El hombre que quiere pisar Marte, no sabe en realidad de qué trata la enfermedad Covid. La enfermedad no ha causado la pandemia, la ha causado una prueba (PCR), que utilizada fraudulentamente, a propósito, ha dado con esta no pandemia.

Pero vayamos por pasos. Después de leer durante casi dos años los sitios oficiales y oficialistas del Covid, dígase OMS para abajo, no encuentro una respuesta adecuada, simplificada, cognitiva, académica o popular que encaje en cualquier entendimiento formal de un individuo medio. El doctor no sabe explicar la enfermedad a su paciente.

Hablemos claro, son unos ineptos, con perdón. Veamos un ejemplo, un artículo cualquiera de hoy mismo, titulado La covid te engaña: te ahogas y no lo notas, pondré una parte:

“[¿Por qué ocurre?

La hipoxia o neumonía silenciosa, pese a no pillarnos tan desprevenidos, sigue siendo un misterio casi dos años después del inicio de la covid.

Se especula que el coronavirus afecta a la sensibilidad de los receptores que informan al cerebro

Hay varios ensayos que han analizado y especulado sus causas, aunque sin certezas sobre los motivos exactos.

Lo que se especuló es que había una insensibilidad de los quimiorreceptores, que se encuentran en la arteria carótida y en los pulmones”, explica el doctor Torres.

Los quimiorreceptores son los sensores encargados de transmitir al cerebro si nos estamos ahogando o nos llega suficiente oxígeno.

El coronavirus afecta al cerebro

La conclusión es que el coronavirus de una manera u otra también afecta a las conexiones neuronales en este sentido.

La afectación cerebral de la covid era algo que los neurólogos descartaban inicialmente. Aunque poco a poco se fueron viendo más ejemplos de pacientes a los que se había detectado el coronavirus en las neuronas.

  • Cuando se extendieron los problemas de pérdida de gusto y olfato ya se empezó a ver que sí había afectaciones.
  • Con los pacientes recuperados de covid grave o los que tienen una covid persistente se están viendo más ejemplos.

Hay muchas alteraciones relacionadas con el cerebro: trastornos cognitivos, insomnio, ansiedad, entre otros”, enumera el doctor Torres.]”

Bueno, un virus por sí solo no crea una enfermedad y una enfermedad sí puede crear trastornos, insomnio, ansiedad y depresión, pongamos por ejemplo el cáncer, sobre todo cuando te lo comunican. Odio esta frase, pero para que me entiendan, es un daño colateral. Pero ellos dicen que es el virus, no la enfermedad. Que es un síntoma que crea el virus. Pues yo tengo mis dudas que un coronavirus cree eso, las mismas que tienen ellos.

Otra cuestión es la falta de oxígeno: Gripe, un coronavirus, neumonía bacteriana o radiaciones.

Y aquí está la clave. Si estudian todos los síntomas de la Covid-19 ¿Dónde encajan de las cuatro enfermedades escritas ahí arriba?

Veamos, ¿un coronavirus que en algunos pacientes produce pérdida de cabello? NO.

¿Una gripe con quemazón en manos y pies y/o uñas deformadas? NO.

¿Neumonía bacteriana con el síntoma de Guillain-Barré? NO.

¿Radiación? SÍ. O puede ser, como nadie sabe nada, como a los que se les paga para saber no saben nada, tanto vale mi opinión.

¡Ah!, se me olvidaba, eran 4+1: La vacuna es o creará otra enfermedad. O visto de otro modo, la radiación y las vacunas son un verdadero cóctel mortal. O puede ser.

¡Miren ustedes! Si hubiera un virus (que hay millones) y una vacuna, estaríamos todos vacunados. Lo qué sí hay es una enfermedad, pero como no es lo que dicen ser porque no lo saben (unos pocos supongo que sí), ¿Qué coño hay en la vacuna?

Ahí abajo hay 201 síntomas que crea un coronavirus. ¡Vamos, ni el ébola, SIDA, sarampión, varicela, rubeola juntos! Para mí es todo un poco raro ¿no?

Investiguen ustedes mismos. No se crean nada de nadie desde la OMS para abajo. Y abajo somos más. Cuídense.


Una profecía autocumplida: colapso sistémico y simulación de pandemias

Comentario de este blog: Esta guerra está llena de espigas, digo de aristas que las mantiene y erige un mismo tallo. Siempre he dicho que no se trataba de dinero, que ya lo poseían, que era otra cosa, como más poder o una especie de poder eterno, un juego de dioses, o más terrenal, un “capitalismo feudal” y un nuevo “neuro-capitalismo sanitario”. Con todo, hay que ir mirando con microscopio todas estas aristas, entre ellas, el colapso económico, por los que tienen el dinero pero más aún, por los que no lo tienen. Estamos en Guerra. El Globalismo contra el pueblo. Artículo importante.


Un año y medio después de la llegada de Virus, algunos pueden haber comenzado a preguntarse por qué las élites gobernantes generalmente sin escrúpulos decidieron congelar la máquina global de obtener ganancias frente a un patógeno que se dirige casi exclusivamente a los improductivos (mayores de 80 años). ¿Por qué tanto celo humanitario? Cui bono? Solo aquellos que no están familiarizados con las maravillosas aventuras de GloboCap pueden engañarse a sí mismos pensando que el sistema eligió cerrarse por compasión. Seamos claros desde el principio: los grandes depredadores del petróleo, las armas y las vacunas no podrían preocuparse menos por la humanidad.

Sigue el dinero

En tiempos pre-Covid, la economía mundial estaba al borde de otro colapso colosal. Aquí hay una breve crónica de cómo se estaba acumulando la presión:

Junio 2019: En su Informe Económico Anual, el Banco de Pagos Internacionales (BPI), con sede en Suiza, el “Banco Central de todos los bancos centrales”, hace sonar las alarmas internacionales. El documento destaca “el sobrecalentamiento […] en el mercado de préstamos apalancados”, donde “los estándares de crédito se han ido deteriorando” y “las obligaciones de préstamos garantizados (CLO) han aumentado, lo que recuerda el fuerte aumento de las obligaciones de deuda garantizada [CDO] que amplificaron la crisis subprime [en 2008]”. En pocas palabras, el vientre de la industria financiera está una vez más lleno de basura.

9 agosto 2019: El BPI publica un documento de trabajo en el que pide “medidas de política monetaria no convencionales” para “aislar a la economía real de un mayor deterioro de las condiciones financieras”. El documento indica que, al ofrecer “crédito directo a la economía” durante una crisis, los préstamos de los bancos centrales “pueden reemplazar a los bancos comerciales en la concesión de préstamos a las empresas”.

15 de agosto de 2019: Blackrock Inc., el fondo de inversión más poderoso del mundo (que administra alrededor de $ 7 billones en fondos de acciones y bonos), publica un libro blanco titulado Lidiar con la próxima recesión. Esencialmente, el documento instruye a la Reserva Federal de los Estados Unidos a inyectar liquidez directamente en el sistema financiero para evitar “una recesión dramática”. Una vez más, el mensaje es inequívoco: “Se necesita una respuesta sin precedentes cuando la política monetaria se agota y la política fiscal por sí sola no es suficiente. Esa respuesta probablemente implicará ‘ir directo'”: “encontrar formas de poner el dinero del banco central directamente en manos de los gastadores del sector público y privado” mientras se evita la “hiperinflación”. Los ejemplos incluyen la República de Weimar en la década de 1920, así como Argentina y Zimbabwe más recientemente”.

22-24 de agosto de 2019: Los banqueros centrales del G7 se reúnen en Jackson Hole, Wyoming, para discutir el documento de BlackRock junto con medidas urgentes para prevenir el colapso que se avecina. En las proféticas palabras de James Bullard, presidente de la Reserva Federal de San Luis: “Solo tenemos que dejar de pensar que el próximo año las cosas van a ser normales”.

15-16 de septiembre de 2019: La recesión se inaugura oficialmente por un aumento repentino en las tasas de repos (del 2% al 10,5%). ‘Repo’ es la abreviatura de ‘acuerdo de recompra’, un contrato en el que los fondos de inversión prestan dinero contra activos colaterales (normalmente valores del Tesoro). En el momento del intercambio, los operadores financieros (bancos) se comprometen a recomprar los activos a un precio más alto, generalmente de la noche a la mañana. En resumen, los repos son préstamos garantizados a corto plazo. Son la principal fuente de financiación para los comerciantes en la mayoría de los mercados, especialmente en la galaxia de los derivados. La falta de liquidez en el mercado de repos puede tener un efecto dominó devastador en todos los principales sectores financieros.

17 de septiembre de 2019: La Fed comienza el programa monetario de emergencia, inyectando cientos de miles de millones de dólares por semana en Wall Street, ejecutando efectivamente el plan “directo” de BlackRock. (Como era de esperar, en marzo de 2020 la Fed contratará a BlackRock para gestionar el paquete de rescate en respuesta a la “crisis de COVID-19”).

19 de septiembre de 2019: Donald Trump firma la Orden Ejecutiva 13887, que establece un Grupo de Trabajo Nacional de Vacunas contra la Influenza cuyo objetivo es desarrollar un “Plan nacional de 5 años (Plan) para promover el uso de tecnologías de fabricación de vacunas más ágiles y escalables y acelerar el desarrollo de vacunas que protejan contra muchos o todos los virus de la influenza”. Esto es para contrarrestar “una pandemia de gripe”, que, “a diferencia de la gripe estacional […] tiene el potencial de propagarse rápidamente por todo el mundo, infectar a un mayor número de personas y causar altas tasas de enfermedad y muerte en poblaciones que carecen de inmunidad previa”. Como alguien adivinó, la pandemia era inminente, mientras que en Europa también estaban en marcha los preparativos (ver aquí y aquí).

18 de octubre de 2019: En Nueva York, se simula una pandemia zoonótica global durante el Evento 201, un ejercicio estratégico coordinado por el Centro de Bioseguridad Johns Hopkins y la Fundación Bill y Melissa Gates.

21-24 de enero de 2020: La reunión anual del Foro Económico Mundial tiene lugar en Davos, Suiza, donde se discuten tanto la economía como las vacunas.

23 de enero de 2020: China pone Wuhan y otras ciudades de la provincia de Hubei en confinamiento.

11 de marzo de 2020: El director general de la OMS llama al Covid-19 una pandemia. El resto es historia.

Unir los puntos es un ejercicio bastante simple. Si lo hacemos, podríamos ver surgir un esquema narrativo bien definido, cuyo resumen sucinto dice lo siguiente: los bloqueos y la suspensión global de las transacciones económicas tenían la intención de 1) Permitir que la Fed inundara los mercados financieros enfermos con dinero recién impreso mientras aplazaba la hiperinflación; y 2) Introducir programas de vacunación masiva y pasaportes sanitarios como pilares de un régimen neofeudal de acumulación capitalista. Como veremos, los dos objetivos se funden en uno solo.

En 2019, la economía mundial estuvo plagada de la misma enfermedad que había causado la crisis crediticia de 2008. Se estaba asfixiando bajo una montaña insostenible de deuda. Muchas empresas públicas no podían generar suficientes beneficios para cubrir el pago de intereses de sus propias deudas y se mantenían a flote sólo mediante la adopción de nuevos préstamos. Las “empresas zombis” (con baja rentabilidad interanual, caída de la facturación, márgenes reducidos, flujo de caja limitado y balance altamente apalancado) estaban aumentando en todas partes. El colapso del mercado de repos de septiembre de 2019 debe ubicarse dentro de este frágil contexto económico.

Cuando el aire está saturado de materiales inflamables, cualquier chispa puede causar la explosión. Y en el mágico mundo de las finanzas, tout se tient:un aleteo de las alas de una mariposa en un determinado sector puede hacer que todo el casa de naipes se derrumbe. En los mercados financieros impulsados por préstamos baratos, cualquier aumento en las tasas de interés es potencialmente catastrófico para los bancos, los fondos de cobertura, los fondos de pensiones y todo el mercado de bonos del gobierno, porque el costo de los préstamos aumenta y la liquidez se agota. Esto es lo que sucedió con el ‘repocalypse’ de septiembre de 2019: las tasas de interés se dispararon a 10.5% en cuestión de horas, estalló el pánico afectando a futuros, opciones, divisas y otros mercados donde los operadores apuestan pidiendo prestado a los repos. La única forma de desactivar el contagio era arrojando tanta liquidez como fuera necesario al sistema, como helicópteros que arrojan miles de galones de agua en un incendio forestal. Entre septiembre de 2019 y marzo de 2020, la Fed inyectó más de 9 billones de dólares en el sistema bancario, lo que equivale a más del 40% del PIB estadounidense.

