé estas cuestiones a partir de 2002, después del susto del ántrax, y la tragedia es que ahora estamos sentados en un mundo donde tenemos cientos de millones de personas a las que se les está inyectando una secuencia informática estimulante de patógenos, que se está vendiendo bajo lo que la oficina de patentes , lo que la profesión médica, y lo que la FDA y sus propias normas clínicas no sugerirían es una vacuna, pero al usar el término en realidad ahora estamos sometiendo a cientos de millones de personas a lo que se sabía que era en 2005 un arma biológica.

Reiner Fuellmich  1:10:54

Reiner traduce.

Dr David Martin  1:11:44

Así que obviamente tengo cientos de horas de estas cosas comprometidas con la memoria porque lo he estado haciendo durante dos décadas. Pero si tiene alguna pregunta, estaré encantado de responderlas.

Reiner Fuellmich  1:11:55

Estoy seguro de que va a haber cientos de preguntas, David. Vamos a estar en contacto. Creo que vas a ser inundado por la gente, por los correos electrónicos de la gente, etc. Solo voy a adelantar lo que entra o vamos a presentar lo que entra, pero creo que, oh, sí, tenemos un Martin Schwab, probablemente tiene una pregunta muy seria.

Prof Martin Schwab  1:12:16

Y después de mí Wolfgang también. Bien. Soy profesor de derecho en la Facultad de Derecho aquí en Bieldfeld, tengo que decirles que las Unidades de Protección Constitucional del Ministerio del Interior ahora observan la llamada escena negacionista de Corona. La negación de corona es todo aquel que se atreve a no estar de acuerdo con el –

Reiner Fuellmich  1:12:54

– con la línea oficial –

Prof Martin Schwab  1:12:55

– con la línea oficial. Sí. Ahora. Si esta Unidad de Protección Constitucional toma nota de que participe en una discusión de que esta pandemia se puso en escena intencionalmente, probablemente intentarán despedirme de mi trabajo. Así que al menos tengo que hacer algunas preguntas. Mientras te oía hablar, eché un vistazo al número de patente, oh, cuál era, 7220852 7151163. Y 7220852 se presentó el 12 de abril y 715 y así sucesivamente se presentó el 28 de abril de 2004. Veo una diferencia entre 16, no 3 días, ¿qué entendí mal?

Dr David Martin  1:14:03

No. ¿El 23 de abril de 2003 fue la fecha de presentación maestra de los CDC?

Prof Martin Schwab  1:14:09

Bien. Bien. Hice esta pregunta porque si tratan de hacerme bajar por mi trabajo, tengo que proporcionar pruebas sólidas.

Dr David Martin  1:14:22

Ahora tenemos todo esto enviado a, sé que el Dr. Fuellmich tiene todo el registro en el expediente fauci. El 100 por ciento de este registro está ahí. El apéndice adicional que envié a través de todos tiene los registros allí incluyendo todas las fechas de presentación de prioridad, así como la fecha de emisión. Así que el 100 por ciento de esto está en registros escritos publicados y ustedes tienen los registros escritos.

Prof Martin Schwab  1:14:26

Bien.

Reiner Fuellmich  1:14:28

He creado mi propio archivo, y está etiquetado como David Martin.

Prof Martin Schwab  1:15:00

Bueno, hay, hice [un] análisis de los informes de los medios aquí, y puedo confirmar que dan una cuenta muy unilateral sobre la pandemia. Todos los que se atreven a declarar que la amenaza es menos peligrosa que el gobierno serán denunciados como teóricos de la conspiración, pecaminosos, etc. Así que los medios de comunicación hicieron exactamente lo que usted señaló en la frase que repitió dos veces antes de ahora. En realidad, nos cuentan la historia de la variante Delta, que se dice que es mucho más contagiosa que todo lo demás. Los expertos con los que he hablado me dijeron que las bases de datos contienen hasta más o 40.000 cepas de virus.

Dr David Martin  1:16:01

correcto.

Prof Martin Schwab  1:16:02

Entonces, ¿podría esta variante delta ser algún tipo de bombo mediático del que nos hablaste antes?

Dr David Martin  1:16:12

No existe tal cosa como una alfa o una beta o una gamma o una variante delta. Este es un medio por el cual lo que se busca desesperadamente es un grado en el que los individuos puedan ser coaccionados para que acepten algo que de otra manera no aceptarían. No ha habido en ninguno de los estudios publicados sobre lo que se ha reportado la variante Delta, no ha habido una población no se calculan, que es la tasa de replicación real. Lo que se ha estimado son simulaciones por ordenador. Pero desafortunadamente, si nos fijamos en GISAID, que es la fuente pública de subir cualquiera de una serie de variaciones, lo que encontrarán es que no ha habido capacidad para identificar ninguna secuencia de genes clínicamente alterada, que luego tiene una variación clínicamente expresada. Y este es el problema desde el principio. Este es el problema que se remonta al comienzo de lo que se alega que es una pandemia, es que no tenemos ninguna evidencia de que la alteración de la secuencia genética tuviera importancia clínica alguna. No ha habido un solo artículo publicado por nadie que realmente haya establecido que cualquier cosa novedosa desde noviembre de 2019, tiene distinción clínica de cualquier cosa que sea anterior a noviembre de 2019. El problema con las 73 patentes que describí es que esas 73 patentes contienen lo que se informó que era novedoso en diciembre de 2019 y 2020, respectivamente. Así que el problema es que incluso si aceptáramos que hay neumonías idiopáticas, incluso si aceptáramos que hay algún conjunto de síntomas inducidos por patógenos, no tenemos una sola evidencia publicada que nos diga que cualquier cosa sobre el subclado SARS CoV 2 tiene distinción clínica de todo lo que se sabía y se publicó antes de noviembre de 2019 en 73 patentes que datan de 2008.

Viviane Fischer  1:18:56

¿Podría ser que la variante Delta es que solo las diferencias, saben que los síntomas clínicos son los mismos, pero que tiene la capacidad de infectar a alguien que ya ha pasado por la variante B?

Dr David Martin  1:19:14

Bueno, aquí es donde vemos una enorme cantidad de respuesta y comportamiento reflexivo al bombo de los medios. No hay, y voy a repetir esto, no hay evidencia de que la variante Delta sea de alguna manera distinta de cualquier otra cosa en GISAID. El hecho de que ahora estemos buscando una cosa no significa que sea una cosa porque estemos viendo fragmentos de cosas. Y el hecho es que si elegimos cualquier fragmento que se me ocurrió, ya saben, podría llegar a la variante Omega mañana. Y podría llegar a la variante Omega y podría decir que estoy buscando esta subcatenía de ADN o ARN, o incluso una proteína. Y podía correr alrededor del mundo yendo, “oh, Dios mío, miedo a la variante Omega”.

Prof Martin Schwab  1:20:15

Sí.

Dr David Martin  1:20:16

Y el problema es que debido a la naturaleza de la forma en que actualmente secuenciamos genomas, que en realidad es un proceso de composición, es lo que llamamos en matemáticas y entrelazado. No tenemos ningún punto de referencia para saber realmente si lo que estamos viendo es, de hecho, distinto del sentido clínico o incluso genómico. Y entonces estamos atrapados en un mundo donde desafortunadamente, si van y miran como yo los papeles que aislaron la variante Delta, y en realidad hacen la pregunta, ¿es la variante Delta algo más que la selección de una secuencia en un cambio sistemático de una otra secuencia ya revelada? La respuesta es, es sólo una alteración, y cuando se inicia y se detiene lo que se llama el marco de lectura. No hay nada novedoso. Sí, bueno

Dr. Wolfgang Wodarg 1:21:20

El Dr. Wolfgang Wodarg traduce.

Reiner Fuellmich  1:28:41

David, voy a hacer una larga historia muy corta. Él está totalmente de acuerdo con su análisis. Él entiende tu angustia con respecto a que le hayas dicho al mundo sobre esto hace 20 años, casi. Y admira su tenacidad. Y está muy agradecido por haber tomado esta mirada tan de cerca al problema a través de la ley de patentes. El Dr. Wodarg cree que las patentes son realmente problemáticas, porque resulta que probablemente sea cinco veces más caro patentar medicamentos, en lugar de tener universidades públicas, no públicas, privadas, sino públicas, que obtengan los estipendios obteniendo el dinero que necesitan para desarrollar estas vacunas.

Dr David Martin  1:29:38

Sí, voy a hacer algo que es muy injusto, pero voy a mantener el documento muy cerca de la pantalla. Y es sólo para fines de representación. Pero quiero que vean que esta es la patente del cuartel que los NIH necesitaban haberles devuelto por razones misteriosas en 2018, esta es la 7279327. Y la gente puede buscar esto por su cuenta. Pero si realmente miras las secuencias que están patentadas, que es una de las cosas que hemos hecho, en realidad miramos las secuencias publicadas, y nos damos cuenta de que dependiendo de dónde recortes la cadena de secuencia real, tendrás lo mismo o tendrás una cosa diferente basada nada más que en dónde decidas analizar el clip. Y quiero leerles, quiero decir, esto es algo que viene directamente de su solicitud de patente. Cuando en realidad hablan de las hebras de ADN, que llaman números de identificación de secuencia. En realidad, dicen específicamente que el organismo es una secuencia artificial, una secuencia artificial, lo que significa que no es una secuencia que tiene una base de reglas en la naturaleza, no es algo que se manifestó para una proteína derivada natural en particular o una secuencia de ARNm derivada natural que se aisló, cada una de ellas es de hecho una secuencia sintética y artificial. Y si volvemos atrás y miramos cada una de ellas, lo que hemos hecho, lo que encontraremos es que las secuencias, de hecho, son contiguas, en muchos casos, pero se superponen en otras, donde es simplemente una determinación de Capricho que dice que algo es o no es parte de un marco de lectura abierto, o es o no es parte de una secuencia de oligonucleótidos en particular. Ahora, la razón por la que eso es importante es porque si vamos a examinar lo que finalmente se está inyectando en los individuos, necesitamos la secuencia exacta, no un tipo de similar a, necesitamos la secuencia exacta. Y si nos fijamos en el requisito de la FDA, y si nos fijamos en el entorno regulatorio europeo, y si nos fijamos en el resto del entorno regulatorio del mundo, por razones que no se pueden explicar, la secuencia exacta que ha entrado en lo que se amplifica dentro de la inyección parece ser esquiva, parece ser algo que alguien no puede, de hecho, afirmar con 100 por ciento de certeza, la secuencia es x. El problema que esto presenta es que en este momento, por mucho que se nos pueda decir que hay, ya saben, ensayos clínicos en curso, y hay todo tipo de otras cosas sucediendo, no tenemos forma de verificar que una secuencia completa ha sido, es, o potencialmente incluso podría ser fabricada en lo que en última instancia se convierte en la nanopartícula lipídica que es la frecuencia portadora en la que se administra la inyección. Y es importante que la gente entienda que ya en 2002, y a lo largo de las solicitudes de patentes de 2003, y luego las patentes de armamentización que comenzaron en 2008, en cada uno de estos casos, se identifican fragmentos, pero se identifican sin especificidad. Así que no tenemos extremos terminales directos de los fragmentos, tenemos fragmentos que tienen, ya saben, brechas esencialmente hipotéticas en las que se puede colocar cualquier cosa. Y esa es la razón por la que encuentro que la verificación de hechos en torno a la situación de las patentes es muy decepcionante. Debido a que la razón por la que los verificadores de hechos entre sus atributos perezosos generales, la razón por la que los verificadores de hechos no están verificando realmente los hechos cuando se trata de los asuntos de patentes es porque las secuencias reales no están representadas en una forma digital que facilita hacer esta comparación. Literalmente, tuvimos que tomar imágenes de papel mecanografiado enviado, y luego codificarlas para hacer nuestra propia evaluación. No se puede hacer esto en el sitio de patentes de la OEP. No se puede hacer esto con los datos de la OMPI de Ginebra. No se puede hacer esto con los datos de la Oficina de Patentes de los Estados Unidos. En realidad tienes que entrar y reconstruir las secuencias genéticas reales a mano y luego compararlas con lo que se ha subido a los servidores públicos y ahí es donde encuentras que la cuestión de la novedad es algo que no se abordó. Era una ilusión fabricada.

Dr Wolfgang Wodarg  1:35:03

Tengo una pregunta más. ¿Es posible que veamos que la gripe ha desaparecido? Ya no tenemos gripe. La gripe seguro que los virus también están secuenciados. Y es posible que esas secuencias de partes de las que ahora hablamos puedan existir en ambos tipos de virus, de modo que es solo una cuestión de pruebas y [una] cuestión de instrumentos para observar lo que encontramos, si encontramos influenza o si encontramos Corona. Si tenemos un cierto, si usted tiene un libro, usted tiene una palabra con cinco letras, y usted encontrará estas cinco letras en muchos libros,

Dr David Martin  1:35:49

¿Correcto? exactamente. Sí. Wolfgang, tu pregunta es una hermosa metáfora de exactamente el problema. El problema es que, si lo que estamos buscando es algo que hemos decidido que ha decidido que vale la pena buscar, entonces lo encontraremos. Y la buena noticia es que lo encontraremos [en] un montón de lugares. Y si hemos decidido que ya no estamos buscando nada, no es del todo sorprendente que no lo encontremos porque no lo estamos buscando. El hecho del asunto es si es las pruebas de PCR rt que decidimos que hay fragmentos, que por cierto, he mirado cada una de las presentaciones regulatorias, que se ha presentado a la FDA, para tratar de averiguar cuál era el estándar de oro para obtener la autorización de uso de emergencia. Y qué fragmento de SARS CoV 2 era oficialmente el fragmento oficial que era el estándar comparativo. Y el problema es que no se puede obtener un solo estándar. Así que la pregunta se convierte en, en un mundo donde no hay un estándar único, ¿qué es lo que realmente encuentras? Porque si estoy buscando y ¿por qué no acabo de leer esto? Si estoy buscando un CCACGCTTTG? ¿Agrego la siguiente hebra G o voy no, no, el siguiente bit es GTTTATTCG. Y entiendes el punto. El punto es que donde elijo comenzar y detenerme, puedo decir que lo encontré. No, no lo encontré.

Dr Wolfgang Wodarg  1:37:33

Sí.

Dr David Martin  1:37:35

Y no encontré la coincidencia que proyecté sobre los datos porque elegí mirar los datos de una manera que no pude encontrar la coincidencia. La gripe no abandonó a la población humana. La influenza fue un mandato fallido de una década de vacuna contra la influenza que fue promovido desesperadamente, desesperadamente por los gobiernos de todo el mundo, fracasaron y decidieron que si la influenza no cumple con la promesa pública de hacer que todos se inyecten, cambiemos el patógeno.

Dr Wolfgang Wodarg  1:38:19

Hay muchos más que pueden cambiar.

Dr David Martin  1:38:21

Oh, Dios mío, tenemos toneladas más por venir.

Reiner Fuellmich  1:38:24

Sí, pero ahora estamos en ellos.

Viviane Fischer  1:38:27

Me gustaría decirles algo sobre este desarrollo de la prueba PCR de drosten, ya saben, porque lo analizamos brevemente, no en la medida en que ahora miraron las patentes que acaban de describir, sino que observamos este tipo de milagro, o como quiero decir, aspecto extraño de como el desarrollo de la prueba de Drosten , porque él, a pesar del hecho de que habría necesitado básicamente, a través de su empleador, The Charite tendría derecho a tener las patentes sobre este, ya saben, su invento, acaba de publicar la instrucción a la casa (inaudible) para que todos pudieran verla. Así que básicamente, toda la invención perdió su posibilidad de ser patentada, y eso es un poco extraño, ya sabes, cuando lo miras, así que le pedimos a la Charita en una solicitud de ley de Libertad de Información, y entonces dijeron, Bueno, ya sabes, porque había mucha prisa por sacar la, ya sabes, esta prueba porque había esto –

Reiner Fuellmich  1:39:34

– pandemia en marcha –

Viviane Fischer  1:39:34

– pandemia en marcha, así que fue como, no miramos las finanzas, ya sabes, simplemente no nos importaba. Así que eso es un poco extraño como procedimiento, porque quiero decir, básicamente esta prueba vale como miles de millones, saben, cómo podrían, quiero decir, este es un hospital financiado con fondos públicos, cómo pueden dar, ya saben, regalar todo esto, y luego porque también estaba en estrecha cooperación con una empresa privada TIB Molbiol. Es el mismo con el que había desarrollado todas las pruebas PCR desde 2002 desde el primer SARS, y luego MERS, (inaudible) y así sucesivamente y así sucesivamente. Así que es muy extraño, ya saben, porque básicamente estaba como, funcionando como un abridor de puertas para esta compañía, ya saben, porque también nos dijeron, así que básicamente, fue Drosten quien decidió a qué posible país o como laboratorio o lo que sea la prueba, esta compañía TIB Molbiol enviaría los kits de prueba para luego, por supuesto, , ganar más dinero, porque él era básicamente como, tenía una ventaja de ser el primero en moverse, ya sabes, Drosten y o esta compañía. Así que está claro ahora, quiero decir, tal vez no había nada en ese momento, porque ya había muchas patentes en marcha. Así que básicamente, a partir de este virus no nuevo o una prueba PCR, no pudo patentar nada que hubiera sido nuevo. Así que, básicamente, era realmente como una cosa muy lógica para hacer entonces usar todo el asunto como un solo para, ya saben, obtener ganancias de esta ventaja de ser el primero en moverse. Y tal vez Drosten está de alguna manera involucrado en toda esta estafa legal, financiera –

Reiner Fuellmich  1:41:16

– oh, es una de las personas más importantes en este juego, porque él es el que está tirando de las cuerdas que tiraron primero.

Dr David Martin  1:41:22

Sí, necesitas crear la ilusión de la demanda, y no hay nada en este momento que haga un mejor trabajo de crear la ilusión de la demanda que la urgencia de un evento que has fabricado.

Reiner Fuellmich  1:41:43

Esto suena casi como comedia, pero no lo es.

Dr David Martin  1:41:47

Bueno, es en que tenemos que darnos cuenta de que parte de la razón por la que fue tan fácil para nosotros monitorear y rastrear esta campaña particular de coerción y terror es porque lo hemos hecho antes. Ya saben, comencé mis comentarios asegurándome de que la gente lo recordara cuando se trataba de resolver el brote de ántrax. Ahora recuerden, que mientras teníamos cientos de 1000 militares en Oriente Medio, supuestamente incluso por los acontecimientos de septiembre de 2001, teníamos dos inspectores postales investigando el ántrax. ¡Dos! El mayor ataque de supuestas pinzas biológicas en suelo estadounidense y tuvimos dos Inspectores Postales. No se puede creer genuinamente que dos Inspectores Postales son los, ya saben, el crimen que detiene, ya saben, individuos alucinantemente poderosos en el universo. Ahora no tengo nada en contra de los inspectores postales, pero puedo garantizarles que si estuviera investigando un ataque bioterroroso, no tendría la oficina de correos, teniendo dos inspectores postales como su equipo de crack, haciendo la investigación. Ya saben, era falso, y el Congreso lo sabía. Y esa es la razón por la que, ya saben, publicamos una cosa que no es necesariamente un éxito de ventas, pero publicamos un informe de inteligencia sobre cada violación de los tratados de armas biológicas y químicas que la gente ha firmado en todo el mundo. Y es una guía telefónica que te dice dónde y quién y quién está financiando, por lo que para nosotros no fue difícil entender que esto no era una crisis de salud pública. Esta fue una campaña de marketing oportunista para abordar un objetivo declarado, y es por eso que esto es una maquinilla de afeitar occams. Es lo más fácil de describir, porque son ellos los que lo establecen. Y la realidad es que dijeron que necesitaban que el público aceptara una contramedida de vacuna contra el Coronavirus, y que necesitaban que los medios crearan el bombo, y que los inversores siguieran donde vieran ganancias. Usted no tiene nada más en lo que deba confiar para explicar los eventos de los últimos 20 meses, que la declaración real del perpetrador real. Y no hago el ejercicio de mirarme el ombligo de entrar para tratar de entender si había problemas de mamá detrás de un ladrón de bancos si están sosteniendo una bolsa de dinero fuera de un banco. De hecho, hago la loca suposición de que tal vez son un ladrón de bancos. Del mismo modo, si tengo a alguien que dice que necesitamos usar los medios de comunicación para promocionar una contramedida médica, que es de hecho la inyección de una proteína quimérica sintética y recombinante desarrollada a partir de una simulación por computadora. Si realmente voy a escuchar la motivación de por qué eso podría estar haciéndose, voy a escuchar a la persona que hace la manipulación que dice que los inversores seguirán donde ven las ganancias? No necesito más explicación.

Reiner Fuellmich  1:45:28

Yo tampoco. Bueno, esto es alucinante. Estoy muy contento, David, [quiero decir] hablamos hace un par de meses, tal vez hace 3 o 4 meses, y nos presentó un David, lo siento, James Henry.

Dr David Martin  1:45:52

Correcto.

Reiner Fuellmich  1:45:52

Y estaba tratando de encontrar abogados de patentes en este país que pudieran estar interesados en este caso. Ahora, hay algunos abogados de patentes que lo entienden, pero aparentemente no hay nadie hasta ahora, pero tal vez esto va a cambiar. Pero no había nadie dispuesto a abordar esto en el contexto de Corona. Ese es el problema.

Dr Wolfgang Wodarg  1:46:17

Esto no es nuevo. He tratado de encontrar un abogado así para especializarme en patentes para la Comisión (inaudible) para el Bundestag alemán hace 10 años, o hace más de 15 años. Y no lo encontramos porque tenían miedo de ser críticos con el sistema. Destruirían su propio trabajo. Esto fue muy difícil.

Reiner Fuellmich  1:46:38

Sí, tenga en cuenta que este es un problema antiguo, porque ahí es donde entra el problema. Desde la creación de la Oficina Europea de Patentes, los alemanes y los franceses, como era de esperar, han mantenido la animosidad que, ya saben, ha sido solo esta nueva versión de la animosidad que se remonta a siglos atrás. Pero cuando se creó la OEP, el papel de la oficina de patentes de Múnich se convirtió en una cuestión muy nacionalista para Alemania. Y la noción de que los examinadores de patentes alemanes y los profesionales de patentes alemanes todavía gozaban de supremacía sobre el resto de Europa se volvió dogmática. En 2003, en 2004, cuando mi organización auditó por primera vez la Oficina Europea de Patentes, y en la que demostramos que entre el 20 y el 30 por ciento de las patentes en Europa eran falsificaciones funcionales, lo que significa que se copiaron de patentes anteriores, la representación alemana de la Oficina Europea de Patentes perdió la cabeza ante la idea de que estaban haciendo algo remotamente mal. Cuando la Unión Europea nos encargó un examen de las patentes de software unos años más tarde, a petición de la delegación sueca ante la Unión Europea, y mostramos cientos y cientos de patentes de software que fueron concedidas ilegalmente por la Unión Europea a través de la OEP. Y luego descubrimos que eran los examinadores de patentes alemanes y los profesionales de patentes alemanes los responsables de su presentación. Una vez más vimos que había una enorme protesta. Y lo que ocurre es que tenemos una posición dogmáticamente sostenida, que dice que aunque se supone que la Oficina Europea de Patentes es paneuropea, todavía hay en la mente del sistema de patentes alemán una supremacía sobre el resto de Europa. Y si pones en duda algo, incluidas las patentes concedidas sobre un arma biológica, estás pisando un terreno por el que no hay perdón.

Dr Wolfgang Wodarg  1:49:09

Sí. Teníamos algunas preguntas de Transparencia Internacional, y fuimos borrados; no se siguió el tema.

Dr David Martin  1:49:17

sí. Simplemente no se puede. No es accesible, y esa es solo la tragedia de lo que desafortunadamente se ha convertido en una organización de captura regulatoria. En realidad no está haciendo el servicio público.

Reiner Fuellmich  1:50:24

Reiner traduce.

Dr David Martin  1:50:53

Bueno, gracias por el tiempo que has pasado y espero que haya sido útil.

Reiner Fuellmich  1:50:57

Fue muy útil.

Dr Wolfgang Wodarg  1:50:59

Muy servicial, muchas gracias.

Reiner Fuellmich  1:51:00

Vamos a escuchar muchos ecos. Gracias David, y que tengas un gran fin de semana.

Dr David Martin  1:51:07

Bien, cuídense todos.

Dr David Martin  1:51:08

Sí, tú también. Adiós.

Viviane Fischer  1:51:10

Adiós.

Dr Wolfgang Wodarg  1:51:11

Adiós.

Fuente: Reiner Fuellmich entrevista al Dr. David Martin – Fraude de patentes de los CDC – (covidtruths.co.uk)

¿COVID 19? ¿COVID 19? LLAMEN A LOS HERMANOS MARX

Sí, parece sacado de una película y haría gracia si no supiéramos lo que está pasando. Y ese es el problema, que creo que nadie, ni científico, ni médico, ni político sabe lo que está pasando en realidad… ¡O bueno!.

Estas son las personas que fallecieron más o menos en la primera ola de la enigmática COVID-19, que lo mismo vale para un cojo que para un desconocido:

Personas con enfermedades crónicas, como obesidad, diabetes, enfermedades respiratorias, enfermedades cardíacas, VIH, entre otros. Adultos mayores de 65 años. Personal de salud.

La cita anterior está sacada de cosas así como la OMS y ministerios de sanidad, ¿os suena? pues bien, son los que tenían que estar o estaban vacunados contra la gripe o influenza.

Y ahora a día de hoy, sacan esto: Observan que la vacuna contra la gripe puede proporcionar una protección vital contra COVID-19, según concluye una nueva investigación que se presenta en el Congreso Europeo de Microbiología Clínica y Enfermedades Infecciosas (ECCMID), y que sugiere que la vacuna anual contra la gripe reduce el riesgo de accidente cerebrovascular, sepsis y TVP en pacientes con COVID-19.

Y vacunas y más vacunas ¿No es una contradicción en sí misma y una idiotez supina? ¿O está pasando algo que no logramos entender de momento? Aviso a navegantes… Y estaban navegando al entrar en un camarote y no es la parte contratante de la primera parte que será considerada como la parte contratante de la primera parte en una ópera de verano o mejor llamen al loquero y a su primo lockdown corre corre que te pillo mi patio de mi casa es particular adiós, salto en ala delta del Titanic… Aviso a remavegantes.

G.R.M.

La Red De Dinero Oscuro E Influencia De Bill Gates

PARTE 1: Conformación Narrativa Filantrópica (The Last American Vagabond)

En los primeros meses de 2020, el magnate de los negocios y multimillonario Bill Gates vio cómo su popularidad se disparaba por las nubes. Según YouGov, el 58 por ciento de los estadounidenses encuestados sobre Gates tenían una opinión positiva de él, es igualmente querido por hombres y mujeres, y tanto los Boomers como los Millennials lo adoran. La popularidad de Gates podría haber aumentado debido a que un documental viral de Netflix sobre su vida se estrenó a finales de 2019. Combine esa prensa positiva con una ola de entrevistas en los medios de comunicación que buscan la guía del hombre que “predijo” la próxima gran pandemia, y listo – Bill Gates es un superhéroe aquí para salvar al planeta de la inminente fatalidad.

Por supuesto, esta visión bastante caricaturesca ignora varios hechos incontrovertibles, y algunas teorías fuertes sobre las verdaderas intenciones de Gates. En primer lugar, los hechos. Bill Gates ha utilizado su inmensa riqueza para ganar influencia y tiempo en los medios de comunicación, difundiendo su mensaje de solucionar problemas de salud global mientras continúa ganando miles de millones. Usando la Fundación Bill y Melinda Gates para repartir subvenciones y donaciones, Gates ha creado una red de organizaciones que deben su presupuesto a la fundación o responden directamente a Gates. Al rastrear las inversiones de la Fundación y las relaciones de Gates, podemos ver que casi todas las personas involucradas en la lucha contra el COVID-19 están vinculadas a Gates o a su fundación por dos grados o menos. Esto le da a Bill Gates y su fundación una influencia indiscutida sobre la respuesta a la pandemia. Igualmente preocupante es el llamado de Gates para el bloqueo global hasta que el mundo entero haya sido vacunado y se le haya dado un certificado digital para probar la inmunidad.

Ahora, las teorías: al escuchar cuidadosamente varios discursos y declaraciones hechas por Gates, queda claro que tiene una inclinación por discutir la reducción del crecimiento de la población. A pesar de que los “verificadores de hechos” afirman que las palabras de Gates han sido sacadas de contexto, sus palabras hablan por sí mismas. Él cree que la población debe reducirse o evitarse que crezca, y cree que esto se puede hacer con vacunas y atención médica.

Mientras tratamos de despegar las capas de acrobacias de relaciones públicas y piezas de calado que adulan a Bill Gates, esperamos ilustrar que el hombre que está siendo apuntalado en el escenario global y vendido a la gente como su salvador, es cualquier cosa menos. A pesar del aparente crecimiento en el apoyo a Bill Gates, también hay evidencia en las redes sociales de que la gente está comenzando a cuestionarlo y desafiar la narrativa del salvador. Este es el primer paso para desentrañar la Red de Dinero Oscuro y Manipulación de Bill Gates.

La influencia global de la Fundación Bill y Melinda Gates

En 1994, según la historia, Bill Gates le pidió a su padre, William Gates Sr., que lo ayudara a “mejorar la salud reproductiva e infantil” fundando y dirigiendo la Fundación William H. Gates. Gates Sr. estuvo de acuerdo y en el año 2000, la Fundación se fusionó con la Gates Learning Foundation para convertirse en la Fundación Bill y Melinda Gates. Según la Fundación, Bill Gates ha donado 36 mil millones de dólares de su riqueza personal a la fundación. Se estima que la Fundación está valorada en $46.8 mil millones.

Durante las últimas dos décadas, la Fundación ha invertido en una serie de empresas y proyectos controvertidos mientras persigue su objetivo de mejorar la salud mundial y el acceso a las vacunas y la atención reproductiva. Todo esto se ha hecho como parte del plan de Gates para remodelar su imagen pública como la de un multimillonario amable y amable cuyo único objetivo es ayudar al mundo. La realidad es mucho más sospechosa.

Tomemos, por ejemplo, el documental de Netflix mencionado anteriormente,Inside Bill’s Brain: Decoding Bill Gates. En lugar de ser una mirada genuina a la vida y la personalidad de Gates, el documental no reconoció los conflictos de intereses que podrían retratar la película – y Bill Gates – bajo una luz diferente. En una reciente investigación explosiva que examina el alcance del dinero de Gates, The Nation señaló que, “en el primer episodio, el director Davis Guggenheim subraya el intelecto expansivo de Gates al entrevistar a Bernie Noe, descrito como un amigo de Gates”. Noe continúa diciendo que Gates lee 150 páginas por hora con un 90 por ciento de retención. Sin embargo, The Nation informó: “Guggenheim no le dice a las audiencias que Noe es el director de Lakeside School, una institución privada a la que la Fundación Bill y Melinda Gates ha dado $ 80 millones”. Casualmente, esta es la misma escuela a la que asisten los hijos de los Gates.

Por supuesto, el uso de la riqueza de las fundaciones para influir en la cobertura de los medios no es nuevo para Bill Gates. Aunque The Guardian reclama independencia editorial, su sección de Desarrollo Global está financiada en parte por The Gates Foundation. La fundación también ha dado más de $ 9 millones a The Guardian, más de $ 3 millones a NBC Universal, más de $ 4 millones al periódico francés Le Monde, más de $ 4.5 millones a NPR, $ 1 millón a Al-Jazeera y $ 49 millones al programa Media Action de la BBC. A la luz de estas inversiones, es fácil entender cómo Gates pudo organizar rápidamente una gira de conferencias de sus medios de comunicación favoritos.

Los medios de comunicación corporativos no son los únicos beneficiarios de la fundación Gates. También han invertido en tecnologías y compañías controvertidas, como Monsanto, geoingeniería, tecnología 5G y vacunas.

MintPress News informó recientemente sobre cómo la Fundación Gates ayudó al gigante farmacéutico y químico altamente controvertido Monsanto Corporation a “ganar un punto de apoyo más fuerte en África”. Mpn también señala que la fundación financió un “ensayo clínicodefectuoso de la vacuna contra el VPH en la India en 2009, donde 23.000 niñas empobrecidas de entre 9 y 15 años estuvieron expuestas a medicamentos potencialmente letales sin siquiera el consentimiento de sus padres, lo que llevó a siete muertes”.

En 2010, también se informó que desde 2007, Gates había dado $ 4.5 millones para estudiar métodos de geoingeniería para alterar la estratosfera para reflejar la energía solar, técnicas para filtrar el dióxido de carbono directamente de la atmósfera y el brillo de las nubes del océano. La geoingeniería es la manipulación deliberada a escala masiva del clima con el propósito declarado de reducir el calentamiento en el planeta. The Guardian señaló previamente que Gates da “unasuma no revelada” al defensor de la geoingeniería y profesor de Harvard David Keith. Gates también posee una participación mayoritaria en la compañía de geoingeniería de Keith, Carbon Engineering. El prominente investigador de geoingeniería Ken Caldeira dice que recibe $ 375,000 al año de Gates y trabaja para Intellectual Ventures, una compañía privada de investigación de geoingeniería propiedad parcial de Gates y dirigida por Nathan Myhrvold, ex jefe de tecnología de Microsoft.

La Fundación también ha invertido 10 millones de dólares en el desarrollo de antenas que acelerarán el despliegue de la controvertida tecnología celular de 5ª generación, también conocida como 5G.

Las preocupaciones en torno a la fortuna de Bill Gates y su uso de la Fundación Bill y Melinda Gates para influir en proyectos de mascotas no es la única preocupación expresada por los críticos de la fundación. El más grande – y más inmediato – es que los multimillonarios no electos como Gates están usando sus fortunas para dar forma a las políticas públicas utilizando sus fundaciones filantrópicas. Este método de invertir miles de millones de dólares en forma de donaciones de caridad deducibles de impuestos a compañías privadas está permitiendo a Gates dar forma a la política y las ganancias al mantener acciones en las mismas compañías apoyadas por la Fundación Gates.

Una investigación reciente de The Nation descubrió más de 19,000 subvenciones caritativas de la Fundación Gates en las últimas dos décadas. También encontraron $ 2 mil millones en estas donaciones caritativas deducibles de impuestos a empresas privadas. Las compañías que reciben estas donaciones incluyen GlaxoSmithKline, Unilever, IBM y NBC Universal Media. La Nación señaló que la Fundación Gates ha dado 250 millones de dólares a compañías de medios y “otros grupos para influir en las noticias”.

La Nación encontró cerca de $ 250 millones en donaciones caritativas de la Fundación Gates a compañías en las que la fundación tiene acciones y bonos corporativos: Merck, Novartis, GlaxoSmithKline, Vodafone, Sanofi, Ericsson, LG, Medtronic, Teva y numerosas nuevas empresas.

Es posible que vea la declaración anterior y pregunte, “¿cómo puede ser esto legal? ¿No es un conflicto de intereses mantener acciones en una empresa a la que también se dan donaciones libres de impuestos?” El simple hecho es que no hay reglas o leyes en contra de hacer exactamente lo que la Fundación Bill y Melinda Gates están haciendo. Si bien algunos podrían argumentar que el esquema de Bill Gates es brillante – donar su fortuna mediante la formación de una fundación que puede dar donaciones deducibles de impuestos a las empresas que en parte posee y cosechar ganancias, mientras que evitar los impuestos – que le está permitiendo ocultar su dinero en una miríada de maneras. Se ha vuelto casi imposible rastrear cada donación, inversión u otra asociación.

La Nación concluyó, “es difícil ignorar las ocasiones en que sus actividades caritativas parecen servir principalmente a intereses privados, incluidos los suyos, apoyando las escuelas a las que asisten sus hijos, las compañías que su fundación posee en parte y los grupos de interés especial que defienden a los estadounidenses ricos, al tiempo que generan miles de millones de dólares en ahorros fiscales”.

Otros hechos notables de la investigación incluyen que la “dotación de $ 50 mil millones de la Fundación Gates ha generado $ 28.5 mil millones en ingresos de inversión en los últimos cinco años”, mientras que solo regala $ 23.5 mil millones en subvenciones caritativas. Además, una investigación de 2007 de LA Times encontró que la organización estaba involucrada en préstamos hipotecarios de alto riesgo y hospitales con fines de lucro que, según los informes, realizaron cirugías innecesarias. Según los informes, la Fundación Gates también invierte en compañías de chocolate que utilizan mano de obra infantil.

Sería un error ver a la Fundación Bill y Melinda Gates como un mero recipiente para que un hombre rico esconda su dinero y obtenga ganancias inconmensurables. No, la Fundación es “más que una colección de subvenciones y proyectos”, dice el Dr. David McCoy, médico de salud pública e investigador del University College de Londres y asesor del Movimiento por la Salud popular. McCoy dice que la Fundación “opera a través de una red interconectada de organizaciones e individuos en el mundo académico y los sectores de ONG y negocios” que permite a Bill Gates “aprovechar” la influencia” en una especie de “pensamiento grupal”.

En la parte 2 de esta investigación examinaremos la miríada de conexiones entre Bill Gates, su fundación y los muchos actores involucrados en la respuesta al COVID-19. También intentaremos responder a la pregunta esencial: ¿Es Bill Gates una fuerza para el bien o una fuerza para el daño?

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 1: Conformación narrativa filantrópica (thelastamericanvagabond.com)

PARTE 2: La Operación COVID-19

Antes de sumergirnos en la actual crisis del COVID-19, se necesita un poco más de información sobre Gates. En la última pieza discutimos la historia de las inversiones de la Fundación Gates. Lo que es importante tener en cuenta es que al usar la Fundación como la organización principal, Gates puede donar e influir en hospitales, universidades, medios de comunicación, gobiernos y organizaciones de salud. La Fundación claramente tiene la capacidad de dar forma a las decisiones tomadas por algunas de las instituciones que financian, incluso cuando estas decisiones van en contra de los deseos de las masas que dicen estar ayudando.

Por ejemplo, en 2017 Independent Science News publicó un informe que detallaba cómo la Fundación Bill y Melinda Gates pagó a la firma de relaciones públicas Emerging Ag $ 1.6 millones para “reclutar a una coalición encubierta de académicos para manipular un proceso de toma de decisiones de la ONU sobre las unidades genéticas”. Los correos electrónicos publicados por la Solicitud de la Ley de Libertad de Información revelan que el esfuerzo de reclutamiento de gates fue parte de un plan para “luchar contra los defensores de la moratoria de la impulsión genética”. Las unidades genéticas son una controvertida tecnología de extinción genética promovida como una forma de eliminar los mosquitos con malaria, plagas agrícolas y especies invasoras.

En el Convenio de las Naciones Unidas sobre la Diversidad Biológica de 2016, 179 organizaciones internacionales pidieron una moratoria de la ONU sobre las unidades genéticas. Los opositores a esta tecnología también distribuyeron una carta, “Un llamado a la conservación con conciencia: no hay lugar para las unidades genéticas en la conservación”, firmada por 30 líderes ambientales que pidieron un “alto a todas las propuestas para el uso de tecnologías de impulso genético, pero especialmente en la conservación”. La Fundación Gates está fuertemente invertida en tecnología de conducción genética y no estaba contenta de ver un retroceso diverso y unificado contra la conducción de genes. La Fundación contrató a Emerging Ag , que tiene su propia red de conexiones con Big Pharma y Big Ag , para cerrar los opositores a la conducción de genes. Emerging Ag tuvo éxito y la moratoria fue derribada.

Coincidentemente, en 2016, la Academia Nacional de Ciencias de Estados Unidos publicó un informe sobre la conducción de genes que fue cofinanciado por la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA) y la Fundación Bill y Melinda Gates. DARPA también se invierte en la investigación de la unidad genética. Como señaló The Guardian después de la publicación del informe nas:

“La misma agencia de investigación de defensa estadounidense (DARPA) que pagó por el estudio NAS ha hecho saber que están participando en la investigación y el desarrollo de organismos sintéticos ‘robustos’. Hay buenas razones para estar preocupados”.

Además, Jim Thomas, del Grupo ETC, que monitorea el impacto de las tecnologías emergentes y las estrategias corporativas en la biodiversidad, la agricultura y los derechos humanos, dijo a ISN que cree que las unidades genéticas son armas biológicas potenciales que podrían tener un impacto “desastroso” en la vida humana y la seguridad alimentaria. “El hecho de que el desarrollo de la unidad genética ahora esté siendo financiado y estructurado principalmente por el ejército estadounidense plantea preguntas alarmantes sobre todo este campo”, declaró.

Independent Science News también señaló:

“Esta tampoco es la primera vez que la Fundación Gates ha utilizado a académicos para influir en la opinión pública y privada sobre las tecnologías de ingeniería genética, como lo demuestra su financiación de la Cornell Alliance for Science“.”

Los correos electrónicos privados obtenidos por Independent Science News se suman a las montañas de evidencia que detallan cómo Gates es capaz de presionar a las organizaciones para que lleven a cabo sus intereses y los de su fundación.

La mafia de la salud global

Bill Gtaes

Teniendo en cuenta estos alarmantes informes sobre la influencia de Gates en la política de salud pública, es importante tomarse un momento para examinar la respuesta actual al COVID-19. Cuando observamos a los actores e instituciones involucradas, ¿vemos la influencia y el dinero de Gates? En caso afirmativo, ¿qué significa esto para la salud pública? ¿La gigantesca influencia y las finanzas de Gates le permitirán dirigir personalmente el curso de la recuperación del COVID-19?

Comencemos por mirar al doctor Anthony S. Fauci, director del Instituto Nacional de Alergias y Enfermedades Infecciosas (NIAID), parte de los Institutos Nacionales de Salud y líder en la lucha contra el COVID-19. Desafortunadamente, cuando se trata de Fauci y el NIAID vemos claramente la influencia de Bill Gates. En 2010, el NIAID y la Fundación Bill y Melinda Gates anunciaron su “Década de colaboración en materia de vacunas”, en la que pedían la coordinación entre la “comunidad internacional de vacunas” y la creación de un “Plan de Acción Mundial sobre Vacunas”. El Dr. Fauci fue nombrado miembro del Consejo de Liderazgo de la asociación. Del mismo modo, Bill Gates se ha asociado con los NIH durante varios años.

A finales de abril, se conoció la noticia de que el NIAID de Fauci donó un total de 7,4 millones de dólares a la investigación relacionada con el coronavirus de murciélagos. Las inversiones agregaron combustible a la teoría de que covid-19 podría ser un virus de bioingeniería que fue liberado a propósito o accidentalmente desde el Instituto de Virología de Wuhan en Wuhan, China. La noticia de la financiación plantea la pregunta obvia; ¿El dinero de Gates influyó o coronó la investigación del coronavirus del NIAID? El tiempo lo dirá.

Otra jugadora importante con conexiones con Gates es la Dra. Deborah Birx, una médica y diplomática estadounidense que se desempeña como Coordinadora Mundial de Sida de Estados Unidos para los presidentes Barack Obama y Donald Trump desde 2014. Actualmente es la Coordinadora de Respuesta al Coronavirus para el Grupo de Trabajo de la Casa Blanca de la Administración Trump. Birx también forma parte de la Junta Directiva de The Global Fund,una organización a la que la Fundación Bill y Melinda Gates prometió una inversión de 750 millones de dólares en 2012. El Fondo Mundial también cuenta con el miembro de la junta directiva Kieran Daly, director adjunto de Política Global y Promoción de la Fundación Gates.

“La Fundación Bill y Melinda Gates es un socio clave del Fondo Mundial, proporcionando contribuciones en efectivo, participando activamente en su junta directiva y comités, y apoyando los esfuerzos de promoción, comunicación y recaudación de fondos del Fondo Mundial”, afirma el Fondo Mundial.

La Universidad Johns Hopkins ha sido un miembro igualmente importante de la respuesta global al COVID-19. Los cálculos de la universidad de las tasas globales de infección y mortalidad se citan comúnmente en los principales medios de comunicación. Sin embargo, una vez más, encontramos que la Fundación Bill y Melinda Gates ha estado invirtiendo en Johns Hopkins durante dos décadas.

Por último, recientemente se informó que la organización conocida como Wellcome Trust se ha asociado con la Fundación Bill y Melinda Gates y MasterCard para “catalizar el trabajo inicial” del Acelerador terapéutico COVID-19. Se supone que la Aceleradora acelerará y evaluará “medicamentos y productos biológicos nuevos y reutilizados para tratar a pacientes con COVID-19 a corto plazo”. Lo que no se mencionó es que la Fundación Gates ha sido un “Fideicomisario” del Wellcome Trust durante varios años. Curiosamente, en 2017, Mark Henderson, Director de Comunicaciones de Wellcome Trust participó en un panel llamado “Deep Dive: Preventing Pandemics”. El Dr. Anthony Fauci también participó en la mesa redonda.

Uno podría señalar la participación de Fauci y Wellcome Trust en un panel sobre pandemias como perfectamente razonable, después de todo, estos son profesionales que se centran en la salud global. Sin embargo, ignorar que las huellas dactilares de Bill Gates están en toda la industria de la salud global sería un error.

Basado en el historial de la Fundación Gates de contratar empresas de relaciones públicas para cerrar detractores o usar su dinero para influir en las instituciones, uno podría ser perdonado por asumir que la fundación no sería alta en la lista de líderes potenciales para una crisis de salud pública. Desafortunadamente, a partir de mayo de 2020, Bill Gates y su Fundación siguen siendo promovidos como héroes en la lucha contra el COVID-19.

¿Quién dirige la OMS?

Desde el brote de COVID-19, tanto Bill Gates como la Organización Mundial de la Salud han entrado en el centro del escenario mientras el mundo los mira en busca de respuestas. A estas alturas, es bien sabido que la Fundación Bill y Melinda Gates es el principal donante no estatal a la OMS. Estados Unidos ha sido el principal donante estatal, pero eso puede cambiar bajo la administración Trump. Gates también fue la primera persona no estatal en dar un discurso de apertura ante la asamblea general de la OMS.

Según un informe de Politico, la opinión (y el dinero) de Bill Gates tiene tanta influencia en la OMS que los funcionarios lo llaman en privado “el Bill Chill”. Dieciséis funcionarios que hablaron bajo condición de anonimato dijeron a Politico que Gates tiene una influencia desmesada en la política de la OMS y pocos se atreven a desafiarlo. “Es tratado como un jefe de Estado, no solo en la OMS, sino también en el G20”,declaró un representante de una ONG con sede en Ginebra.

Las acusaciones de la influencia de Gates fueron secundadas por Foreign Affairs cuando informaron que “pocas iniciativas de política o estándares normativos establecidos por la Organización Mundial de la Salud se anuncian antes de que hayan sido investigadas casual y extraoficialmente por el personal de la Fundación Gates”.

El actual Director General de la OMS es Tedros Adhanom, ex Ministro de Salud de Etiopía. Durante su mandato como Ministro de Salud de Etiopía, Tedros colaboró con la Fundación Clinton y la Fundación Bill y Melinda Gates para trabajar en vacunas, entre otras medidas sanitarias. Politico informó que antes de que Tedros fuera seleccionado para el puesto de la OMS en 2017, Gates fue acusado de apoyar a Tedros y usar su influencia para ayudar a ganar la nominación.

Si bien la mayoría de los delegados de los países miembros expresaron su creencia de que Gates tiene buenas intenciones, algunos temían que el dinero de la Fundación Gates provenga de “grandes empresas” y pudiera “servir como un caballo de Troya para que los intereses corporativos socaven el papel de la OMS en el establecimiento de normas y la formulación de políticas de salud”.

La conclusión más importante es que las tarifas pagadas por los países miembros de la OMS representan menos de una cuarta parte del presupuesto bienal de 4,5 mil millones de dólares, lo que deja a Gates, los gobiernos y otras fundaciones para llenar el vacío. Estas donaciones se destinan a proyectos específicos y la OMS no puede decidir cómo utilizarlas. En el caso de la Fundación Bill y Melinda Gates, esos fondos suelen destinarse a programas de vacunación.

No importa de qué manera abordes las soluciones que se presentan como respuesta a la pandemia de COVID-19, encontrarás las huellas dactilares de Bill Gates. En repetidas ocasiones ha utilizado su dinero e influencia para obtener ganancias y ganar poder constantemente sin haber sido elegido para un cargo político.

En la parte 3 de esta investigación examinaremos las estrategias que Bill Gates ha pedido en respuesta al COVID-19. También veremos cómo Bill Gates y la familia Rockefeller han ido prediciendo una situación como la que estamos presenciando actualmente. Finalmente, mostraremos cómo esta crisis presenta la oportunidad perfecta para que Gates y sus cohortes obtengan enormes ganancias y se posicionen a la cabeza de un Estado tecnocrático emergente.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 2: La operación COVID-19 (thelastamericanvagabond.com)

PARTE 3: Vigilancia De La Salud, Evento 201 Y La Conexión Rockefeller

Bloqueos, rastreo de contactos, certificados digitales y vacunas

En los últimos cuatro meses Bill Gates ha hecho decenas de apariciones en medios donde ha pedido varias “soluciones” controvertidas al COVID-19. Gates dice que estas propuestas deben implementarse antes de que la sociedad pueda volver a la “normalidad”. Desde pedir bloqueos prolongados, vigilancia de la salud (también conocido como rastreo de contactos)certificados digitales.

La ciencia detrás de los cierres ha sido cuestionada en numerosas ocasiones por los expertos en salud. Más recientemente, Michael Levitt, un profesor de la Universidad de Stanford que predijo la trayectoria inicial de la pandemia, declaró que creía que el confinamiento fue un “gran error” y que en realidad pudo haber costado vidas. TLAV también ha expuesto el rastreo de contratos y el llamado a un “ejército” de personas para monitorear al público como una expansión de la vigilancia. Coincidentemente, se informó esta misma semana que la Fundación Gates invirtió recientemente cientos de millones de dólares en compañías tecnológicas como Google, que pueden terminar construyendo la infraestructura de rastreo de contactos.

Lo que Gates describe como “certificados digitales” suena idéntico a lo que algunos llaman “pasaportes de inmunidad”, una forma de identificación digital que incluirá los datos de salud de una persona, así como su estado de vacunación. Durante un AMA de Reddit, Gates declaró: “Eventualmente tendremos algunos certificados digitales para mostrar quién se ha recuperado o ha sido probado recientemente o cuando tengamos una vacuna quién la ha recibido”. Lo que Gates describe –un certificado digital para demostrar quién ha sido vacunado– suena similar a los recientes llamamientos para que los pasajeros usen pasaportes de inmunidad antes de que se les permita volar.

Sin embargo, las declaraciones y la filantropía de Gates revelan su enfoque principal en la “lucha por la salud global”: la promoción de vacunas para todo el mundo. En lugar de centrarse en el agua potable, el acceso a la vivienda o cualquier otra propuesta para ayudar a los más pobres del mundo, Gates cree que el acceso a las vacunas es más apremiante. Mucho antes del COVID-19, la Fundación Gates ha estado involucrada en la financiación de polémicos esfuerzos de vacunación en África e India.

Un informe de 2015 titulado, Poder filantrópico y desarrollo: ¿Quién da forma a la agenda?, examina la influencia de la filantropía global y proporciona ejemplos de la influencia indebida que Gates y otros pueden ejercer. El informe describe gran parte de lo que describimos en la Parte 1 de esta investigación, incluyendo cómo,“a través de la colocación del personal de la Fundación en los órganos de toma de decisiones de las organizaciones internacionales y las asociaciones mundiales de salud” la Fundación Gates influye y guía la política de salud pública. La Fundación Gates es miembro de la junta directiva no sólo de GAVI, sino también del Fondo Mundial, la Alianza para la Salud de la Madre, el Recién Nacido y el Niño, la Empresa medicamentos para la malaria, la Alianza para lograr la regresión de la malaria, la Alianza contra la Tuberculosis, la Alianza Alto a la Tuberculosis y muchas otras.

La investigación también proporciona detalles sobre las inversiones de Gates en vacunas y sus conexiones con los fabricantes de vacunas. Como se informó en la Parte 2 de esta investigación, en 2010 la Fundación Bill y Melinda Gates lanzó la “Década de las Vacunas” y pidió un “Plan de Acción Mundial de Vacunas”. También ayudaron a crear la asociación público-privada conocida como GAVI, o la Alianza Mundial para el Fomento de la Vacunación y la Inmunización.

“La Fundación Gates proporcionó una promesa inicial de cinco años de US$ 750 millones como capital inicial para lanzar esta asociación mundial público-privada en el año 2000 y ha seguido siendo su fuerza impulsora y su mayor donante”, señala el informe. “Entre 2000 y 2014, la Fundación Gates aportó el 23 por ciento (US$2.287,94 millones) del financiamiento total de los donantes de alrededor de US$9,9 mil millones”.

El informe señaló que los investigadores han criticado a GAVI por seguir un “enfoque gates” sobre los desafíos de salud global, “centrándose en intervenciones de salud verticales específicas de la enfermedad (a través de vacunas), en lugar de enfoques horizontales y holísticos (por ejemplo, el fortalecimiento del sistema de salud)”. Además, hay evidencia de que el apoyo de la Fundación Gates a GAVI ha alentado a los fabricantes de vacunas a producir vacunas específicas que resultan en “más de $ 1 mil millones para Pfizer y GlaxoSmithKline (GSK)”.

La organización no gubernamental Médicos sin Fronteras (MSF) también ha cuestionado el impacto general de la Alianza GAVI en la asequibilidad de las vacunas, afirmando que “el costo de inmunizar completamente a un niño fue 68 veces más caro en 2014 que en 2001”. MSF también pide a GAVI que excluya a las compañías farmacéuticas de su consejo de administración para reducir los conflictos de intereses.

Una de las conclusiones más importantes de la investigación es que la Fundación Gates opera una puerta giratoria entre el personal de la Fundación y las grandes compañías farmacéuticas como Merck y GSK. El informe proporciona varios ejemplos de esta puerta giratoria, incluido Trevor Mundel, el presidente de la División de Salud Global de la Fundación Gates, trabajó anteriormente con Novartis, Pfizer y Parke-Davis. El predecesor de Mundel, Tachi Yamada, había sido ejecutivo y miembro de la junta directiva de GSK. Kim Bush, responsable de las iniciativas de asociación con la atención médica para la Fundación Gates, anteriormente trabajó para Baxter International Healthcare Corporation. Penny Heaton, Directora de Desarrollo de Vacunas en la Fundación Gates desde 2013, trabajó antes para Novartis Vaccines and Diagnostics y para Merck &Co.

La Fundación Gates y las vacunas de ARNm

Otra nota interesante del informe es cómo la Fundación tiene una participación de 52 millones de dólares en el capital de la compañía farmacéutica alemana CureVac. La colaboración está destinada a acelerar el desarrollo de vacunas de ARN mensajero (ARNm) contra diversas enfermedades, incluidos el rotavirus, el VIH y el virus sincitial respiratorio.

La vacuna de ARNm se ha discutido como un candidato potencial para la vacuna contra el COVID-19. Específicamente, la compañía biotecnológica Moderna Therapeutics está liderando el camino para la terapéutica de ARNm y las vacunas potenciales. El programa de vacunación contra el ARN de Moderna ha recibido 100 millones de dólares en fondos de la Fundación Gates. La controvertida vacuna de ARNm de Moderna también fue desarrollada con una donación de 25 millones de dólares de la Agencia de Proyectos de Investigación Avanzada de Defensa (DARPA).

Como informó TLAV, Donald Trump también nombró al Dr. Moncef Slaoui , un ex ejecutivo de Big Pharma que hasta hace poco se sentaba en la junta de Moderna , como su “Zar de las Vacunas” para dirigir la “Operación Warp Speed”, el esfuerzo de la administración Trump para acelerar una vacuna para fines de 2020. En 2016, Slaoui fue nombrado miembro del Consejo de Administración de Moderna Therapeutics. Renunció al ser nombrado para un cargo en la actual administración estadounidense.

La escritora de TLAV Whitney Webb informó recientemente sobre el papel de Moderna en la lucha contra el COVID-19 y sus conexiones con la Fundación Gates:

“La Coalición para las Innovaciones en Preparación para Epidemias (CEPI, por sus, anunció que financiaría tres programas separados para promover el desarrollo de una vacuna para el nuevo coronavirus responsable del brote actual.

Cepi – que se describe a sí mismo como “una asociación de organizaciones públicas, privadas, filantrópicas y civiles que financiará y coordinará el desarrollo de vacunas contra amenazas de alta prioridad para la salud pública” – fue fundada en 2017 por los gobiernos de Noruega y la India junto con el Foro Económico Mundial y la Fundación Bill y Melinda Gates. Su financiación masiva y sus estrechas conexiones con organizaciones públicas, privadas y sin ánimo de lucro la han posicionado para poder financiar la rápida creación de vacunas y distribuirlas ampliamente.

El reciente anuncio de CEPI reveló que financiaría dos compañías farmacéuticas , Inovio Pharmaceuticals y Moderna Inc., así como la Universidad de Queensland de Australia, que se convirtió en socio de CEPI a principios del año pasado. Cabe destacar que las dos compañías farmacéuticas elegidas tienen estrechos vínculos y/o asociaciones estratégicas con DARPA y están desarrollando vacunas que involucran de manera controvertida material genético y/o edición de genes. La Universidad de Queensland también tiene vínculos con DARPA, pero esos vínculos no están relacionados con la investigación biotecnológica de la universidad, sino con la ingeniería y el desarrollo de misiles“.”

Webb continúa detallando cómo Moderna está trabajando con los NIH de Estados Unidos para desarrollar una vacuna para el nuevo coronavirus y cómo el proyecto será financiado en su totalidad por cepi, que a su vez fue fundada y financiada por la Fundación Bill y Melinda Gates.

No debería sorprender que Bill Gates ahora esté apoyando abiertamente las vacunas de ARN. El desarrollo de estas vacunas —y el esfuerzo general de la Operación Warp Speed— está ignorando los ya inestables protocolos y medidas de seguridad para la fabricación de vacunas. La Operación Warp Speed y los ensayos posteriores en humanos en los que participaron 100.000 voluntarios “comprimirán lo que normalmente son 10 años de desarrollo y pruebas de vacunas en cuestión de meses”.

La prisa por conseguir al público una vacuna que no ha sido probada adecuadamente es aún más preocupante teniendo en cuenta las recientes declaraciones de Gates sobre la necesidad de vacunar a toda la población mundial. En un blog en su sitio web, Gate afirma: “El objetivo es elegir una o dos mejores construcciones de vacunas y vacunar a todo el mundo, es decir, 7 mil millones de dosis si es una vacuna de dosis única y 14 mil millones si es una vacuna de dos dosis”.

El impulso de Gates para una vacuna obligatoria probablemente tendrá un fuerte impacto en las decisiones de la OMS, los CDC y otras organizaciones de salud globales que financia, influye o de las que es miembro de la junta directiva. La financiación de Gates de un ” tatuaje de punto cuántico” que puede almacenar registros de vacunación ha hecho poco para calmar la disidencia y el miedo a sus verdaderas motivaciones.

A pesar de la proclamación de Gates como un héroe que ha salvado millones de vidas, la idea de forzar las vacunas ha provocado una creciente oposición a las vacunas y preocupaciones sobre su seguridad. Ya sea que se trate del denunciante de los CDC, el testimonio del Dr. Andrew Zimmerman sobre la seguridad de las vacunas o simplemente el apoyo a la libertad de elección, las personas de todo el mundo son escépticas de la seguridad de las vacunas y la influencia de las grandes farmacéuticas y no es probable que acepten una vacuna obligatoria en silencio.

La conexión rockefeller, el paso de bloqueo y el evento 201

Bill Gates

A medida que concluimos nuestra investigación sobre Bill Gates y consideramos sus segundas intenciones, es importante hacer un balance de la compañía que mantiene y las filosofías que ha promovido.

El informe, Poder filantrópico y desarrollo: ¿Quién da formaa la agenda? , también proporciona un antecedente importante sobre los orígenes de la filantropía moderna y la capacidad de ese dinero para influir en la salud global, la alimentación y la política agrícola. Los investigadores describen el papel de las dinastías Rockefeller y Carnegie en la creación de la filantropía estadounidense:

“Las raíces de la filantropía moderna se remontan al comienzo del siglo 20 en los Estados Unidos, cuando los magnates de los negocios John D. Rockefeller y Andrew Carnegie establecieron las primeras grandes fundaciones estadounidenses, principalmente como una forma de proteger algunos de sus ingresos de los impuestos, pero también como una forma de obtener prestigio e influencia en los Estados Unidos y los asuntos mundiales.

En 1911 Andrew Carnegie estableció la Carnegie Corporation de Nueva York y le dio una dotación de 125 millones de dólares, convirtiéndola en el mayor fideicomiso filantrópico jamás establecido hasta ese momento. Un año antes, Carnegie, que hizo su fortuna en la industria del acero, fundó el Carnegie Endowment for International Peace, que se convirtió en uno de los principales think tanks de política exterior de EEUU”.

Irónicamente, la formación de la Fundación Rockefeller suena inquietantemente similar a la propia historia de Gates de enfrentar acusaciones antimonopolio y de monopolio durante su tiempo en Microsoft y luego fundar la Fundación Bill y Melinda Gates como una forma de reescribir la historia y crear un personaje de héroe alrededor de sí mismo.

“La Fundación Rockefeller se estableció en 1913, dos años después de que la Corte Suprema de los Estados Unidos dictaminara que la Standard Oil Company de John D. Rockefeller era un monopolio ilegal y ordenó que se dividiera en compañías más pequeñas. La disolución de la entonces compañía petrolera más grande del mundo convirtió a su fundador y principal accionista John D. Rockefeller en el hombre más rico del mundo. Con el establecimiento de su fundación, pudo aislar una gran parte de su fortuna de los impuestos sobre la renta y la herencia.

La filantropía y la evasión fiscal no son los únicos puntos en común entre Bill Gates y los Rockefeller. Según los registros genealógicos, Gates está relacionado con la familia Rockefeller a través de Nelson Rockefeller, un ex vicepresidente de los ESTADOS UNIDOS. Sin embargo, las conexiones van más allá de ser asociadas por parientes lejanos. Tanto la Fundación Rockefeller como la Fundación Gates aparentemente “predijeron” un escenario muy similar al de la pandemia que se desarrolla frente a nuestros ojos.

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates se asoció con el Centro Johns Hopkins para la Seguridad de la Salud y el Foro Económico Mundial en un ejercicio pandémico de alto nivel conocido como Evento 201. Gates es un largo tiempo “Colaborador de agenda” para el WEF y ha donado a Johns Hopkins. El evento 201 simuló cómo respondería el mundo a una pandemia de coronavirus que arrasó el planeta. La simulación imaginó la muerte de 65 millones de personas, los cierres masivos, las cuarentenas, la censura de puntos de vista alternativos bajo el pretexto de combatir la “desinformación”, e incluso planteó la idea de arrestar a las personas que cuestionan la narrativa de la pandemia.

Coincidentemente, uno de los jugadores involucrados en el Evento 201 fue el Dr. Michael Ryan, el jefe del equipo de la Organización Mundial de la Salud responsable de la contención internacional y el tratamiento del COVID-19. Ryan llamó a buscar familias para encontrar individuos potencialmente enfermos y aislarlos de sus familias.

La Fundación Rockefeller imaginó un escenario similar en 2010 como parte de su documento,“Escenarios para el futuro de la tecnología y el desarrollointernacional”. Este documento incluye un escenario llamado “Lockstep”, que describe una pandemia que arrasa el mundo y resulta en un control más autoritario por parte de los gobiernos de los países desarrollados. El documento también describe la respuesta a la pandemia de la siguiente manera:

“Durante la pandemia, los líderes nacionales de todo el mundo exhibieron su autoridad e impusieron reglas y restricciones herméticas, desde el uso obligatorio de mascarillas hasta controles de temperatura corporal en las entradas a espacios comunes como estaciones de tren y supermercados. Incluso después de que la pandemia se desvaneció, este control y supervisión más autoritarios de los ciudadanos y sus actividades se mantuvo e incluso se intensificó”.