Por lo tanto, la narrativa dominante debe revertirse: el mercado de valores no colapsó (en marzo de 2020) porque se tuvieron que imponer confinamientos; más bien, hubo que imponer confinamientos porque los mercados financieros estaban colapsando. Con los confinamientos llegó la suspensión de las transacciones comerciales, que drenó la demanda de crédito y detuvo el contagio. En otras palabras, la reestructuración de la arquitectura financiera a través de una política monetaria extraordinaria dependía de que se apagara el motor de la economía. Si la enorme masa de liquidez inyectada en el sector financiero hubiera alcanzado transacciones sobre el terreno, se habría desatado un tsunami monetario con consecuencias catastróficas.

Como afirma la economista Ellen Brown, fue “otro rescate”, pero esta vez “al amparo de un virus”. Del mismo modo, John Titus y Catherine Austin Fitts señalaron que la “varita mágica” Covid-19 permitió a la Fed ejecutar el plan “directo” de BlackRock, literalmente: llevó a cabo una compra sin precedentes de bonos del gobierno, mientras que, en una escala infinitesimalmente menor, también emitió “préstamos COVID” respaldados por el gobierno a las empresas. En resumen, solo un coma económico inducido proporcionaría a la Fed el espacio para desactivar la bomba de tiempo que se está desvaneciendo en el sector financiero. Examinado por la histeria colectiva, el banco central de los Estados Unidos tapó los agujeros en el mercado de préstamos interbancarios, esquivando la hiperinflación, así como el “Consejo de Supervisión de la Estabilidad Financiera” (la agencia federal para monitorear el riesgo financiero creado después del colapso de 2008), como se discute aquí. Sin embargo, el plan de “ir directo” también debe enmarcarse como una medida desesperada, ya que solo puede prolongar la agonía de una economía global cada vez más rehén de la impresión de dinero y la inflación artificial de los activos financieros.

En el corazón de nuestra situación se encuentra un callejón sin salida estructural insuperable. La financiarización apalancada en la deuda es la única línea de vuelo del capitalismo contemporáneo, la inevitable ruta de escape hacia adelante para un modelo reproductivo que ha alcanzado su límite histórico. Los capitales se dirigen a los mercados financieros porque la economía basada en el trabajo es cada vez menos rentable. ¿Cómo llegamos a esto?

La respuesta se puede resumir de la siguiente manera: 1. La misión de la economía de generar plusvalía es tanto el impulso para explotar la fuerza de trabajo como para expulsarla de la producción. Esto es lo que Marx llamó la “contradicción en movimiento” del capitalismo. [1] Si bien constituye la esencia de nuestro modo de producción, esta contradicción hoy es contraproducente, convirtiendo la economía política en un modo de devastación permanente. 2. La razón de este cambio de fortuna es el fracaso objetivo de la dialéctica trabajo-capital: la aceleración sin precedentes en la automatización tecnológica desde la década de 1980 hace que se expulse más fuerza de trabajo de la producción que (re)absorbida. La contracción del volumen de salarios significa que el poder adquisitivo de una parte creciente de la población mundial está disminuyendo, con la deuda y la miseria como consecuencias inevitables. 3. A medida que se produce menos plusvalía, el capital busca rendimientos inmediatos en el sector financiero apalancado por la deuda en lugar de en la economía real o invirtiendo en sectores socialmente constructivos como la educación, la investigación y los servicios públicos.

La conclusión es que el cambio de paradigma en curso es la condición necesaria para la supervivencia (distópica) del capitalismo, que ya no es capaz de reproducirse a través del trabajo asalariado masivo y la utopía consumista concomitante. La agenda de la pandemia fue dictada, en última instancia, por la implosión sistémica: la caída de la rentabilidad de un modo de producción que la automatización desenfrenada está haciendo obsoleto. Por esta razón inmanente, el capitalismo depende cada vez más de la deuda pública, los bajos salarios, la centralización de la riqueza y el poder, un estado de emergencia permanente y las acrobacias financieras.

Si ‘seguimos el dinero’, veremos que el bloqueo económico atribuido desviadamente al Virus ha logrado resultados nada despreciables, no solo en términos de ingeniería social, sino también de depredación financiera. Rápidamente destacaré cuatro de ellos.

1) Como se anticipó, ha permitido a la Fed reorganizar el sector financiero imprimiendo un flujo continuo de miles de millones de dólares de la nada; 2) Ha acelerado la extinción de las pequeñas y medianas empresas, permitiendo a los grandes grupos monopolizar los flujos comerciales; 3) Ha deprimido aún más los salarios laborales y ha facilitado ahorros significativos de capital a través del “trabajo inteligente” (que es particularmente inteligente para aquellos que lo implementan); 4) Ha permitido el crecimiento del comercio electrónico, la explosión de big tech y la proliferación del dólar farmacéutico, que también incluye la muy despreciada industria del plástico, que ahora produce millones de nuevas máscaras faciales y guantes cada semana, muchos de los cuales terminan en los océanos (para deleite de los “nuevos distribuidores verdes”). Solo en 2020, la riqueza de los aproximadamente 2.200 multimillonarios del planeta creció en 1,9 billones de dólares,un aumento sin precedentes históricos. Todo ello gracias a un patógeno tan letal que, según datos oficiales, solo el 99,8% de los infectados sobreviven (ver aquí y aquí),la mayoría de ellos sin experimentar ningún síntoma.

Hacer el capitalismo de manera diferente

El motivo económico del whodunit Covid debe situarse en un contexto más amplio de transformación social. Si rascamos la superficie de la narrativa oficial, un escenario neofeudal comienza a tomar forma. Masas de consumidores cada vez más improductivos están siendo reglamentados y dejados de lado, simplemente porque Mr Global ya no sabe qué hacer con ellos. Junto con los subempleados y los excluidos, las clases medias empobrecidas son ahora un problema que debe manejarse con el palo de los confinamientos, los toques de queda, la vacunación masiva, la propaganda y la militarización de la sociedad, en lugar de con la zanahoria del trabajo, el consumo, la democracia participativa, los derechos sociales (reemplazados en el imaginario colectivo por los derechos civiles de las minorías) y las “vacaciones bien merecidas”.

Por lo tanto, es delirante creer que el propósito de los confinamientos es terapéutico y humanitario. ¿Cuándo se ha preocupado el capital por la gente? La indiferencia y la misantropía son los rasgos típicos del capitalismo, cuya única pasión real es la ganancia, y el poder que viene con ella. Hoy en día, el poder capitalista se puede resumir con los nombres de los tres fondos de inversión más grandes del mundo: BlackRock, Vanguard y State Street Global Advisor. Estos gigantes, que se encuentran en el centro de una enorme galaxia de entidades financieras, gestionan una masa de valor cercana a la mitad del PIB mundial y son accionistas importantes en alrededor del 90% de las empresas que cotizan en bolsa. A su alrededor gravitan instituciones transnacionales como el Fondo Monetario Internacional, el Banco Mundial, el Foro Económico Mundial, la Comisión Trilateral y el Banco de Pagos Internacionales, cuya función es coordinar el consenso dentro de la constelación financiera. Podemos asumir con seguridad que todas las decisiones estratégicas clave – económicas, políticas y militares – están al menos fuertemente influenciadas por estas élites. ¿O queremos creer que Virus los ha tomado por sorpresa? Más bien, el SARS-CoV-2 , que, según la admisión de los CDC y la Comisión Europea, nunca ha sido aislado ni purificado, es el nombre de un arma especial de guerra psicológica que se desplegó en el momento de mayor necesidad.

¿Por qué deberíamos confiar en un mega cártel farmacéutico (la OMS) que no se encarga de la “salud pública”, sino de comercializar productos privados en todo el mundo a las tasas más rentables posibles? Los problemas de salud pública se derivan de las pésimas condiciones de trabajo, la mala nutrición, el aire, el agua y la contaminación de los alimentos, y sobre todo de la pobreza desenfrenada; sin embargo, ninguno de estos “patógenos” está en la lista de preocupaciones humanitarias de la OMS. Los inmensos conflictos de intereses entre los depredadores de la industria farmacéutica, las agencias médicas nacionales y supranacionales, y los cínicos ejecutores políticos, es ahora un secreto a voces. No es de extrañar que el día en que el COVID-19 fue clasificado como una pandemia, el WEF, junto con la OMS, lanzó la Plataforma de Acción Covid, una coalición de “protección de la vida” dirigida por más de 1.000 de las empresas privadas más poderosas del mundo.

Lo único que importa para la camarilla que dirige la orquesta de emergencias sanitarias es alimentar la maquinaria lucrativa, y cada movimiento está planeado para este fin, con el apoyo de un frente político y mediático motivado por el oportunismo. Si la industria militar necesita guerras, la industria farmacéutica necesita enfermedades. No es casualidad que la “salud pública” sea, con mucho, el sector más rentable de la economía mundial, en la medida en que las grandes farmacéuticas gastan aproximadamente tres veces más que las grandes petroleras y el doble que las grandes tecnológicas en cabildeo. La demanda potencialmente interminable de vacunas y brebajes genéticos experimentales ofrece a los cárteles farmacéuticos la perspectiva de flujos de ganancias casi ilimitados, especialmente cuando están garantizados por programas de vacunación masiva subsidiados con dinero público (es decir, por más deuda que caerá sobre nuestras cabezas).

¿Por qué todos los tratamientos contra el Covid han sido prohibidos o saboteados penalmente? Como admite cándidamente la FDA, el uso de vacunas de emergencia solo es posible si “no hay alternativas adecuadas, aprobadas y disponibles”. Un caso de verdad oculto a plena vista. Además, la actual religión de la vacuna está estrechamente vinculada al aumento del dólar farmacéutico, que, al alimentarse de pandemias, está listo para emular las glorias del ‘petrodólar’, permitiendo a los Estados Unidos continuar ejerciendo la supremacía monetaria global. ¿Por qué toda la humanidad (¡incluidos los niños!) inyectar “vacunas” experimentales con efectos adversos cada vez más preocupantes pero sistemáticamente minimizados, cuando más del 99% de los infectados, la gran mayoría asintomáticos, se recuperan? La respuesta es obvia: porque las vacunas son el becerro de oro del tercer milenio, mientras que la humanidad es material de explotación de “última generación” en modalidad de conejillo de indias.

Ante este contexto, la puesta en escena de la pantomima de emergencia triunfa a través de una manipulación inaudita de la opinión pública. Cada “debate público” sobre la pandemia está descaradamente privatizado,o más bien monopolizado por la creencia religiosa en comités técnico-científicos financiados por las élites financieras. Toda “discusión libre” está legitimada por la adhesión a protocolos pseudocientíficas cuidadosamente purgados del contexto socioeconómico: uno “sigue a la ciencia” mientras finge no saber que “la ciencia sigue al dinero”. La famosa declaración de Karl Popper de que la “ciencia real” solo es posible bajo la égida del capitalismo liberal en lo que él llamó “la sociedad abierta”,[1] ahora se está haciendo realidad en la ideología globalista que anima, entre otros, la Open Society Foundation de George Soros. La combinación de “ciencia real” y “sociedad abierta e inclusiva” hace que la doctrina Covid sea casi imposible de desafiar.

Para el COVID-19, entonces, podríamos imaginar la siguiente agenda. Se prepara una narrativa ficticia basada en un riesgo epidémico presentado de tal manera que promueva el miedo y el comportamiento sumiso. Lo más probable es que se trata de un caso de reclasificación diagnóstica. Todo lo que se necesita es un virus de la gripe epidemiológicamente ambiguo, sobre el que construir una historia agresiva de contagio relacionable con áreas geográficas donde el impacto de las enfermedades respiratorias o vasculares en la población anciana e inmunocomprometa es alto, tal vez con el agravante de la fuerte contaminación. No hay necesidad de recuperar mucho, dado que las unidades de cuidados intensivos en los países ‘avanzados’ ya habían colapsado en los años previos a la llegada del Covid, con picos de mortalidad para los que nadie había soñado con exhumar la cuarentena. En otras palabras, los sistemas de salud pública ya habían sido demolidos y, por lo tanto, preparados para el escenario de pandemia.

Pero esta vez hay un método en la locura: se declara un estado de emergencia, que desencadena el pánico, causando a su vez la obstrucción de hospitales y residencias de ancianos (con alto riesgo de sepsis), la aplicación de protocolos nefastos y la suspensión de la atención médica. Et voilà, ¡el virus asesino se convierte en una profecía autocumplida! La propaganda que se extiende por los principales centros de poder financiero (especialmente América del Norte y Europa) es esencial para mantener el “estado de excepción” (Carl Schmitt), que se acepta inmediatamente como la única forma posible de racionalidad política y existencial. Poblaciones enteras expuestas al intenso bombardeo mediático se rinden a través de la autodisciplina, adhiriéndose con grotesco entusiasmo a formas de “responsabilidad cívica” en las que la coerción se transforma en altruismo.