En el escenario imaginado, la fundación Rockefeller predice que “los escáneres que utilizan tecnología avanzada de resonancia magnética funcional (fMRI) se convierten en la norma en los aeropuertos y otras áreas públicas para detectar comportamientos anormales que pueden indicar “intención antisocial”. Curiosamente, la Administración de Seguridad en el Transporte anunció recientemente planes para controlar las temperaturas en los aeropuertos estadounidenses. El documento continúa describiendo cómo, eventualmente, la gente del mundo se cansaría del control y los disturbios civiles comenzarían:

“Para 2025, la gente parecía estar cansándose de tanto control de arriba hacia abajo y dejando que los líderes y las autoridades tomaran decisiones por ellos. Dondequiera que los intereses nacionales chocan con los intereses individuales, hay conflictos. El retroceso esporádico se volvió cada vez más organizado y coordinado, a medida que los jóvenes desafectos y las personas que habían visto cómo su estatus y sus oportunidades se escapaban, principalmente en los países en desarrollo, incitaban a los disturbios civiles”.

Si bien podría ser conveniente descartar el Evento 201 y Lock Step como una coincidencia, sería miope ignorarlos teniendo en cuenta que las Fundaciones Gates y Rockefeller están muy involucradas en la financiación de la industria mundial de la salud. Si bien abundan las teorías sobre si la pandemia de COVID-19 fue planeada o diseñada de alguna manera, como para imitar los planes discutidos en el Evento 201 y Lock Step, evidencia dura si actualmente falta. Aun así, no debemos descartarlos por completo.

Reducción de la población a través de la eugenesia

Las dinastías Gates y Rockefeller también están unidas por su interés común en la eugenesia, la ciencia desacreditada que promovió la idea de que las personas de “buen nacimiento” deben ser alentadas a reproducirse, mientras que aquellos con “genes malos” deben ser desalentados de la reproducción o esterilizados por completo. La ciencia fue desarrollada por Francis Galton como una estrategia para mejorar la raza humana. La idea era extremadamente popular en Estados Unidos antes de que los nazis abrazaran la doctrina y la llevara al extremo.

La eugenesia también fue extremadamente popular entre la familia Rockefeller. Un informe del Instituto Hudson señala que “las primeras fundaciones estadounidenses estaban profundamente inmersas en la eugenesia, el esfuerzo por promover la reproducción del ajuste y suprimir la reproducción de los no aptos”. El informe afirma que los Rockefeller y otros primeros filántropos estadounidenses creían en la “eugenesia filantrópica”, la idea de que podían usar su dinero para crear fundaciones que promovieran la filosofía de la eugenesia.

La Fundación Rockefeller y su familia ayudaron a financiar a los investigadores de los Institutos Kaiser Wilhelm en Alemania que estaban involucrados en los programas de esterilización nazi, financiaron la Oficina de Registros de Eugenesia y muchos otros programas que promovían el control de la población. En 1952, después de que los experimentos de eugenesia nazis fueran ampliamente conocidos, John D. Rockefeller III ayudó a crear el Population Council para promover la eugenesia sin el bagaje del término.

En su libro, Apareciendo por la vida,el padre de Bill Gates, William H. Gates II, escribió sobre su admiración por los Rockefeller y su filantropía:

“Una lección que aprendimos al estudiar y trabajar con los Rockefeller es que para tener éxito en la búsqueda de objetivos audaces se necesitan socios de ideas afines con los que colaborar.

Y aprendimos que tales goles no son premios reclamados por los de corto plazo. Los Rockefellers se quedan con problemas difíciles durante generaciones”.

Parece que Gates II era un partidario de la filosofía de eugenesia de Rockefellers, ya que sirvió como jefe de Planned Parenthood durante un tiempo. Planned Parenthood fue financiado en parte por una donación de $1.5 millones del Consejo de Población creado por Rockefeller. Gates II fue precedido en Planned Parenthood por Alan Guttmacher, quien simultáneamente se desempeñó como Director de la Sociedad Americana de Eugenesia.

Este interés en la eugenesia puede haber retrocedido tres generaciones al abuelo de Bill Gates, William H. Gates, ya que la Sociedad Americana de Eugenesia tenía un miembro con el nombre de “William H. Gates” en la década de 1920. El William H. Gates que aparece en la lista de AES fue catalogado como “profesor” y hay un profesor William H. Gates de la Universidad Estatal de Luisiana, pero todavía no hay evidencia de que el abuelo de Gates sea el mismo William H. Gates.

A pesar de todo, la actual familia Gates tiene la costumbre de pasar tiempo alrededor de sus compañeros eugenistas filantrópicos. En diciembre de 2001, William H. Gates recibió la inauguración de las “Medallas Andrew Carnegie de Filantropía” por su trabajo de caridad. Gates Sr. recibió su premio junto a Walter H. y Leonore Annenberg en nombre de la Fundación Annenberg, Brooke Astor, Irene Diamond, David y Laurance S. Rockefeller en nombre de la familia Rockefeller, George Soros y Ted Turner. Aunque Bill Gates no aparece en la foto, la Carnegie Corporation menciona que el mayor Gates estaba representando a la “familia Gates”.

Bill Gates
Bill Gates

Más recientemente, en 2010 Bill Gates fue visto con otros multimillonarios en un evento que fue descrito por los medios corporativos como “Se llaman el Buen Club – y quieren salvar al mundo.” The Guardian informó:

“Este es el Buen Club, el nombre dado a la pequeña élite global de filántropos multimillonarios que recientemente celebraron su primera y altamente secreta reunión en el corazón de la ciudad de Nueva York.

Los nombres de algunos de los miembros son figuras familiares: Bill Gates, George Soros, Warren Buffett, Oprah Winfrey, Michael Bloomberg, David Rockefeller y Ted Turner. Pero también hay otros, como los gigantes empresariales Eli y Edythe Broad, que son igualmente ricos pero menos conocidos. En total, sus miembros valen 125 mil millones de dólares”.

The Guardian también señala que Rockefeller, Gates y Buffet organizaron la reunión. The Wall Street Journal informó que la reunión se centró en la desaceleración del crecimiento de la población, un eufemismo para la eugenesia. La aparición de Ted Turner tanto en la reunión de 2001 como en la reunión de 2010 no debería ser una sorpresa, ya que también ha sido un defensor vocal del control de la población.

También cabe señalar que a pesar de las negaciones de Bill Gates, también fue socio del depredador sexual Jeffrey Epstein. La escritora de TLAV Whitney Webb documentó previamente la relación y los intentos de ocultarla. Coincidentemente, Epstein también fue expuesto como un defensor de la eugenesia.

¿Se levantará el verdadero Bill Gates?

Ahora que hemos llegado al final de esta investigación sobre las vidas, las finanzas y la historia de Bill Gates, debemos detenernos a reflexionar sobre sus motivaciones. ¿Es Bill Gates el adorable filántropo multimillonario que podría salvar al mundo del COVID-19? ¿Es el financiador de los peligrosos ensayos de vacunas? ¿Está motivado por un deseo de ayudar a la humanidad o está motivado por una filosofía desacreditada o la ciencia de la raza y la eugenesia?
Si vamos a juzgar a un individuo por la empresa que mantiene, por los proyectos que financian y por las palabras que dicen, entonces debería quedar claro que la familia Gates tiene una historia de promoción y apoyo a la eugenesia. Armados con este conocimiento podemos echar un nuevo vistazo a la filantropía de Bill Gates y llegar a entender que podría tener motivos que son muy diferentes de sus declaraciones públicas.

El hecho es que Bill Gates corre en círculos de élite donde la promoción de la eugenesia, el control de la población, la esterilización y otras tácticas de ingeniería social son la norma. Este hombre está siendo apuntalado frente al mundo como el héroe que necesitamos desesperadamente para liberarnos de las garras de la pandemia de COVID-19. Si sus trucos de relaciones públicas y filantropía logran convencer a las personas de que él es el salvador que han estado buscando, es probable que nos enfrentemos a un futuro de vigilancia de rastreo de contactos, certificados digitales para viajar, vacunas forzadas, seguimiento y restricciones de todo movimiento y cuarentenas forzadas.

Lo único que se interpone entre Gates y su agenda son los corazones y las mentes libres del mundo. Nuestro tiempo es corto. Debemos organizarnos, compartir esta información vital y #ExposeBillGates.

Fuente: La red de dinero oscuro e influencia de Bill Gates – Parte 3: Vigilancia de la salud, Evento 201 y la conexión Rockefeller (thelastamericanvagabond.com)

The Last American Vagabond

“El pangolín volador”

Es el título de un gran artículo de Andreas Canetti, profesor emérito de política exterior. Con más de 26.000 palabras y 283 notas, el escrito es indispensable para el tema Covid-19, y sin ironía alguna, intuyes que poco se sabe del virus y que nada es lo que parece. La geopolítica, estrategia, guerra y economía juega y está jugando a pesar del virus. ¿Y si digo, jugó? Esto quiere decir que había personas que conocían la futura pandemia, no alguna futurible, sino esta. Y a otros que deberían saberlo, se lo ocultaron y otros o los mismos no actuaron a tiempo para no descubrir o desenmascararse a tiempo, tiempo que los acusaban de una actuación “criminal” velando la verdad o poniendo otra arista como una viga de grande en las ecuaciones, largas como el genoma de un pequeño virus.

Pero más allá de esta tesina y por ende nacida de ella hay algo intuitivo en el fin de lo que voy a exponer en dos palabras, pero antes citaré a Canetti:

…El 10 de enero, la OMS recomendó precauciones basadas en la experiencia del SRAS y el MERS. Fauci tomó la decisión de desarrollar una vacuna. El 12 de enero (hora estadounidense del 11 de enero), las autoridades chinas compartieron la secuencia genética del nuevo virus, que fue publicada por la OMS y la biblioteca pública de genes GISAID. Al día siguiente, el Centro de Investigación de Vacunas de Fauci y “el equipo de investigación de enfermedades infecciosas de Moderna finalizaron la secuencia para la vacuna contra el SARS-CoV-2 y Moderna se movilizó hacia la fabricación clínica”, escribió Moderna. Un día después de que los chinos identificaran la secuencia genética y la hicieran pública, Moderna había finalizado las secuencias de la nueva vacuna y había avanzado “hacia la fabricación clínica”. ¿Cómo es esto posible? Un productor europeo de vacunas dijo que Moderna debe haber tenido el virus antes de enero. La vacuna de Moderna había recibido subvenciones de DARPA de Michael Callahan. ¿Por qué el Departamento de Defensa estaba financiando esta vacuna? El 14 de enero, la OMS propuso nuevas precauciones”…

La investigación científica disponible, incluidos varios estudios filogenéticos, apunta a un virus de Guangdong (o más bien a un virus de Yunnan/Laos/Camboya) como el “tipo ancestral” que había mutado y luego se había propagado a otros países, o a que dicho virus había pasado por un laboratorio estadounidense y luego se había sembrado como arma biológica en muchos países, sobre todo en China, donde el brote en Wuhan en el mercado de mariscos de Huanan primero hizo que este mercado apareciera como el origen del virus. Pero en diciembre de 2019, el SARS CoV-2 en Wuhan resultó ser dos virus genéticamente distantes que indicaban un ancestro común mucho más temprano que no era de Wuhan. Los virus italianos, franceses y estadounidenses aparecieron simultáneamente o más bien antes de cualquier “virus de Wuhan” conocido, y estaban genéticamente distantes de él. No fue esto último lo que se había extendido a Italia, Francia o Estados Unidos. El ministro de Relaciones Exteriores de China, Wang Yi, describió estas nuevas revelaciones científicas como “brotes separados en múltiples lugares del mundo”.280 Y sea lo que sea, ciertamente no fueron los virus los que saltaron simultáneamente de los murciélagos a los humanos en “múltiples lugares del mundo”. Sin embargo, los halcones de China, como Pompeo y Pottinger, habían utilizado deliberada y persistentemente el término, “el virus de Wuhan”, y la solicitud de Pompeo al G7 de usar este término y su negativa a firmar su documento (que no se refería a “el virus de Wuhan”), nos dicen que esta expresión había estado en camino durante algún tiempo. Su persistente petición a todos los estados occidentales de responsabilizar a China por “el virus de Wuhan” indica que este era en realidad el punto con el virus ya antes de los primeros informes en China.

Trump dice: “Esto es peor que Pearl Harbor, esto es peor que el World Trade Center [911 …]. Debería haberse detenido justo en la fuente [en China]”.Como si esta pandemia, como la de Pearl Harbor y el 11 de septiembre, estuviera a punto de desencadenar una nueva guerra estadounidense, no una participación estadounidense en la Guerra Mundial como en 1941, no una “Guerra contra el Terrorismo” como en 2001, sino una “guerra híbrida” (una guerra económico-biológica) de 2021 con China que rehaga la geopolítica global. Los veinte años de “guerra contra el terrorismo” pueden ser reemplazados por veinte años de “guerra híbrida” contra China. A nivel nacional, sin embargo, el virus parece haber sido un vehículo para derribar a un Presidente errático y menos confiable. La cobertura de los medios de comunicación (el “thriller de noticias en vivo” en curso) muestra que este no es un brote viral regular. Otra cosa es otra cosa. Se trata de una Operación Especial convertida en un psyop importante. Esto no es sólo una gripe grave. Es un “ejercicio en vivo”, pero “podría ser mucho peor”, por citar a Kadlec: “habrá otra pandemia, garantizada”.

Las dos palabras que han recorrido mi columna vertebral con un sonido ronco como cuando trocean un atún de cientos de kilos a la última frase del artículo, ha sido, “La vacuna”*.

*Ni promuevo ni niego la vacuna, todos somos muy mayorcitos. Los niños son otra cosa.

G.R.M.

The Flying Pangolin, by Andreas Canetti – The Unz Review

The Flying Pangolin

It’s the title of a great article by Andreas Canetti, Emeritus Professor of Foreign Policy. With more than 26,000 words and 283 notes, the writing is essential for the Covid-19 issue, and without any irony, you sense that little is known about the virus and that nothing is what it seems. Geopolitics, strategy, war and economics play and are playing despite the virus. What if I say, he played? This means that there were people who knew about the future pandemic, not some future pandemic, but this one. And to others who should know it, they hid it from them and others or they did not act in time so as not to discover or unmask themselves in time, while they were accused of a “criminal” action, veiling the truth or putting another edge like a large beam in the equations as long as the genome of a small virus.

But beyond this thesis and therefore born from it, there is something intuitive in the end of what I am going to explain in two words, but first I will quote Canetti:

 …On January 10, WHO recommended precaution based on experience from SARS and MERS. Fauci took the decision to develop a vaccine. On January 12 (January 11 US time), Chinese authorities shared the genetic sequence of the new virus, which was published by the WHO and the public gene library GISAID. The next day, Fauci’s Vaccine Research Center and “Moderna’s infectious disease research team finalized the sequence for the SARS-CoV-2 vaccine and Moderna mobilized toward clinical manufacture”, Moderna wrote.A day after the Chinese had identified the genetic sequence and made it public, Moderna had finalized sequences for the new vaccine and moved “towards clinical manufacture”. How is this possible? A European vaccine producer told that Moderna must have had the virus before January. The Moderna vaccine had received grants from Michael Callahan’s DARPA. Why was the Defense Department financing this vaccine? On January 14, WHO proposed further precaution”…

Available scientific research, including several phylogenetic studies, point either to a Guangdong (or rather to a Yunnan/Laos/Cambodia) virus as the “ancestral type” that had mutated and then spread to other countries, or to such a virus having passed through a US lab and then been seeded as a bioweapon in many countries, not least in China, where the outbreak in Wuhan at the Huanan seafood market first made this market appear as the origin of the virus. But in December 2019, the SARS CoV-2 in Wuhan turned out to be two genetically distant viruses indicating a much earlier common ancestor that wasn’t from Wuhan. The Italian, French, and US viruses appeared simultaneous or rather before any known “Wuhan virus”, and they were genetically distant from it. It was not the latter that had spread to Italy, France, or to the US. China’s Foreign Minister Wang Yi described these new scientific revelations as “separate outbreaks in multiple places in the world”. And whatever it was, it was certainly not viruses that simultaneously jumped from bats to humans at “multiple places in the world”. However, the China hawks, like Pompeo and Pottinger, had deliberately and persistently used the term, “the Wuhan virus”, and Pompeo’s request to G7 to use this term and his refusal to sign its document (that did not refer to “the Wuhan virus”), tell us that this expression had been in the pipeline for some time. His persistent request to all Western states to hold China accountable for “the Wuhan virus” indicates that this was actually the point with the virus already before the very first reports in China. 

Trump says: “This is worse than Pearl Harbor, this is worse than the World Trade Center [911 …]. It should have been stopped right at the source [in China],” as if this pandemic, like Pearl Harbor and September 11, is about to trigger a new US war, not a US participation in World War as in 1941, not a “War on Terror” as in 2001, but a 2021 “hybrid war” (an economic-biological war) with China that will remake global geopolitics. The twenty years of “War on Terror” may be replaced by twenty years of “hybrid war” against China. Domestically, however, the virus appears to have been a vehicle to bring down an erratic and less trustworthy President. The media coverage (the ongoing “live news thriller”) shows that this is not a regular viral outbreak. It is something else. It is a Special Operation made into a major PSYOP. This is not just a serious flu. It is a “live exercise”, but “it could be much worse”, to quote Kadlec: “there will be another pandemic, guaranteed”.

The two words that have crossed my spine with a hoarse sound like when they chop a tuna of hundreds of kilos to the last sentence of the article, has been, “The vaccine”*.

* I neither promote nor deny the vaccine, we are all very old. Children are something else.

The Flying Pangolin, by Andreas Canetti – The Unz Review

Ivermectina: Tratamiento barato de Covid demostrado ser altamente eficaz en un nuevo estudio revisado por pares

Un nuevo estudio revisado por pares por el Dr. Pierre Kory y sus colegas sobre Ivermectin ha sido publicado en el American Journal of Therapeutics. Titulado“Revisión de la evidencia emergente que demuestra la eficacia de la ivermectina en la profilaxis y tratamiento del COVID-19”,proporciona una nueva visión general autorizada de la evidencia hasta la fecha y pide que el fármaco ampliamente disponible sea “desplegado global y sistemáticamente en la prevención y tratamiento del COVID-19”.

El estudio resume la impresionante base de evidencia para el uso de Ivermectina.

1. Desde 2012, múltiples estudios in vitro han demostrado que la ivermectina inhibe la replicación de muchos virus, incluyendo la gripe, el zika, el denguey otros.

2. La ivermectina inhibe la replicación SARS-CoV-2 y la unión al tejido huésped a través de varios mecanismos observados y propuestos.

3. La ivermectina tiene potentes propiedades antiinflamatorias con datos in vitro que demuestran una profunda inhibición tanto de la producción de citoquinas como de la transcripción de factor nuclear-κB (NF-κB), el mediador más potente de la inflamación.

4. La ivermectina disminuye significativamente la carga viral y protege contra el daño de los órganos en múltiples modelos animales cuando se infecta con SARS-CoV-2 o coronavirus similares.

5. La ivermectina previene la transmisión y el desarrollo de la enfermedad covid-19 en los expuestos a pacientes infectados.

6. La ivermectina acelera la recuperación y previene el deterioro en pacientes con enfermedad leve a moderada tratada a tiempo después de los síntomas.

7. La ivermectina acelera la recuperación y evita el ingreso y la muerte en pacientes hospitalizados en la UCI.

8. La ivermectina reduce la mortalidad en pacientes en estado crítico con COVID-19.

9. La ivermectina conduce a reducciones temporalmente asociadas en las tasas de mortalidad por casos en las regiones después de las campañas de distribución de ivermectina.

10. La seguridad, la disponibilidad y el costo de la ivermectina son casi incomparables dada su baja incidencia de interacciones importantes con fármacos, junto con sólo efectos secundarios leves y raros observados en casi 40 años de uso y miles de millones de dosis administradas.

11. La Organización Mundial de la Salud ha incluido durante mucho tiempo la ivermectina en su “Lista de medicamentos esenciales”.

La calidad de las pruebas de Ivermectin ha sido cuestionada, lo que ha llevado a muchos países, incluyendo el Reino Unido y Estados Unidos, a no recomendar su uso para COVID-19. El estudio toma esta crítica de frente.

Aunque un subconjunto de ensayos tiene un diseño observacional, debe reconocerse que en el caso de la ivermectina (1) la mitad de los ensayos utilizaron un diseño de ensayo controlado aleatorizado (12 de los 24 revisados anteriormente) y (2) los diseños de ensayos observacionales y aleatorizados llegan a conclusiones equivalentes en promedio, como se informó en una gran revisión cochrane del tema a partir de 2014. En particular, los TCT que utilizan técnicas de coincidencia de propensión (como en el estudio rajter de Florida) encuentran conclusiones casi idénticas a los TCC realizados posteriormente en muchos estados de enfermedades diferentes, incluyendo síndromes coronarios, enfermedades críticas y cirugía. Del mismo modo, como se evidencia en los metaanálisis de la profilaxis y el ensayo de tratamiento, así como en la tabla de ensayos sumarios, la totalidad de los beneficios encontrados en los diseños de ensayos de OCT y RCT se alinean tanto en la dirección como en la magnitud del beneficio. Esta consistencia de beneficio entre numerosos ensayos de diseños de diferentes tamaños de múltiples países y centros diferentes de todo el mundo es única y proporciona un apoyo fuerte y adicional.

Un indicio de la política en torno a Ivermectin se puede recoger en la sección de discusión, donde los autores se preguntan cuánta más evidencia necesita un medicamento barato y seguro como la ivermectina en una emergencia internacional antes de que pueda ser aprobado.

Los continuos desafíos a los que se enfrentan los proveedores de atención médica al decidir sobre intervenciones terapéuticas apropiadas en pacientes con COVID-19 se aliviarían considerablemente si la orientación basada en evidencia más actualizada y proporcional provenía de los principales organismos gubernamentales de atención médica. Actualmente, en los Estados Unidos, las directrices de tratamiento para COVID-19 son emitidas por los Institutos Nacionales de Salud. Su recomendación más reciente sobre el uso de ivermectina en pacientes con COVID-19 se actualizó por última vez el 11 de febrero de 2021, donde encontraron que “no había pruebas suficientes para recomendar a favor o en contra de la ivermectina en COVID-19”. Para que una recomendación más definitiva sea emitida por los principales organismos líderes de salud pública (PHA), es evidente que se necesitan aún más datos sobre la calidad y la cantidad de ensayos, incluso durante una emergencia mundial de atención médica, y teniendo en cuenta una intervención segura, oral, de bajo costo, ampliamente disponible e implementable, como la ivermectina.

Los autores añaden que hay más pruebas en camino y expresan una seria esperanza de que “si los beneficios anteriores en los resultados clínicos continúan siendo reportados en los ensayos restantes … esta casi duplicación de la actual base de pruebas de apoyo merecería una recomendación para su uso por la OMS, los NIH y otros ACUERDOS de apoyo”.

El estudio incluye dos gráficos llamativos, de Perú y Uruguay, que ilustran la fuerte asociación del uso de Ivermectina con la reducción de las infecciones y muertes de Covid.

Alto Parana utilizó Ivermectin desde donde la línea va audaz, mientras que los otros estados no
En Perú, Lima no utilizó Ivermectin, mientras que los otros estados

Teniendo en cuenta la rapidez con la que se han autorizado las vacunas que utilizan tecnología novedosa con registros de seguridad no probados a largo plazo para su uso, la falta de aprobación de un medicamento seguro conocido con pruebas considerables que sugieran beneficios clínicos es casi inexplicable. Algunos han sugerido que la resistencia ha sido motivada por el deseo de las compañías farmacéuticas de priorizar medicamentos más rentables como las vacunas. Si es así, este es un ejemplo criminal de poner las ganancias ante la gente.

Es bueno ver este estudio llegar a la publicación. (Hay rumores de que algunos diarios lo rechazaron, no por ninguna razón técnica, sino porque sería controvertido, posiblemente con sus patrocinadores.) Es de esperar que haya muchos más estudios de este tipo, y un cambio radical en las actitudes de los reguladores hacia medicamentos reutilizados como la ivermectina.

Por Will Jones / 3 de mayo de 2021 • 22.38

Ivermectin: Cheap Covid Treatment Shown to be Highly Effective in New Peer-Reviewed Study – Lockdown Sceptics

Tribunal Administrativo de Viena: Política coronavirus sin fundamento, prueba de PCR inapropiada

Un fallo que toda Austria, y tal vez el mundo entero, lleva esperando más de un año.

Por fin, un tribunal ha examinado los fundamentos inestables sobre los que descansa la política corona, que reclama una peligrosa pandemia mundial. Recientemente, el reconocido profesor John Ioannidis encontró que la mortalidad por infección por SARS-CoV-19 es sólo del 0,15 por ciento, exactamente la misma que la de la gripe anual. Durante la supuesta pandemia, aproximadamente tantas personas parecen haber contraído covid-19 como de otra manera habría contraído la gripe – mientras que supuestamente no hay o casi ningún caso de gripe en todo el mundo. Esto está dando a más y más personas una pausa para pensar.

Definición de enfermedad completamente incorrecta

El Tribunal Administrativo de Viena examinó de cerca las bases de la política histérica del gobierno federal austriaco y constató que la definición de enfermedad del ministro Anschober por sí sola es completamente errónea e infundada.

Si uno va por las definiciones del Ministro de Salud, “Definición de caso Covid-19” de 23.12.2020, un “caso confirmado” es:

1) cualquier persona con detección de ácido nucleico específico SARS-CoV-2 (prueba de PCR, nota), independientemente de la manifestación clínica, o

2) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios clínicos, o

3) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios epidemiológicos.

Por lo tanto, ninguno de los tres “casos confirmados” definidos por el Ministro de Salud cumple con los requisitos del término de la OMS “persona enferma/infectada”. La OMS rechaza la única invocación de la prueba del ITP (caso confirmado 1).

Motivo de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Si viviéramos en una democracia, este juicio sería capaz de cambiarlo todo. Todas las medidas tendrían que ser revocadas inmediatamente, todo el gobierno federal tendría que renunciar y tendría que ser procesado legalmente por la destrucción sin sentido de innumerables medios de vida.

Una cita igualmente memorable, que muestra hasta qué punto la política, pero también los medios comprados han engañado al público en el último año:

En él, el Servicio de Salud de la Ciudad de Viena utiliza las palabras “números de caso”, “resultados de pruebas”, “incidencia de casos”, así como “número de infecciones”. Esta mezcla de términos no hace justicia a una evaluación científica de la situación epidémica. (…) Para la OMS, el factor decisivo es el número de infecciones/enfermedades y no el número de personas que dieron positivo u otros “números de casos”.

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Como base de la parte médica de las razones de la sentencia, el tribunal se basó en lo siguiente:

Aviso de información de la OMS para usuarios de IVD 2020/05, tecnoloqies de testinq (NAT) de ácido nucleico que utilizan reacción en cadena de polimerasa (PCR) para la detección de SARS-CoV-2, 20 de enero de 2021.

Estudio de 2020 (Bullard, J., Dust, K., Funk, D., Strong, J. E., Alexander, D., Garnett, L., & Poliquin, G. (2020). Predecir el coronavirus del síndrome respiratorio agudo grave infeccioso 2 a partir de muestras diagnósticas. Enfermedades Infecciosas Clínicas, 7j(10), 2663-2666.)

Dr. Cary Mullis (inventor de la prueba de PCR): “… que una prueba de PCR no es diagnóstica y, por lo tanto, por sí sola no revela nada sobre la enfermedad o infección de una persona.”

El tribunal afirma que un médico por sí solo tiene derecho a determinar si una persona está enferma o sana (2 párr. 2 Z 1 y 2 Ärztegesetz1998, BGBI. I. Nº 169/1998 modificado por BGBI. I No. 31/2021).

También se menciona la extrema tendencia a errores de las pruebas de antígeno, y se critica que la Comisión Corona se basaría exclusivamente en tales pruebas de antígeno para los análisis actuales. Esta pequeña información por sí sola es una bomba política.

Si la Comisión Corona hubiera utilizado la definición de caso del Ministro de Salud y no la de la OMS; cualquier determinación del número de “números enfermos/infectados para “enfermos/infectados” es errónea.

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, de 24 de marzo de 2021.

El veredicto aún puede ser apelado ante el Tribunal Constitucional o se puede presentar un recurso extraordinario ante el Tribunal Contencioso Administrativo.

Vienna Administrative Court: Corona Policy Without Basis, PCR Test Inappropriate | Europe Reloaded

Oponerse a la dictadura sanitaria perjudica gravemente la salud

Opposing the health dictatorship seriously harms health

Burundi y Tanzania compartieron la oposición de sus dirigentes ante las medidas de la OMS. El presidente de Burundi, Pierre Nkurunziza, expulsó a los sicarios de la OMS de su país, mientras que el presidente tanzano, John Magufuli, químico, hizo lo propio, tras demostrar al mundo que los test PCR con los que querían justificar la inexistente epidemia, ofrecían falsos positivos, tanto en muestras obtenidas en papayas, como en aceite de coche o en cabras. Twitter.

La osadía de estos presidentes les ha costado la vida, ambos han sufrido un desafortunado “infarto” como advertencia al resto sobre que va a suceder a cualquiera que no colabore con los psicópatas que controlan el mundo

Estamos ante dos mártires de la lucha contra la dictadura mundial, pero una historia escrita por estos asesinos, olvidará pronto y pervertirá la memoria sobre estos y todos los que se oponen a el N.O.M.

Por supuesto sus sucesores han tomado buena nota de lo que les espera si no colaboran y de lo rentable que puede resultar para ellos que lo hagan. No habrá que extrañarse, pues, de que de las ínfimas cifras de muertes atribuidas al coronavirus en dichos países (recordemos que los diez países más pobres de Africa han tenido, en conjunto, menos víctimas mortales del Covid que la Comunidad Autónoma de Madrid, por tener un referente) pasemos en breve a elevadas tasas de mortalidad que “obliguen” a las autoridades a abrir las puertas a las “salvadoras” compañías farmacéuticas.

A estas alturas debería entenderse que a pesar de ser un negocio millonario, no se trata solo de dinero. También que estamos solo al principio de algo mucho peor de lo que las mentes más retorcidas puedan sospechar.

(Fuente: Astillas de realidad)

31 Razones por las que no tomaré la vacuna

Por el Rabino Chananya Weissman

  1. No es una vacuna. Una vacuna por definición proporciona inmunidad a una enfermedad. Esto no proporciona inmunidad a nada. En el mejor de los casos, simplemente reduce la posibilidad de obtener un caso grave de un virus si uno lo atrapa. Por lo tanto, es un tratamiento médico, no una vacuna. No quiero tomar un tratamiento médico para una enfermedad que no tengo.
  2. Las compañías farmacéuticas, los políticos, el establecimiento médico y los medios de comunicación han unido sus fuerzas para referirse universalmente a esto como una vacuna cuando no es una, con la intención de manipular a las personas para que se sientan más seguras a la hora de someterse a un tratamiento médico. Debido a que están siendo engañosos, no confío en ellos, y no quiero tener nada que ver con su tratamiento médico.
  3. Los supuestos beneficios de este tratamiento médico son mínimos y no durarían mucho en ningún caso. El establecimiento lo reconoce, y ya está hablando de vacunas adicionales y un número cada vez mayor de nuevas “vacunas” que se requerirían regularmente. Me niego a convertirme en un paciente crónico que recibe inyecciones de nuevos productos farmacéuticos de forma regular simplemente para reducir mis posibilidades de obtener un caso grave de un virus que estas inyecciones ni siquiera previenen.
  4. Puedo reducir mis posibilidades de tener un caso grave de un virus fortaleciendo mi sistema inmunológico naturalmente. En el caso de que contrate un virus, hay vitaminas y medicamentos bien establecidos que han tenido resultados maravillosos en la protección de la enfermedad, sin los riesgos y incógnitas de este tratamiento médico.
  5. El establecimiento insiste en que este tratamiento médico es seguro. No pueden saber esto porque los efectos a largo plazo son totalmente desconocidos, y no se conocerán durante muchos años. Pueden especular que es seguro, pero es falso para ellos hacer tal afirmación que no puede ser conocida. Debido a que están siendo falsos, no confío en ellos, y no quiero ninguna parte de su tratamiento.
  6. Las compañías farmacéuticas tienen cero responsabilidad si algo sale mal, y no pueden ser demandadas. Lo mismo para los políticos que están impulsando este tratamiento. No me inyectaré un nuevo dispositivo médico experimental cuando las personas detrás de él no acepten ninguna responsabilidad si algo sale mal. No arriesgaré mi salud y mi vida cuando se nieguen a arriesgar nada.
  7. El primer ministro de Israel ha admitido abiertamente que el pueblo israelí es el laboratorio mundial para este tratamiento experimental. No me interesa ser conejillo de indias ni donar mi cuerpo a la ciencia.
  8. Israel aceptó compartir datos médicos de sus ciudadanos con una compañía farmacéutica extranjera como parte fundamental de su acuerdo para recibir este tratamiento. Nunca consiento que mis datos médicos personales fueran compartidos con ninguna de esas entidades, ni siquiera me lo pidieron. No contribuiré a esta empresa sórdida.
  9. Los ejecutivos y miembros de la junta directiva de Pfizer están registrados en que no han tomado su propio tratamiento, a pesar de toda la fanfarria y las garantías. Alegan que considerarían injusto “cortar la línea”. Esta es una excusa absurda, y se necesita una cantidad increíble de chutzpah para decir tal cosa. Tal “línea” es un producto de su propia imaginación; si acapararan un par de inyecciones por sí mismos nadie lloraría mal. Además, los multimillonarios con aviones privados e islas privadas no son conocidos por esperar en la fila hasta que cientos de millones de campesinos en todo el mundo van primero a recibir lo que estos multimillonarios quieren para sí mismos.
  10. Los medios de comunicación han aceptado esta absurda excusa sin preguntas ni preocupaciones. Además, elogian a los ejecutivos de Pfizer por su supuesto sacrificio en no tomar su propio tratamiento experimental hasta que vayamos primero. Ya que nos consideran tan tontos, no confío en ellos, y no quiero su nuevo tratamiento. Pueden tener mi lugar en la fila. Iré a la parte de atrás de la línea.
  11. Tres hechos que deben ser reunidos:
  • Bill Gates está promocionando estas vacunas como esenciales para la supervivencia de la raza humana.
  • Bill Gates cree que el mundo tiene demasiada gente y necesita ser “despoblado”.
  • Bill Gates, quizás el hombre más rico del mundo, tampoco ha sido inyectado. No hay prisa.

No. Transmitiré cualquier tratamiento médico que quiera que tome.

  1. El establecimiento ha sido totalmente unilateral en la celebración de este tratamiento. Los políticos y los medios de comunicación están instando a la gente a tomarlo como un deber moral y cívico. Los beneficios del tratamiento están siendo muy exagerados, los riesgos están siendo ignorados y las incógnitas están siendo desechadas. Debido a que están siendo engañosos y manipuladores, no apostaré mi bienestar personal en su integridad.
  2. Hay una intensa campaña de propaganda para que la gente tome este tratamiento. Los políticos y las celebridades se están tomando selfies de sí mismos inyectados (tal vez en algunos casos fingiendo ser inyectados), los medios de comunicación están exagerando esto como lo más genial, inteligente, feliz y divertido de hacer. Es la campaña de marketing más extendida de la historia. Esto no es en absoluto apropiado para ningún tratamiento médico, y mucho menos uno nuevo, y me hace retroceder.
  3. Las masas están siguiendo en remolque, publicando fotos de sí mismos siendo inyectados con un medicamento, alimentando la presión de los compañeros de masa para hacer lo mismo. Hay algo muy alarmante y enfermo en esto, y no quiero formar parte de ello. Nunca tomé drogas sólo porque “todo el mundo lo está haciendo” y está bien. Ciertamente no voy a empezar ahora.
  4. Aquellos que plantean preocupaciones sobre este tratamiento médico están siendo intimidados, calumniados, burlados, censurados, ostracizados, amenazados y despedidos de sus trabajos. Esto incluye profesionales médicos que tienen preocupaciones basadas en la ciencia sobre la droga y cuidadores que han sido testigos de personas bajo su cargo que sufren reacciones horribles y la muerte poco después de ser inyectados. Cuando el establecimiento está purgando buenas personas que arriesgan todo simplemente para plantear preocupaciones sobre un nuevo tratamiento médico , incluso si no se oponen abiertamente a él – confiaré en estas personas valientes sobre el establecimiento cada vez. No puedo pensar en un solo caso similar en la historia cuando la verdad y la moralidad resultaron estar del lado del establishment.
  5. Este es el mayor experimento médico en la historia de la raza humana.
  6. A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado.
  7. Si estuvieran al frente con las masas, muy pocos aceptarían participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.
  8. El establecimiento médico no está informando a la gente sobre nada de esto. Se han convertido en agentes de marketing para una droga experimental, sirviendo a grandes empresas y políticos que han hecho tratos con ellos. Se trata de un conflicto directo con su mandato de preocuparse exclusivamente por el bienestar de las personas a su cargo. Dado que el establecimiento médico se ha corrompido, y se ha convertido en nada más que una herramienta corporativa y política, no confío en la droga experimental de la que tanto quieren inyectarme.
  9. Estamos siendo presionados de varias maneras para que nos inyecten, lo que viola la ética médica y los fundamentos de la sociedad democrática. La mejor manera de conseguir que no haga algo es presionarme para que lo haga.
  10. El gobierno ha sellado su protocolo relacionado con el virus y los tratamientos durante TREINTA AÑOS. Esta es la información que el público tiene derecho a conocer, y el gobierno tiene la responsabilidad de compartir. ¿Qué están encubriendo? ¿Realmente esperan que crea que todo es kosher sobre todo esto, y que están preocupados ante todo por mi salud? La última vez que lo hicieron fue con el Asunto de los Niños Yemeníes. Si no estás familiarizado con eso, ísralo. Ahora están tirando del mismo shtick. No me engañaron la primera vez, y definitivamente no me están engañando ahora.
  11. ¿El gobierno puede compartir nuestros datos médicos personales con corporaciones extranjeras, pero no compartirán su propio protocolo sobre el asunto con nosotros? Estoy fuera.
  12. El establecimiento ha reclutado médicos, rabinos, medios de comunicación y masas para arengar a personas que no quieren que se les inyecte un nuevo medicamento. Nos llaman el peor tipo de nombres. Nos dicen que creemos en conspiraciones locas, que estamos en contra de la ciencia, que somos egoístas, que somos asesinos, que no nos importan los ancianos, que es culpa nuestra que el gobierno siga imponiendo restricciones draconianas al público. Todo se debe a que no queremos que nos inyecten un tratamiento experimental, sin preguntas. Incluso se nos dice que tenemos la obligación religiosa de hacer esto, y que somos pecadores graves si no lo hacemos. Dicen que si no estamos de acuerdo en que nos inyecten, debemos ser obligados a permanecer dentro de nuestros hogares para siempre y ser excluidos de la vida pública.Esto es horrible, repugnante, una perversión del sentido común, la moralidad y la Torá. Me hace retroceder, y sólo consolida aún más mi desconfianza hacia estas personas y mi oposición a tomar su droga experimental. ¿Cómo se atreven?
  13. Sé de muchas personas que se inyectaron, pero ninguna de ellas estudió la ciencia en profundidad, sopesó cuidadosamente los beneficios potenciales contra los riesgos, comparó esta opción con otras alternativas, fue verdaderamente informada, y decidió que este tratamiento médico era la mejor opción para ellos. Por el contrario, se les inyectó por el bombo, la propaganda, la presión, el miedo, la confianza ciega en lo que supuestamente creían “la mayoría de los expertos” (suponiendo que todos estudiaran todo en profundidad y fueran completamente objetivos, lo cual es altamente dudoso), la confianza ciega en lo que ciertos rabinos influyentes les instaron a hacer (ditto lo anterior), o el miedo histérico de que la única opción era inyectarse o enfermarse gravemente por el virus. Cuando vea histeria masiva y comportamiento similar a un culto en torno a un tratamiento médico, sospecharé mucho y lo evitaré.
  14. Las compañías farmacéuticas tienen una larga y gloriosa historia de causar carnicería masiva con drogas maravillosas que empujaban a poblaciones desprevenidas, incluso después de que ya se conocieran problemas graves. En lugar de presionar el botón de pausa y detener la comercialización de estos medicamentos hasta que estos problemas pudieran ser investigados adecuadamente, las compañías farmacéuticas hicieron todo lo que estaba en su poder para suprimir la información y seguir empujando sus productos. Cuando las empresas y las personas han demostrado una falta tan grave de preocupación por la vida humana, no confiaré en ellas cuando bombeen una nueva droga maravilla. Este no es nuestro primer rodeo.
  15. De hecho, las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados, el establecimiento médico los está dejando de lado como no relacionados o insignificantes, los medios de comunicación lo ignoran, las compañías farmacéuticas están avanzando a toda velocidad, y aquellos que levantan una bandera roja siguen siendo intimidados, censurados y castigados. Claramente mi vida y mi bienestar no son su principal preocupación. No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima “coincidencia”.
  16. Aunque muchas personas han muerto poco después de ser inyectadas – incluyendo jóvenes perfectamente sanos – no se nos permite dar a entender que la inyección tuvo algo que ver con ella. De alguna manera esto es anti-ciencia y hará que más personas mueran. Creo que negar cualquier posible vínculo, abusar de la gente que especula que puede haber un vínculo, y demostrar no la más mínima curiosidad para explorar si puede haber un vínculo es lo que es anti-ciencia y muy bien podría causar la muerte de más personas. Esta misma gente cree que estoy obligado a inyectarme también. No hay un maldito agradecimiento.
  17. Estoy repulsado por la adoración religiosa, culta de un producto farmacéutico, y no participaré en este ritual.
  18. Mi proveedor de “atención médica” me sigue molestando para que me inyecten, sin embargo, no me han proporcionado ninguna información sobre este tratamiento o cualquier posible alternativa. Todo lo que sé lo aprendí de otros fuera del establecimiento. El consentimiento informado se ha convertido en consentimiento conforme. Me niego.
  19. Veo todas las mentiras, corrupción, propaganda, manipulación, censura, intimidación, violación de la ética médica, falta de integridad en el proceso científico, represión de reacciones adversas inconvenientes, desestimación de preocupaciones legítimas, histeria, comportamiento de culto, ignorancia, mente cerrada, miedo, tiranía médica y política, ocultación de protocolos, falta de verdadera preocupación por la vida humana, falta de respeto a los derechos humanos básicos y libertades, perversión de la Torá y sentido común , demonización de las buenas personas, el mayor experimento médico de todos los tiempos que llevan a cabo las personas codiciosas, poco confiables, sin dios, la falta de responsabilidad para aquellos que exigen que arriesgue todo… Veo todo esto y he decidido que todos pueden tener mi lugar en la fila. Pondré mi confianza en Dios. Usaré la mente con la que Él me bendijo y confiaré en mis instintos naturales. Lo que lleva a la razón final que resume por qué no voy a “vacunar”.
  20. Todo apesta.

ChananyaWeissman.com

No creas todo lo que lees sobre las muertes por gripe (2014)

Este artículo es de 2014. Saquen vuestras propias conclusiones. Es muy interesante y clarificador. Nada se sabía de la pandemia del Covid-19.

01/24/2014 05:40 EST | Actualizado:03/26/2014 05:59h

No creas todo lo que lees sobre las muertes por gripe

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional.

Lawrence Salomón Columnista

La gripe provoca “entre 250.000 y 500.000 muertes anuales” en todo el mundo, nos dice Wikipedia. “La estimación típica es de 36,000 [muertes] al año en los Estados Unidos”, informa NBC, citando los Centros para el Control de Enfermedades. “Entre 4.000 y 8.000 canadienses al año mueren de gripe y sus complicaciones relacionadas, según la Agencia de Salud Pública de Canadá”, dice el Globe and Mail, agregando que “esas cifras son controvertidas porque son estimaciones”.

“Controversial” es un eufemismo, y no sólo en Canadá, y no sólo porque las cifras son estimaciones. Las cifras difieren enormemente de los sobrios recuentos registrados en los certificados de defunción -por ley cada certificado debe mostrar una causa- y reportados por las agencias oficiales que recopilan y mantienen estadísticas vitales.

Según el Sistema Nacional de Estadísticas Vitales en los EE.UU., por ejemplo, las muertes anuales por gripe en 2010 ascendieron a sólo 500 por año– menos que las muertes por úlceras (2.977), hernias (1.832) y embarazo y parto (825), y muy lejos de las grandes causas de muerte como las cardiopatías (597.689) y los cánceres (574.743). La historia es similar en Canadá, donde los asesinos poco probables también empequeñecen el recuento de muertes por gripe en Canadá.

Incluso esa cifra de 500 para Estados Unidos podría ser demasiado alta, según análisis en revistas autorizadas como el American Journal of Public Health y el British Medical Journal. Sólo alrededor del 15-20% de las personas que presentan síntomas similares a los de la gripe tienen el virus de la gripe– el otro 80-85% realmente contagió rinovirus u otros gérmenes que son indistinguibles de la verdadera gripe sin pruebas de laboratorio, que rara vez se hacen. En 2001, un año en el que los certificados de defunción enumeraban a 257 estadounidenses como que habían muerto de gripe, sólo 18 fueron identificados positivamente como verdaderas gripes. Los otros 239 simplemente se suponía que eran gripes y muy probablemente tenían pocas gripes verdaderas entre ellos.

“Los datos estadounidenses sobre las muertes por gripe son un desastre”, afirma un artículo de 2005 en el British Medical Journal titulado “¿Las cifras de mortalidad por gripe en Ee.UU. son más relaciones públicas que científicas?” Este artículo cuestiona la cifra de 36.000 muertes por gripe comúnmente reclamada, y con la descripción de la “gripe/neumonía” como la séptima causa de muerte en los Estados Unidos.

“¿Pero por qué se agrupan la gripe y la neumonía?”, se pregunta el artículo. “¿Es la relación tan fuerte o única para justificar su caracterización como una sola causa de muerte?”

La respuesta del artículo es no. La mayoría de las muertes por neumonía no están relacionadas con la gripe. Por ejemplo, “los medicamentos supresores del ácido estomacal están asociados con un mayor riesgo de neumonía adquirida por la comunidad, pero estos medicamentos y neumonía no se compilan como una sola estadística”, explicó el Dr. David Rosenthal, director de los Servicios de Salud de la Universidad de Harvard. “La gente no necesariamente muere, per se, del virus [de la gripe]: la viremia. De lo que mueren es de una neumonía secundaria”.

La neumonía, según la Asociación Americana del Pulmón, tiene más de 30 causas diferentes,siendo la gripe sólo una de ellas. El propio CDC reconoce la escasa relación, diciendo que “sólo una pequeña proporción de las muertes… sólo el 8,5% de todas las muertes por neumonía y gripe [están] relacionadas con la gripe.”

Debido a que los certificados de defunción desmienten las afirmaciones de numerosas muertes por gripe, los CDC reclutaron modelos informáticos para llegar a su estimación de 36.000 muertes por gripe. Pero incluso aquí necesitaba doblar la terminología médica convencional para llegar a cifras de muerte convincentes.

“Las estadísticas de causa de muerte se basan únicamente en la causa subyacente de la muerte [definida internacionalmente] como ‘la enfermedad o lesión que inició el tren de eventos que condujeron directamente a la muerte'”, explica el Centro Nacional de Estadísticas de Salud. Debido a que la gripe rara vez fue una “causa subyacente de muerte”, los CDC crearon el término sólido, “muerte asociada a la gripe”.

Usando esta nueva definición suelta, los modelos informáticos de los CDC podrían contar a las personas que murieron de una dolencia cardíaca u otras causas después de tener gripe. Como admitió William Thompson, del Programa Nacional de Inmunización de los CDC, la mortalidad asociada a la gripe es “una asociación estadística … No sé si diríamos que es la causa subyacente de la muerte”.

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional. “Realmente parecía que necesitábamos hacer algo para animar a la gente a vacunarse contra la gripe”.

La respuesta de los CDC fue su “receta de siete pasos para generar interés en la vacunación contra la gripe (o cualquier otra) vacuna”, una muestra de diapositivas que Nowak presentó en la Cumbre Nacional de Vacunas contra la Gripe de 2004.

Aquí está la “Receta que fomenta el interés y la demanda de la vacuna antigripal”, en el lenguaje truncado que aparece en sus diapositivas: “Los expertos médicos y las autoridades de salud pública [deberían] públicamente (por ejemplo a través de los medios de comunicación) declarar preocupación y alarma (y predecir resultados nefastos) – e instar a la vacunación contra la gripe.” Esta receta, indicó su presentación de diapositivas, daría lugar a “un interés y atención significativas de los medios de comunicación … en términos que motivan el comportamiento (por ejemplo, como ‘muy grave’, ‘más grave que los últimos o años pasados’, ‘mortal’). Otras recomendaciones emotivas incluyeron fomentar “la percepción de que muchas personas son susceptibles a un mal caso de gripe” y “Ejemplos visibles/tangibles de la gravedad de la enfermedad (por ejemplo, imágenes de niños, familias de los afectados que se acercan) y personas que se vacunan (las primeras para motivar, esta última para reforzar) “.

Los CDC decidieron descaradamente crear un mercado masivo para la vacuna antigripal al reclutar a los medios de comunicación para que entraran en pánico entre el público. Un medio de comunicación obediente e incuestionable obligado por la hipnotización de los números, y 10 años después todavía lo está obligando.

Don’t Believe Everything You Read About Flu Deaths | HuffPost Canada (huffingtonpost.ca)

COVID, GRIPE Y RESFRIADO (SENTIDO) COMÚN

Seré breve. Según la Universidad de Maryland, EE.UU. hizo un estudio allá por el “lejano” 2018: “Descubrimos que las personas que tienen gripe contaminan con virus el aire que les rodea simplemente al respirar, sin necesidad de toser ni estornudar“, reconoce Donald Milton, profesor de salud ambiental en Maryland y principal investigador del estudio. Este especialista explica que las personas con gripe generan aerosoles infecciosos, que son pequeñas gotas que permanecen suspendidas en el aire durante mucho tiempo, incluso cuando no están tosiendo, y especialmente durante los primeros días de la enfermedad.

¿Les suena? Por tanto la gripe no ha podido desaparecer, si así fuera, tampoco habría contagio por aerosoles de la Covid-19. Es curioso. Hasta ahora, ¡¡¡SEIS CASOS DE GRIPE en la temporada 2020/21 en España!!! Con sentido común, esto es imposible de creer.

Conclusión: Si tengo gripe y el año pasado o hace dos pasé un resfriado común por coronavirus, las PCR dan positivos en bastantes casos y tenemos parte de la ecuación resuelta. Un positivo por covid que en realidad es una gripe. Incluso muertes por gripe achacadas con PCR a la covid.

Si los aerosoles son el vehículo y el SarsCov-2 y el resfriado son coronavirus y viajan en el mismo vehículo, el resfriado común no ha desaparecido y la gripe tampoco. ¿Por qué motivo iban a desaparecer si utilizan la misma forma de propagarse? Quiero decir, si hay Covid, hay aerosoles y si hay aerosoles, hay gripe y resfriado común.

G.R.M.

COVID, FLU AND THE COMMON COLD

I’ll be quick. According to the University of Maryland, USA did a study back in the “distant” 2018: “We discovered that people who have the flu contaminate the air around them with viruses simply by breathing, without the need to cough or sneeze,” he acknowledges. Donald Milton, a Maryland professor of environmental health and the study’s principal investigator. This specialist explains that people with the flu generate infectious aerosols, which are small droplets that remain suspended in the air for a long time, even when they are not coughing, and especially during the first days of the illness.

Does it ring a bell? Therefore, the flu has not been able to disappear, if it were, there would be no spread by Covid-19 aerosols. It’s curious. So far, SIX CASES OF FLU in the 2020/21 season in Spain !!! With common sense, this is impossible to believe.

Bottom Line: If I have the flu and I had a common cold from coronavirus last year or two, PCR tests are positive in quite a few cases and we have part of the equation solved. A positive for covid that is actually a flu. Even deaths from influenza attributed with PCR to covid.

If the aerosols are the vehicle and the SarsCov-2 and the cold are coronavirus and they travel in the same vehicle, the common cold has not disappeared and neither has the flu. For what reason would they disappear if they use the same way of spreading? I mean, if there is Covid, there are sprays and if there are sprays, there is flu and the common cold.

¿POR QUÉ NO HAY UNA VACUNA CON VIRUS ATENUADO DEL SARS-CoV-2?

Supongo que en el mundo en el que vivimos hoy en día, se puede preguntar sin ser borrado de Internet y sin que te señalen como “negacionista”. Peligro.

Según la CDC (Centros para el Control y la Prevención de Enfermedades de EE.UU.), hay o habrá tres clases de vacunas para el COVID-19: 1) Las vacunas ARNm; 2) Las vacunas de subunidades proteicas y 3) Las vacunas de vectores.

Como bien dice la CDC, Para despertar la respuesta inmunitaria, el sistema de muchas vacunas consiste en inyectar el germen atenuado o inactivado en nuestros organismos. Pero ninguna de las tres vacunas propuestas, son del tipo “tradicional”. Pero ¿Por qué?

Hay tres opciones, empecemos por la última, no les da la gana. La primera, el virus SARS-Cov-2 no existe y la segunda, no han conseguido secuenciarlo y aislarlo al completo. Creo que la última es la correcta. No se puede hacer una vacuna de virus atenuado si este no se conoce del todo. Lógico.

Y hay más preguntas ¿saben los Gobiernos y estas grandes farmacéuticas algo que el vulgo no sabe? ¿Se ha traficado con información? ¿Puede que el SARS-Cov-2 sea una quimera de tres virus y al menos uno de ellos no tenga vacuna descubierta ni “futurible” ni “tradicional”?

Como alguien dijo, las preguntas no son indiscretas, lo son las respuestas… Pero en este caso, ¿Por qué?

G.R.M.

WHY IS THERE NO VACCINE WITH VIRUS ATTENUATED? (Covid19)

I suppose that in the world we live in today, you can ask without being deleted from the Internet and without being singled out as a “denier”. Danger.

According to the CDC, there are or will be three classes of vaccines for COVID-19: 1) mRNA vaccines; 2) Protein subunit vaccines and 3) Vector vaccines.

As the CDC says, To awaken the immune response, the system of many vaccines consists of injecting the attenuated or inactivated germ into our organisms. But none of the three proposed vaccines are of the “traditional” type. But why?

There are three options, let’s start with the last one, they don’t feel like it. The first, the SARS-Cov-2 virus does not exist and the second, they have not managed to sequence and isolate it completely. I think the last one is correct. An attenuated virus vaccine cannot be made if the virus is not fully known. Logical.

And there are more questions. Do the governments and these big pharmaceutical companies know something that the common people do not? Has information been trafficked? Could it be that SARS-Cov-2 is a chimera of three viruses and at least one of them does not have a discovered, “future” or “traditional” vaccine?

As someone said, the questions are not indiscreet, the answers are … But in this case, why?

En la gripe asiática de 1957-58, rechazaron los encierros

Jeffrey A. Tucker – 12 de enero de 2021

La gripe asiática de 1957-58 fue una pandemia mortal con un alcance más amplio para resultados graves que Covid-19 de 2020. Mató entre 1 y 4 millones de personas en todo el mundo, y 116.000 en los Estados Unidos en un tiempo con la mitad de la población. Fue un importante contribuyente a un año en el que Estados Unidos vio 62.000 muertes en exceso.

A nivel mundial, podría haber sido cinco veces más mortal que Covid-19, medido por muertes per cápita. Era inusualmente letal para las personas más jóvenes: el 40 por ciento de las muertes se habían producido entre personas menores de 65 años, mientras que la edad promedio de muerte de Covid-19 es de 80, con sólo el 10-20% de las muertes menores de 65 años.

Lo que llama la atención es cómo los funcionarios de salud pública manejaron la pandemia. Tuvo una respuesta diametralmente opuesta a la que los responsables políticos persiguieron en 2020. Se podría suponer que esto se debió a la negligencia y la falta de sofisticación en la comprensión de la necesidad de encierro. ¡Seguro que no sabían hace 65 años lo que sabemos hoy!

En realidad, esto es completamente falso. De hecho, los expertos en salud pública consideraron el cierre de escuelas, el cierre de negocios y la prohibición de los eventos públicos, pero todo el espíritu de la profesión los rechazó. Había dos motivos para este rechazo: los bloqueos serían demasiado perturbadores, inhabilitando la capacidad de los profesionales médicos para hacer frente competentemente a la crisis, y también porque esas políticas serían inútiles porque el virus ya estaba aquí y se estaba propagando.

Mientras que los bloqueos en el caso Covid-19 podrían haber contribuido a alargar la crisis retrasando la inmunidad del rebaño, el período en el que la gripe asiática tuvo las consecuencias más graves fue de sólo tres meses. Los periódicos apenas lo cubrían y la mayoría de la gente no se daba cuenta. Las historias de la época apenas lo mencionan, mientras que la historia temprana de 2020 hablará principalmente sobre el virus y los encierros. Esto no se debe a la pandemia, sino a la brutal respuesta de la política de pandemia.

El mejor artículo único sobre la respuesta de la política de gripe asiática de 1957-58 es “Salud Pública y Respuestas Médicas a la Pandemia de Influenza 1957-58” por el gran epidemiólogo Donald A. Henderson y otros entre sus colegas en Johns Hopkins. Apareció en 2009 en la revista Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science. Se incrusta al final de este artículo.

El artículo es de vital importancia porque demuestra que no bloquear fue una decisión deliberada, no algún tipo de fracaso. La negativa a perturbar la sociedad y restringir la libertad en presencia de un patógeno fue un logro de las ideas modernas de salud pública. Desde el mundo antiguo hasta el siglo XIX, la respuesta típica a la enfermedad era atribuirla al aire corrupto y huir mientras demonizaba y excluyeba a los enfermos. Los avances médicos modernos, con el descubrimiento de virus y bacterias, antibióticos, terapias antivirales y el funcionamiento del sistema inmunitario humano, aconsejaron la calma de la comunidad y las relaciones médico-paciente.

El organismo de salud pública más influyente en ese momento era la Asociación de Oficiales de Salud Estatales y Territoriales (ASTHO). Se conocieron el 27 de agosto de 1957. Llegaron a la conclusión de que deberían recomendar la atención domiciliaria tanto como sea posible para evitar que los hospitales se abarroten. Instruirían a las personas a buscar atención médica si los síntomas se vuelven graves.

De lo contrario, ASTHO concluyó de la siguiente manera: «’No hay ninguna ventaja práctica en el cierre de escuelas ni en la restricción de las reuniones públicas en lo que se refiere a la propagación de esta enfermedad».

En particular, las escuelas no estaban cerradas porque los expertos en salud pública observaron que los niños simplemente recogerían el virus en otros lugares. “El Comisionado de Salud del Condado de Nassau en Nueva York”, señala Henderson, “declaró que ‘las escuelas públicas deben permanecer abiertas incluso en una epidemia’ y que ‘los niños se enfermarían con la misma facilidad para salir de la escuela'”.

Hemos oído incesantemente que Covid-19 requirió cierres porque es una nueva cepa para la que no hubo una vacuna. Bueno, la gripe asiática ya era nueva y tampoco había vacuna. Para cuando llegó uno, era sólo 60% eficaz y no ampliamente utilizado. Henderson comenta: “Es evidente que la vacuna no tuvo ningún efecto apreciable en la tendencia de la pandemia”.

¿Tal vez tuvimos que cerrar debido a casos asintomáticos? No es verdad. Henderson señala sobre la gripe asiática: “Las tasas de ataque en las escuelas oscilaron entre el 40% y el 60%. Las encuestas serológicas revelaron que la mitad de los que no reportan enfermedad de la gripe mostraban evidencia serológica de infección”.

Para estar seguro de que hubo interrupciones. No ocurrieron por la fuerza, sino por necesidad debido al ausentismo. Fueron efímeros. Los millones de personas expuestas al virus desarrollaron anticuerpos y continuaron. Esto era cierto en particular para los escolares:

“El ausentismo escolar alcanzó su máximo con 280.000 ausencias el 7 de octubre. Esto equivalía al 29% de todos los asistentes a la escuela. La tasa más alta se registró para las escuelas de Manhattan, que tenían una tasa general de 43% de ausencia. Ese día, 4.642 profesores (11%) no se reportó al trabajo debido a estar enfermo. Los establecimientos comerciales, sin embargo, no reportaron un aumento significativo del ausentismo. Dentro de las 2 semanas después del pico,las tasas de absentismo escolar casi volvieron a la normalidad, alrededor del 7%”.

Los informes de periódicos en ese momento no ofrecen ningún registro de cancelaciones generalizadas de eventos públicos y mucho menos cierres forzosos. A veces, los partidos de fútbol de la universidad y de la escuela secundaria se pospusieron debido a ausencias por enfermedad. Algunas convenciones fueron canceladas por los organizadores. Pero eso es todo.

El único editorial del New York Timessobre la gripe asiática reflejó la sabiduría de salud pública: “Mantengamos la cabeza fría sobre la gripe asiática a medida que comienzan a acumularse las estadísticas sobre la propagación y la virulencia de la enfermedad”.

Henderson concluye lo siguiente:

La pandemia de 1957-58 fue una enfermedad tan rápidamente diseminada que se hizo rápidamente evidente para los funcionarios de salud estadounidenses que los esfuerzos para detener o frenar su propagación eran inútiles. Por lo tanto, no se hicieron esfuerzos para poner en cuarentena a individuos o grupos, y se tomó la decisión deliberada de no cancelar o posponer grandes reuniones como conferencias, reuniones de la iglesia o eventos deportivos con el fin de reducir la transmisión.

No se hizo ningún intento de limitar el viaje o de otros casos examinar a los viajeros. Se hizo hincapié en la prestación de atención médica a las personas afectadas y en mantener el funcionamiento continuo de los servicios comunitarios y de salud. Las enfermedades febriles y respiratorias llevaron a un gran número de pacientes a clínicas, consultorios médicos y salas de emergencia, pero un porcentaje relativamente pequeño de los infectados requirieron hospitalización.

El ausentismo escolar debido a la gripe era alto, pero las escuelas no estaban cerradas a menos que el número de estudiantes o maestros cayera a un número lo suficientemente bajo como para justificar el cierre. Sin embargo, el curso del brote en las escuelas fue relativamente breve, y muchos podrían volver fácilmente a las actividades en un plazo de 3 a 5 días. Se dijo que un número significativo de trabajadores sanitarios estaban afectados por la gripe, pero los informes indican que los hospitales eran capaces de adaptarse adecuadamente para hacer frente a las cargas de los pacientes.

Los datos disponibles sobre el absentismo industrial indican que las tarifas eran bajas y que no se interrumpió los servicios esenciales ni de la producción. El impacto global sobre el PIB fue insignificante y probablemente dentro del rango de variación económica normal.

Los funcionarios de salud tenían la esperanza de que los suministros significativos de vacunas pudieran estar disponibles a su debido tiempo, y se hicieron esfuerzos especiales para acelerar la producción de vacunas, pero las cantidades que se disponían eran demasiado tarde para afectar el impacto de la epidemia. La propagación nacional de la enfermedad fue tan rápida que en 3 meses había arrasado por todo el país y había desaparecido en gran medida.

Uno lee este relato detallado de cómo la salud pública respondió entonces en comparación con ahora y la respuesta es llorar. ¿Cómo pudo pasarnos esto? Sabíamos con seguridad que los encierros eran terribles para la salud pública. Lo sabemos desde hace 100 años.

El cierre de una economía contradice rotundamente un principio fundacional de la Organización Mundial de la Salud: “El desarrollo económico y la salud pública son inseparables y complementarios… el desarrollo social, cultural y económico de una comunidad, y su estado de salud, son interdependientes”.

En 1957-58, los funcionarios de salud pública se tomaron en serio esa observación. Esta gripe muy grave se produjo y se produjo con una mínima perturbación social y económica. Sistemas inmunes en los Estados Unidos y en todo el mundo adaptados a la nueva cepa de la gripe.