Todo el guión de la pandemia, desde la ‘curva de contagio’ hasta las ‘muertes por Covid’, se basa en la prueba PCR, que fue autorizada para la detección del SARS-CoV-2 por un estudio elaborado en tiempo récord por encargo de la OMS. Como muchos ya sabrán, la falta de fiabilidad diagnóstica de la prueba PCR fue denunciada por su propio inventor, el premio Nobel Kary Mullis (lamentablemente fallecida el 7 de agosto de 2019), y recientemente reiterada por, entre otros, 22 expertos de renombre internacional que exigieron su eliminación por claros defectos científicos. Obviamente, la solicitud cayó en oídos sordos.

La prueba PCR es el motor de la pandemia. Funciona a través de los infames ‘umbrales de ciclo’: cuantos más ciclos haces, más falsos positivos (infecciones, muertes por Covid) produces, como incluso el gurú Anthony Fauci admitió imprudentemente cuando afirmó que los hisopos no valen nada por encima de los 35 ciclos. Ahora, ¿por qué durante la pandemia se realizaron rutinariamente amplificaciones de 35 ciclos o más en laboratorios de todo el mundo? Incluso el New York Times, ciertamente no una guarnda de peligrosos negadores del Covid, planteó esta pregunta clave el verano pasado. Gracias a la sensibilidad del hisopo, la pandemia se puede encender y apagar como un grifo, lo que permite al régimen de salud ejercer un control total sobre el “monstruo numerológico” de los casos y muertes por Covid, los instrumentos clave del terror cotidiano.

Todo este alarmismo continúa hoy, a pesar de la flexibilización de algunas medidas. Para entender por qué, deberíamos volver al motivo económico. Como se ha señalado, varios billones de efectivo recién impreso han sido creados con unos pocos clics de un ratón por los bancos centrales e inyectados en los sistemas financieros, donde en gran parte han permanecido. El objetivo de la ola de impresión era tapar las calamitosas brechas de liquidez. La mayor parte de este “dinero del árbol mágico” todavía está congelado dentro del sistema bancario en la sombra, las bolsas de valores y varios esquemas de moneda virtual que no están destinados a ser utilizados para el gasto y la inversión. Su función es únicamente proporcionar préstamos baratos para la especulación financiera. Esto es lo que Marx llamó “capital ficticio”, que continúa expandiéndose en un bucle orbital que ahora es completamente independiente de los ciclos económicos en el suelo.

La conclusión es que no se puede permitir que todo este efectivo inunde la economía real, ya que esta última se sobrecalentaría y desencadenaría la hiperinflación. Y aquí es donde Virus sigue siendo útil. Si inicialmente sirvió para “aislar la economía real” (para citar nuevamente el documento del BIS), ahora supervisa su reapertura tentativa, caracterizada por la sumisión al dogma de la vacunación y los métodos cromáticos de regimentación masiva, que pronto pueden incluir bloqueos climáticos. ¿Recuerdas cómo nos dijeron que solo las vacunas nos devolverían nuestra “libertad”? De manera demasiado predecible, ahora descubrimos que el camino hacia la libertad está lleno de “variantes”, es decir, iteraciones de Virus. Su propósito es aumentar el “recuento de casos” y, por lo tanto, prolongar los estados de emergencia que justifican la producción de dinero virtual de los bancos centrales destinado a monetizar la deuda y financiar los déficits. En lugar de volver a los tipos de interés normales, las élites optan por normalizar la emergencia sanitaria alimentando el fantasma del contagio. Por lo tanto, la tan publicitada “reducción” (reducción del estímulo monetario) puede esperar, al igual que Pandexit.

En la UE, por ejemplo, el «programa de compras de emergencia pandémica» del Banco Central Europeo de 1,85 billones de euros, conocido como PEPP, se prevé que continúe hasta marzo de 2022. Sin embargo, se ha insinuado que podría necesitar extenderse más allá de esa fecha. Mientras tanto, la variante Delta está causando estragos en la industria de viajes y turismo, con nuevas restricciones (incluida la cuarentena) que interrumpen la temporada de verano. Una vez más, parece que estamos atrapados dentro de una profecía autocumplida (especialmente si, como el premio Nobel Luc Montagnier y muchos otros han insinuado, las variantes, por leves que sean, son la consecuencia de agresivas campañas de vacunación masiva). Cualquiera que sea el caso, el punto fundamental es que el Virus sigue siendo necesario para el capitalismo senil, cuya única posibilidad de supervivencia depende de generar un cambio de paradigma del liberalismo al autoritarismo oligárquico.

Si bien su crimen está lejos de ser perfecto, los orquestadores de este golpe global deben, sin embargo, ser acreditados con una cierta brillantez sádica. Su prestidigitación tuvo éxito, tal vez incluso más allá de las expectativas. Sin embargo, cualquier poder que apunte a la totalización está destinado al fracaso, y esto se aplica también a los sumos sacerdotes de la religión Covid y a los títeres institucionales que han movilizado para desplegar el psyop de emergencia sanitaria. Después de todo, el poder tiende a engañarse a sí mismo acerca de su omnipotencia. Aquellos sentados en la sala de control no se dan cuenta de hasta qué punto su dominio es incierto. Lo que no ven es que su autoridad depende de una “misión superior”, a la que permanecen parcialmente ciegos, a saber, la auto reproducción anónima de la matriz capitalista. El poder de hoy reside en la máquina lucradora cuyo único propósito es continuar su viaje imprudente, lo que podría conducir a la extinción prematura del Homo sapiens. Las élites que han estafado al mundo en la obediencia al Covid son la manifestación antropomórfica del autómata capitalista, cuya invisibilidad es tan astuta como la del propio Virus. Y la novedad de nuestra era es que la “sociedad encerrada” es el modelo que mejor garantiza la reproducibilidad de la máquina capitalista, independientemente de su destino distópico.


[1] Karl Marx, Grundrisse (Londres: Penguin, 1993), 706.

[2] Karl Popper, The Open Society and its Enemies,2 volúmenes (Princeton: Princeton UP, 2013).


La narrativa sin sentido predominante del Coronavirus, desacreditada en 10 o 26 minutos

Doctor Thomas Binder

Todo prójimo enfermo y todo familiar de prójimo fallecido tiene mi más profunda empatía pero, ante todo, también tiene derecho a conocer la verdad.

Me gustaría presentar la realidad de la crisis de la corona, entrar en su cronología y confrontar sus numerosos mitos y absurdos intelectuales con la cientificidad. Los estudios más importantes están vinculados en el texto. Se puede encontrar más información científica, incluidos enlaces a otros estudios importantes, en las páginas de inicio de “Aletheia – Medicine and Science for Proportionality”, el “Corman-Drosten Review Report” y “Doctors for Covid Ethics”, de los cuales soy un miembro.

Epidemia de pruebas de PCR, 2006

Como médicos y científicos responsables, en el caso de infecciones diagnosticadas mediante pruebas rápidas de PCR en el contexto de una supuesta epidemia de alcance nacional o pandemia de alcance internacional, siempre debemos considerar la posibilidad de una pseudoepidemia o epidemia deTests.

El 27 de enero de 2007, el New York Times, virtualmente la biblia de los periodistas en cuya integridad todavía se podía confiar en ese momento, publicó un importante artículo titulado: ‘Faith in Quick Test Leads to Epidemic That Wasn’t’; “La fe en las pruebas rápidas conduce a una epidemia que no fue”.

El Dr. Herndon, internista de un centro médico en el estado estadounidense de New Hampshire, tose incesantemente durante quince días a partir de mediados de abril de 2006. Pronto, un especialista en enfermedades infecciosas tiene la inquietante idea de que esto podría ser el comienzo de una tos ferina. epidemia. A finales de abril, otros miembros del personal del hospital también estaban tosiendo. La tos intensa y persistente es un síntoma principal de la tos ferina. Y si se trata de tos ferina, el brote debe ser contenido de inmediato porque la enfermedad puede ser fatal para los bebés en el hospital y provocar una neumonía peligrosa en pacientes ancianos frágiles.

Es el comienzo de un extraño episodio en el centro médico: la historia de la epidemia que no lo fue. Durante meses, casi todos los involucrados creen que hay un gran brote de tos ferina en el centro médico con consecuencias de gran alcance. A casi 1.000 miembros del personal se les realiza una prueba rápida de PCR y se les apartó del trabajo hasta que se obtuviesen los resultados; 142 personas, el 14,2% de las examinadas, incluido el Dr. Herndon, dan positivo en la prueba de PCR rápida, por lo que se les diagnostica tos ferina. Miles, incluidos muchos niños, reciben antibióticos y una vacuna como protección. Las camas de hospital se retiran de servicio como medida de precaución, incluso algunas en la unidad de cuidados intensivos.

Meses después, todos los que aparentemente padecen tos ferina se quedan atónitos al saber que en cultivos bacterianos, el estándar de oro diagnóstico para la tos ferina, la bacteria que causa la tos ferina no se pudo detectar en una sola muestra. Toda la locura fue una falsa alarma.

La supuesta epidemia de tos ferina no había tenido lugar en la realidad, sino solo en las mentes de los involucrados, provocada por la fe ciega en una prueba de PCR rápida altamente sensible que se había vuelto tan moderna. En verdad, todos los que habían caído enfermos habían padecido un resfriado inofensivo. Los infecciosos y epidemiólogos habían dejado de lado su experiencia y sentido común y habían ignorado descaradamente este diagnóstico diferencial más probable del síntoma de tos.

Muchas de las nuevas pruebas moleculares son rápidas pero técnicamente exigentes. Cada laboratorio las elabora a su manera como las denominadas ‘cervezas caseras’. Por lo general, no están disponibles comercialmente y rara vez hay buenas estimaciones de sus tasas de error. Su alta sensibilidad hace que sean probables los falsos positivos. Cuando se hacen las pruebas a cientos o miles de personas, como sucedió aquí, los resultados falsos positivos pueden dar la apariencia de una epidemia.

Un infectólogo dijo: En ese momento tuve la sensación de que esto nos daba una sombra de lo que podría ser durante una epidemia de gripe pandémica.

Y un epidemiólogo explicó: Uno de los aspectos más preocupantes de la pseudoepidemia es que todas las decisiones parecían tan sensatas en ese momento.

La locura de una pseudoepidemia o una epidemia de Tests parecía perfectamente normal para muchos involucrados.

Le recomiendo que lea este artículo publicado en el New York Times en 2007 y se pregunte: “¿No deberíamos haber aprendido mucho de esto para el futuro?”

Escándalo de la gripe porcina, 2009

Como médicos y científicos responsables, en una supuesta o real epidemia de ámbito nacional o pandemia de alcance internacional debemos recordar siempre las presuntas o reales epidemias o pandemias anteriores. Aquí está el último.

En la primavera de 2009, un virus de influenza sumamente contagioso y peligroso, el H1N1, parece amenazar a la humanidad. La enfermedad que causa es clínicamente indistinguible de la gripe estacional y se llama gripe porcina.

Expertos como el virólogo alemán Prof. Christian Drosten difundieron escenarios de terror prediciendo millones de muertes en todo el mundo. En mayo, la OMS flexibiliza los criterios para declarar una pandemia por razones que nunca se han explicado. Elimina la peligrosidad del patógeno causante de la definición de pandemia. Ahora, la propagación rápida y masiva de un patógeno comparativamente inofensivo en al menos dos regiones de la OMS es suficiente. Cualquier endemia, cada ola estacional de cualquier gripe o virus del resfriado, sin importar cuán inofensivo sea, puede llamarse pandemia. Inmediatamente, la OMS declara una pandemia de H1N1 el 11 de junio.

Los políticos se toman en serio las advertencias de los expertos y de la OMS. Sin consultar a la población, están adquiriendo cientos de millones de paquetes de medicamentos antivirales costosos y escasamente efectivos y cientos de millones de dosis de vacunas aprobadas apresuradamente que, después de todo, se producen utilizando métodos convencionales.

Los críticos que describen el virus como comparativamente inofensivo son ridiculizados o ignorados inicialmente. Finalmente, los científicos, en Europa especialmente el microbiólogo y epidemiólogo de infecciones alemán Prof. Sucharit Bhakdi y el neumólogo y político alemán Dr. Wolfgang Wodarg, captan la atención en los medios de comunicación y la política. La locura global que ya amenazaba en ese momento puede evitarse justo a tiempo.