Diez años más tarde, llegó una nueva mutación de esta gripe. La salud pública respondió de la misma manera, con sabiduría, calma y sin intervenciones en los derechos y libertades de las personas. El funcionamiento social y económico se consideró acertadamente crucial para una visión global de la salud pública.

Los bloqueos fueron descartados en el pasado precisamente para que el daño de una pandemia se minimizara y pudiéramos superarlo más rápidamente. Esta era la ciencia. Esta fue la ciencia hasta la primavera de 2020, cuando todo cambió. De repente, la “ciencia” favoreció olvidar todo lo que hemos aprendido del pasado y reemplazarlo por políticas brutales que destrozaron la economía y la vida de las personas, al tiempo que no lograban nada en términos de minimizar el daño pandémico.

Habíamos pensado en nosotros un vocabulario completamente nuevo diseñado para disfrazar lo que se nos estaba haciendo. No estábamos bajo arresto domiciliario, nuestros negocios destrozados, las escuelas cerradas, las artes en vivo y los deportes abolidos, nuestros planes de viaje destrozados y separados por la fuerza de sus seres queridos. No, sólo estábamos experimentando “mitigación de enfermedades” a través de “contención en capas dirigidas”, “intervenciones no farmacológicas” y “distanciamiento social”.

Todo esto es Owelliano con la sabiduría tradicional de salud pública habiendo sido derribado por el agujero de la memoria. La ciencia real no cambió. La salud pública tradicional nos implora que consideremos no sólo un patógeno, sino todas las variables que afectan a la salud, no sólo a corto plazo, sino también a largo plazo. Así fue y así es hoy.

In the Asian Flu of 1957-58, They Rejected Lockdowns – AIER

EL VIRUS CAE DEL CIELO

The virus falls from the sky

Que no del espacio exterior. Buscando y leyendo desde que empezó el tema del coronavirus, a falta de la coherencia oficial, como que en octubre de 2020 la OMS cambiara la versión y significado de “inmunidad de rebaño”, he leído de todo, hay que saber buscar. En los medios de comunicación masivos sólo hay un mensaje, dirigido y teledirigido a base de acallar al otro, al que piensa diferente pero también científicamente. Hay de todo, malo, bueno y barato, tanto en el mensaje oficial (ridículo, porque en realidad están diciendo que no sabemos nada de este virus, y más bien de los virus en general) como en los mensajes digamos extraoficiales, al menos llenos de matices y colmando un vacío que proporcionado a sabiendas, la propia naturaleza humana lo ocupa a veces hasta rebozar. Bueno, somos humanos, tan naturales como un virus, bueno, o no.

Yoichi Shimatsu, periodista y escritor en una saga de 28 escritos o artículos que van del 9 de enero al 16 de noviembre de 2020 para rense.com que hacen de el un verdadero ensayo. En la entrega o parte 20 tiene una teoría de la propagación de esta quimera (virus) al menos un tanto curiosa y no menos científica, nunca antes ni oída ni vista para con los virus y su propagación.

Os dejo aquí la parte del artículo que nos concierne, y yo me pregunto, ¿alguien nos está ocultando información? Si se dan cuenta, las autoridades tienen una obsesión con la noche, no quieren que salgamos a la calle digamos de 12 a 6 am. ¿Pero porqué? ¿Qué nos esconden?

Aquí la parte del artículo 20, por cierto, está escrito (los tiempos son importantes) el 23 de abril de 2020 titulado Nublado con una probabilidad de caídas de los cadáveres dispersos COVID en las islas de calor urbano – Parte 20 / Cloudy With A Chance Of Scattered Cadavers COVID Fallout On Urban Heat Islands – Part 20 :

Arquitecto de soluciones Urban Heat Island

Mi área de especialización en periodismo de crisis con especial atención a los desastres, con enfoque en los factores humano-causales y el impacto social, se enriqueció mucho al cooperar con el profesor de arquitectura Stephen Lau, el pionero más importante de Asia en los efectos de la isla de calor urbana (UHI) entonces en la Universidad de Hong Kong y más recientemente en la Universidad Nacional de Singapur. La concentración de calor sobre ciudades y ciudades más grandes es un fenómeno probado por la investigación con un impacto importante en la salud pública, como se muestra en este contagio del coronavirus.

Fuera del campo arquitectónico, el efecto Isla de Calor Urbano (UHI) no es bien conocido debido a la desafortunada dominación mediática por dudosos estudios ambientales de la teoría del “calentamiento global”, la mayoría de ellos un fraude promovido por la industria de la energía nuclear para perpetuar el mito de que el uranio es seguro, limpio, barato y “verde” (como la kriptonita es para Superman). El monopolio mediático de la agenda climática alimentada por la energía nuclear es el principal factor para que el público desconocie el papel de la corriente de chorro en la transmisión del COV a las metrópolis del hemisferio norte.

Ciudades en una burbuja

En la parte superior de una burbuja de calor sobre cualquier ciudad dada, hay un diferencial de temperatura de mediodía diario mensurable de alrededor de 7 grados C (alrededor de 12 F) más alto que la atmósfera circundante, mientras que los modelos de cambio climático, que no se basan en la investigación de campo real, estiman menos de un aumento de 1 grado durante un siglo. LA UHI es palpable y a veces insoportable, mientras que el “calentamiento global” es imperceptible en un termómetro de mercurio. Casi todos los activistas del cambio climático residen y crecen en las grandes ciudades, confundiendo un punto de calor localizado para una condición general del mundo. En esta premisa falsa, la percepción distorsionada se extrapola utilizando datos de estaciones meteorológicas metropolitanas para aumentar los hallazgos de los centros de meteorología rurales, sesgando los resultados a un nivel más alto posible de 1 grado C durante cien años, no es gran cosa en absoluto. Cientos de millones de dólares.han sido desperdiciados en este ejercicio de distracción por la industria de la energía nuclear, mientras que las grandes ciudades se han quedado indefensas contra las enfermedades infecciosas transmitidas por la corriente de chorro y el efecto UHI. Nuclear siempre se escapa de sus crímenes, incluyendo Three Mile Island, Chernobyl y Fukushima, castigados con una bofetada en la mano y nada cercano a la indemnización para las víctimas de sus inversores, y mucho menos multas punitivas.

Este tipo de fraude científico y colusión política han suscitado malas decisiones políticas por parte de los ayuntamientos y los gobiernos nacionales en favor de la urbanización de alta densidad y la concentración de población dentro de las megaciudades en beneficio de los grandes bancos, el capital privado, los inversores institucionales, los desarrolladores inmobiliarios y las cadenas minoristas corporativas. Desde esta perspectiva, el contagio del coronavirus es principalmente culpa de la política estatal corrupta en favor de los desarrolladores de propiedades y el capitalismo de consumo en oposición al interés nacional a largo plazo servido por una mezcla de baja densidad de ciudades rodeadas por un campo financieramente estable de granjas familiares, el modelo basado en la democracia Jeffersoniana en lugar del favoritismo hamiltoniano hacia los bancos centrales y las finanzas de Wall Street.

Plume sobre Wuhan

Para comprender cómo los virus de Wuhan y Chongqing rodearon el planeta para converger e infectar ciudades con una enorme bio-caída, debemos comenzar al principio, en los 84 hornos en crematorios en Wuhan y aproximadamente la mitad de ese número aguas arriba en la guarnición de Chongqing del Grupo PLA 77, donde posiblemente más de 2.000 soldados murieron de infección por COV por el ataque de la guerra contra el CISM. Como se evidencia en la larga franja amarilla a la izquierda de la imagen del satélite Windy, sus cuerpos de soldados infectados durante y después de los juegos militares de Wuhan fueron eliminados en secreto en los crematorios en todo el municipio de Chongqing, aparentemente todavía sin notificación de sus parientes más cercanos. Este trato de los jóvenes caídos no es el honor que se debe dar a los jóvenes patrióticos que protegieron a los atletas militares extranjeros, se reunieron en defensa de la ciudadanía wuhan y evitaron una propagación aún peor por todo el mundo. Especialmente después de meditar en el aro de los medios de comunicación de Beijing sobre “ganar una guerra popular en Wuhan”, me entristece aún más pensar en términos del costo humano de las profundidades a las que la propaganda del régimen puede hundirse a expensas de vidas innecesariamente perdidas consideradas meras carnes de cañón. ¿Qué tan importante es salvar la cara cuando las víctimas inocentes están perdiendo la vida en masa?

Dado el recuento repetido de falsos cuerpos, el número total de cremaciones sigue siendo cuestionable, incluso con el nuevo recuento revisado de 3.869 muertes en Wuhan, aparentemente sin incluir a los oficiales de policía y a los condenados a prisiones. Una estimación conservadora de 6.000 muertes militares y civiles también puede ser una subestimación, al considerar el tamaño de la neblina de azufre sobre las dos ciudades durante más de un mes de cremaciones sin parar. El aparejo de números es intolerable, bárbaro e inhumano, especialmente para los parientes más cercanos de los muertos.

La temperatura dentro de un horno de crematorio es ideal en el rango de 975 C (1.750 F), más o menos cien grados, para hacer un cuerpo a cenizas en una hora. Durante las semanas centrales de la crisis de Wuhan, las temperaturas de combustión deben haber aumentado para acelerar la eliminación de cuerpos para evitar la descomposición y la liberación de virus. Las altas temperaturas constantes del horno, sin embargo, causan la descamación y roturas de las tuberías de alimentación de gas, añadiendo más presión sobre los equipos de trabajo agotados. El intervalo entre cremaciones implica la reducción de la temperatura con el fin de eliminar las cenizas e insertar el siguiente cadáver. Este nivel de calor más bajo durante el período de reinicio permitió a los virus escapar a través de las chimeneas relativamente cortas para montar el penacho de calor de enfriamiento en el cielo.

Debido a la amenaza potencial para que los equipos de emergencia que transportaban cuerpos de los hospitales a los crematorios, los cadáveres frescos fueron desempolvados con polvo de azufre para evitar que las infecciones bacterianas se expandieran las pústulas en llagas abiertas que liberan virus en el aire. Este tipo de método pragmático es uno de los aspectos más desconcertantes para manejar los cuerpos de los muertos, que no se reporta en los medios de comunicación o incluso en la literatura académica, que presencié cuando era un niño y ayudante en la funeraria de mi tío para crear un parecido del difunto para una visión de ataúd abierto por los dolientes. Bombear formaldehído en las venas como un antiséptico, un conservante, consume demasiado tiempo e inapropiado para una emergencia como Wuhan y tal arte no tiene sentido cuando un cuerpo requiere eliminación inmediata a medida que la descomposición se instala, la propagación del hedor, los líquidos y las bacterias junto con los virus en el aire. Un cadáver infectado que se desintegró en una acera en Wuhan habría sido desastroso, por lo que algunas toallas y azufre tuvieron que ser suficientes para el traseso del hospital y el viaje en furgoneta de una hora de duración a un crematorio. Saludo a esos héroes no cantados, los trabajadores de emergencia, por su gran resistencia a luchar a través de ese infierno en la Tierra.

Cube-Sat infrarrojo sobre la pira

El sitio de desinformación de la CIA Snopes, hace mucho tiempo desacreditado en mis artículos de años atrás, está arrojando tonterías sobre supuestos gráficos falsos del servicio meteorológico Windy. Además del polvo de azufre para evitar la descomposición de la piel, se encuentran cantidades adicionales de dióxido de azufre y óxido nitroso en el gas natural de menor calidad de las plantas de separación de gases. Por el contrario, se filtra el gas de cocina para su cocina a un alto costo. Como nadie está cenando en la carne asada, el gas más barato tiene que ser suficiente. Las imágenes ventosas de las emisiones de azufre y nitrógeno no son gráficos informáticos fantasiosos basados en el modelado teórico, como afirma falsamente Snopes, sino basados en la vigilancia de los satélites de observación de la Tierra utilizados para detectar liberaciones y explosiones químicas.

El EOS de teledetección (satélite de observación de la Tierra) es un dispositivo de monitoreo en forma de cubo o “cúbico” con un detector hiperespectral (multi-longitud de onda altamente sensible) en el ancho de banda infrarrojo, que también se puede utilizar para detectar preparaciones de lanzamiento para cohetes y rastrear incendios forestales, cualquier cosa que emita calor. Los datos son procesados por ordenador en imágenes precisas codificadas por colores, en este caso particular por el servicio meteorológico Windy con sede en Praga, República Checa. Lo imaginante no es una especie de ficción, como afirma Snopes, pero es muy precisa y científica.

Esta distorsión es otro ejemplo de la gran cantidad de desinformación oficial en respuesta al peor evento terrorista de la historia reciente, mucho más allá del 911. La operación de desninfo del Estado Profundo debe ser investigada, desmantelada y los funcionarios a cargo encarcelados. Demasiada gente está muerta y muriendo por este tipo de interferencia política y chicanería mediática. ¡Muchas gracias al equipo Windy por la gran captura, Dekuji!

Exploding Body Fat

Los virus del COV permanecen activos dentro de los cadáveres y pueden ser infecciosos durante un período indeterminable, como recientemente se descubrió en el shock de un forense en Tailandia. El cuerpo de un adulto no se convierte fácilmente en cenizas, siendo tan pesado como una vaquilla con contenido de agua en alrededor del 55 por ciento del peso corporal. La fase inicial de la cremación tiene que representar gran parte del contenido de agua como vapor, lo que impide la incineración. Otro problema para la quemadura es la grasa subcutánea, y los chinos de hoy tienden a tener sobrepeso de una dieta aceitosa. La grasa del vientre explota y silba, soplando partículas de sangre y carne en la columna de calor hacia el cielo. Sería como poner al máximo tu parrilla de barbacoa y añadir un lanzallamas, soplando ese asado de cerdo como un petardo en pocos segundos.

Dado que las chimeneas del crematorio son más cortas que una chimenea de chimenea, liberando prematuramente partículas de carne crujientes en la superficie exterior, pero no completamente “cocinadas”, ni siquiera medio rara pero rara. La incineración apresurada dio lugar a miles de millones y probablemente billones de virus en espiral hacia arriba en el borde del vórtice de calor que se elevan a los confines más bajos de la corriente de chorro para ser transportados a tierras extranjeras.

En un día normal, el penacho de cremación se elevará a 3.000 metros, pero Wuhan fue un extraordinario evento de super-bonfire, que va las 24 horas del día durante semanas, con una enorme efusión de energía térmica que proporciona un enorme aumento, alcanzando fácilmente 8.000 metros (5 millas), la altitud del último invierno y la corriente de chorro de primavera temprana moviéndose a más de 250 mph. Las bacterias, que contienen agua, se congelarán y morirán en estas condiciones. Los virus, sin embargo, no son organismos, sino más bien máquinas y pueden sobrevivir al frío extremo durante una larga duración, como lo muestran las partículas de ARN en el permafrost siberiano a -50C o -55F, que pueden ser revividos por los microbiólogos.

A estas alturas, un mes después del final de las cremaciones masivas, probablemente sea demasiado tarde para llevar un paraguas contra cualquier consecuencia de carne humana y virus activos. El peligro inmediato de los cielos ha pasado, aparte de la posibilidad de que los virus escapen de las cremaciones en Corea del Sur, Japón, partes de Estados Unidos y Europa, y en todo el planeta. Has oído la expresión “Está lloviendo gatos y perros afuera” para que puedas decirle a tus nietos: “Yo estaba allí cuando llovía cadáveres”.

Decencia del entierro

La indignidad de la incineración masiva en una fría y cruel respuesta urbana a una epidemia contrasta con los lentos ritos que presencié en el sur de Tailandia, como voluntario para la labor de búsqueda y rescate después del tsunami asiático que azotó el día después de la Navidad de 2004. Un cuidador con un templo local al norte de Phuket apiló madera alrededor de una víctima de ahogamiento mientras un monje cantaba una bendición, y luego puso una antorcha en los troncos. La pira ardió durante horas hasta la reducción final a cenizas y algunos huesos, que fueron rastrillados y colocados en una caja de madera con otra oración. En ese momento, me dirigí de regreso a la costa para reincorporarme a un equipo tailandés y coreano mientras el explorador olfateaba cuerpos atrapados bajo edificios, bajo montones de escombros o embistido por la presión de las olas en las raíces de las palmeras. Mi sentido del olfato era mucho mejor que otros, debido al hábito coreano de comer kimchee y los tailandeses que consumen salsa picante tipo Sri Racha, así que se dejó a mi nariz de tofu aburridamente sosa para ser el perro de búsqueda.

Días más tarde llegó una reunión de Nochevieja en silencio para voluntarios cansados desgastados por el hedor de cuerpos hinchables en descomposición mientras buscaban marcas de identificación para escribir en carteles para familias angustiadas antes de cerrar las bolsas del cuerpo. En una colina era el único lugar para que los voluntarios pasaran la noche en las vacaciones. Los tailandeses de Bangkok, canadienses, holandeses y algunos otros se reunieron sobre cajas de cerveza y almuerzos de cajas de expiración pasada para compartir tranquilamente su trauma una larga sombra del sol que se pone en el mar de Andamán se deslizó a través del amplio balcón.

Cuando un joven expresó su sentimiento de culpa por beber después de una experiencia tan horrible, como la persona mayor allí les dije a todos que cada uno de ellos se ganó este momento y relajarse en una rara noche especial aparta un año aterrador y dará a todos fuerzas para el calvario de mañana por la mañana y para el resto de sus vidas. Por cualquier razón que hayamos venido aquí, cada uno sabe ahora a través del testimonio personal que la vida termina con la muerte y por eso hemos aprendido a acercarnos a la muerte con calma no como algo horrible, sino como un tributo a la vida de otra persona. Entonces, ¿qué mejor momento para un brindis por ustedes valientes voluntarios? En los primeros albores del año 2005, cada individuo partió por un camino diferente a lo largo de la interminable línea del tsunami, cada uno de acuerdo en que aunque llegamos como extraños y quedamos traumatizados por esta experiencia fue la mejor Nochevieja que esta breve existencia podría permitirse.

Arco de la pandemia

Tokio – El penacho que sale de Wuhan llega a la costa del Pacífico en media hora, en el Mar de China Oriental, donde los primeros aviones de primavera se curvan hacia el noreste hacia Japón, mientras que las nevadas de finales de primavera se convierten en lluvias lluviosas sobre las primeras grandes islas de calor urbano de los distritos de negocios de Shinjuku, Maruchiuno y Shimbashi de Tokio. A medida que los equipos de limpieza apagan las luces de las torres de oficinas, una corriente descendente empuja innumerables virus hacia los suburbios periféricos donde sus compañeros de oficina se dirigen a la estación local, sin saber que están caminando a través de una niebla viral. En la hora punta de la mañana temprano, los virus llegan al centro con las hordas de viajeros empacados en el metro.

La capital japonesa es altamente radiactiva, como se muestra en el monitoreo de datos de un grupo ciudadano que ha encontrado docenas de puntos críticos. El nivel de radiactividad ha matado las algas en la bahía de Tokio, pero los virus corona son sólo 120 nanómetros de ancho, tres veces más pequeños que los poros en una máscara facial médica. No se ha investigado, pero los virus son probablemente lo suficientemente pequeños como para evitar impactos directos de la radiación gamma sobre la región de Tokio. Los pasajeros a bordo del crucero Diamond Princess nunca tuvieron la oportunidad, especialmente una noche, contra los miles de millones de virus que caen de la corriente de chorro hacia la bahía de Tokio, siendo estos lo suficientemente pequeños como para pasar a través del sistema de filtración de aire de la nave. Esta es la razón por la que mi equipo de microbiólogos en la crisis del SARS de Hong Kong abogó por los limpiadores de aire con la generación UV de radicales libres de dióxido de titanio para desinfectar el aire interior. El resto del mundo no se ha puesto al día y no ha mostrado mucho interés en estas tecnologías eficaces.

Trans-Pacífico – El flujo continuo de virus en el chorro de flujo que viaja hacia el norte hasta el estrecho de Bering y luego hacer una trayectoria balística hacia el sur para hacer tierra en Seattle, la primera ciudad estadounidense con una gran cantidad de infecciones, aunque muchos de ellos son parientes de Navy SEALS que participaron en los juegos de Wuhan, y luego procediendo hacia el sur a través del área de la bahía y Los Angeles , girando antes de la frontera con México hacia vastos tramos vacíos de Texas. La población de la costa oeste ha sufrido mucho daño en el tejido pulmonar por Fukushima y la radiactividad local, los incendios forestales relacionados y ahora las pruebas 5G, por lo que una alta tasa de mortalidad por virus transmitidos por chorros es una inaltería.

Nueva Orleans – Los celebrantes que convergían para Mardi Gras a finales de febrero capturaron la altura misma de las consecuencias del virus de origen Wuhan. Contrariamente a la historia de brujas sin sentido de Fauci y sus brujos, los que se fueron de fiesta de esos estados del medio oeste y del sur estaban libres de infecciones, y en su lugar los virus cayeron sobre sus cabezas después de descender a lo largo del camino de deslizamiento sobre las frías aguas del Misisipi. Nueva Orleans es una isla de calor urbano ubicada entre dos cuerpos de agua que atraen virus, el Poderoso Misisipi y el Golfo de México. Sea cual sea la forma en que sopla el viento, los virus están fluyendo hacia Bourbon Street, lo cual es una pena ya que un buen momento es tener un linint up de botellas de cerveza Dixie, pero no se trague las ostras de aguas profundas. El mundo se ha deteriorado desde aquellos días universitarios que me autogané a Nawlins para disfrutar de música y toda la noche.

Fort Lauderdale y Miami – El diferencial de temperatura de Sunny Florida entre las áreas interiores y la costa significa que las cascadas de coronavirus fluyen en corriente descendente directamente hacia las playas y son soplados de vuelta hacia la costa por la brisa de las olas, empapando en parte a los estudiantes universitarios vestidos en las vacaciones de primavera y de Pascua. Ya no enseñan ciencias en la universidad cuando la mojito mixología y el sexo son las especialidades más populares entre los jóvenes y tontos.

Nueva York – Poco después de que el Polar Vortex se desplazara hacia el este desde la región de Ohio hacia el noreste, la siguiente gran oportunidad para la infección masiva fue en la línea de abejas a Nueva York y Boston, ambos puertos con ríos y rascacielos imponentes con calor de vapor a plena ráfaga. Estas son las clásicas Islas de Calor Urbana, con potentes cambios de presión de aire como pistones. Por lo tanto, durante el día, la burbuja de calor de Manhattan arroja virus hasta los espacios abiertos de Brooklyn y Staten Island. Por la noche, después de que las oficinas cierran sus puertas y la temperatura del suelo se desploma, los virus bajan en Central Park y luego en las aceras llenas de visitantes a la Gran Manzana. Los cañones de estructuras altas atrapan virus, vertiendo por las entradas del metro, a través de puertas giratorias y en los conductos de ventilación de los taxis. El Apple es un refugio de virus, que se remata cada noche, mientras que los equipos de emergencia en carretillas elevadoras que cargan cuerpos en camiones refrigerados que están sirviendo a una morgue temporal hasta que 45 nuevas unidades de almacenamiento de cadáveres se establecen en toda la metrópolis. Hart Island se utiliza como un lugar de entierro masivo. Esto es primitivo, de vuelta a la Edad Oscura. La ciudad de Nueva York no tiene espacio para los cuerpos, que comenzarán a engordarse con billones de nuevos virus a medida que el clima se calienta a finales de abril. Wall Street está rodeada por la ola de la muerte que creó.

Londres, Madrid y Milán – Lo mismo ocurre con Europa, cuando la corriente de propulsión giraba hacia el sur sobre Londres, se dirigió a Madrid y se desmayó sobre Milán, en la peor campaña de bombardeos desde la Segunda Guerra Mundial. Desde allí el flujo de aire cruzó sobre Moscú “inmune”, que ahora se está descongelando a una floración viral. El chorro de agua ya se ha ido hacia el norte sobre Beijing y la región de Dongbei del noreste de China alrededor de Shenyang y luego Corea del Norte, donde el Gran Líder cayó repentinamente enfermo cuando CoV comenzó a mejorar en el calentamiento de las temperaturas al aire libre. El Grim Reaper es una bestia de mil millones de virus acechando la tierra para nuevas víctimas.

Aprender de los desafíos de la vida

Basado en la práctica de las contramedidas de Urban Heat Island, incluyendo “techos verdes” para reducir la burbuja de calor y el uso de agua subterránea como refrigerante en lugar de sistemas de enfriamiento de techos generadores de calor, los virus no caerían al nivel del suelo en tal abundancia, sino que circularían en la corriente de chorro hasta que la radiación solar los destruyera. La solución es así de simple. Los flujos de aire en oficinas, restaurantes y hogares que canalizan el aire rancio hacia arriba y fuera de los interiores hasta el nivel del techo reducirían las probabilidades de infección en un millón de veces más. Un mejor diseño de inodoros y urinarios, y especialmente secadores de manos, que ahora soplan virus de las manos a la cara, era parte de las propuestas de mi equipo de microbiología, con algunos adoptados en Hong Kong y el continente y otros ignorados, lo que de hecho ha ahorrado a Hong Kong la peor parte de este contagio. Pequeños pasos marcan una gran diferencia en la salud pública, ya que es más eficaz para combatir enfermedades infecciosas en el entorno construido que dentro de su cuerpo.

Si la sociedad va a revivir y sobrevivir, no puedes olvidar esta pandemia como un mal sueño cuando el encierro ha terminado y vuelve a vivir como un cerdo en un estilete. Si no se realizan cambios, entonces el próximo brote podría ser el último. Es muy importante, ya que he estado haciendo hincapié en no quedar atrapado en conceptos abstractos sin apoyo por datos convincentes, como el calentamiento global y la teoría del cambio climático, que son responsables de descarrilar los pasos básicos que fueron defendidos por el movimiento temprano del Día de la Tierra de desarrollar una sociedad de reciclaje para hacer frente a las montañas de residuos tóxicos, para eliminar radicalmente la mayoría de los pesticidas y otras contaminaciones químicas , para promover estilos de vida saludables en una mezcla de campo y ciudad en lugar de mega-ciudades, y homeopatía y terapias herbales en lugar de montones de productos farmacéuticos.

El coronavirus está aquí porque las personas eran perezosas y mentalmente laxas, permitiendo que algunos actores cínicos desarrollaran virus en armas de destrucción masiva porque se dieron cuenta de que no había medidas de bioseguridad en su lugar, ni siquiera los hábitos simplemente de saneamiento personal. Esta es probablemente la última llamada, porque si no respondes y actúas y aplicas presiones políticas y boicoteas a las corporaciones malvadas, la próxima será la última llamada.

La vida dentro de una burbuja

Las megaciudades son el problema y no la solución. Los estados centrales del medio oeste tienen los menos niveles de infecciones por coronavirus y también están en las peores condiciones financieras debido al dominio de la agroindustria corporativa que se beneficia de las exportaciones de soja y maíz a China y a los banqueros y comerciantes de materias primas que lo financian. Mientras tanto, las granjas familiares han sufrido deudas crónicas e impagos hipotecarios debido a las políticas de préstamos de ingeniería financiera en favor de los propietarios de tierras corporativas a megaescala implementadas por Wall Street y State Street, los mismos intereses plutocráticos responsables de la actual pandemia del CoV y la guerra biológica que la desató.

La promoción neoliberal de las megaciudades y el despojo de las comunidades agrarias es esencial para el control corporativo-bancario-político de todos los recursos naturales, desde minerales y energía hasta la producción de alimentos y fuentes de agua, mientras empaquetaba a la gente en recintos cada vez más ajustados, con un bloqueo esencial para el reciclaje psicológico de las expectativas “poco realistas” de lo que era normal no hace mucho tiempo, mientras que los miembros multimillonarios de la junta poseen múltiples mansiones, islas de playa y centros personales. El aislamiento social impuesto a los Estados del Medio Oeste sin apenas casos COVID es una prueba del internamiento masivo de una sociedad una vez libre basada en la autonomía de los hogares agrícolas y de la comunidad local. Siempre he entendido que el internamiento en tiempo de guerra de mi kinfolk fue un experimento de lavado de cerebro por parte de los liberales globalistas Roosevelt, un juicio por un eventual asalto total a los derechos constitucionales. El intento desesperado de la élite fascista neoliberal de destruir los valores y formas de vida tradicionales es una agresión sin barnizar, una guerra de clases por parte de las instituciones criminales ricas y poco representativas contra una democracia de base comprometida con la vida, la libertad y la búsqueda de la felicidad.

La OMS elimina la inmunidad adquirida naturalmente de su sitio web

WHO Deletes Naturally Acquired Immunity from Its Website

Jeffrey A. Tucker – 23 de diciembre de 2020. Tiempo de lectura: 5 minutos

¿Quizás tienes la sensación de que algo sospechoso está pasando? Mismo. Si no es una cosa, es otra.

El coronavirus vivió en superficies hasta que no lo hizo. Las máscaras no funcionaban hasta que lo hacían, entonces no lo hicieron. Hay una transmisión asintomática, pero no la hay. Los bloqueos funcionan para controlar el virus, excepto que no lo hacen. Todas estas personas están enfermas sin síntomas hasta que, a mal tiempo, las pruebas de PCR son tremendamente inexactas porque nunca fueron diseñadas para ser herramientas de diagnóstico. Todos están en peligro del virus, excepto que no. Se propaga en las escuelas, pero no lo hace.

En él va. Diario. No es de extrañar que tanta gente haya dejado de creer cualquier cosa que digan “autoridades de salud pública”. En combinación con los gobernadores y otros autócratas que hacen sus órdenes, se propusieron quitarles la libertad y los derechos humanos y esperaban que les agradeciémos por salvarnos la vida. En algún momento de este año (para mí era el 12 de marzo) la vida comenzó a sentirse como una novela distópica de su elección.

Bueno, ahora tengo otra prueba que añadir a la pila de desorden de peces. La Organización Mundial de la Salud, por razones desconocidas, ha cambiado repentinamente su definición de una concepción básica de la inmunología: la inmunidad del rebaño. Su descubrimiento fue uno de los principales logros de la ciencia del siglo XX, emergiendo gradualmente en la década de 1920 y luego cada vez más refinado a lo largo del siglo XX.

La inmunidad al rebaño es una observación fascinante que se puede rastrear a la realidad biológica o a la teoría de probabilidad estadística, lo que prefiera. (Ciertamente no es una “estrategia”, así que ignore cualquier fuente de medios que la describa de esa manera.) La inmunidad del rebaño habla directamente, y con poder explicativo, a la observación empírica de que los virus respiratorios son generalizados y en su mayoría leves (frío común) o muy graves y de corta duración (ébola).

¿Por qué es esto? La razón es que cuando un virus mata a su huésped – es decir, cuando un virus sobrecarga la capacidad del cuerpo para integrarlo, su huésped muere y por lo tanto el virus no se propaga a otros. Cuanto más ocurre esto, menos se propaga. Si el virus no mata a su huésped, puede saltar a otros a través de todos los medios habituales. Cuando obtienes un virus y lo combates, tu sistema inmunitario codifica esa información de una manera que crea inmunidad a él. Cuando le sucede a suficientes personas (y cada caso es diferente por lo que no podemos poner un número claro en él, especialmente dadas tantas inmunidades cruzadas), el virus pierde su calidad de pandemia y se vuelve endémico, es decir predecible y manejable. Cada nueva generación incorpora esa información a través de una mayor exposición.

Esto es lo que uno llamaría Virología/Inmunología 101. Es lo que lees en todos los libros de texto. Se ha enseñado en biología celular de noveno grado durante probablemente 80 años. Observar las operaciones de este fenómeno evolutivo es bastante maravilloso porque aumenta el respeto por la forma en que la biología humana se ha adaptado a la presencia de patógenos sin enloquecer absolutamente.

Y el descubrimiento de esta fascinante dinámica en biología celular es una de las principales razones por las que la salud pública se volvió tan inteligente en el siglo XX. Mantuvimos la calma. Gestionamos virus con profesionales médicos: relaciones médico/paciente. Evitamos la tendencia medieval a correr con el pelo en llamas, sino que usamos racionalidad e inteligencia. Incluso el New York Times reconoce que la inmunidad natural es poderosa con Covid-19, lo cual no es en lo más mínimo sorprendente.