En todo el mundo, entre 150 y 600 mil personas murieron con o por el H1N1, que resultó ser menos peligroso que la influenza estacional. En consecuencia, la preparación para la vacunación fue baja. Sin embargo, solo en Suecia, unos 700 niños contrajeron narcolepsia incapacitante, enfermedad del sueño, causada por vacunas innecesarias e inseguras aprobadas apresuradamente. Solo en Suiza, se vendieron o regalaron 1,8 millones de dosis de vacunas en el extranjero y se eliminaron 8,9 millones.

Apenas hubo cobertura mediática del escándalo de la gripe porcina. El éxito temporal del pánico alimentado por los medios se debió principalmente a la interconexión de los expertos, la industria farmacéutica, la OMS y los políticos de la salud. Al final, las autoridades sanitarias aparentemente abrumadas se habían enamorado de una campaña de propaganda casi perfectamente orquestada.

Te recomiendo que veas el documental „Profiteure der Angst – das Geschäft mit der Schweinegrippe“; “Beneficiarios del miedo – El negocio de la gripe porcina”, producido en alemán por Arte en noviembre de 2009, y te preguntes: “¿No deberíamos haber aprendido mucho de esto para el futuro?”

‘Evento 201’: Simulación de la pandemia de Corona, 2019

La situación es amenazadora. Un nuevo virus corona se está extendiendo por todo el mundo. El número de casos en el panel de control de la Universidad Johns Hopkins está aumentando y aumentando. El peligroso virus altamente contagioso, inmunorresistente está paralizando el comercio y el transporte a nivel mundial y haciendo que la economía mundial caiga libremente.

Lo que suena como el supuesto brote de la supuesta pandemia de SARS-CoV-2 en la provincia china de Wuhan en diciembre de 2019, es el escenario del “Evento 201”.

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates, la Universidad Johns Hopkins y el WEF están organizando una simulación de pandemia con este nombre. Después de la gripe española, la gripe aviar y la gripe porcina, como patógeno no eligen otro virus de la gripe, sino un coronavirus que hasta ahora es completamente desconocido para los profanos, sobre todo para políticos y periodistas.

Esta simulación de una pandemia de corona que estalló en Sudamérica no es atendida por médicos, sino por representantes occidentales de los organizadores, la ONU, la OMS, gobiernos, autoridades y corporaciones globales de los campos de las altas finanzas, farmacéutica, logística, turismo. y los medios de comunicación, así como por el Dr. George Gao, virólogo y director de los CDC chinos, el equivalente chino de la Oficina Federal Suiza de Salud Pública (BAG).

Los participantes están de acuerdo en que una pandemia de corona es disruptiva, solo puede superarse mediante la cooperación gubernamental y privada global, las corporaciones globales relevantes para el sistema deben apoyarse financieramente, las empresas medianas deben sacrificarse si es necesario, las voces que se desvían de la narrativa prevaleciente deben ser censurada constantemente en los medios de comunicación social y de masas, y la pandemia solo se puede acabar con la vacunación de toda la población mundial.

La simulación termina con 65 millones de muertes en todo el mundo.

Te recomiendo que veas el documental „Event 201: Corona-Pandemie vom Reissbrett“; “Evento 201: La pandemia de Corona desde el tablero de dibujo”, producido en alemán con subtítulos en inglés por ExpressZeitung en junio de 2020, y te preguntes: “¿No deberían los medios de comunicación informar sobre esto en detalle?”

Corona escándalo, 2020

Dos meses y medio después, el 31 de diciembre de 2019, los CDC chinos, dirigidos por el Dr. George Gao, informan a la OMS 27 casos de neumonía de causa desconocida, de una población china de 1.400 millones. El 7 de enero de 2020, las autoridades sanitarias chinas identificaron un nuevo coronavirus como agente causante.

El 21 de enero de 2020, el profesor Christian Drosten et al. Presentar un artículo , con cuya receta los laboratorios pueden producir una prueba rápida de RT-PCR para la detección del virus denominada 2019-nCoV. Se acepta al día siguiente y se publica en la revista Eurosurveillance otro día después.

La OMS ya había publicado la prueba rápida Drosten RT-PCR en su sitio web una semana antes y la recomendó como el estándar de oro de diagnóstico mundial.

El 30 de enero, Drosten et al. publicó la justificación de la narrativa de la transmisión asintomática epidemiológicamente relevante de 2019-nCoV en la carta al editor del New England Journal of Medicine, virtualmente una de las biblias de nosotros los médicos en cuya integridad todavía podíamos confiar en ese momento, con el título ‘Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany’; “Transmisión de la infección por 2019-nCoV a partir de un contacto asintomático en Alemania”.

El 11 de febrero, la OMS nombra al nuevo virus corona SARS-CoV-2, la enfermedad que causa COVID-19; enfermedad del coronavirus. Lo hace en contra de la solicitud de los virólogos chinos. Prefirieron llamarlo HCoV-19, coronavirus humano, debido al peligro de que el nombre SARS-CoV-2 pudiera despertar temores infundados por su falta de similitud biológica y epidemiológica con el mucho más peligroso SARS-CoV-1.

El 11 de marzo, la OMS declara una pandemia de COVID. Mientras tanto, su Director General, el biólogo, inmunólogo y filósofo Dr. Tedros Adhanom Ghebreyesus, fue acusado de genocidio en Etiopía ante la Corte Penal Internacional en La Haya. La presunción de inocencia se aplica, por supuesto.

Ahora, casi todo está sucediendo como sucedió durante el escándalo de la gripe porcina en 2009, pero de una manera aún más lubricada. Expertos, en su mayoría médicos de laboratorio y biólogos que trabajan como virólogos o epidemiólogos, que nunca han examinado a nadie que padezca una infección respiratoria, y mucho menos tratado, declaran que el SARS-CoV-2 es prácticamente un extraterrestre del que no sabemos absolutamente nada y que debemos considerar extremadamente peligroso, hasta que en gran parte los mismos expertos hayan demostrado lo contrario en algún momento. En Suiza, se constituyen como ‘Grupo de Trabajo Científico Nacional Suizo COVID-19’ y se ofrecen al Consejo Federal Suizo como asesores científicos.

Los políticos ejecutivos y legislativos, así como las autoridades sanitarias federales y cantonales, todos aterrorizados por ellos, aceptan su oferta y parecen seguirlos tan ciegamente como el Consejo Federal aparentemente siguió ciegamente a la OMS cuando declaró la pandemia de COVID. A diferencia de cualquier club de nueve bolos, el consejo científico asesor ahora oficial del gobierno suizo a través de lo que se supone que es la mayor crisis de Suiza desde la Segunda Guerra Mundial no mantiene ningún registro de sus actividades.

El 16 de marzo, el Consejo Federal Suizo declara la ‘situación excepcional’, el nivel de peligro más alto de la ley epidémica, basado en exactamente cero evidencia científica,

Los medios de comunicación, incluida la emisora ​​pública suiza SRG, asumen la tercera parte de este conglomerado de ignorancia, arrogancia, incompetencia e irresponsabilidad organizada que se intensifican mutuamente. Ellos mismos, sin cerebro y sin corazón, martillean en nuestras cabezas durante todo el día:

Existe una pandemia de un virus corona killer transmisible asintomáticamente, altamente contagioso e incluso epidemiológicamente relevante. ¡Todo ser humano aparentemente sano y cordial puede ser tu ángel de la muerte!

A diferencia de 2009, los medios de comunicación censuran, desacreditan y difaman constantemente a los médicos y científicos que cuestionan, incluidas luminarias como John Ioannidis, profesor de medicina, epidemiología y salud pública en la Facultad de Medicina de la Universidad de Stanford, uno de los científicos más reconocidos y citados del mundo, especializado en fraude científico; el Prof. Sucharit Bhakdi y el Dr. Wolfgang Wodarg. Después de haber sido difamado, incluyendo presuntas amenazas a políticos y mi familia, por parte de un particular muy conocido por mí, fui brutalmente arrestado por una unidad antiterrorista en mi consulta y, después de que inmediatamente resultó que no había amenazado a nadie, simplemente la visión del mundo de gente enferma, fui enviado a un pabellón psiquiátrico cerrado durante seis días debido a ‘ponerme en peligro mientras estaba en la locura COVID’.

Los gobiernos de casi todos los países parecen haber olvidado sus planes epidémicos, que sabiamente preservan a los individuos, la sociedad y la economía. En obediencia ciega a la OMS y a los grupos de presión, llamados expertos, están implementando intervenciones no farmacológicas autodestructivas, incluidos bloqueos nunca antes considerados, siguiendo el modelo autoritario chino. Lo están haciendo casi a nivel mundial, al mismo tiempo.

Sin consultar a la población, obtienen miles de millones de dosis de inyecciones de ARNm y ADN de emergencia, que incluso son aprobadas temporalmente por Swissmedic. Esta tecnología se está utilizando ampliamente en humanos por primera vez. Casi en todo el mundo, la constitución, el estado de derecho, los derechos humanos, las libertades civiles, la ética, la cientificidad y el sentido común están siendo sacrificados a favor de un régimen autoritario cuasi global bajo el control de la OMS: ¡Quién controla a la OMS, controla mundo!

Todos los elementos de la narrativa corona predominante se inventan a partir del vacío libre de hechos

1. El SARS-CoV-2 no surgió en Wuhan en diciembre de 2019. Primero, en noviembre de 2020, un estudio de Milán mostró que el SARS-CoV-2 era endémico en Italia ya en septiembre de 2019, antes de la temporada de gripe 2019/20. Otros estudios mostraron lo mismo más tarde, por ejemplo en Francia.

2. No hay una epidemia de SARS-CoV-2 de alcance nacional, por lo tanto, no hay una pandemia. Esto ya es evidente por la falta de exceso de mortalidad cuando se corrige por demografía, y por la baja ocupación de las unidades de cuidados intensivos, cuyas capacidades, además, se han reducido enormemente desde abril de 2020.

3. La indicación para realizar pruebas, es decir, no solo en pacientes hospitalizados críticamente enfermos con necesidad de una terapia antiviral específica, en el sistema de vigilancia y en una cohorte de estudio, sino también para realizar pruebas incluso asintomáticas, antes llamadas personas sanas y, además de eso, es incorrecto realizar una prueba para uno solo de todos los virus respiratorios que deben considerarse en el diagnóstico diferencial de las infecciones respiratorias .

4. La prueba Drosten RT-PCR no es diagnóstica de una infección por SARS-CoV-2 ni de una enfermedad o muerte por COVID-19. El 27 de noviembre de 2020, un grupo internacional de 22 científicos de la vida, incluyéndome a mí, publicó una “Revisión externa por pares del documento Corman-Drosten”.

Explicamos que existen conflictos de interés, que la supuesta revisión por pares dentro de las 24 horas es absurda, y diez fallas científicas fundamentales. Esta publicación médica más importante de 2020, que difícilmente puede ser superada en términos de falta de cientificidad, nunca debería haberse publicado.

El protocolo de prueba Corman-Drosten RT-PCR se fabrica de manera deficiente y vaga, sin validación ni estandarización. Como resultado de la reacción cruzada con otros coronavirus, su especificidad de aproximadamente el 98,6%, y un corresaondiente umbral de 1,4% de falsos positivos, que ya es bajo en ausencia de virus, se reduce aún más hasta el 92,4%, correspondiente a un 7,6% de falsos positivos, durante la temporada de gripe. En todas partes, la prueba se realiza de manera diferente y con umbrales de ciclo demasiado altos. Aunque los estudios han demostrado que no hay virus cultivables presentes en muestras con un valor de Ct superior a 28, las pruebas aún se llevan a cabo con valores de umbral de ciclo superiores a 35. Sus resultados se informan en todo el mundo sin hacer referencia a los síntomas clínicos.

5. Los síntomas, hallazgos clínicos de laboratorio y radiológicos del COVID-19 no se pueden distinguir claramente de las enfermedades causadas por otros virus respiratorios.

6. No hay transmisión asintomática epidemiológicamente relevante de virus respiratorios. Mientras tanto, lo que aprendimos en la escuela de medicina también ha sido confirmado para el SARS-CoV-2 por numerosos estudios. El ‘contacto asintomático’ inventado por el profesor Drosten en la carta al editor del 30 de enero de 2020 fue muy sintomático: la paciente había suprimido sus síntomas con medicación.

Por lo tanto, todas las intervenciones no farmacológicas para personas asintomáticas, antes llamadas sanas, más allá de las medidas efectivas comprobadas para contener la propagación del SARS-CoV-2, la higiene y el autoaislamiento de las personas enfermas, son ineficaces.

7. La alta tasa de letalidad (CFR) del 2%, citada durante mucho tiempo, era engañosa. Todo estudiante de escuela primaria sabe que no es el CFR lo que es relevante, sino la tasa de letalidad por infección (IFR), que fácilmente puede reducirse en un factor de aproximadamente cien debido al número de casos no detectados.