Hasta que un día, esta extraña institución llamada Organización Mundial de la Salud, una vez gloriosa porque era la principal responsable de la erradicación de la viruela, ha decidido de repente eliminar todo lo que acabo de escribir de los conceptos básicos de la biología celular. Literalmente ha cambiado la ciencia de una manera soviética. Se ha eliminado con la clave de eliminación cualquier mención de inmunidades naturales de su página web. Ha dado el paso adicional de caracterizar realmente la estructura y el funcionamiento de las vacunas.

Para que me creas, trataré de ser lo más preciso posible. Aquí está el sitio web del 9 de junio de 2020. Puedes verlo aquí en Archive.org. Usted tiene que mover hacia abajo la página y haga clic en la pregunta sobre la inmunidad del rebaño. Ves lo siguiente.

Eso es bastante preciso en general. Incluso la afirmación de que el umbral “todavía no está claro” es correcta. Hay inmunidades cruzadas a Covid de otros coronavirus y hay memoria de células T que contribuye a la inmunidad natural.

Algunas estimaciones son tan bajas como 10%, que está muy lejos de la estimación modelada del 70% de la inmunidad al virus que es estándar dentro del ámbito farmacéutico. La vida real es mucho más complicada que los modelos, en economía o epidemiología. La declaración pasada de la OMS es una descripción sólida, si “pop”.

Sin embargo, en una captura de pantalla fechada el 13 de noviembre de 2020, leemos la siguiente nota que de alguna manera pretende como si los seres humanos no tuvieran sistemas inmunes en absoluto, sino que dependen enteramente de grandes farmacias para inyectar cosas en nuestra sangre.

Lo que ha hecho esta nota en la Organización Mundial de la Salud es eliminar lo que equivale a toda la historia del millón de años de la humanidad en su delicada danza con patógenos. Sólo se podía obtener de esto que todos nosotros no somos más que pizarras en blanco e inaprobables en las que la industria farmacéutica escribe su firma.

En efecto, este cambio en la OMS ignora e incluso elimina 100 años de avances médicos en virología, inmunología y epidemiología. Es completamente poco científico: chelines para la industria de las vacunas exactamente como los teóricos de la conspiración dicen que la OMS ha estado haciendo desde el comienzo de esta pandemia.

Lo que es aún más extraño es la afirmación de que una vacuna protege a las personas de un virus en lugar de exponerlas a ella. Lo sorprendente de esta afirmación es que una vacuna funciona precisamente disparando el sistema inmunitario a través de la exposición. Por qué tuve que escribir esas palabras está realmente más allá de mí. Esto se conoce desde hace siglos. Simplemente no hay manera para que la ciencia médica reemplace por completo el sistema inmunitario humano. Sólo se puede jugar a través de lo que solía llamarse inoculación.

Toma de esto lo que quieras. Es un signo de los tiempos. Durante casi un año completo, los medios de comunicación nos han estado diciendo que la “ciencia” requiere que cumplamos con sus dictados que van en contra de cada principio del liberalismo, cada expectativa que hemos desarrollado en el mundo moderno que podemos vivir libremente y con la certeza de los derechos. Entonces la “ciencia” se hizo cargo y nuestros derechos humanos fueron criticados. Y ahora la “ciencia” en realidad está eliminando su propia historia, aerógrafo sobre lo que solía saber y reemplazarlo por algo engañoso en el mejor de los casos y evidentemente falso en el peor.

No puedo decir por qué, exactamente, la OMS hizo esto. Sin embargo, dados los acontecimientos de los últimos nueve o diez meses, es razonable suponer que la política está en juego. Desde el comienzo de la pandemia, aquellos que han estado presionando los bloqueos y la histeria sobre el coronavirus han resistido la idea de inmunidad natural del rebaño, en cambio insistiendo en que debemos vivir encerrados hasta que se desarrolle una vacuna.

Es por eso que la Declaración del Gran Barrington,escrita por tres de los epidemiólogos preeminentes del mundo y que abogaba por abrazar el fenómeno de la inmunidad del rebaño como una forma de proteger a los vulnerables y minimizar los daños a la sociedad, fue recibida con tal veneno. Ahora vemos a la OMS también sucumbiendo a la presión política. Esta es la única explicación racional para cambiar la definición de inmunidad del rebaño que ha existido durante el siglo pasado.

La ciencia no ha cambiado; sólo la política tiene. Y es precisamente por eso que es tan peligroso y mortal someter la gestión del virus a las fuerzas de la política. Eventualmente la ciencia también se inclina hacia el carácter duplicado de la industria política.

Cuando los libros de texto existentes que los estudiantes usan en la universidad contradicen los últimos pronunciamientos oficiales de las autoridades durante una crisis en la que la clase dominante claramente está tratando de apoderarse del poder permanente, tenemos un problema.

WHO Deletes Naturally Acquired Immunity from Its Website – AIER

La Agenda Secreta del Banco Mundial y el FMI

Por Peter Koenig

El Banco Mundial y el Fondo Monetario Internacional (FMI) trabajan de la misma mano – sin problemas. No sólo están prestando regularmente enormes sumas de dinero a regímenes de terror de todo el mundo, sino que chantajean a las naciones pobres para que acepten condiciones draconianas impuestas por Occidente. En otras palabras, el BM y el FMI son culpables de los abusos más atroces contra los derechos humanos.

No se podía decir, cuando se lee sobre la entrada del Banco Mundial la noble frase, “Nuestro sueño es mundial libre de pobreza”. A esta hipocresía sólo puedo añadir, “… Y nos aseguramos de que siga siendo un sueño”. Esto dice ambas cosas, la mentira y el carácter criminal de las dos Instituciones Financieras Internacionales, creadas bajo la Carta de las Naciones Unidas, pero instigadas por los Estados Unidos.

El frente de estas instituciones es brillante. Lo que le parece a las inversiones en infraestructura social, en escuelas, sistemas de salud, necesidades básicas como agua potable, saneamiento, incluso protección del medio ambiente, sobre todo “Alivio de la pobreza”, es decir, un mundo libre de pobreza. Pero lo falso que es esto hoy en día y ya estaba en los años 1970 y 1980 es asombroso. Poco a poco la gente está abriendo los ojos a una realidad abyecta, de explotación y coerción y chantaje total. Y eso, bajo los auspicios de las Naciones Unidas. ¿Qué le dice sobre el sistema de las Naciones Unidas? ¿En qué manos están las Naciones Unidas? – La organización mundial fue creada en San Francisco, California, el 24 de octubre de 1945, justo después de la Segunda Guerra Mundial, por 51naciones, comprometidas con el mantenimiento de la paz y la seguridad internacionales, el desarrollo de relaciones amistosas entre las naciones y la promoción del progreso social, mejores niveles de vida y derechos humanos.

La ONU reemplazó a la Sociedad de Naciones que formaba parte del Acuerdo de Paz después de la Primera Guerra Mundial, el Tratado de Versalles. Entró en vigor el 10 de enero de 1920, tenía su sede en Ginebra, Suiza, con el propósito de desarme, prevenir la guerra a través de la seguridad colectiva, resolver disputas entre países, mediante la diplomacia de negociación y mejorar el bienestar mundial. En retrospectiva, es fácil ver que todo el sistema de las Naciones Unidas se estableció como una farsa hipócrita, haciendo creer a la gente que sus poderosos líderes sólo querían la paz. Estos poderosos líderes eran todos occidentales; el mismo que menos de 20 años después de la creación de la noble Sociedad de Naciones, comenzó la Segunda Guerra Mundial.

*

Esta pequeña introducción proporciona el contexto para lo que eventualmente se convertiría en el resultado de las Naciones Unidas para el robo global, para las naciones empobrecidas, en todo el mundo, para la explotación de las personas, para los abusos contra los derechos humanos y para palear enormes cantidades de activos desde el fondo, desde el pueblo hasta la oligarquía, la élite corporativa cada vez más pequeña, las llamadas Instituciones de Bretton Woods.

En julio de 1944, más de 700 delegados de 44 Naciones Aliadas (aliados con los ganadores de la Segunda Guerra Mundial, incluida la Unión Soviética) se reunieron en el Mount Washington Hotel, situado en Bretton Woods, New Hampshire, Estados Unidos, para regular el orden monetario y financiero internacional después de la Segunda Guerra Mundial. Seamos seguros, esta conferencia se llevó a cabo bajo los auspicios de los Estados Unidos, el auto-declarado ganador de la Segunda Guerra Mundial, y a partir de ahora el maestro sobre el orden financiero del mundo, que no era inmediatamente visible, una agenda oculta a simple vista.

El FMI fue creado oficialmente para “regular” las monedas occidentales, llamadas convertibles, aquellas que se suscribieron para aplicar las reglas del nuevo estándar de oro, es decir, US$ 35 / Onza Troya (alrededor de 31,1 gramos). Tenga en cuenta que el patrón oro, aunque aplicable por igual a 44 naciones aliadas estaba vinculado al precio del oro nominado en dólares estadounidenses,no basado en una cesta del valor de las 44 monedas nacionales. Esto ya era razón suficiente para cuestionar el futuro sistema. Y cómo va a salir. Pero nadie cuestionó el arreglo. Difícil de creer, sin embargo, el de todos estos economistas nacionales, ninguno se atrevió a cuestionar la naturaleza traicionera de la configuración del patrón oro.

El Banco Mundial, o el Banco de Reconstrucción y Desarrollo (IBRD), se creó oficialmente para administrar el Plan Marshall para la Reconstrucción de Europa destruida por la guerra. El Plan Marshall fue una donación de los Estados Unidos y fue nombrado en honor al Secretario de Estado de los Estados Unidos George Marshall, quien lo propuso en 1947. El plan dio 13.200 millones de dólares en ayuda exterior a los países europeos que habían sido devastados física y económicamente por la Segunda Guerra Mundial. Se iba a implementar de 1948 a 1952, que por supuesto era un tiempo demasiado corto, y se extendió hasta principios de la década de 1960. En los términos actuales, el plan Marshall valdría unas 10 veces más, o unos 135 mil millones de dólares EE.UU.

El Plan Marshall era y sigue siendo un Fondo Rotatorio, devuelto por los países en cuestión, para que pudiera ser cedido. El dinero del Plan Marshall fue prestado varias veces y, por lo tanto, fue muy eficaz. La contraparte europea del Fondo Marshall administrado por el Banco Mundial fue un banco de reciente creación creado bajo el Ministerio de Finanzas alemán, el Banco Alemán de Reconstrucción y Desarrollo (KfW – acrónimo alemán de “Kreditanstalt f’r Wiederaufbau”).

KfW, como contraparte europea del Banco Mundial sigue existiendo y se dedica principalmente a proyectos de desarrollo en el Sur Global, ahora principalmente con fusores del Gobierno alemán y tomados prestados de los mercados de capitales alemanes y europeos. KfW a menudo coopera en proyectos conjuntos con el Banco Mundial. Hoy en día todavía hay un Departamento especial dentro de KfW que se ocupa exclusivamente del dinero del Fondo del Plan Marshall. Estos fondos todavía rotatorios se utilizan para prestar a las regiones pobres del sur de Europa, y también para apuntalar las economías de Europa del Este, y se utilizaron especialmente para integrar a la antigua Alemania Oriental en la actual “Gran Alemania”.

Dos elementos del Plan Marshall son particularmente llamativos y dignos de mención. En primer lugar, el plan de reconstrucción creó un lazo, una dependencia entre los Estados Unidos y Europa, la misma Europa que fue destruida en gran medida por las fuerzas aliadas occidentales, mientras que básicamente la Segunda Guerra Mundial fue ganada en gran medida por la Unión Soviética, los enormes sacrificios de la URSS, con un estimado de 25 a 30 millones de muertes. Por lo tanto, el Plan Marshall también fue diseñado como un escudo contra la Rusia comunista, es decir, la URSS.

Mientras que oficialmente la Unión Soviética era un aliado de las potencias occidentales, Estados Unidos, Reino Unido y Francia, en realidad la URSS comunista era un archienemigo del oeste, especialmente de los Estados Unidos. Con el dinero del Plan Marshall, Estados Unidos compró la alianza europea, una dependencia que no ha terminado hasta el día de hoy, y que todavía está impidiendo a Europa establecer relaciones normales con Rusia, a pesar de que la Unión Soviética ha desaparecido hace tres décadas. La guerra fría subsiguiente después de la Segunda Guerra Mundial contra la URSS, también basada en mentiras flagrantes, fue un testimonio directo de otra farsa propagandística occidental, que hasta el día de hoy, la mayoría de los europeos aún no han captado.

En segundo lugar, la imposición estadounidense de un fondo de reconstrucción con sede en dólares estadounidenses no sólo estaba creando una dependencia del dólar europeo, sino que también estaba sentando las bases para una moneda singular, eventualmente para invadir Europa – lo que sabemos hoy, se ha convertido en el euro. El euro no es más que el hijo adoptivo del dólar, ya que fue creado bajo la misma imagen que el dólar estadounidense: es una moneda fiduciaria, respaldada por nada. La Europa Unida, o ahora llamada Unión Europea, nunca fue realmente una unión. Nunca fue una idea europea, pero presentada por los Servicios Secretos de los Estados Unidos disfrazados de unos cuantos honchos europeos traicioneros. Y cada intento de crear una Europa Unida, una Federación Europea, con una Constitución Europea, similar a los Estados Unidos, fue amargamente saboteado por los Estados Unidos, principalmente a través del topo estadounidense en la UE, a saber, el Reino Unido.

Estados Unidos no quería una Europa fuerte, tanto económica como posiblemente con el tiempo también militarmente (pop. 450 millones de la UE, frente a US pop. 330 millones; 2019 PIB de la UE US$ 20,3 billones equivalentes, frente al PIB de EE.UU. 21,4 billones. La mayoría de los economistas estarían de acuerdo en que una moneda común para un grupo de países sueltos no tiene futuro, no es sostenible. No existe una Constitución común, por lo tanto, no hay un objetivo común, financiera, económica y militarmente. Una moneda común no es sostenible a largo plazo en estas circunstancias inestables. Esto es más que visible sólo 20 años después del euro. La eurozona es un desastre desesperado. En el Banco Central Europeo (BCE), también una creación inspirada en la FED y el Tesoro de los Estados Unidos. El BCE no tiene realmente ninguna función del Banco Central. Es más bien un perro de observación. Porque cada país miembro de la UE todavía tiene su propio Banco Central, aunque con una soberanía drásticamente reducida que los países de la eurozona concedieron al BCE, sin recibir ningún derecho equivalente.

De los 27 miembros de la UE, sólo 19 forman parte de la zona euro. Aquellos países que no forman parte de la Eurozona, es decir, la República Checa, Dinamarca, Hungría, Suecia, y más, han preservado su política financiera soberana y no dependen del BCE. Esto significa que si Grecia hubiera optado por no participar en la Eurozona cuando se vieron afectados por la “crisis” fabricada en 2008/2009, Grecia estaría ahora en camino hacia la recuperación completa. No habrían sido objeto de los caprichos y dictados del FMI, la infame troika, la Comisión Europea (CE), el BCE y el FMI, pero podrían haber optado por organizar su deuda internamente, ya que la mayor parte de la deuda era deuda interna, sin necesidad de endeudarse del extranjero.

En un referéndum de rescate de 2015, la población griega votó abrumadoramente en contra del rescate, lo que significa contra la nueva deuda gigantesca. Sin embargo, el entonces presidente griego Tsipras, siguió adelante como si el referéndum nunca hubiera tenido lugar y aprobó el enorme rescate a pesar de casi el 70% del voto popular en su contra.

Esto es una clara indicación de fraude, que no estaba pasando juego limpio. Tsipras y / o sus familias pueden haber sido coaccionados para aceptar el rescate – o de lo contrario. Tal vez nunca sepamos la verdadera razón por la que Tsipras vendió a su pueblo, el bienestar del pueblo griego a los oligarcas detrás del FMI y el Banco Mundial, y los puso en abyecta miseria, con el mayor desempleo en Europa, pobreza desenfrenada y tasas de suicidio disparadas.

Grecia puede servir de ejemplo sobre cómo pueden llevar a otros países de la UE si no se “comportan”, lo que significa adherirse a las reglas de oro no escritas de obediencia a los maestros del dinero internacional.

Esto da miedo.

*

Y ahora, en estos tiempos de covid, es relativamente fácil. Los países pobres, en particular en el Sur Mundial, ya endeudados por el plandemic, están aumentando su deuda externa para satisfacer a sus poblaciones necesidades básicas. O eso te hacen creer. Gran parte de la deuda acumulada por los países en desarrollo es deuda interna o interna, como la deuda del Norte Global. Realmente no necesita instituciones de préstamos extranjeras para eliminar la deuda local. ¿O ha visto a uno de los países ricos del Norte Global pedir prestado al FMI o al Banco Mundial para dominar su deuda? – Difícilmente.

Entonces, ¿por qué caería el Sur Global? Corrupción parcial, coacción parcial y chantaje parcial. – Sí, el chantaje, uno de los crímenes más grandes internacionales imaginables, fue cometido por las principales instituciones financieras internacionales de las Naciones Unidas, el BM y el FMI.

Por ejemplo, el mundo entero se pregunta cómo es que un enemigo invisible, un virus coronazo a los 193 países miembros de la ONU a la vez, por lo que el Dr. Tedros, Director General de la OMS, declara el 11 de marzo una pandemia -sin razón alguna ya que sólo hubo 4.617 casos en todo el mundo-, pero el resultado previsto fue un bloqueo mundial total el 16 de marzo de 2020. Sin excepciones. Había algunos países que no se lo tomaban tan en serio, como Brasil, Suecia, Bielorrusia, algunos países africanos, como Madagascar y Tanzania, desarrollaron sus propias reglas y se dieron cuenta de que el uso de máscaras hacía más daño que bien, y el distanciamiento social destruiría el tejido social de sus culturas y las generaciones futuras.

Pero el estado satánico y oscuro no quería tener nada que ver con los países “independientes”. Todos ellos tuvieron que seguir el dictado desde muy arriba, desde las Puertas, Rockefeller, Soroses, et al elite, pronto para ser reforzados por Klaus Schwab, sirviendo como el secuaz jefe del Foro Económico Mundial (WEF). De repente, se ve en Brasil, un aumento drástico en nuevos “casos”, sin preguntas, pruebas masivas, no importa que las infames pruebas de PCR no valen nada, según los científicos más serios – ver “La prueba COVID-19 RT-PCR: Cómo engañar a toda la humanidad. Usando una “Prueba” para encerrar a la Sociedad (por Pascal Sacré – 5 de noviembre de 2020) (sólo los científicos vendidos y corruptos, los pagados por las autoridades nacionales, seguirían insistiendo en las pruebas RT-PCR). El brasileño Bolsonaro se enferma con el virus y el recuento de muertes aumenta exponencialmente, a medida que la economía brasileña se desmorona.

¿Coincidencia? Apenas.

En los países del Banco Mundial y/o el FMI, ofreciendo ayuda masiva principalmente alivio de la deuda, ya sea como subvenciones o como préstamos a bajo interés. Pero con enormes ataduras: Debe seguir las reglas establecidas por la OMS, debe seguir las reglas sobre las pruebas masivas en materia de vacunación, cuando estén disponibles, vacunación de mandatarias – si se ajusta a estas y otras reglas específicas de cada país, como dejar que las corporaciones occidentales toquen sus recursos naturales, continuar privatizando su infraestructura social y servicios – puede recibir asistencia del BM y el FMI.

Ya en mayo de 2020, el Grupo del Banco Mundial anunció que sus operaciones de emergencia para luchar contra el COVID-19 ya habían llegado a 100 países en desarrollo, hogar del 70% de la población mundial con préstamos de 160 mil millones de dólares ee.UU. más. Esto significa, para hoy, 6 meses más tarde y en medio de la “Segunda Ola”, el número de países y el número de préstamos o subvenciones de “alivio” debe haber aumentado exponencialmente, habiendo llegado a cerca de los 193 países miembros de la ONU. Lo que explica cómo todos, literalmente todos los países, incluso los países africanos más importantes, como Madagascar y Tanzania, entre los más pobres de los pobres, han sucumbido a la coacción o chantaje de las infames instituciones de Bretton Woods.

Estas instituciones no tienen disputas en la generación de dólares, ya que el dólar es dinero fiduciario, no respaldado por ninguna economía, sino que puede ser producido literalmente desde el aire caliente y prestado a los países pobres, ya sea como deuda o como subvención. Estos países, a partir de ahora y por la presión de las instituciones financieras internacionales, dependerán para siempre de los maestros occidentales de la salvación. Covid-19 es la herramienta perfecta para que los mercados financieros palanen activos de abajo a arriba.

Con el fin de maximizar la concentración de las riquezas en la parte superior, tal vez una o dos o incluso tres nuevas ondas covid pueden ser necesarias. Todo eso está planeado, el WEF ya ha previsto los próximos escenarios, por su libro tiránico “Covid-19 – El Gran Reinicio”. Está todo dispuesto. Y nuestros intelectuales occidentales lo leen, lo analizan, lo critican, pero no lo destrozamos, lo dejamos pararse y observamos cómo se mueve la palabra en la dirección Restablecer. Y el plan es ejecutado debidamente por el Banco Mundial y el FMI, todo bajo el pretexto de hacer el bien para el mundo.

¿Qué es diferente del papel del Banco Mundial y el FMI ante el plandemic covid? – Nada. Sólo la causa de la explotación, el indevolcimiento, la esclavitud. Cuando Covid llegó se hizo fácil. Antes de eso y hasta finales de 2019, los países en desarrollo, en su mayoría ricos en recursos naturales como los codiciados occidentales, el petróleo, el oro, el cobre y otros minerales, como las tierras raras, serían abordados por el BM, el FMI o ambos.

Podrían recibir alivio de la deuda, los llamados préstamos de ajuste estructural, sin importar si realmente necesitaban o no esa deuda. Hoy en día estos préstamos vienen en todos los nombres, formas, formas y colores, literalmente como las revoluciones de color, por ejemplo, a menudo como operaciones de apoyo presupuestario – simplemente los llamo cheques en blanco – nadie controla lo que está sucediendo con el dinero. Sin embargo, los países tienen que reestructurar sus economías, racionalizar sus servicios públicos, privatizar el agua, la educación, los servicios de salud, la electricidad, las carreteras, los ferrocarriles y otorgar concesiones extranjeras para la explotación de los recursos naturales.

La mayor parte de este fraude –el fraude al “robar” los recursos nacionales, pasa sin ser visto por el público en general, pero los países se vuelven cada vez más dependientes de los paymasters occidentales – la soberanía de los pueblos y la soberanía institucional se ha ido. Siempre hay un corruptor y un corrupto. Desafortunadamente, siguen estando omnipresentes en el Sur Global. A menudo, por una porción de dinero, los países se ven obligados a votar con los Estados Unidos a favor o en contra de ciertas resoluciones de la ONU que son de interés para los Estados Unidos. Aquí vamos, el sistema corrupto de la ONU.

Y, por supuesto, cuando se crearon las dos organizaciones de Bretton Woods en 1944, el sistema de votación decidió que no es un país, un voto como en teoría es en la ONU, pero Estados Unidos tiene un derecho absoluto de veto en ambas organizaciones. Sus derechos de voto se calculan en función de su contribución de capital que deriva de una fórmula compleja, basada en el PIB y otros indicadores económicos. En ambas instituciones, el derecho de voto de los Estados Unidos y también el derecho de veto es de alrededor del 17%. Ambas instituciones tienen 189 países miembros. Ninguno de estos otros países tiene un derecho de voto superior al 17%. La UE lo habría hecho, pero los Estados Unidos nunca les permitieron convertirse en un país o una Federación.

*

Covid ha puesto al descubierto, si no antes, cómo estas instituciones financieras internacionales “oficiales” de Bretton Woods, constituidas por las Naciones Unidas, están plenamente integradas en el sistema de las Naciones Unidas, en el que la mayoría de los países todavía confían, tal vez por falta de algo mejor.

Pregunta, sin embargo: ¿Qué es mejor, un sistema corrupto hipócrita que proporciona la “apariencia”, o la abolición de un sistema distópico y el valor de crear uno nuevo, en nuevas circunstancias democráticas y con derechos soberanos por cada país participante?

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

Este artículo fue publicado originalmente en New Eastern Outlook.

Peter Koenig es economista y analista geopolítico. También es especialista en recursos hídricos y medio ambiente. Trabajó durante más de 30 años con el Banco Mundial y la Organización Mundial de la Salud en todo el mundo en los campos del medio ambiente y el agua. Da conferencias en universidades de Estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea como Global Research; ICH; Nueva Perspectiva Oriental (NEO) y más. Es autor de Implosion – Un Thriller Económico sobre Guerra, Destrucción Ambiental y Codicia Corporativa – ficción basada en hechos y en 30 años de experiencia en el Banco Mundial en todo el mundo.

Peter también es coautor del libro de Cynthia McKinney “When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis” (ClarityPress – 1 de noviembre de 2020)

Peter Koenig es investigador asociado del Centro de Investigación sobre la Globalización.

La fuente original de este artículo es Global Research. Derechos de autor © Peter Koenig, Global Research, 2020

The Secret Agenda of the World Bank and the IMF – Global ResearchGlobal Research – Centre for Research on Globalization

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.

¿Exagero?

Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

“Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico”.

https://www.msn.com/es-es/entretenimiento/noticias/la-extra%C3%B1a-muerte-por-coronavirus-de-un-anciano-argentino-que-viv%C3%ADa-aislado/ar-BB1aIm4l?ocid=msedgntp

The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

“Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, “said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, “he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, “the doctor recalled”.

CARTAS A LA OMS Y MÁS

Destinatarios


  • Tedros Adhanom Ghebreyesus , Organización Mundial de la Salud;
  • Mario Monti , Jefe de Salud de la Organización Mundial de la Salud;
  • Ursula Von der Leyen , presidenta de la Comisión Europea;
  • David Sassoli , presidente del Parlamento Europeo;
  • a los Presidentes de cada Nación;
  • a los Ministros de Salud de cada nación.

Carta de:

Luc Montagnier ,
Premio Nobel de Medicina, Francia

Estimados presidentes y ministros:

Como grupo internacional de científicos, médicos y abogados, nos comunicamos con usted hoy con respecto a la epidemia de SARS-CoV-2, que ha cambiado la vida de personas en todo el mundo.

Después de un período de perplejidad al formular tanto el diagnóstico de infección por covid-19 como la terapia para los pacientes, parece que, como ocurre con muchas otras infecciones virales, existen tres tipos de características clínicas de esta infección:

  1. asintomático en pacientes con PCR positiva;
  2. sintomático con signos clínicos leves;
  3. sintomático con insuficiencia orgánica grave.

Una terapia experimentada por primera vez en China y desarrollada en Francia por Pr Didier Raoult ha demostrado tener cierta eficacia en los dos primeros grupos de pacientes. Esta terapia implica el uso de hidroxicloroquina en dosis moderadas en combinación con azitromicina, inmunomoduladores y antioxidantes, y tiene como objetivo evitar que estos pacientes evolucionen a la fase tres más grave.

Proponemos que una comisión médica desarrolle un protocolo terapéutico basado en la experiencia clínica. Este comité debe ser independiente de la presión económica de las empresas farmacéuticas, los grupos políticos y los editores de revistas científicas.

Se ha demostrado que la evolución de los pacientes de la fase 2 a la fase 3 podría verse bloqueada por la terapia anterior. Como resultado, la letalidad (proporción de muertes por pacientes con PCR positiva) podría ser un parámetro importante de eficacia de este protocolo.

Si no hay respuesta lo consideraremos de acuerdo con nuestras conclusiones.

Sinceramente

Más cartas y firmas aquí https://www.internationalfreechoice.com/

COVID-21 ¿Película basada en hechos reales?

Traigo aquí un supuesto correo-e de un político del Partido Liberal Canadiense. Como el virus decían que supuestamente declinaría en la época estival y así no ha sido, ya me espero cualquier cosa. Tal texto puede ser una realidad en la estrategia, las tácticas pueden variar dependiendo de muchos factores. Lean como ficción y entiendan como realidad fronteriza que nos ha tocado ver, leer y escuchar en el limbo de la percepción vital. El guion de la película está escrito…

De una fuente anónima:

Comité Estratégico de LPC LeakInboxLPC leaker <LPC_leaker@protonmail.com>1:47 PM (7 horas hace )toHello,

Mensaje Original ‐‐‐‐‐‐‐

El sábado 10 de octubre de 2020 1:38 PM,

REMOVED <REMOVED>

escribió: Querido *******, Quiero proporcionarle información muy importante. Soy miembro del comité dentro del Partido Liberal de Canadá. Me siento dentro de varios grupos de comités, pero la información que estoy proporcionando proviene del comité de Planificación Estratégica (que es dirigido por la PMO).

Necesito empezar diciendo que no soy feliz haciendo esto, pero tengo que
hacerlo. Como canadiense y lo que es más importante como padre que quiere un futuro mejor no sólo para mis hijos, sino también para otros niños. La otra razón por la que estoy haciendo esto es porque aproximadamente el 30% de los miembros del comité no están satisfechos con la dirección que esto llevará a Canadá, pero nuestras opiniones han sido ignoradas y planean avanzar hacia sus metas. También han dejado muy claro que nada detendrá los resultados previstos.

La hoja de ruta y el objetivo fueron establecidos por la PMO y es el siguiente: – Fase en las restricciones de bloqueo secundario sobre una base de rodadura, comenzando con las principales áreas metropolitanas primero y expandiéndose hacia el exterior.

Se espera para noviembre de 2020.

Apresurar la adquisición (o construcción de) instalaciones de aislamiento en todas las provincias y territorios.

Se espera para diciembre de 2020.

– Los nuevos casos diarios de COVID-19 aumentarán más allá de la capacidad de las pruebas, incluyendo aumentos en las muertes relacionadas con COVID después de las mismas curvas de

crecimiento. Se espera para finales de noviembre de 2020. – Bloqueo secundario completo y total (mucho más estricto que la primera y segunda restricciones de fase rodante).

Previsto para finales de diciembre de 2020

– principios de enero de 2021 – Reforma y ampliación del programa de desempleo que se convertirá en el programa de renta básica universal. Se espera para el primer trimestre de 2021.

– Mutación COVID-19 proyectada y/o coinución con virus secundarios(denominado COVID-21)dando lugar a una tercera onda con una tasa de mortalidad mucho mayor y una mayor tasa de infección.

Se espera para febrero de 2021.

– Los nuevos casos diarios de hospitalizaciones COVID-21 y muertes relacionadas con COVID-19 y COVID-21 superarán la capacidad de los centros de atención médica. Esperado Q1 – Q2 2021.

– Se implementarán restricciones de bloqueo mejoradas (denominadas Tercer Bloqueo). Se impondrán restricciones de viaje completas (incluidas las interridades y las interesoreidades). Se espera el segundo trimestre de 2021. – Transición de individuos al programa universal de renta básica.

Se espera a mediados del segundo trimestre de 2021. – Projected cadena de suministro descomponeciones, escasez de inventario, gran inestabilidad económica.

Se espera a finales del segundo trimestre de 2021. – Despliegue de personal militar en las principales áreas metropolitanas, así como en todas las carreteras principales para establecer puestos de control de viaje.

Restringir el viaje y el movimiento. Proporcionar apoyo logístico a la zona. Se espera para el tercer trimestre de 2021.

Junto con eso, se pidió a la comisión de Planificación Estratégica que diseñara una forma eficaz de hacer la transición de los canadienses para hacer frente a un esfuerzo económico sin precedentes.

Uno que cambiaría el rostro de Canadá y alteraría para siempre la vida de los canadienses. Lo que se nos dijo fue que para compensar lo que era esencialmente un colapso económico a escala internacional, que el gobierno federal iba a ofrecer a los canadienses un alivio total de la deuda.

Así es como funciona: el gobierno federal ofrecerá eliminar todas las deudas personales (hipotecas, préstamos, tarjetas de crédito, etc.) que todos los fondos serán proporcionados a Canadá por el FMI bajo lo que se conocerá como el programa de Restablecimiento Mundial dela Deuda .

A cambio de la aceptación de esta condonación total de la deuda, el individuo perdería la propiedad de todos y cada uno de los bienes y activos para siempre.