8. La afirmación inicial de que el 5% de las personas infectadas necesitaría un tratamiento de cuidados intensivos fue incorrecta , por las mismas razones que todo estudiante de primaria comprende. Condujo a la adquisición de alrededor de 1.000 ventiladores y al aplazamiento de operaciones que no eran de emergencia pero que eran necesarias.

9. El SARS-CoV-2 no es un asesino en masa. La estimación realista más reciente del IFR global es del 0,15%, por debajo del 0,05% para los menores de 70 años. Después de reemplazar el número de fallecidos en 28 días con una prueba de PCR positiva por cualquier causa por el número de fallecidos por COVID-19, es incluso mucho menor, muy por debajo del de la influenza estacional.

10. Una epidemia no se propaga exponencialmente, sino según una función logística o de Gompertz.

11. Debido a la inmunidad básica y cruzada, solo alrededor del 10-20% de las personas contraen los virus de la corona y la influenza estacionales durante cada temporada de influenza. Es probable que exista inmunidad colectiva desde el final de la temporada Corona-19, en nuestras latitudes medias del norte en abril de 2020. Por lo tanto, una ‘enésima ola de un virus respiratorio’ también es una imposibilidad biológica.

12. Existe una profilaxis eficaz: por ejemplo, estilo de vida saludable, muchos contactos sociales y vitamina D3.

13. Existe una terapia eficaz, bien tolerada y de bajo costo: por ejemplo, budesonida tópica, dosis normales de hidroxicloroquina e ivermectina.

14. Las inyecciones experimentales seriadas de ARNm y ADN son innecesarias (IFR 0.15%; para menores de 70 años menor del 0.05%, incluso mucho menor después de reemplazar el número de fallecidos por cualquier causa dentro de los 28 días con una prueba de PCR positiva por el número de fallecidos de COVID-19, además SARS-CoV-2 está mutando permanentemente y en el sentido de que se vuelve más infeccioso y menos peligroso), ineficaces (según los estudios de registro , que no valen el papel en el que están escritos, las inyecciones de ARNm reducen el riesgo de enfermedad leve COVID-19 absolutamente (!) en <1%, no hay datos para cursos severos y en > 75 años), e inseguras (reacciones anafilácticas, tromboembolismo, trombocitopenia, CID y miocarditis a corto plazo, posible ADE a mediano plazo, posibles enfermedades autoinmunes, cáncer y otras a mediano-largo plazo).

¡El SARS-CoV-2 no es un extraterrestre! Es un miembro recién descubierto de la conocida familia de coronavirus beta. Por lo tanto, evidentemente ocurre estacionalmente de noviembre a abril y muta, sin intervención humana, de tal manera que se vuelve cada vez más contagioso pero menos peligroso. Debido a la inmunidad básica y cruzada existente, solo una fracción de la población se enferma. La enfermedad suele ser autolimitada y deja inmunidad, posiblemente de por vida, y mejor que la mejor vacuna que haya existido. En comparación, mata a pocas personas y, a diferencia de la influenza, a ningún niño.

Toda la narrativa de la corona predominante es una tontería. Justifica la locura inhumana y anticientífica que domina a nivel mundial. Esto se puede ocurrir con cualquier virus respiratorio: si dejamos de hacer pruebas a todas las personas con una prueba RT-PCR hipersensible y poco específica que reacciona de forma cruzada con otros virus por homología con un fragmento de ARN del SARS-CoV-2, y las hacemos para uno de, por ejemplo, la gripe o el metapneumovirus, inmediatamente tendremos una pandemia de pruebas de gripe o metapneumo.

Por cierto, todos los estudiantes de medicina de segundo año deben estudiar los conceptos básicos de epidemiología. Allí se aprende que cuando se declara una epidemia de alcance nacional, se debe conformar inmediatamente una cohorte de estudio representativa de la población. Se utiliza para controlar el número de casos, la gravedad de la enfermedad y el estado de inmunidad, en este caso determinando los anticuerpos y la inmunidad de las células T.

Aunque ha pasado más de un año desde que la OMS declaró la pandemia de COVID, no existe una cohorte de vigilancia tan representativa. Peor aún: de la semana 13 a la 44, la BAG también había detenido el sistema de vigilancia, completando así el vuelo ciego total.

La epidemia es en gran parte una epidemia de pruebas de PCR irreal, pero las medidas opresivas que ha producido son reales; amenazan nuestra libertad, nuestros medios de subsistencia e incluso nuestras vidas.

¡Estimados compañeros responsables!

Recuerden el juramento hipocrático (“Primero, no hagas daño, para evitar la tercera cura”) y la Declaración de Ginebra de la Asociación Médica Mundial:

No utilizaré mis conocimientos médicos para violar los derechos humanos y las libertades civiles, incluso bajo amenaza.

¡Queridos compañeros humanos responsables!

Despertad, poneos en pie y luchad, pacíficamente pero con firmeza; si no es por ti mismo, ¡por el futuro de Tus hijos y el de sus nietos!

Tres presidentes rechazan las vacunas. Mueren tres presidentes

Tres países que rechazaron las inyecciones experimentales de COVID han visto morir a sus presidentes

O crees que hay una conspiración real o crees que esto no es más que una coincidencia, que va en contra tanto de la lógica como de las Escrituras. Tres presidentes de tres países murieron en circunstancias misteriosas, y con pocos meses de distancia, después de que rechazaran las inyecciones experimentales de COVID para su pueblo.

Aquí están estos hombres.

En Burundi fue presidente Pierre Nkurunziza

En Tanzania, fue el presidente John Magufuli (El que osó ridiculizar a la OMS con sus test PCR positivos a una papaya, una cabra, codorniz y dicen que hasta a aceite de coche usado).

En Haití, fue el presidente Jovenel Moïse

Los tres presidentes están ahora MUERTOS.


¿Cuáles son las probabilidades de que estos tres hombres en particular, todos mueran en el cargo. . . y lo único que tienen en común es que se negaron a aceptar la vacuna para sus países?

Para muchas personas, sus muertes parecen un asesinato; aunque el de Haití fue directamente asesinado, fue asesinado por hombres con armas de fuego.

Todo este esfuerzo y gasto, todo este soborno y coerción, toda esta manipulación e intimidación, toda esta presión y fuerza para protegerse contra un virus que tiene una tasa de supervivencia del 99%.

Y ahora parece haber una clara probabilidad de que tres presidentes hayan sido asesinados porque cada uno rechazó la distribución de las vacunas contra el Covid en sus respectivos países.

A pesar de una densidad de población similar, una mayor población total y una peor atención médica disponible, Haití ha tenido el 1,8% de los casos de Covid que ha tenido Nueva Jersey. Dicho de otra manera, los ciudadanos de Nueva Jersey con una alta tasa de vacunación tienen 53 veces más probabilidades de contraer Covid-19 que los haitianos que no tienen acceso a una vacuna.

Moïse lo sabía. Es una de las razones por las que rechazó las vacunas gratuitas en mayo y junio. Pero no oirán hablar de eso. Ya no. La historia oficial sobre la reticencia a las vacunas en Haití ha cambiado repentinamente tras el asesinato de Moïse. Ahora, los funcionarios de salud en el país afirman que no rechazaron TODAS las vacunas, solo las vacunas de AstraZeneca debido a los mayores riesgos que supuestamente tienen. Por supuesto, esta narrativa no se materializó hasta después de que Moïse fue asesinado.

Con Moïse fuera del camino, las puertas se están abriendo de par en par para la nación que no necesita ni quiere que las vacunas de repente las tengan disponibles. Como si fuera poco, el régimen de Biden ha ofrecido enviar millones de vacunas a la nación muy pronto.

Sorprendentemente, casi todo el mundo está ignorando el hecho de que más estadounidenses han muerto por las vacunas contra el Covid en los primeros CINCO MESES de este año que por todas las vacunas durante los últimos DIEZ AÑOS.

Casi todo el mundo está ignorando el hecho de que un tribunal en Lisboa, Portugal, ha determinado que solo el 0,9% de los “casos verificados” murieron realmente de Covid, que su cifra es de 152, no los 17.000 reclamados. Y la gente también ignora el hecho de que las denuncias fraudulentas sobre muertes por Covid como las de Portugal son universales y se están produciendo donde viven.

Casi todo el mundo está ignorando el hecho de que la Unión Europea ha informado de que hasta el 19 de junio de 2021, ha habido 1,5 millones de heridos por vacuna y más de 15.000 muertes.

Informes como estos son interminables, y casi todo el mundo los ignora por completo.

Y ahora, es cuando Haití se va a contagiar ¿SERÁ HAITÍ LA PRÓXIMA INDIA? | Las termitas del cielo ( escrito el 9 de mayo. En este caso, muerto el perro aparece la rabia.

Conclusión, es la vacuna ¿Qué hay en la vacuna?

Fuentes: (Tres presidentes rechazan las vacunas contra el Covid; Mueren tres presidentes – LewRockwell); (Hal Turner Radio Show – Three Countries on Earth Declined the COVID Vax; Los tres de sus presidentes ahora están MUERTOS)

152 muertes por covid en Portugal desde enero de 2020

PDF de la Sentencia

Desde marzo de 2020 han muerto en Portugal 152 personas de covid, nombradas formalmente por el ministerio de sanidad y confirmadas por un tribunal.

Todos los “otros” murieron de todo lo demás que mata y acaba de tener una prueba PCR positiva inútil!

Los datos son de SICO, el único sistema de certificados de defunción en Portugal. La referencia a “bajo la tutela del MJ es espuria, todos se emiten bajo la tutela del MJ que es la única institución que los emite.

Vivimos en un fraude de dimensiones nunca antes visto.

En respuesta a una acción popular, fue necesario citar al tribunal para que el ministerio respondiera, desesperado por no denunciar el fraude.

Todos los responsables de la manipulación de los datos de “casos” y “muertes” sólo pueden, después de esto, ser juzgados por el delito si queda algo de dignidad en el estado de derecho.

152 mortes de covid em Portugal desde janeiro 2020

Fuente: 152 muertes por covid en Portugal desde enero de 2020 |

Tribunal Administrativo de Viena: Política coronavirus sin fundamento, prueba de PCR inapropiada

Un fallo que toda Austria, y tal vez el mundo entero, lleva esperando más de un año.

Por fin, un tribunal ha examinado los fundamentos inestables sobre los que descansa la política corona, que reclama una peligrosa pandemia mundial. Recientemente, el reconocido profesor John Ioannidis encontró que la mortalidad por infección por SARS-CoV-19 es sólo del 0,15 por ciento, exactamente la misma que la de la gripe anual. Durante la supuesta pandemia, aproximadamente tantas personas parecen haber contraído covid-19 como de otra manera habría contraído la gripe – mientras que supuestamente no hay o casi ningún caso de gripe en todo el mundo. Esto está dando a más y más personas una pausa para pensar.

Definición de enfermedad completamente incorrecta

El Tribunal Administrativo de Viena examinó de cerca las bases de la política histérica del gobierno federal austriaco y constató que la definición de enfermedad del ministro Anschober por sí sola es completamente errónea e infundada.

Si uno va por las definiciones del Ministro de Salud, “Definición de caso Covid-19” de 23.12.2020, un “caso confirmado” es:

1) cualquier persona con detección de ácido nucleico específico SARS-CoV-2 (prueba de PCR, nota), independientemente de la manifestación clínica, o

2) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios clínicos, o

3) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios epidemiológicos.

Por lo tanto, ninguno de los tres “casos confirmados” definidos por el Ministro de Salud cumple con los requisitos del término de la OMS “persona enferma/infectada”. La OMS rechaza la única invocación de la prueba del ITP (caso confirmado 1).

Motivo de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Si viviéramos en una democracia, este juicio sería capaz de cambiarlo todo. Todas las medidas tendrían que ser revocadas inmediatamente, todo el gobierno federal tendría que renunciar y tendría que ser procesado legalmente por la destrucción sin sentido de innumerables medios de vida.

Una cita igualmente memorable, que muestra hasta qué punto la política, pero también los medios comprados han engañado al público en el último año:

En él, el Servicio de Salud de la Ciudad de Viena utiliza las palabras “números de caso”, “resultados de pruebas”, “incidencia de casos”, así como “número de infecciones”. Esta mezcla de términos no hace justicia a una evaluación científica de la situación epidémica. (…) Para la OMS, el factor decisivo es el número de infecciones/enfermedades y no el número de personas que dieron positivo u otros “números de casos”.

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Como base de la parte médica de las razones de la sentencia, el tribunal se basó en lo siguiente:

Aviso de información de la OMS para usuarios de IVD 2020/05, tecnoloqies de testinq (NAT) de ácido nucleico que utilizan reacción en cadena de polimerasa (PCR) para la detección de SARS-CoV-2, 20 de enero de 2021.

Estudio de 2020 (Bullard, J., Dust, K., Funk, D., Strong, J. E., Alexander, D., Garnett, L., & Poliquin, G. (2020). Predecir el coronavirus del síndrome respiratorio agudo grave infeccioso 2 a partir de muestras diagnósticas. Enfermedades Infecciosas Clínicas, 7j(10), 2663-2666.)

Dr. Cary Mullis (inventor de la prueba de PCR): “… que una prueba de PCR no es diagnóstica y, por lo tanto, por sí sola no revela nada sobre la enfermedad o infección de una persona.”

El tribunal afirma que un médico por sí solo tiene derecho a determinar si una persona está enferma o sana (2 párr. 2 Z 1 y 2 Ärztegesetz1998, BGBI. I. Nº 169/1998 modificado por BGBI. I No. 31/2021).

También se menciona la extrema tendencia a errores de las pruebas de antígeno, y se critica que la Comisión Corona se basaría exclusivamente en tales pruebas de antígeno para los análisis actuales. Esta pequeña información por sí sola es una bomba política.

Si la Comisión Corona hubiera utilizado la definición de caso del Ministro de Salud y no la de la OMS; cualquier determinación del número de “números enfermos/infectados para “enfermos/infectados” es errónea.

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, de 24 de marzo de 2021.

El veredicto aún puede ser apelado ante el Tribunal Constitucional o se puede presentar un recurso extraordinario ante el Tribunal Contencioso Administrativo.

Vienna Administrative Court: Corona Policy Without Basis, PCR Test Inappropriate | Europe Reloaded

La simplicidad de una cadena argumental. Covid-19

Hay comentarios de los internautas sobre artículos que merecen el artículo en sí. Este es a mi modo de parecer el de un tal “Willen”, que ilustro a continuación:

‘Carl Sagan sobre el tema del razonamiento científico dice (entre otras cosas) que

“Si hay una cadena argumental, cada eslabón de la cadena debe funcionar (incluida la premisa), no solo la mayoría de ellos”.

Considero que ese punto es muy útil. Así que a pesar de que no sé (exactamente) cómo funciona el PCR, qué son las vacunas contra el ARNm y lo que realmente hay en ella, no necesito saber todo esto (aunque si quiero, siempre puedo intentarlo, por supuesto). Sólo tengo que encontrar el eslabón más débil para saber si Covid es el virus asesino o no para el que tenemos que bloquear países, etc.

Y el eslabón más débil para Covid19 es la premisa. Es decir, si el promedio de morir con Covid (en Países Bajos) es de 82 años, mientras que la edad promedio de muerte (en Países Bajos) fue de 80 años en el 2019, usted sabe que no hay exceso de mortalidad por Covid y que el riesgo de morir desde la vejez es el mismo que el riesgo de morir con Covid.

Todo lo demás que se desprende de esto, incluidos los encierros, los tipos de pruebas, la vacunación y el miedo de la población, es claramente absurdo’.

What’s up with our fact-checking blind spots? – OffGuardian (

The simplicity of a story line. Covid-19

There are comments from Internet users about articles that deserve the article itself. This is in my opinion that of a certain “Willen”, which I put below:

‘Carl Sagan on the issue of scientific reasoning says (amongst others) that

‘If there’s a chain of argument, every link in the chain must work (including the premise)—not just most of them.’

I consider that point as very useful. So even though I do not know (exactly) how the pcr thingy works, what mRNA vaccines are and what is actually in it, I do not need to know all this (although if I want to, I can always try of course). I only have to find the weakest link in order to know if covid is the killer virus or not for which we have to lockdown countries, etc.

And the weakest link for covid19=the premise. That is, if the average of dying with covid (in NL) is 82 years, while the average age of death (in NL) was 80 years in 2019, you know that there is no excess mortality from covid and that the risk of dying from old age is the same as the risk of dying with covid.

All the rest that follows from this, including lockdowns, types of testing, vaccination, and the population being (made) frightened, is plainly absurd’.

Oponerse a la dictadura sanitaria perjudica gravemente la salud

Opposing the health dictatorship seriously harms health

Burundi y Tanzania compartieron la oposición de sus dirigentes ante las medidas de la OMS. El presidente de Burundi, Pierre Nkurunziza, expulsó a los sicarios de la OMS de su país, mientras que el presidente tanzano, John Magufuli, químico, hizo lo propio, tras demostrar al mundo que los test PCR con los que querían justificar la inexistente epidemia, ofrecían falsos positivos, tanto en muestras obtenidas en papayas, como en aceite de coche o en cabras. Twitter.

La osadía de estos presidentes les ha costado la vida, ambos han sufrido un desafortunado “infarto” como advertencia al resto sobre que va a suceder a cualquiera que no colabore con los psicópatas que controlan el mundo

Estamos ante dos mártires de la lucha contra la dictadura mundial, pero una historia escrita por estos asesinos, olvidará pronto y pervertirá la memoria sobre estos y todos los que se oponen a el N.O.M.

Por supuesto sus sucesores han tomado buena nota de lo que les espera si no colaboran y de lo rentable que puede resultar para ellos que lo hagan. No habrá que extrañarse, pues, de que de las ínfimas cifras de muertes atribuidas al coronavirus en dichos países (recordemos que los diez países más pobres de Africa han tenido, en conjunto, menos víctimas mortales del Covid que la Comunidad Autónoma de Madrid, por tener un referente) pasemos en breve a elevadas tasas de mortalidad que “obliguen” a las autoridades a abrir las puertas a las “salvadoras” compañías farmacéuticas.

A estas alturas debería entenderse que a pesar de ser un negocio millonario, no se trata solo de dinero. También que estamos solo al principio de algo mucho peor de lo que las mentes más retorcidas puedan sospechar.

(Fuente: Astillas de realidad)

El médico Sciuto desmonta versión oficial del coronavirus

Con el aplomo y la seguridad en sí mismo de quien se sabe portavoz de la verdad, el médico uruguayo Javier Sciuto, que en esta entrevista de 18 minutos aparece acompañado por los empresarios Fernando Vega y Fernando Ferreira, pone las cartas sobre la mesa y demuele la versión oficial de la Plandemia con la precisión de un cirujano:$/embed/ENTREVISTA-SciutoVegaFerreira/2b04e26db72d6694c7ddda79052dae2c53dc792c?r=3mqGPXDEfiAmZyZ1kW6B9b948ShEhX1G

Lo que dice este médico será en cuestión de tiempo aceptado como evidente, aunque ahora prevalezcan en los medios las mentiras de quienes mercadean con nuestra salud y nuestros derechos:

* “Si hacemos test serológicos a toda la población –que son los test que de verdad hay que hacer y no las PCRs-, en una semana se acaba la pandemia”.

* “Esto que estamos viviendo no es una pandemia causada por un virus, es una pandemia de falsos positivos por PCR”.

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.


Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

Tribunal Portugués: Pruebas PCR “poco fiables” y Cuarentenas “Ilegales”

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de “alto riesgo de infección” basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.


La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

“Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico”.

The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

“Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, “said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, “he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, “the doctor recalled”.

La hoja de ruta de Covid-19: Hacia el caos económico mundial y la destrucción social

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación del virus no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

Por el profesor Michel Chossudovsky Global Research, 13 de octubre de 2020

Ahora se confirma sin lugar a dudas que la prueba de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizada para estimar casos positivos COVID-19 no tiene sentido. No puede detectar ni identificar el virus. Lo que detecta son partículas o fragmentos de numerosos virus, incluyendo el resfriado común (corona beta) y la gripe estacional (virus A y B)

PCR- Positivo no implica Covid-19 Positivo. Las estadísticas derivadas de la prueba de ITP no miden los “casos confirmados”. La prueba del ITP no proporciona las estadísticas requeridas (por los responsables de la formulación de políticas y las autoridades sanitarias nacionales) para evaluar el número de personas infectadas.

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación de la infección viral no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

La prueba de PCR es la pistola humeante. ¿por qué?

Debido a que la prueba de PCR es defectuosa e inválida como medio para identificar la propagación del virus, lo que significa que TODAS LAS DECISIONES PRINCIPALES tomadas por la OMS y los gobiernos nacionales desde finales de enero de 2020 (apoyadas por estadísticas defectuosas) no son válidas. Además, los informes oficiales, incluida la OMS, confirman que Covid-19 no es un virus asesino, tiene características similares a la gripe estacional.

El propósito de este artículo es examinar cómo estas decisiones de gran alcance, invariablemente basadas en mentiras y estadísticas erróneas, han contribuido a un estado de caos económico, social y político en todo el mundo, lo que ha llevado al cierre y cierre de 190 economías nacionales de los Estados miembros de las Naciones Unidas. Sólo tres países, entre ellos Bielorrusia, Nicaragua y Suecia, se negaron a cerrar su economía nacional.

El cierre de las economías nacionales se presentó como un medio para hacer frente al “Virus Asesino” y “Salvar Vidas”. Está muy documentado, sus impactos han llevado al desempleo masivo y a la pobreza en todo el mundo.

Anexo al presente artículo: Detalles relativos a la prueba RT-PCR

Para obtener más detalles sobre la prueba PCR, haga clic aquí

La hoja de ruta hacia el caos económico y la destrucción social

18 de octubre de 2019. 201 Ejercicio de simulación pandémica

El coronavirus fue nombrado inicialmente 2019-nCoV por la OMS, el mismo nombre que el adoptado en el ejercicio de simulación del 18 de octubre de 2019 201 bajo los auspicios de la Escuela de Salud John Hopkins Bloomberg, Centro para la Seguridad de la Salud (un evento patrocinado por la Fundación Gates y el Foro Económico Mundial). (Evento 201)

7 de enero de 2020: Las autoridades chinas “identificaron un nuevo tipo de virus” que (según los informes oficiales) fue aislado el 7 de enero de 2020.

20-24 de enero: Reuniones del Foro Económico Mundial en Davos. El papel de los poderosos intereses financieros

Los intereses financieros dominantes, las fundaciones multimillonarias y las instituciones financieras internacionales desempeñaron un papel clave en la puesta en marcha de la Emergencia de Salud Pública de la OMS (PHEIC). La decisión no fue tomada por la OMS.

En la semana anterior a esta histórica decisión de la OMS. El PHEIC fue objeto de “consultas” en el Foro Económico Mundial (WEF), Davos (21-24 de enero). El Director General de la OMS, Dr. Tedros, estuvo presente en Davos. Estas consultas fueron fundamentales para influir en la decisión histórica de la OMS del 30 de enero.

¿Hubo un conflicto de intereses definido por la OMS? El mayor donante de la OMS es la Fundación Bill y Melinda Gates, que junto con el WEF y el CEPI ya había anunciado en Davos el desarrollo de una vacuna Covid-19 antes del histórico 30 de enero de la PHEIC.

28 de enero de 2020: El Centro para el Control y la Prevención de Enfermedades (CDC) de los Estados Unidos confirmó que el virus de la novela corona había sido aislado. Hasta la fecha, el proceso de identificación del virus no se ha hecho público.

30 de enero de 2020: La Emergencia de Salud Pública de Preocupación Internacional (PHEIC) de la OMS

La primera etapa de esta crisis fue lanzada por la OMS el 30 de enero. Aunque oficialmente no fue designada como una “Pandemia”, sin embargo contribuyó a encabezar la campaña del miedo.

Desde el principio, las estimaciones de “casos positivos confirmados” han sido parte de un “Juego de Números”.

En algunos casos las estadísticas simplemente no se mencionaban y en otros casos los números se inflaban con el fin de crear pánico.

El número de “casos confirmados” basado en estimaciones erróneas (PCR) utilizadas para justificar esta decisión de alcance lejano fue ridículamente bajo.

La población mundial fuera de China es del orden de 6.400 millones. El 30 de enero de 2020 fuera de China había:

83 casos en 18 países, y sólo 7 de ellos no tenían antecedentes de viajes en China. (véase OMS,30 de enero de 2020).

El 29 de enero de 2020, el día anterior al lanzamiento del PHEI(registrado por la OMS), hubo 5 casos en los Estados Unidos, 3 en Canadá, 4 en Francia, 4 en Alemania.

No había una “base científica” que justificara el lanzamiento de una emergencia mundial de salud pública.

Captura de pantalla de la tabla de la OMS, 29 de enero de 2200,

un día antes de la decisión de la OMS de declarar una emergencia mundial de salud pública

Esos números ridículamente bajos (no mencionados por los medios de comunicación) se utilizaron para encabezar una campaña de miedo en todo el mundo.