La persona también tendría que aceptar participar en el calendario de vacunación COVID-19 y COVID-21, que proporcionaría a la persona un viaje sin restricciones y una vida sin restricciones incluso bajo un bloqueo completo (mediante el uso de la identificación con foto conocida como HealthPass de Canadá).

Los miembros del Comité preguntaron quién se convertiría en el propietario de los bienes y activos perdidos en ese escenario y qué sucedería con los prestamistas o instituciones financieras, simplemente nos dijeron “el programa de Restablecimiento Mundial de la Deuda manejará todos los detalles”.

Varios miembros del comité también cuestionaron lo que les pasaría a las personas si se negaban a participar en el programa World Debt Reset, o el HealthPass, o el calendario de vacunación, y la respuesta que obtuvimos fue muy

preocupante. Esencialmente nos dijeron que era nuestro deber asegurarnos de que se nos ocurrió un plan para asegurar que eso nunca sucedería. Nos dijeron que era en el mejor interés para los individuos participar.

Cuando varios miembros del comité presionaron implacablemente para obtener una respuesta, nos dijeron que aquellos que se negaran vivirían primero bajo las restricciones de bloqueo indefinidamente.

Y que en un corto período de tiempo a medida que más canadienses pasaran al programa de condonación de la deuda, los que se negaran a participar se considerarían un riesgo para la seguridad pública y serían reubicados en instalaciones de aislamiento.

Una vez en esas instalaciones se les darían dos opciones, participarían en el programa de condonación de deudas y serían liberados, o permanecerían indefinidamente en la instalación de aislamiento bajo la clasificación de un grave riesgo para la salud pública y tener todos sus activos confiscados.

Así que como pueden imaginar después de escuchar todo esto se convirtió en una discusión acalorada y se intensificó más allá de cualquier cosa que he presenciado
antes. Al final, la OMG insinuó que todo el programa avanzará sin importar quién esté de acuerdo o no. Que no será sólo Canadá, sino que, de hecho, todas las naciones tendrán hojas de ruta y agendas similares.

Que tenemos que aprovechar las situaciones que tenemos ante nosotros para promover el cambio a una escala más grande para el mejoramiento de todos. Los miembros que se opusieron y los que plantearon cuestiones clave que surgirían de tal cosa fueron completamente ignorados. Nuestras opiniones e inquietudes fueron ignoradas. Simplemente nos dijeron que lo hiciéramos.

Todo lo que sé es que no me gusta y creo que va a colocar a los canadienses en un futuro oscuro.

COVID-21 Movie based on real events?

I bring here an alleged e-mail from a politician from the Canadian Liberal Party. As they said the virus would supposedly decline in the summer season and it has not, I expect anything. Such text can be a reality in strategy, tactics can vary depending on many factors. Read as fiction and understand as a border reality that we have had to see, read and hear in the limbo of vital perception. The script for the film is written …

https://www.nexusnewsfeed.com/article/geopolitics/canadian-control-measures-just-the-tip-of-the-earth-sized-iceberg

La hoja de ruta de Covid-19: Hacia el caos económico mundial y la destrucción social

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación del virus no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

Por el profesor Michel Chossudovsky Global Research, 13 de octubre de 2020

Ahora se confirma sin lugar a dudas que la prueba de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizada para estimar casos positivos COVID-19 no tiene sentido. No puede detectar ni identificar el virus. Lo que detecta son partículas o fragmentos de numerosos virus, incluyendo el resfriado común (corona beta) y la gripe estacional (virus A y B)

PCR- Positivo no implica Covid-19 Positivo. Las estadísticas derivadas de la prueba de ITP no miden los “casos confirmados”. La prueba del ITP no proporciona las estadísticas requeridas (por los responsables de la formulación de políticas y las autoridades sanitarias nacionales) para evaluar el número de personas infectadas.

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación de la infección viral no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

La prueba de PCR es la pistola humeante. ¿por qué?

Debido a que la prueba de PCR es defectuosa e inválida como medio para identificar la propagación del virus, lo que significa que TODAS LAS DECISIONES PRINCIPALES tomadas por la OMS y los gobiernos nacionales desde finales de enero de 2020 (apoyadas por estadísticas defectuosas) no son válidas. Además, los informes oficiales, incluida la OMS, confirman que Covid-19 no es un virus asesino, tiene características similares a la gripe estacional.

El propósito de este artículo es examinar cómo estas decisiones de gran alcance, invariablemente basadas en mentiras y estadísticas erróneas, han contribuido a un estado de caos económico, social y político en todo el mundo, lo que ha llevado al cierre y cierre de 190 economías nacionales de los Estados miembros de las Naciones Unidas. Sólo tres países, entre ellos Bielorrusia, Nicaragua y Suecia, se negaron a cerrar su economía nacional.

El cierre de las economías nacionales se presentó como un medio para hacer frente al “Virus Asesino” y “Salvar Vidas”. Está muy documentado, sus impactos han llevado al desempleo masivo y a la pobreza en todo el mundo.


Anexo al presente artículo: Detalles relativos a la prueba RT-PCR

Para obtener más detalles sobre la prueba PCR, haga clic aquí


La hoja de ruta hacia el caos económico y la destrucción social

18 de octubre de 2019. 201 Ejercicio de simulación pandémica

El coronavirus fue nombrado inicialmente 2019-nCoV por la OMS, el mismo nombre que el adoptado en el ejercicio de simulación del 18 de octubre de 2019 201 bajo los auspicios de la Escuela de Salud John Hopkins Bloomberg, Centro para la Seguridad de la Salud (un evento patrocinado por la Fundación Gates y el Foro Económico Mundial). (Evento 201)

7 de enero de 2020: Las autoridades chinas “identificaron un nuevo tipo de virus” que (según los informes oficiales) fue aislado el 7 de enero de 2020.

20-24 de enero: Reuniones del Foro Económico Mundial en Davos. El papel de los poderosos intereses financieros

Los intereses financieros dominantes, las fundaciones multimillonarias y las instituciones financieras internacionales desempeñaron un papel clave en la puesta en marcha de la Emergencia de Salud Pública de la OMS (PHEIC). La decisión no fue tomada por la OMS.

En la semana anterior a esta histórica decisión de la OMS. El PHEIC fue objeto de “consultas” en el Foro Económico Mundial (WEF), Davos (21-24 de enero). El Director General de la OMS, Dr. Tedros, estuvo presente en Davos. Estas consultas fueron fundamentales para influir en la decisión histórica de la OMS del 30 de enero.

¿Hubo un conflicto de intereses definido por la OMS? El mayor donante de la OMS es la Fundación Bill y Melinda Gates, que junto con el WEF y el CEPI ya había anunciado en Davos el desarrollo de una vacuna Covid-19 antes del histórico 30 de enero de la PHEIC.

28 de enero de 2020: El Centro para el Control y la Prevención de Enfermedades (CDC) de los Estados Unidos confirmó que el virus de la novela corona había sido aislado. Hasta la fecha, el proceso de identificación del virus no se ha hecho público.

30 de enero de 2020: La Emergencia de Salud Pública de Preocupación Internacional (PHEIC) de la OMS

La primera etapa de esta crisis fue lanzada por la OMS el 30 de enero. Aunque oficialmente no fue designada como una “Pandemia”, sin embargo contribuyó a encabezar la campaña del miedo.

Desde el principio, las estimaciones de “casos positivos confirmados” han sido parte de un “Juego de Números”.

En algunos casos las estadísticas simplemente no se mencionaban y en otros casos los números se inflaban con el fin de crear pánico.

El número de “casos confirmados” basado en estimaciones erróneas (PCR) utilizadas para justificar esta decisión de alcance lejano fue ridículamente bajo.

La población mundial fuera de China es del orden de 6.400 millones. El 30 de enero de 2020 fuera de China había:

83 casos en 18 países, y sólo 7 de ellos no tenían antecedentes de viajes en China. (véase OMS,30 de enero de 2020).

El 29 de enero de 2020, el día anterior al lanzamiento del PHEI(registrado por la OMS), hubo 5 casos en los Estados Unidos, 3 en Canadá, 4 en Francia, 4 en Alemania.

No había una “base científica” que justificara el lanzamiento de una emergencia mundial de salud pública.

Captura de pantalla de la tabla de la OMS, 29 de enero de 2200,

un día antes de la decisión de la OMS de declarar una emergencia mundial de salud pública

Esos números ridículamente bajos (no mencionados por los medios de comunicación) se utilizaron para encabezar una campaña de miedo en todo el mundo.

31 de enero de 2020: Decisión del presidente Trump de suspender los viajes aéreos con China

Mientras que la OMS “no recomendó restricciones a los viajes o al comercio”, los cinco llamados “casos confirmados” en los Estados Unidos fueron suficientes para “justificar” la decisión del presidente Trump el 31 de enero de suspender los viajes aéreos a China mientras precipitaba una campaña de odio contra los chinos étnicos en todo el mundo occidental.

Esta histórica decisión del 31 de enero allanó el camino hacia la interrupción del comercio internacional de productos básicos, así como las restricciones mundiales a los viajes aéreos.

Y esos “casos confirmados” defectuosos fueron en su mayor parte utilizando la prueba RT-PCR estándar.

20-21 de febrero de 2020. Datos de Covid en todo el mundo fuera de China: el crucero Diamond Princess

Si bien China informó de un total de 75.567 casos de COVID-19, (20 de febrero) los casos confirmados fuera de China eran abismáticamente bajos y las estadísticas basadas en gran parte en la prueba de ITP utilizada para confirmar la “propagación mundial del virus” eran cuestionables, por decir lo menos. Además, de los 75.567 casos en China, un gran porcentaje se había recuperado. Y las cifras de recuperación no fueron reconocidas por los medios de comunicación.

El día de la histórica conferencia de prensa del Dr. Tedros (20 de febrero de 2020) el número registrado de casos confirmados fuera de China fue de 1073 de los cuales 621 eran pasajeros y tripulantes en el Diamond Princess Cruise Ship (atrapado en aguas territoriales japonesas).

Desde un punto de vista estadístico, la decisión de la OMS que señalaba una posible “difusión del virus en todo el mundo” no tenía sentido.

El 20 de febrero, el 57,9% de los “casos confirmados” de Covid-19 en todo el mundo eran de la Diamond Princess, apenas representativa de una “tendencia estadística” mundial. La historia oficial es la siguiente:

  • Un pasajero con sede en Hong Kong que había desembarcado de la Princesa Diamante en Hong Kong el 25 de enero desarrolló neumonía y fue positivo para la novela coronavirus el 30 de enero.
  • Se informó que había viajado el 10 de enero a Shenzhen en China continental (que limita con los nuevos territorios de Hong Kong).
  • La Princesa Diamante llegó a Yokohama el 3 de febrero. Se impuso una cuarentena al estudio de la serie de cruceros Ver NCBI.
  • Muchos pasajeros se enfermaron debido al confinamiento en el barco.
  • Todos los pasajeros y la tripulación de la Princesa Diamante emprendieron la prueba de PCR.
  • El número de casos confirmados aumentó a 691 el 23 de febrero.

Desde el punto de vista de la evaluación de las tendencias estadísticas mundiales, los datos no se levantan. Sin los datos de Diamond Princess, los llamados casos confirmados en todo el mundo fuera de China el 2o de febrero habrían sido del orden de 452, de una población de 6.400 millones de habitantes.

Examine el gráfico de la OMS a continuación. El azul indica los casos confirmados sobre la Diamond Princess (transporte internacional) (que llegó a Yokohama el 3 de febrero de 2020), muchos de los cuales estuvieron enfermos, confinados en sus habitaciones durante más de dos semanas (cuarentena impuesta por Japón). Todos los pasajeros y la tripulación realizaron la prueba RT-PCR (que no detecta ni identifica Covid-19).

No hace falta decir que estos supuestos datos fueron fundamentales para encabezar la campaña del miedo y el colapso de los mercados financieros en el transcurso del mes de febrero. (ver sección a continuación)

Fuente OMS, 28 de febrero de 2020

La crisis financiera de febrero de 2020. El choque corona 2020

Del 20 al 21 de febrero de 2020 se cumple el inicio del colapso financiero de 2020.

20 de febrero de 2020: En una conferencia de prensa celebrada el jueves 20 de febrero por la tarde (hora del AEC) en una reunión informativa en Ginebra, el Director General de la OMS. El Dr. Tedros Adhanom Ghebreyesus, dijo que era

“preocupado de que la posibilidad de contener el brote de coronavirus se “cerrara” …

“Creo que la ventana de oportunidad sigue ahí, pero que la ventana se está estrechando.”

Estas declaraciones de “shock and awe” contribuyeron a aumentar la campaña del miedo, a pesar del hecho de que el número de casos confirmados fuera de China era extremadamente bajo.

Oficialmente 1073 casos en todo el mundo.

Excluyendo a la Diamond Princess, 452 los llamados “casos confirmados” en todo el mundo fuera de China, para una población de 6.400 millones registradas por la OMS el 20 de febrero, 15 en los Estados Unidos, 8 en Canadá, 9 en el Reino Unido.

Se registraron un mayor número de casos fuera de China en Corea del Sur (153 casos según la OMS) e Italia (registrados por las autoridades nacionales).

Datos de la OMS registrados en febrero de 2020 al comienzo del llamado Covid Financial Crash (derecha)

La declaración del Dr. Tedros (basada en conceptos y estadísticas defectuosos) puso las bases para el colapso financiero de febrero provocado por información privilegiada, conocimiento previo, comercio de derivados, ventas en corto y una gran parte de las operaciones de los fondos de cobertura.

Quien tuviera conocimiento previo (información privilegiada) de la declaración del Director General de la OMS del 20 de febrero habría cosechado importantes beneficios monetarios.

¿Hubo un conflicto de intereses? La OMS recibe fondos de la Fundación Gates. Y Bill Gates tiene “60% de sus activos invertidos en acciones [incluyendo acciones y fondos de índices]”, según un informe de la CNBC de septiembre de 2019.

El desplome bursátil iniciado el 20 de febrero, conocido como el Accidente coronavirus 2020,fue categorizado como:

“la caída más rápida en los mercados bursátiles globales en la historia financiera, y el desplome más devastador desde el accidente de Wall Street de 1929.”

La causa de la crisis financiera fue (según los analistas), V. El Virus. La propagación del virus fuera de China.

La campaña de miedo del “virus asesino” junto con las oportunas “advertencias” del Dr. Tedros sobre la necesidad de implementar una pandemia mundial sirvieron indeleblemente a los intereses de los especuladores institucionales y fondos de cobertura de Wall Street. El desplome financiero condujo a un cambio importante en la distribución de la riqueza del dinero. (ver análisis a continuación)

En la semana siguiente al anuncio de la OMS del 20 al 21 de febrero,el Dow Jones se derrumbó un 12% (CNBC, 28 de febrero de 2020). Según los analistas, la caída de la DJIA fue el resultado de la propagación mundial del virus. Una declaración sin sentido en contradicción con el (pequeño) número de estimaciones positivas de la OMS Covid, la mayoría de las cuales se basaron en la prueba de PCR defectuosa.El lunes 24 de febrero, tras la reapertura de los mercados bursátiles, hubo una caída sin precedentes en el Dow Jones atribuible a los “peligros inminentes” que“Covid estaba extendiendo en todo el mundo creando incertidumbres en los mercados financieros”..Las existencias cayeron bruscamente el lunes (24 de febrero) a medida que aumentaba el número de casos de coronavirus fuera de China,lo que avivó los temores de una prolongada desaceleración económica mundial debido a la propagación del virus. El promedio industrial Dow Jones cerró 1.031,61 puntos menos, o un 3,56%, en 27.960,80.” (CNBC) (sin cursivas en el apartado de inglés)

Promedio industrial Dow Jones Diciembre 2019 – Marzo 2020

También el 24 de febrero, Trump solicitó una ayuda de emergencia de 1.250 millones de dólares.

Según la BBC, los mercados bursátiles mundiales vieron fuertes caídas “debido a las preocupaciones sobre el impacto económico del virus”, lo que sugiere que el virus era “la “mano” invisible responsable de la disminución de los mercados financieros.

COVID-19 fue identificado por poco como el catalizador de la crisis financiera.

¿Quién estaba detrás de este catalizador? ¿Quién estuvo detrás de la campaña de miedo que contribuyó a desencadenar el caos y la incertidumbre en los mercados financieros?

11 de marzo de 2020: La pandemia Covid-19, encierro, cierre de 190 economías nacionales

El Director General de la OMS había puesto las bases en su Conferencia de Prensa del 21 de febrero. “el mundo debería hacer más para prepararse para una posible pandemia de coronavirus”. La OMS ha pedido a los países que estén “en una fase de preparación”.

El 11 de marzo de 2020: la OMS declaró oficialmente una pandemia mundial en un momento en que había 18.000 casos confirmados y 4291 muertes de una población mundial total fuera de China del orden de 6.400 millones de personas. ¿Qué te dicen estas “estadísticas”?

Inmediatamente después del anuncio del 11 de marzo de la OMS, la campaña del miedo se puso en marcha. Al igual que en el caso del accidente del 20 al 21 de febrero, la declaración del 11 de marzo del Director General de la OMS había puesto las bases. Los mercados bursátiles se desplomaron en todo el mundo. A la mañana siguiente, el Dow (DJIA) se desplomó un 9,99% (una disminución de 2.352,60 para cerrar en 21.200,62). El Jueves Negro, 12 de marzo de 2020, fue “el peor día del Dow” desde 1987. Se había producido una transferencia masiva de la salud de la riqueza financiera en favor de los multimillonarios estadounidenses.

Las instrucciones de confinamiento se transmitieron a 193 Estados miembros de las Naciones Unidas.Los políticos son los instrumentos de poderosos intereses financieros. ¿Se justificó esta decisión de gran alcance como un medio para combatir el Virus?

Sin precedentes en la historia, aplicada casi simultáneamente en un gran número de países, sectores enteros de la economía mundial fueron desestabilizados. Las pequeñas y medianas empresas fueron conducidas a la bancarrota. El desempleo y la pobreza son desenfrenados.

En algunos países han estallado las hambrunas. Los impactos sociales de estas medidas son devastadores. Los impactos en la salud (mortalidad, morbilidad) de estas medidas, incluida la desestabilización del sistema de atención sanitaria nacional (en numerosos países) superan con creces los atribuidos a Covid-19. (Para más detalles ver artículo del autor aquí,

Enriquecimiento multimillonario. La apropiación y redistribución de la riqueza

La riqueza multimillonaria ha aumentado drásticamente desde principios de febrero. Hay tres fases distintas, que están directamente relacionadas con la crisis de la corona, cada una de las cuales está marcada por cambios importantes en la distribución de la riqueza global.

  1. La crisis financiera iniciada el 20 de febrero propiciaba una redistribución dramática de la riqueza monetaria y la propiedad de los activos financieros. El conocimiento previo, la información privilegiada y el comercio especulativo desempeñaron un papel clave. ¿Hubo conocimiento previo de la declaración del Dr. Tedros de la OMS del 20 de febrero?
  2. El cierre y cierre del 11 de marzo de las economías nacionales de 190 Estados miembros de la ONU, que desencadenaron las quiebras tanto de las pymes como de las pymes en todo el mundo. El evento del 11 de marzo también estuvo marcado por la caída de los mercados bursátiles en todo el mundo, comenzando el jueves negro 12 de marzo de 2020.
  3. La tercera etapa del enriquecimiento multimillonario se refiere a la aplicación de la llamada “Segunda Ola”, que consiste en desencadenar una nueva ola de quiebras.

La redistribución de la riqueza en favor de la clase multimillonaria se confirma mediante un estudio de IPS relativo al cierre de la economía mundial.

La riqueza combinada de los multimillonarios estadounidenses aumentó en 850.000 millones de dólares desde el 18 de marzo de 2020,lo que supone un aumento de más del 28 por ciento. (Esta estimación no tiene en cuenta el aumento de la riqueza durante el período anterior al 18 de marzo, que estuvo marcado por una serie de desplomes bursátiles).

El 18 de marzo de 2020, los multimillonarios estadounidenses habían combinado una riqueza de 2.947 billones de dólares. Para el 8 de octubre, su riqueza ha aumentado a 3,8 billones de dólares (3.798 millones de dólares para ser exactos).

A nivel mundial, los multimillonarios son grandes ganadores durante la pandemia de Covid-19. Según un reciente informe de UBS, los aproximadamente 2.189 multimillonarios mundiales tienen actualmente 10,2 billones de dólares. Se trata de un aumento estimado de 1,5 billones de dólares durante la pandemia que examinan los datos multimillonarios de UBS y Forbes de 2019.

La siguiente tabla identifica el aumento de la riqueza personal de los cinco multimillonarios estadounidenses más ricos (del 18 de marzo al 17 de junio de 2020). (No esbozada en el cuadro, la riqueza de los multimillonarios estadounidenses aumentó en otros 266.000 millones de dólares de junio a octubre de 2020).

Reflexionemos ahora brevemente sobre la Segunda Ola que ahora se impone a millones de personas.

La segunda ola

Septiembre-Octubre 2020. El establecimiento financiero ha dado instrucciones a los gobiernos para que apliquen lo que equivale a un segundo programa de bancarrota utilizando el pretexto y la justificación de que el número de casos positivos de Covid ha aumentado.

Con toda probabilidad, esta segunda oleada conducirá a un nuevo proceso de apropiación y concentración de la riqueza.

Al mismo tiempo, hay una tendencia hacia las formas totalitarias de gobierno.

Todas las formas de actividad social se ven afectadas incluyendo reuniones familiares, bodas y funerales, reuniones públicas, por no hablar del cierre de escuelas, universidades, museos, eventos deportivos y culturales. Ahora se están aplicando medidas del estado policial para hacer cumplir el cumplimiento. ¡Y la gente acepta!

Al comienzo de la Segunda Ola, el proceso de posponer la reapertura de la economía mundial contribuirá indeleblemente a acabar con las pequeñas y medianas empresas (regionales y locales) de todo el mundo, al tiempo que precipitará la quiebra de sectores enteros de la economía mundial, incluidas las aerolíneas, las cadenas hoteleras y la industria turística. Esto, a su vez, conducirá a la apropiación de activos reales por parte de poderosos intereses financieros.

La campaña del miedo ha vuelto a estar en marcha.

Las estadísticas oficiales basadas en estimaciones erróneas y manipuladas de los llamados casos positivos “confirmados” de Covid constituyen la base para justificar estas medidas diabólicas.

V el virus se presenta como la amenaza. Pero el virus no tiene un impacto directo en las variables económicas clave.

Lo que está en juego no tiene precedentes: es una agenda neoliberal global llevada a cabo por gobiernos corruptos en nombre del establishment financiero.

El sentido común nos dice que el cierre de la economía global destruye la vida de las personas.

Interrumpir la campaña del miedo constituye el primer paso hacia la reversión de la marea

Para más detalles sobre los impactos económicos. Artículo relacionado

Combatir el virus: El desempleo masivo no es la solución

Por el Prof. Michel Chossudovsky, 05 de octubre de 2020

Michel Chossudovsky, Profesor de Economía


Anexo

La prueba de reacción en cadena de la transcripción inversa-polimerasa (RT-PCR)

La prueba estándar utilizada para detectar / identificar SARS-2 en todo el mundo es la prueba de reacción en cadena de transcripción inversa-polimerasa(RT-PCR) que se utiliza para estimar y tabular el número de casos covid-19 positivos confirmados. (Esta no es la única prueba utilizada. Las observaciones a continuación se refieren únicamente al ITP estándar).

Según el Premio Nobel, la Dra. Kary Mullis, que inventó la prueba de PCR:

“PCR detecta un segmento muy pequeño del ácido nucleico que forma parte de un virus en sí. El fragmento específico detectado está determinado por la elección un tanto arbitraria de las imprimaciones de ADN utilizadas que se convierten en los extremos del fragmento amplificado.”

La prueba de PCR nunca tuvo la intención de identificar el virus.

La prueba pcR estándar aplicada en relación con Covid-19 no detecta ni identifica el virus. Lo que detecta son fragmentos de varios virus, según el reconocido inmunólogo suizo Dr. B. Stadler. Según el Dr. Pascal Sacré, “estas pruebas detectan partículas virales, secuencias genéticas, no todo el virus”

“Fragmentos de virus positivos” no significa“SARS-2 positivo” (o Covid-19 Positivo). La prueba de PCR puede recoger fragmentos de virus de la gripe (A, B) así como coronavirus beta fríos comunes (por ejemplo, OC43, HKU1). Lo que han hecho los gobiernos es dar al ITP positivo una sola etiqueta, a saber, Covid-19, cuando en realidad la prueba positiva de ITP podría ser el resultado de otros virus, incluidos los relacionados con la gripe o el resfriado común coronavirus, que (según los CDC) tienen síntomas similares a Covid-19.

Una vez establecida y aceptada la etiqueta Covid-19 Positive, está sujeta a numerosas formas de manipulación, por no hablar de la falsificación de certificados de defunción.

Qué es Covid-19, SARS-2. ¿Cómo se prueba? ¿Cómo se mide? La campaña del miedo no tiene base científica

Por el Prof. Michel Chossudovsky, 08 de octubre de 2020La fuente original de este artículo es Global ResearchDerechos de autor © Prof. Michel Chossudovsky, Global Research, 2020

Interpretación Errónea del Virus Parte II: Principio y Fin de la Crisis del Coronavirus

Por Dr. Stefan Lanka

Artículo original publicado en la revista: Wissenschafftplus
Enlace al artículo original: https://wissenschafftplus.de/uploads/article/wissenschafftplus-fehldeutung-virus-teil-2.pdf Fuente de la traducción al español: desconocido.

La definición del SARS y del coronavirus o covid-19 significa que se considera que la neumonía atípica es el cuadro clínico que caracteriza a la enfermedad. Si se pueden detectar patógenos conocidos en la neumonía, ésta se considera típica, si no atípica. Uno de los dos hechos decisivos para el SARS y la crisis del coronavirus es que al menos el 20- 30% de todas las neumonías son atípicas. Las causas de la neumonía atípica son claramente conocidas y por lo tanto NO deben presentarse como la causa de un virus desconocido.

Este hecho es suprimido por los infectólogos y virólogos y es la base del miedo y el pánico actuales, porque se crea la impresión entre los afectados, el público y los políticos, de que la neumonía atípica sería especialmente peligrosa y a menudo mortal porque todavía no hay medicamentos ni vacunas para la supuesta nueva enfermedad.

Desde el momento en que se ofrece un procedimiento de prueba para el supuesto nuevo virus, que, oculto por los implicados, también prueba “positivamente” a personas sanas, el número de casos aumenta automáticamente. Inicialmente, las personas con neumonía típica también serán examinadas, luego más y más personas con otras enfermedades.

Esto se considera una prueba práctica de la propagación del virus. Automáticamente, más y más de otras enfermedades se añaden a la enfermedad original “neumonía atípica” y este “síndrome” se muestra como “la nueva enfermedad viral”.

El otro hecho decisivo, no sólo para el SARS y la crisis del coronavirus, es que los virólogos que afirman que los virus causan enfermedades, están suprimiendo una situación obvia abiertamente mentirosa por razones comprensibles.

El método de prueba de virus que se ofrece es un método de detección genética. No aíslan de un virus las secuencias de genes que utilizan para la prueba de detección. Aíslan secuencias genéticas que se liberan típicamente en mayores cantidades cuando los tejidos y las células mueren. Estas secuencias genéticas, generalmente cortas, y componentes del metabolismo humano, constituyen la base para el trabajo de laboratorio posterior.

Sin embargo, con la ayuda de programas informáticos, los virólogos sólo pueden construir mentalmente largas cadenas de material genético a partir de muchas secuencias cortas de genes. Estas son entonces producidas como verdaderas cadenas de ADN viral. Esta es la razón por la que los resultados positivos de las pruebas se obtienen repetidamente incluso en individuos sanos probados.

Para evitar refutarse a sí mismos, estos virólogos ignoran constantemente dos reglas prescritas por la ciencia. Uno es verificar sistemáticamente todas las afirmaciones por sí mismas. La otra es probar todos los supuestos y métodos utilizados mediante experimentos de control.

Si realizaran los experimentos de control, descubrirían que TODAS las secuencias genéticas cortas, que sólo unen mentalmente, para formar una cadena genética viral se originan en el metabolismo humano y no en el exterior, de un supuesto virus.

El impulso de la crisis del coronavirus fue desencadenado por un mensaje de un joven oftalmólogo el 30/12/2019 en Internet, que se difundió de forma inmediata y muy rápidamente. Éste dijo a sus amigos que varias personas estaban en cuarentena en su hospital, que se confirmaron siete casos de SARS, que se cuidaran y protegieran.

El profesor Christian Drosten, de la Charité de Berlín, se enteró de ello e inmediatamente comenzó a elaborar procedimientos de prueba para los virus del SARS antes de que estuviera claro y pudiera determinarse si el informe de China sobre el SARS era verdadero y estaba probado, y especialmente antes de que los virólogos chinos publicaran sus resultados.

Los virólogos autorizados de la Comisión de Control de Enfermedades de China (CCDC) publicaron sus resultados el 24 de enero de 2020 y el 3 de febrero de 2020.

Informan sobre el aislamiento de muchas secuencias genéticas cortas, que, cuando se ensamblan, podrían representar una cadena genética de un nuevo tipo de virus. Los autores señalan expresamente -y todos los demás virólogos implicados hasta la fecha- que aún no se han realizado los experimentos absolutamente necesarios que permitan afirmar que se trata efectivamente de una cadena genética de un virus causante de enfermedades.

Por el contrario: los virólogos chinos incluso señalan explícitamente que la cadena genética construida tiene hasta un 90% de similitud con las cadenas genéticas de los inofensivos y por decenios de antigüedad, reivindicados corona virus en los murciélagos.

El 21/01/2020 (¡3 días antes de la primera publicación de la CCDC!) la OMS recomendó a todas las naciones usar el procedimiento de prueba desarrollado por el Prof. Drosten. Al afirmar que había desarrollado un procedimiento de prueba fiable para el virus, que se estaba extendiendo rápidamente en China, el profesor Drosten, haciendo caso omiso de las normas claramente definidas de la labor científica, que forman parte de su contrato de trabajo, y violando las leyes del pensamiento y la lógica de la virología, ha desencadenado y causado el aumento y la globalización del pánico epidémico chino.



1. El comienzo de la crisis del Coronavirus

Cuando el joven oftalmólogo Li Wenliang informó a siete médicos de Wuhan a través de WhatsApp el 30/12/2019 de que varias personas estaban en cuarentena en su hospital, que se habían confirmado siete casos de SARS, y que debían tener cuidado y protegerse, no tenía la intención de causar pánico.

Si lo hubiera hecho, habría publicado el anuncio en Internet y advertido al público. Uno de los siete destinatarios de este mensaje privado de WhatsApp publicó una “captura de pantalla”, es decir, una foto del mensaje, en Internet sin ser consciente de las posibles consecuencias. Por supuesto, esta información se difundió muy rápidamente dentro de China y luego en todo el mundo.

Este mensaje desencadenó una ola de temor, pánico e indagaciones a las autoridades sanitarias chinas y al gobierno debido al pánico causado por una crisis de SARS en 2003, que la Organización Mundial de la Salud (OMS) clasificó como “amenaza mundial” el 12 de marzo de 2003.

En consecuencia, el Gobierno de Beijing envió una “fuerza de reacción rápida” integrada por epidemiólogos y virólogos del Centro de Control de Enfermedades de China a Wuhan el 31 de diciembre de 2019 para apoyar a las autoridades sanitarias locales y a la provincia circundante de Hubei. El objetivo era comprobar y verificar las afirmaciones de un brote de una epidemia. Si efectivamente se hubiera producido un brote, la situación debería controlarse adecuadamente.

En la primera publicación autorizada de los autores del CCDC sobre los resultados de su investigación, “A New Coronavirus from Patients with Pneumonia in China, 2019”, no se informa de una acumulación de pacientes con neumonía de causa desconocida.

Informan que los pacientes encontrados pueden ser agrupados en un “grupo” con características comunes. La característica común era la visita más o menos frecuente de un mercado mayorista de mariscos en Wuhan. Lo pequeño que era el grupo de pacientes con neumonía atípica puede verse por el hecho de que el CCDC tomó frotis y líquidos del tracto respiratorio inferior de sólo cuatro pacientes, para buscar patógenos conocidos y desconocidos.