31 de enero de 2020: Decisión del presidente Trump de suspender los viajes aéreos con China

Mientras que la OMS “no recomendó restricciones a los viajes o al comercio”, los cinco llamados “casos confirmados” en los Estados Unidos fueron suficientes para “justificar” la decisión del presidente Trump el 31 de enero de suspender los viajes aéreos a China mientras precipitaba una campaña de odio contra los chinos étnicos en todo el mundo occidental.

Esta histórica decisión del 31 de enero allanó el camino hacia la interrupción del comercio internacional de productos básicos, así como las restricciones mundiales a los viajes aéreos.

Y esos “casos confirmados” defectuosos fueron en su mayor parte utilizando la prueba RT-PCR estándar.

20-21 de febrero de 2020. Datos de Covid en todo el mundo fuera de China: el crucero Diamond Princess

Si bien China informó de un total de 75.567 casos de COVID-19, (20 de febrero) los casos confirmados fuera de China eran abismáticamente bajos y las estadísticas basadas en gran parte en la prueba de ITP utilizada para confirmar la “propagación mundial del virus” eran cuestionables, por decir lo menos. Además, de los 75.567 casos en China, un gran porcentaje se había recuperado. Y las cifras de recuperación no fueron reconocidas por los medios de comunicación.

El día de la histórica conferencia de prensa del Dr. Tedros (20 de febrero de 2020) el número registrado de casos confirmados fuera de China fue de 1073 de los cuales 621 eran pasajeros y tripulantes en el Diamond Princess Cruise Ship (atrapado en aguas territoriales japonesas).

Desde un punto de vista estadístico, la decisión de la OMS que señalaba una posible “difusión del virus en todo el mundo” no tenía sentido.

El 20 de febrero, el 57,9% de los “casos confirmados” de Covid-19 en todo el mundo eran de la Diamond Princess, apenas representativa de una “tendencia estadística” mundial. La historia oficial es la siguiente:

  • Un pasajero con sede en Hong Kong que había desembarcado de la Princesa Diamante en Hong Kong el 25 de enero desarrolló neumonía y fue positivo para la novela coronavirus el 30 de enero.
  • Se informó que había viajado el 10 de enero a Shenzhen en China continental (que limita con los nuevos territorios de Hong Kong).
  • La Princesa Diamante llegó a Yokohama el 3 de febrero. Se impuso una cuarentena al estudio de la serie de cruceros Ver NCBI.
  • Muchos pasajeros se enfermaron debido al confinamiento en el barco.
  • Todos los pasajeros y la tripulación de la Princesa Diamante emprendieron la prueba de PCR.
  • El número de casos confirmados aumentó a 691 el 23 de febrero.

Desde el punto de vista de la evaluación de las tendencias estadísticas mundiales, los datos no se levantan. Sin los datos de Diamond Princess, los llamados casos confirmados en todo el mundo fuera de China el 2o de febrero habrían sido del orden de 452, de una población de 6.400 millones de habitantes.

Examine el gráfico de la OMS a continuación. El azul indica los casos confirmados sobre la Diamond Princess (transporte internacional) (que llegó a Yokohama el 3 de febrero de 2020), muchos de los cuales estuvieron enfermos, confinados en sus habitaciones durante más de dos semanas (cuarentena impuesta por Japón). Todos los pasajeros y la tripulación realizaron la prueba RT-PCR (que no detecta ni identifica Covid-19).

No hace falta decir que estos supuestos datos fueron fundamentales para encabezar la campaña del miedo y el colapso de los mercados financieros en el transcurso del mes de febrero. (ver sección a continuación)

Fuente OMS, 28 de febrero de 2020

La crisis financiera de febrero de 2020. El choque corona 2020

Del 20 al 21 de febrero de 2020 se cumple el inicio del colapso financiero de 2020.

20 de febrero de 2020: En una conferencia de prensa celebrada el jueves 20 de febrero por la tarde (hora del AEC) en una reunión informativa en Ginebra, el Director General de la OMS. El Dr. Tedros Adhanom Ghebreyesus, dijo que era

“preocupado de que la posibilidad de contener el brote de coronavirus se “cerrara” …

“Creo que la ventana de oportunidad sigue ahí, pero que la ventana se está estrechando.”

Estas declaraciones de “shock and awe” contribuyeron a aumentar la campaña del miedo, a pesar del hecho de que el número de casos confirmados fuera de China era extremadamente bajo.

Oficialmente 1073 casos en todo el mundo.

Excluyendo a la Diamond Princess, 452 los llamados “casos confirmados” en todo el mundo fuera de China, para una población de 6.400 millones registradas por la OMS el 20 de febrero, 15 en los Estados Unidos, 8 en Canadá, 9 en el Reino Unido.

Se registraron un mayor número de casos fuera de China en Corea del Sur (153 casos según la OMS) e Italia (registrados por las autoridades nacionales).

Datos de la OMS registrados en febrero de 2020 al comienzo del llamado Covid Financial Crash (derecha)

La declaración del Dr. Tedros (basada en conceptos y estadísticas defectuosos) puso las bases para el colapso financiero de febrero provocado por información privilegiada, conocimiento previo, comercio de derivados, ventas en corto y una gran parte de las operaciones de los fondos de cobertura.

Quien tuviera conocimiento previo (información privilegiada) de la declaración del Director General de la OMS del 20 de febrero habría cosechado importantes beneficios monetarios.

¿Hubo un conflicto de intereses? La OMS recibe fondos de la Fundación Gates. Y Bill Gates tiene “60% de sus activos invertidos en acciones [incluyendo acciones y fondos de índices]”, según un informe de la CNBC de septiembre de 2019.

El desplome bursátil iniciado el 20 de febrero, conocido como el Accidente coronavirus 2020,fue categorizado como:

“la caída más rápida en los mercados bursátiles globales en la historia financiera, y el desplome más devastador desde el accidente de Wall Street de 1929.”

La causa de la crisis financiera fue (según los analistas), V. El Virus. La propagación del virus fuera de China.

La campaña de miedo del “virus asesino” junto con las oportunas “advertencias” del Dr. Tedros sobre la necesidad de implementar una pandemia mundial sirvieron indeleblemente a los intereses de los especuladores institucionales y fondos de cobertura de Wall Street. El desplome financiero condujo a un cambio importante en la distribución de la riqueza del dinero. (ver análisis a continuación)

En la semana siguiente al anuncio de la OMS del 20 al 21 de febrero,el Dow Jones se derrumbó un 12% (CNBC, 28 de febrero de 2020). Según los analistas, la caída de la DJIA fue el resultado de la propagación mundial del virus. Una declaración sin sentido en contradicción con el (pequeño) número de estimaciones positivas de la OMS Covid, la mayoría de las cuales se basaron en la prueba de PCR defectuosa.El lunes 24 de febrero, tras la reapertura de los mercados bursátiles, hubo una caída sin precedentes en el Dow Jones atribuible a los “peligros inminentes” que“Covid estaba extendiendo en todo el mundo creando incertidumbres en los mercados financieros”..Las existencias cayeron bruscamente el lunes (24 de febrero) a medida que aumentaba el número de casos de coronavirus fuera de China,lo que avivó los temores de una prolongada desaceleración económica mundial debido a la propagación del virus. El promedio industrial Dow Jones cerró 1.031,61 puntos menos, o un 3,56%, en 27.960,80.” (CNBC) (sin cursivas en el apartado de inglés)

Promedio industrial Dow Jones Diciembre 2019 – Marzo 2020

También el 24 de febrero, Trump solicitó una ayuda de emergencia de 1.250 millones de dólares.

Según la BBC, los mercados bursátiles mundiales vieron fuertes caídas “debido a las preocupaciones sobre el impacto económico del virus”, lo que sugiere que el virus era “la “mano” invisible responsable de la disminución de los mercados financieros.

COVID-19 fue identificado por poco como el catalizador de la crisis financiera.

¿Quién estaba detrás de este catalizador? ¿Quién estuvo detrás de la campaña de miedo que contribuyó a desencadenar el caos y la incertidumbre en los mercados financieros?

11 de marzo de 2020: La pandemia Covid-19, encierro, cierre de 190 economías nacionales

El Director General de la OMS había puesto las bases en su Conferencia de Prensa del 21 de febrero. “el mundo debería hacer más para prepararse para una posible pandemia de coronavirus”. La OMS ha pedido a los países que estén “en una fase de preparación”.

El 11 de marzo de 2020: la OMS declaró oficialmente una pandemia mundial en un momento en que había 18.000 casos confirmados y 4291 muertes de una población mundial total fuera de China del orden de 6.400 millones de personas. ¿Qué te dicen estas “estadísticas”?

Inmediatamente después del anuncio del 11 de marzo de la OMS, la campaña del miedo se puso en marcha. Al igual que en el caso del accidente del 20 al 21 de febrero, la declaración del 11 de marzo del Director General de la OMS había puesto las bases. Los mercados bursátiles se desplomaron en todo el mundo. A la mañana siguiente, el Dow (DJIA) se desplomó un 9,99% (una disminución de 2.352,60 para cerrar en 21.200,62). El Jueves Negro, 12 de marzo de 2020, fue “el peor día del Dow” desde 1987. Se había producido una transferencia masiva de la salud de la riqueza financiera en favor de los multimillonarios estadounidenses.

Las instrucciones de confinamiento se transmitieron a 193 Estados miembros de las Naciones Unidas.Los políticos son los instrumentos de poderosos intereses financieros. ¿Se justificó esta decisión de gran alcance como un medio para combatir el Virus?

Sin precedentes en la historia, aplicada casi simultáneamente en un gran número de países, sectores enteros de la economía mundial fueron desestabilizados. Las pequeñas y medianas empresas fueron conducidas a la bancarrota. El desempleo y la pobreza son desenfrenados.

En algunos países han estallado las hambrunas. Los impactos sociales de estas medidas son devastadores. Los impactos en la salud (mortalidad, morbilidad) de estas medidas, incluida la desestabilización del sistema de atención sanitaria nacional (en numerosos países) superan con creces los atribuidos a Covid-19. (Para más detalles ver artículo del autor aquí,

Enriquecimiento multimillonario. La apropiación y redistribución de la riqueza

La riqueza multimillonaria ha aumentado drásticamente desde principios de febrero. Hay tres fases distintas, que están directamente relacionadas con la crisis de la corona, cada una de las cuales está marcada por cambios importantes en la distribución de la riqueza global.

  1. La crisis financiera iniciada el 20 de febrero propiciaba una redistribución dramática de la riqueza monetaria y la propiedad de los activos financieros. El conocimiento previo, la información privilegiada y el comercio especulativo desempeñaron un papel clave. ¿Hubo conocimiento previo de la declaración del Dr. Tedros de la OMS del 20 de febrero?
  2. El cierre y cierre del 11 de marzo de las economías nacionales de 190 Estados miembros de la ONU, que desencadenaron las quiebras tanto de las pymes como de las pymes en todo el mundo. El evento del 11 de marzo también estuvo marcado por la caída de los mercados bursátiles en todo el mundo, comenzando el jueves negro 12 de marzo de 2020.
  3. La tercera etapa del enriquecimiento multimillonario se refiere a la aplicación de la llamada “Segunda Ola”, que consiste en desencadenar una nueva ola de quiebras.

La redistribución de la riqueza en favor de la clase multimillonaria se confirma mediante un estudio de IPS relativo al cierre de la economía mundial.

La riqueza combinada de los multimillonarios estadounidenses aumentó en 850.000 millones de dólares desde el 18 de marzo de 2020,lo que supone un aumento de más del 28 por ciento. (Esta estimación no tiene en cuenta el aumento de la riqueza durante el período anterior al 18 de marzo, que estuvo marcado por una serie de desplomes bursátiles).

El 18 de marzo de 2020, los multimillonarios estadounidenses habían combinado una riqueza de 2.947 billones de dólares. Para el 8 de octubre, su riqueza ha aumentado a 3,8 billones de dólares (3.798 millones de dólares para ser exactos).

A nivel mundial, los multimillonarios son grandes ganadores durante la pandemia de Covid-19. Según un reciente informe de UBS, los aproximadamente 2.189 multimillonarios mundiales tienen actualmente 10,2 billones de dólares. Se trata de un aumento estimado de 1,5 billones de dólares durante la pandemia que examinan los datos multimillonarios de UBS y Forbes de 2019.

La siguiente tabla identifica el aumento de la riqueza personal de los cinco multimillonarios estadounidenses más ricos (del 18 de marzo al 17 de junio de 2020). (No esbozada en el cuadro, la riqueza de los multimillonarios estadounidenses aumentó en otros 266.000 millones de dólares de junio a octubre de 2020).