Mientras tanto, el pánico en Wuhan y sus alrededores aumentó extremadamente. Ni siquiera las medidas adoptadas por la policía, que el 3 de enero de 2020 pidió al oftalmólogo Li Wenliang que se comprometiera por escrito firmando una declaración punible de cese y desistimiento para no difundir nada más sobre un posible brote de SARS, pudieron frenar la dinámica de pánico que se había desarrollado y que empeoraba peligrosamente.

El 10/01/2020 Wenliang, y poco después también sus padres, desarrollaron los síntomas de la neumonía. Li Wenliang se aisló porque estaba convencido de que había sido infectado con el virus del SARS el día anterior por un paciente ocular. Esto también aumentó el pánico.

Los doctores que lo atendieron realizaron un gran número de pruebas diferentes, todas las cuales resultaron negativas. A medida que su estado de salud se deterioraba y cada vez más personas mostraban la simpatía del público por su destino, las pruebas se continuaron hasta que una primera prueba de SARS, el 30/01/2020, se consideró “positiva”. El desastre del creciente pánico del SARS, que mutó en la crisis mundial del coronavirus, siguió su curso.

Li Wenliang difundió este resultado en Internet con las siguientes palabras: “Hoy las pruebas de ácido nucleico han dado un resultado positivo, el polvo se ha asentado, finalmente diagnosticado”.

Este anuncio aumentó el pánico ya existente. Todo se descontroló por completo cuando publicó su declaración firmada de cese y desistimiento del 03/01/2020 en Internet. Esta publicación de su declaración de cesación, que era peligrosa para él, fue y sigue siendo considerada por todas las personas presas del pánico, como prueba de que hay una nueva epidemia de SARS, porque un médico, que a su vez está afectado, sigue informando y advirtiendo al público a pesar de la amenaza de sanciones.

El pánico aumentó aún más porque la salud de Li Wenliang se deterioró a pesar del uso intensivo de una variedad de sustancias antibióticas y el público participó regularmente de esto. La situación estaba al borde de la escalada porque el informe de su muerte fue más que caótico y contradictorio.

Esta fue y sigue siendo la razón central por la que el público chino y mundial asumió que se había producido otro brote de SARS en Wuhan, pero que se había redefinido como una nueva epidemia, una pandemia con un nuevo nombre, Covid-19.



2. Una, de dos posibles causas del miedo de Li Wenliang

El temor del oftalmólogo Li Wenliang se basa en los acontecimientos de 2003 en China, cuando los científicos occidentales afirmaron que se había producido una acumulación de neumonía atípica en el sur de China. Dos días después de la creación mental de una cadena genética del supuesto nuevo virus (SARS-CoV-1), en la que el Prof. Drosten estuvo significativamente involucrado, el Prof. Drosten ofreció un supuesto procedimiento de prueba para este supuesto virus.

Aproximadamente 800 personas con neumonía atípica, es decir, neumonía en la que no se detectan patógenos conocidos, pero que resultó “positiva” con la prueba del Prof. Drosten, murieron, por lo tanto -posiblemente de forma incorrecta y sobre tratada- con el diagnóstico de SARS en lugar de “neumonía atípica”.

La base de que el temor al SARS se mantuviese y aumentara hasta 2019, son dos publicaciones de 2013 y 2017 que dieron lugar a especulaciones sobre la posibilidad de que aparecieran nuevos coronavirus del SARS. Los autores de ambas publicaciones afirman que los murciélagos sanos proporcionan pruebas de la existencia de secuencias genéticas cortas que pueden ser interpretadas como componentes de un virus.

Estas secuencias genéticas cortas tendrían similitudes con las secuencias genéticas cortas que se declararon componentes del supuesto coronavirus del SRAS-1 (SARS-CoV-1) en 2003.

SARS significa Síndrome Respiratorio Agudo Severo, que es otra descripción de los síntomas de la neumonía atípica.

Se dice que estas hebras genéticas mentales (ficticias, transformadas en realidad) son capaces de desarrollarse en la realidad y formar un virus real. Este virus, que se afirma está en murciélagos y otros animales salvajes pero que sigue siendo inofensivo, podría saltar a los humanos a través de la mordedura, el contacto o el consumo y convertirse en un asesino mortal.

En los seres humanos, este inofensivo virus podría, a través de cambios (mutaciones), convertirse en un coronavirus del SARS que es realmente nuevo y podría causar una enfermedad. Tal acontecimiento y la consiguiente oleada de enfermedades, como la neumonía atípica, deben esperarse en cualquier momento.

Hasta la fecha, los virólogos no han podido aislar un virus del SARS de un paciente, un murciélago, otro animal o en el laboratorio, ni han podido detectar una cadena genética intacta y completa de un virus del SARS. Hasta la fecha no se ha podido confirmar la suposición de los virólogos de que existen de hecho cadenas genéticas virales que están construidas de la misma manera que las cadenas genéticas compuestas de secuencias genéticas cortas.

Hay otras formas en que aún no se ha demostrado la existencia y la presencia de una cadena genética completa de un virus del SARS, aunque desde hace mucho tiempo se dispone de técnicas estándar muy sencillas para determinar la longitud de las secuencias genéticas.

Los temores alimentados masivamente por tales afirmaciones falsas fueron la base de los temores del oftalmólogo Li Wenliang, así como de otros médicos e infectólogos no sólo en Wuhan.

Estas alegaciones son la razón por la que los epidemiólogos y virólogos de la CCDC, a partir del 31 de diciembre de 2019, se centraron en encontrar secuencias de genes similares que se definieron como componentes del coronavirus del SARS en 2003 (véanse las explicaciones que figuran a continuación).



3. La segunda de las posibles causas de miedo de Li Wenliang

Las crisis del SARS y del Coronavirus comenzaron con la afirmación en los medios de comunicación de que hay una acumulación de pacientes con neumonía atípica. Esta alegación nunca fue corroborada. Sólo se afirmó que la neumonía atípica que se produjo podía explicarse por la suposición de la aparición de un nuevo virus, porque algunas de las personas con neumonía atípica tenían contacto con los mercados de animales.

Para poder confirmar la suposición de que un virus desconocido podría ser la causa de la neumonía atípica, se suprimieron los hechos conocidos descritos en la literatura médica y científica. De hecho, hay varios y amplios espectros de causas no infecciosas de neumonía atípica. Por varias razones, esta neumonía atípica tiene más probabilidades de ser mortal que la típica.

Las causas son, entre otras, la inhalación de vapores, disolventes y sustancias tóxicas. La entrada de alimentos, bebidas o contenidos estomacales en los pulmones en caso de dificultades para tragar o de la pérdida del conocimiento también puede causar una neumonía extremadamente grave (neumonía por aspiración).

El agua por sí sola es suficiente, si entra en los pulmones de las personas que se están ahogando, para causar una neumonía atípica grave. Otra causa es el reconocido espectro de disfunciones inmunológicas, como las alergias y las reacciones auto-inmunes. También se sabe que la radiación desencadena una inflamación de los pulmones en el cáncer, que no puede distinguirse de la típica neumonía.

La neumonía congestiva es particularmente conocida en las personas mayores. Éstas se desarrollan debido a la retención de agua (edema), a la permanencia prolongada en cama, a la debilidad del corazón y/o de los riñones, que puede conducir a una ventilación y circulación sanguínea inadecuadas en los pulmones, y como consecuencia directa de la inflamación de los pulmones, es decir, de la neumonía atípica.

Lógicamente, una combinación de causas subyacentes también causa neumonía atípica. Una neumonía atípica puede convertirse rápidamente en una neumonía típica si se produce una colonización secundaria del pulmón inflamado. Esta es la razón por la que el porcentaje de neumonía atípica es probablemente más alto que el 20-30% estimado.

En los estudios de las cinco personas documentadas en las dos publicaciones pertinentes a la crisis del coronavirus, no se investigaron la posible presencia o la historia, los signos, los mecanismos y los efectos de estas causas conocidas de la neumonía atípica. Los virólogos no suelen hacerlo de todos modos, y los miembros de la CCDC no pudieron hacerlo ni siquiera en las circunstancias de pánico.

Excluir la mención de la neumonía atípica demuestra una grave negligencia médica e impide el tratamiento correcto de los pacientes. Por consiguiente, los afectados corren el riesgo de que se les manipule mal con un cóctel de sustancias antibióticas ricas en efectos secundarios, que es capaz de causar de forma independiente la muerte de los pacientes, especialmente en caso de sobredosis. El pánico puede ser incluso fatal en muy poco tiempo, no sólo en el caso de problemas cardiovasculares.

La respuesta a la pregunta crucial de si se ha detectado realmente un nuevo virus o si sólo se emiten piezas cortas y endógenas de material genético como componentes de un virus o se interpretan erróneamente como tales, es decisiva para que la crisis del coronavirus pueda terminar rápidamente. Al igual que con el H1N1, los responsables de la crisis del coronavirus dicen que ésta sólo se puede acabar con la vacunación. Sin embargo, la idea de la vacunación ha sido refutada tanto como la de los virus.

Para la evaluación y clasificación de los acontecimientos que rodearon el desencadenamiento y el mantenimiento de la crisis del coronavirus es útil el recuerdo de la pandemia de gripe porcina de 2009, que ya ha sido olvidada.

La mayoría de la población en ese momento estaba preparada para vacunarse contra los supuestos virus de la gripe porcina. Luego hubo un retraso en la entrega anunciada de las vacunas. Las vacunas no podían llenarse en jeringas listas para usar, ya que los nuevos potenciadores de ingredientes activos utilizados por primera vez dañaban la mezcla de la vacuna y la inutilizaban. Por esta razón, la vacuna se llenó en ampollas para 10 personas cada una, a las que sólo se permitió añadir los potenciadores de la sustancia activa poco antes del acto de la vacunación.

Durante este tiempo se supo que los potenciadores del principio activo, llamados adyuvantes, sin los cuales una vacuna no podría desarrollar su efecto, son nuevos y no han sido probados. Se supo que estos novedosos amplificadores de drogas consisten en nanopartículas. Se sabe que las nanopartículas son muy reactivas debido a su diminuto tamaño y, por lo tanto, se utilizan como catalizadores en muchas reacciones químicas. En los procesos técnicos, por ejemplo, hacen que las superficies se comporten de forma completamente diferente a la que se puede conseguir con los métodos convencionales.

Entonces se supo que la Canciller alemana Angela Merkel y las Fuerzas Armadas alemanas iban a recibir esta vacuna, pero sin el novedoso potenciador de sustancias activas de nanopartículas, mientras que la policía y la población iban a recibir la vacuna con las nanopartículas no probadas.

Como resultado, el 93% de la población rechazó la vacuna producida para ellos. Sólo al 7% de los alemanes se les ha administrado esta vacuna.

El metabolismo humano no puede metabolizar y excretar nanopartículas. Debido a esta negativa por parte de casi toda la población, la gripe porcina en realidad desapareció de la noche a la mañana siguiente, como por arte de magia, de los medios de comunicación al basurero y las vacunas al alto horno.

(Se permite una pequeña polémica: sorprendentemente, el virus de la gripe porcina H1N1 despegó al galope de los cerdos, ya no infectó a otras personas, no enfermó a los infectados y su presencia en los medios de comunicación se detuvo inmediatamente. Tal vez el virus de la gripe porcina se ha convertido en virus de la gripe de los peces, para nadar por los ríos en los cuerpos de los salmones, sólo para atacar de nuevo con fuerza concentrada en el mercado de pescado en Wuhan).

Los epidemiólogos, infectólogos y virólogos implicados han aprendido del fracaso de la planificación de la pandemia, que no culminó con la vacunación. Analizaron las causas y publicaron sus conclusiones y recomendaciones para el futuro en el número 12 de diciembre de 2010 del Bundesgesundheitsblatt (Gaceta Federal de Salud). El significativo título de este número: “Pandemias. Lecciones aprendidas” Lo que significa tanto como: ¡Las lecciones que hemos aprendido de la debacle de la gripe porcina H1N1!

Algunos de los artículos de este número están disponibles en Internet, pero no los más importantes. Las principales recomendaciones para la gestión de la pandemia son:

• Asegurarse de que los expertos no se contradigan entre sí en los debates públicos.

• Participación temprana de los medios de comunicación social y de los líderes. – Control de la red Internet. Esto con el fin de evitar que las reivindicaciones y las críticas pongan en peligro el consenso y la aceptación de las medidas en la política y la sociedad.

¡Estas recomendaciones ya se han aplicado con éxito! Se censura en Internet, se excluye a los críticos con insultos, entre otras cosas. Los argumentos obligatorios que refutan la suposición de la pandemia y que han pasado al dominio público simplemente no se abordan. Sólo un experto, el Prof. Drosten, es escuchado en los medios y en la política. La única “crítica” que se le hizo, expresada por un virólogo especializado en VIH, tuvo la función de reforzar la afirmación central de la existencia de un nuevo virus, el SARS-CoV-2.



4. La globalización del pánico por los virus chinos del SARS y la creación de la crisis del coronavirus por el Prof. Drosten

El profesor Christian Drosten, de la Charité de Berlín, afirma que desde el 1/01/2020 ha desarrollado un método de detección genética con el que puede detectar con fiabilidad la presencia del nuevo coronavirus en los seres humanos.

Para a) poder comprender qué supuestos y qué acciones constituyen la base de las afirmaciones del Prof. Drosten y b) comprobar si sus conclusiones de haber desarrollado un procedimiento de prueba seguro para el nuevo coronavirus están lógica y científicamente probadas o no, o incluso refutadas, es necesario explicar los términos y técnicas utilizadas, presentar su argumentación y analizar las dos publicaciones decisivas a las que se refiere el Prof. Drosten.

¿Cómo se definen un virus y un coronavirus?

¿Cómo se definen las secuencias en este contexto? – ¿Cómo funcionan los métodos de detección de secuencias llamadas PCR, RT-PCR y RT-PCR en tiempo real?

¿Cuándo se puede emitir la detección de la presencia de secuencias en humanos como prueba de la presencia de un virus?

¿Cómo se demuestra científicamente la existencia de un virus?

 
Términos

– En la ciencia, un virus se define por su material genético específico, que es único para ese virus.

– El material genético de un virus también se conoce como la cadena genética viral, la molécula genética viral o su genoma. – El material genético viral de un virus contiene las distintas secuencias genéticas para la formación de las distintas proteínas virales, conocidas como genes virales.

– El material genético de un virus puede consistir en ADN o ARN.

– Los virus corona se definen por el hecho de que consisten en una molécula específica de ARN rodeada por una envoltura.

– El material genético de un determinado virus se define por su longitud determinada con precisión y la determinación exacta de la estructura de la cadena del genoma viral.

– La composición del material genético de un virus resulta de la determinación exacta del número y la secuencia específica de los cuatro bloques de construcción que componen un material genético. Los cuatro bloques de construcción de un material genético se llaman nucleótidos. – El proceso de determinar la secuencia específica de los cuatro componentes básicos de un material genético se denomina secuenciación.

– El resultado de la determinación de la secuencia de los componentes básicos de una sustancia hereditaria se denomina secuencia o secuencia genética.

– Los virus patógenos se definen por el hecho de que su secuencia es única y no se da en organismos sanos. – Para detectar y determinar la presencia del material genético de un virus, de acuerdo con las leyes del pensamiento y la lógica que precede a toda ciencia como regla fundamental, este virus debe ser aislado y estar presente en forma pura para que las propias secuencias de genes de la célula no se malinterpreten como componentes de un virus.

– Sólo es posible determinar la secuencia de una sustancia genética si está presente en forma de ADN. – Para determinar la secuencia de una sustancia genética que está presente en forma de ARN, primero debe ser convertida bioquímicamente en ADN.

– El proceso de conversión de una sustancia genética de ARN en ADN se denomina “transcripción inversa” y se abrevia como “RT”.


Las técnicas utilizadas por el Prof. Drosten y las primeras conclusiones

– La presencia y la longitud de un material genético se determina separándolo longitudinalmente en un campo eléctrico. Los trozos cortos migran más rápido, los más largos más lentamente. Al mismo tiempo, para determinar la longitud del material genético a examinar, se añaden piezas de material genético de longitud conocida de diferentes longitudes. Esta fiable técnica estándar para detectar y determinar la longitud del material genético se llama “electroforesis en gel”.

– Si la concentración de un determinado material genético es demasiado baja para ser detectada por la técnica de “electroforesis en gel”, puede ser multiplicada a voluntad por la técnica de multiplicación ilimitada de ADN, llamada Reacción en Cadena de la Polimerasa. De esta manera, el ADN indetectable puede hacerse visible en la electroforesis en gel. Este es un requisito previo para hacer accesible el material genético para investigaciones posteriores, especialmente para la posterior determinación decisiva de su longitud y secuencia. Este método también se conoce como PCR para abreviar.

El inventor de la técnica de la PCR, Kary Mullis, que fue galardonado con el Premio Nobel de Química en 1993 por este invento, señaló desde el principio que este, su método desarrollado para el análisis en sala blanca en las fábricas de chips de ordenador es muy propenso a errores. En su discurso del Premio Nobel, que está documentado en la página del Comité del Premio Nobel, también señaló que no hay ninguna prueba verificable, en realidad científica, de que la sustancia genética conocida como genoma del VIH desencadene realmente una inmunodeficiencia o una de las diversas enfermedades que se agrupan de manera inadmisible bajo el término “SIDA” y se tratan con quimioterapia altamente tóxica. Señaló que sólo hay consenso entre los científicos participantes en que el “VIH” desencadenaría una inmunodeficiencia.

Para poder reproducir un ADN con la técnica de PCR, se requiere el conocimiento de la composición, la secuencia del ADN. Esto se debe a que un ADN sólo puede propagarse por PCR si fragmentos cortos de genes producidos artificialmente se unen al principio y al final del ADN, que corresponden exactamente a la secuencia del principio y del final del ADN que se va a propagar. Estos cortos trozos de ADN producidos artificialmente se llaman, por lo tanto, primers, las moléculas iniciadoras de la PCR. Tienen una media de entre 24 y 30 nucleótidos de largo (los bloques de construcción del material genético).

Así pues, la PCR no puede utilizarse para detectar secuencias o virus desconocidos. Sólo la determinación de la secuencia de un virus permite desarrollar una prueba de PCR para la detección de la secuencia de un gen originado en un virus. – En los primeros días de la PCR, sólo era posible determinar la cantidad de ADN amplificado mediante electroforesis en gel después de que se hubiera detenido la reacción de amplificación de la PCR. Mientras tanto, se añaden ciertos colorantes a las enzimas y sustancias necesarias para la PCR. La detección de estos tintes durante el curso de la PCR muestra aproximadamente qué concentraciones de ADN reproducido artificialmente se produjeron y cuánto ADN estaba realmente presente aproximadamente al comienzo de la PCR. Dado que la cantidad de ADN producido artificialmente puede determinarse aproximadamente mientras la técnica de PCR sigue funcionando, esta extensión de la técnica de PCR se denomina “PCR en tiempo real”. Por lo tanto, una “PCR en tiempo real” que va precedida de otro paso, la conversión de ARN en ADN mediante “transcripción inversa” (RT), se denomina “RTPCR en tiempo real”.

– El Prof. Drosten utiliza la técnica de “RT-PCR en tiempo real” en la prueba que ha desarrollado para la detección del nuevo virus corona. Con ese fin, ha seleccionado secuencias genéticas cortas de un conjunto de datos de Internet del 1/01/2020 que se atribuyen a los virus del SARS. Sobre la base de esas secuencias de fragmentos genéticos cortos, que se interpretan como posibles componentes de los virus del SARS, él diseñó las secuencias de cebadores de la PCR decisivas para la PCR a fin de detectar el virus “todavía” desconocido en China con su “RT-PCR en tiempo real”.

Cuando aparecieron en Internet compilaciones preliminares de secuencias el 10/01/2020 y el 12/01/2020, que posteriormente fueron modificadas y publicadas el 24/01/2020 y el 3/02/2020, esto representó el resultado de los dos primeros intentos de identificar el virus aún desconocido. Con este fin, los virólogos de la CCDC usaron programas de computadora para ensamblar teóricamente las secuencias de fragmentos cortos de genes en una posible cadena genética.

En ambas publicaciones, los virólogos de la CCDC afirman que no hay evidencia de que estas sugerencias de secuencias puedan realmente causar enfermedades. El 10/01/2020 y el 12/01/2020, las propuestas de secuencias chinas eran todavía provisionales y no se habían sometido todavía al estricto proceso de revisión prescrito científicamente.

El hecho de que la Organización Mundial de la Salud (OMS) recomiende la prueba de detección PCR desarrollada por el Prof. Drosten para la detección del nuevo virus el 21/01/2020, incluso antes de la publicación de las publicaciones de las dos primeras propuestas de secuencias chinas, demuestra un primer hecho: El Prof. Drosten utilizó datos no verificados científicamente para su prueba de PCR rápidamente globalizada del 2019-nCoV, que fue rebautizada como SARS-CoV-2 el 7 de febrero de 2020 con la participación del mismo Prof. Drosten.

El cambio de nombre el 7 de febrero de 2020 de la designación de “nCoV” a “SARS-CoV-2”, una mera presunción de virus posiblemente defectuoso o inofensivo, en un patógeno peligroso, dio a la opinión pública la impresión de que se había descubierto un virus real del SARS en China, que causa una enfermedad peligrosa, a saber, el SARS, y mató al nuevo ídolo de China, Li Wenliang, que empequeñeció a la dirección del partido.

El Prof. Drosten y sus colegas del Grupo de Nomenclatura de Virus cumplieron así las expectativas de la población, que estaba aterrorizada hasta la médula: “finalmente diagnosticado”, “finalmente diagnosticado”. Esta expectativa fue despertada por el impulso del pánico masivo desencadenado por el Dr. med. Li Wengling y aparentemente cumplido por el Prof. Drosten.

El factor decisivo en la evaluación de este acto es el hecho de que en aquel momento todos los virólogos directamente implicados testificaron -y todavía testifican hoy- que no hay pruebas de que este nuevo virus cause realmente la enfermedad. ¿O sólo ocurre en paralelo en enfermedades, en procesos de curación, después de procesos de curación, en algunas personas sanas, en muchas personas sanas o en todas las personas?

Esto demuestra que el Prof. Drosten ha cruzado la línea claramente reconocible de la acción científicamente justificada en un fraude reconocible y trascendental. También no podrá salir de esto utilizando una revista para la publicación de su procedimiento de prueba del 23/01/2020 que no comprueba las declaraciones hechas en ella antes de ir a la imprenta.



5. Las preguntas decisivas para un rápido final de la crisis del Coronavirus

La cuestión central y decisiva es si el Prof. Drosten ha cumplido con su deber científico, que forma parte de su contrato de trabajo, consigo mismo y verifica sistemáticamente todas las afirmaciones hechas en su publicación sobre el método de detección que desarrolló y las declaraciones públicas basadas en él.

Este deber científico central da lugar a tres preguntas centrales:

¿Comprobó el Prof. Drosten si las secuencias de genes que forman la base de su procedimiento de prueba y que le fueron proporcionadas por virólogos chinos son en realidad secuencias que se originan en un virus?

¿Llevó a cabo el Prof. Drosten los experimentos de control que son obligatorios en la ciencia y que prueban si las secuencias que utilizó realmente se originan en un virus? ¿Llevó a cabo los experimentos de control que prueban si las secuencias que utiliza, que atribuye al nuevo virus, son en realidad secuencias que no son secuencias que se producen en todos los metabolismos, tal vez incluso en plantas, como las papayas de Tanzanía o que se producen en mayor número en el metabolismo de las enfermedades?

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su método de prueba, con el que sólo detecta áreas parciales de 2 (dos) genes del genoma de un total de 10 (diez) genes del coronavirus, detecta un virus completo, activo y causante de la enfermedad? ¿Y no sólo fragmentos de un virus, después de una supuesta batalla exitosa del sistema inmunológico o la presencia de virus “defectuosos” o “incompletos” o “inofensivos” en nuestro material genético, que son típicos y constituyen el 50% de las masas genéticas de nuestros cromosomas?

Las respuestas son el resultado de la realización documentada del Prof. Drosten durante el desarrollo del procedimiento de la prueba y de la no realización documentada del Prof. Drosten hasta hoy. El virólogo Prof. Drosten, que desarrolló el método de detección del nuevo coronavirus (primero llamado 2019-nCoV y luego, a partir del 7/02/2020 llamado SARS- CoV-2), describe el desarrollo del método de prueba en una publicación publicada el 23/01/2020 en la página 3 de este artículo, en la columna de la izquierda, a 8 líneas de distancia, describe el primer y decisivo paso de su enfoque:

“Antes del anuncio público de las secuencias del virus de 2019-nCoV, nos basamos en los informes de los medios de comunicación social que anunciaban la detección de un virus similar al SARS. Por lo tanto, asumimos que un CoV relacionado con el SARS estuvo involucrado en el brote”.

Esto significa que el Prof. Drosten y sus colaboradores han asumido, basándose en los informes de los medios de comunicación social, que un coronavirus relacionado con el SARS podría estar implicado en el supuesto brote de neumonía atípica. En ese momento no se disponía de datos clínicos que apoyaran esa hipótesis. ¿Cuál era su siguiente paso?

“Descargamos todas las secuencias completas y parciales (longitud media >400 nucleótidos) de virus relacionados con el SARS que estaban disponibles en el GenBank el 1 de enero de 2020.”

Continúa en la columna derecha de la página 3, tercera fila desde la parte superior:

“Alineamos estas secuencias [Nota mía, SL: contra una secuencia estándar dada del virus del SARS] y utilizamos las secuencias alineadas para desarrollar nuestras pruebas (Figura S1 en el suplemento de esta publicación).

“Tras la publicación de la primera secuencia de 2019 nCoV en virological.org, seleccionamos tres pruebas basadas en lo bien que se ajustaban al genoma de 2019 nCoV (Figura 1). (“Descargamos todas las secuencias completas y parciales (si >400 nt) de virus relacionados con el SARS disponibles en el GenBank antes del 1 de enero de 2020 […] Estas secuencias fueron alineadas y la alineación se utilizó para el diseño del ensayo (Figura suplementaria S1).

De sus explicaciones se pueden extraer respuestas, conclusiones y consecuencias claras:

¿Comprobó el Prof. Drosten si las secuencias de genes, que son la base de su procedimiento de prueba y que fueron proporcionadas por virólogos chinos, son en realidad secuencias de un virus? ¡La respuesta es NO! No pudo comprobar si las secuencias proporcionadas eran de un virus, porque las dos publicaciones decisivas que describían la extracción de las secuencias de genes que utilizó no estaban disponibles para él antes de que su prueba fuera lanzada al mercado.

¿Llevó a cabo el Prof. Drosten los experimentos de control obligatorios en la ciencia para probar si las secuencias que usó realmente se originaron de un virus? ¿Llevó a cabo los experimentos de control para averiguar si las secuencias que utilizó, que atribuyó al nuevo virus, son en realidad secuencias que se producen en cualquier metabolismo, tal vez incluso en las plantas, o que se producen de forma metabolizada en las enfermedades?

La respuesta es: ¡NO! Ni él, ni los virólogos de la CCDC, ni otros han llevado a cabo de forma demostrable estos experimentos de control necesarios hasta el día de hoy, y si lo han hecho, no los han publicado. Para estos cruciales experimentos de control, deben utilizarse secuencias genéticas cortas del metabolismo de individuos sanos para secuenciarlos. Estas cortas secuencias genéticas, como las de los enfermos, deben ser ensambladas con los mismos programas informáticos para formar una larga cadena genética de un virus. Este experimento nunca se llevó a cabo o nunca se publicó. Ni siquiera se menciona este experimento de control obligatorio, que resulta de las leyes del pensamiento y la lógica de la virología – para controlar consistentemente los propios resultados. En el momento en que este experimento se lleva a cabo y se publica, la crisis del coronavirus termina inmediatamente.

El otro experimento de control resultante de la lógica científica es el ensayo intensivo, mediante el procedimiento PCR desarrollado (RT-PCR en tiempo real), con muestras clínicas de personas con enfermedades distintas de las atribuidas al virus y utilizando muestras de personas, animales y plantas sanas para comprobar si estas muestras no dan también resultados “positivos”.

Estos nuevos experimentos de control, que son lógicamente necesarios para validar un procedimiento de prueba, es decir, para comprobar si es válido y tiene alguna importancia, aún no se han realizado y ni siquiera se ha afirmado que se hayan realizado. Por consiguiente, los inventores y productores de estos procedimientos de prueba se han asegurado, mediante la información apropiada en los rótulos, por ejemplo, que la prueba sólo debe utilizarse para fines de estudio y no es adecuada para fines de diagnóstico.

Puedo predecir con certeza que las personas que liberan mayores cantidades de secuencias genéticas del tipo de tejido de los epitelios escamosos, por ejemplo, los pacientes renales, darán “positivo” con la PCR desarrollada por el Prof. Drosten a más tardar cuando su cantidad de frotis se multiplique y se concentre un poco. Es muy probable que incluso todos los organismos puedan dar positivo.

Hago un llamamiento a bioquímicos, bioinformáticos, virólogos y especialistas en cultivos celulares para que lleven a cabo estos experimentos de control, los publiquen y me informen sobre ellos. He diseñado un experimento de control que excluye de entrada la excusa de que el material de muestra utilizado ha sido contaminado con el virus del SARS Cov-2 antes o durante el experimento de control.

Los costos de la realización de los experimentos de control están cubiertos si se permite que yo y observadores neutrales estemos presentes durante la realización de los experimentos de control y se documenta cada paso. Por favor, póngase en contacto con la editorial para que se ponga en contacto. Los resultados pondrán fin a la crisis del coronavirus inmediatamente. No sirve de nada si sólo presento los resultados de los experimentos de control.

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su procedimiento de prueba, con el que sólo detecta áreas parciales de sólo 2 (dos) genes del genoma de un total de 10 (diez) genes del virus del Corona, detecta un virus completo, activo y causante de enfermedad y no sólo fragmentos de un virus después de una supuesta batalla exitosa del sistema inmunológico o debido a la presencia de numerosos virus “defectuosos”, “incompletos” e “inofensivos” en nuestro material genético?

El Prof. Drosten no consideró estas preguntas lógicas en absoluto, porque no aparecen en ninguna parte de sus publicaciones y afirmaciones. La detección de sólo secuencias genéticas cortas de una cadena genética larga de un virus nunca puede probar la presencia de un virus intacto y por lo tanto reproducible. Para poder calificar de válida una prueba de PCR de este tipo, habría que realizar primero estudios cuyos resultados demuestren que la detección de secuencias genéticas cortas prueba automáticamente la presencia de una cadena genómica completa e intacta de un virus. Esos estudios lógicamente convincentes aún no se han realizado ni mencionado.

Al comienzo de la crisis del coronavirus, la principal viróloga, la Prof. Karin Mölling, una destacada experta en el campo de los virus asociados a las células, inofensivos, incompletos o defectuosos conocidos como endógenos, describió las medidas adoptadas como injustificadas. Ha demostrado en publicaciones y en un libro, que la mitad del material genético de los humanos, es decir, la mitad de las secuencias de la que están formados nuestros cromosomas consiste en secuencias genéticas inactivas y defectuosas de virus.

Lo que no sabe, o está ocultando, es que el metabolismo produce constantemente una gran cantidad de secuencias genéticas de ARN de cualquier composición, que no aparecen en forma de secuencias de ADN en los cromosomas.

Este hecho pone en tela de juicio las afirmaciones de existencia de todos los virus ARN, como los coronavirus, el virus del Ébola, el VIH, el virus del sarampión y los virus del SARS.

Este hecho es también la base por la que, con los experimentos de control, se pone fin inmediatamente no sólo a la crisis del coronavirus, sino también al miedo y al mal manejo por parte de toda la virología de los supuestos virus de la enfermedad. Puedo asegurarle que las causas reales y los fenómenos de infección atribuidos a los virus han sido probados en el sentido “positivo” de la palabra “ciencia”.

Referencias

https://www.loveproductions.org/english/articles/misinterpretation-of-virus/

Wrong Interpretation of the Virus Part II: Beginning and End of the Coronavirus Crisis

COMPARTIR