Reflexionemos ahora brevemente sobre la Segunda Ola que ahora se impone a millones de personas.

La segunda ola

Septiembre-Octubre 2020. El establecimiento financiero ha dado instrucciones a los gobiernos para que apliquen lo que equivale a un segundo programa de bancarrota utilizando el pretexto y la justificación de que el número de casos positivos de Covid ha aumentado.

Con toda probabilidad, esta segunda oleada conducirá a un nuevo proceso de apropiación y concentración de la riqueza.

Al mismo tiempo, hay una tendencia hacia las formas totalitarias de gobierno.

Todas las formas de actividad social se ven afectadas incluyendo reuniones familiares, bodas y funerales, reuniones públicas, por no hablar del cierre de escuelas, universidades, museos, eventos deportivos y culturales. Ahora se están aplicando medidas del estado policial para hacer cumplir el cumplimiento. ¡Y la gente acepta!

Al comienzo de la Segunda Ola, el proceso de posponer la reapertura de la economía mundial contribuirá indeleblemente a acabar con las pequeñas y medianas empresas (regionales y locales) de todo el mundo, al tiempo que precipitará la quiebra de sectores enteros de la economía mundial, incluidas las aerolíneas, las cadenas hoteleras y la industria turística. Esto, a su vez, conducirá a la apropiación de activos reales por parte de poderosos intereses financieros.

La campaña del miedo ha vuelto a estar en marcha.

Las estadísticas oficiales basadas en estimaciones erróneas y manipuladas de los llamados casos positivos “confirmados” de Covid constituyen la base para justificar estas medidas diabólicas.

V el virus se presenta como la amenaza. Pero el virus no tiene un impacto directo en las variables económicas clave.

Lo que está en juego no tiene precedentes: es una agenda neoliberal global llevada a cabo por gobiernos corruptos en nombre del establishment financiero.

El sentido común nos dice que el cierre de la economía global destruye la vida de las personas.

Interrumpir la campaña del miedo constituye el primer paso hacia la reversión de la marea

Para más detalles sobre los impactos económicos. Artículo relacionado

Combatir el virus: El desempleo masivo no es la solución

Por el Prof. Michel Chossudovsky, 05 de octubre de 2020

Michel Chossudovsky, Profesor de Economía


La prueba de reacción en cadena de la transcripción inversa-polimerasa (RT-PCR)

La prueba estándar utilizada para detectar / identificar SARS-2 en todo el mundo es la prueba de reacción en cadena de transcripción inversa-polimerasa(RT-PCR) que se utiliza para estimar y tabular el número de casos covid-19 positivos confirmados. (Esta no es la única prueba utilizada. Las observaciones a continuación se refieren únicamente al ITP estándar).

Según el Premio Nobel, la Dra. Kary Mullis, que inventó la prueba de PCR:

“PCR detecta un segmento muy pequeño del ácido nucleico que forma parte de un virus en sí. El fragmento específico detectado está determinado por la elección un tanto arbitraria de las imprimaciones de ADN utilizadas que se convierten en los extremos del fragmento amplificado.”

La prueba de PCR nunca tuvo la intención de identificar el virus.

La prueba pcR estándar aplicada en relación con Covid-19 no detecta ni identifica el virus. Lo que detecta son fragmentos de varios virus, según el reconocido inmunólogo suizo Dr. B. Stadler. Según el Dr. Pascal Sacré, “estas pruebas detectan partículas virales, secuencias genéticas, no todo el virus”

“Fragmentos de virus positivos” no significa“SARS-2 positivo” (o Covid-19 Positivo). La prueba de PCR puede recoger fragmentos de virus de la gripe (A, B) así como coronavirus beta fríos comunes (por ejemplo, OC43, HKU1). Lo que han hecho los gobiernos es dar al ITP positivo una sola etiqueta, a saber, Covid-19, cuando en realidad la prueba positiva de ITP podría ser el resultado de otros virus, incluidos los relacionados con la gripe o el resfriado común coronavirus, que (según los CDC) tienen síntomas similares a Covid-19.

Una vez establecida y aceptada la etiqueta Covid-19 Positive, está sujeta a numerosas formas de manipulación, por no hablar de la falsificación de certificados de defunción.

Qué es Covid-19, SARS-2. ¿Cómo se prueba? ¿Cómo se mide? La campaña del miedo no tiene base científica

Por el Prof. Michel Chossudovsky, 08 de octubre de 2020La fuente original de este artículo es Global ResearchDerechos de autor © Prof. Michel Chossudovsky, Global Research, 2020

Interpretación Errónea del Virus Parte II: Principio y Fin de la Crisis del Coronavirus

Por Dr. Stefan Lanka

Artículo original publicado en la revista: Wissenschafftplus
Enlace al artículo original: Fuente de la traducción al español: desconocido.

La definición del SARS y del coronavirus o covid-19 significa que se considera que la neumonía atípica es el cuadro clínico que caracteriza a la enfermedad. Si se pueden detectar patógenos conocidos en la neumonía, ésta se considera típica, si no atípica. Uno de los dos hechos decisivos para el SARS y la crisis del coronavirus es que al menos el 20- 30% de todas las neumonías son atípicas. Las causas de la neumonía atípica son claramente conocidas y por lo tanto NO deben presentarse como la causa de un virus desconocido.

Este hecho es suprimido por los infectólogos y virólogos y es la base del miedo y el pánico actuales, porque se crea la impresión entre los afectados, el público y los políticos, de que la neumonía atípica sería especialmente peligrosa y a menudo mortal porque todavía no hay medicamentos ni vacunas para la supuesta nueva enfermedad.

Desde el momento en que se ofrece un procedimiento de prueba para el supuesto nuevo virus, que, oculto por los implicados, también prueba “positivamente” a personas sanas, el número de casos aumenta automáticamente. Inicialmente, las personas con neumonía típica también serán examinadas, luego más y más personas con otras enfermedades.

Esto se considera una prueba práctica de la propagación del virus. Automáticamente, más y más de otras enfermedades se añaden a la enfermedad original “neumonía atípica” y este “síndrome” se muestra como “la nueva enfermedad viral”.

El otro hecho decisivo, no sólo para el SARS y la crisis del coronavirus, es que los virólogos que afirman que los virus causan enfermedades, están suprimiendo una situación obvia abiertamente mentirosa por razones comprensibles.

El método de prueba de virus que se ofrece es un método de detección genética. No aíslan de un virus las secuencias de genes que utilizan para la prueba de detección. Aíslan secuencias genéticas que se liberan típicamente en mayores cantidades cuando los tejidos y las células mueren. Estas secuencias genéticas, generalmente cortas, y componentes del metabolismo humano, constituyen la base para el trabajo de laboratorio posterior.

Sin embargo, con la ayuda de programas informáticos, los virólogos sólo pueden construir mentalmente largas cadenas de material genético a partir de muchas secuencias cortas de genes. Estas son entonces producidas como verdaderas cadenas de ADN viral. Esta es la razón por la que los resultados positivos de las pruebas se obtienen repetidamente incluso en individuos sanos probados.

Para evitar refutarse a sí mismos, estos virólogos ignoran constantemente dos reglas prescritas por la ciencia. Uno es verificar sistemáticamente todas las afirmaciones por sí mismas. La otra es probar todos los supuestos y métodos utilizados mediante experimentos de control.

Si realizaran los experimentos de control, descubrirían que TODAS las secuencias genéticas cortas, que sólo unen mentalmente, para formar una cadena genética viral se originan en el metabolismo humano y no en el exterior, de un supuesto virus.

El impulso de la crisis del coronavirus fue desencadenado por un mensaje de un joven oftalmólogo el 30/12/2019 en Internet, que se difundió de forma inmediata y muy rápidamente. Éste dijo a sus amigos que varias personas estaban en cuarentena en su hospital, que se confirmaron siete casos de SARS, que se cuidaran y protegieran.

El profesor Christian Drosten, de la Charité de Berlín, se enteró de ello e inmediatamente comenzó a elaborar procedimientos de prueba para los virus del SARS antes de que estuviera claro y pudiera determinarse si el informe de China sobre el SARS era verdadero y estaba probado, y especialmente antes de que los virólogos chinos publicaran sus resultados.

Los virólogos autorizados de la Comisión de Control de Enfermedades de China (CCDC) publicaron sus resultados el 24 de enero de 2020 y el 3 de febrero de 2020.

Informan sobre el aislamiento de muchas secuencias genéticas cortas, que, cuando se ensamblan, podrían representar una cadena genética de un nuevo tipo de virus. Los autores señalan expresamente -y todos los demás virólogos implicados hasta la fecha- que aún no se han realizado los experimentos absolutamente necesarios que permitan afirmar que se trata efectivamente de una cadena genética de un virus causante de enfermedades.

Por el contrario: los virólogos chinos incluso señalan explícitamente que la cadena genética construida tiene hasta un 90% de similitud con las cadenas genéticas de los inofensivos y por decenios de antigüedad, reivindicados corona virus en los murciélagos.

El 21/01/2020 (¡3 días antes de la primera publicación de la CCDC!) la OMS recomendó a todas las naciones usar el procedimiento de prueba desarrollado por el Prof. Drosten. Al afirmar que había desarrollado un procedimiento de prueba fiable para el virus, que se estaba extendiendo rápidamente en China, el profesor Drosten, haciendo caso omiso de las normas claramente definidas de la labor científica, que forman parte de su contrato de trabajo, y violando las leyes del pensamiento y la lógica de la virología, ha desencadenado y causado el aumento y la globalización del pánico epidémico chino.

1. El comienzo de la crisis del Coronavirus

Cuando el joven oftalmólogo Li Wenliang informó a siete médicos de Wuhan a través de WhatsApp el 30/12/2019 de que varias personas estaban en cuarentena en su hospital, que se habían confirmado siete casos de SARS, y que debían tener cuidado y protegerse, no tenía la intención de causar pánico.

Si lo hubiera hecho, habría publicado el anuncio en Internet y advertido al público. Uno de los siete destinatarios de este mensaje privado de WhatsApp publicó una “captura de pantalla”, es decir, una foto del mensaje, en Internet sin ser consciente de las posibles consecuencias. Por supuesto, esta información se difundió muy rápidamente dentro de China y luego en todo el mundo.

Este mensaje desencadenó una ola de temor, pánico e indagaciones a las autoridades sanitarias chinas y al gobierno debido al pánico causado por una crisis de SARS en 2003, que la Organización Mundial de la Salud (OMS) clasificó como “amenaza mundial” el 12 de marzo de 2003.

En consecuencia, el Gobierno de Beijing envió una “fuerza de reacción rápida” integrada por epidemiólogos y virólogos del Centro de Control de Enfermedades de China a Wuhan el 31 de diciembre de 2019 para apoyar a las autoridades sanitarias locales y a la provincia circundante de Hubei. El objetivo era comprobar y verificar las afirmaciones de un brote de una epidemia. Si efectivamente se hubiera producido un brote, la situación debería controlarse adecuadamente.

En la primera publicación autorizada de los autores del CCDC sobre los resultados de su investigación, “A New Coronavirus from Patients with Pneumonia in China, 2019”, no se informa de una acumulación de pacientes con neumonía de causa desconocida.

Informan que los pacientes encontrados pueden ser agrupados en un “grupo” con características comunes. La característica común era la visita más o menos frecuente de un mercado mayorista de mariscos en Wuhan. Lo pequeño que era el grupo de pacientes con neumonía atípica puede verse por el hecho de que el CCDC tomó frotis y líquidos del tracto respiratorio inferior de sólo cuatro pacientes, para buscar patógenos conocidos y desconocidos.

Mientras tanto, el pánico en Wuhan y sus alrededores aumentó extremadamente. Ni siquiera las medidas adoptadas por la policía, que el 3 de enero de 2020 pidió al oftalmólogo Li Wenliang que se comprometiera por escrito firmando una declaración punible de cese y desistimiento para no difundir nada más sobre un posible brote de SARS, pudieron frenar la dinámica de pánico que se había desarrollado y que empeoraba peligrosamente.

El 10/01/2020 Wenliang, y poco después también sus padres, desarrollaron los síntomas de la neumonía. Li Wenliang se aisló porque estaba convencido de que había sido infectado con el virus del SARS el día anterior por un paciente ocular. Esto también aumentó el pánico.

Los doctores que lo atendieron realizaron un gran número de pruebas diferentes, todas las cuales resultaron negativas. A medida que su estado de salud se deterioraba y cada vez más personas mostraban la simpatía del público por su destino, las pruebas se continuaron hasta que una primera prueba de SARS, el 30/01/2020, se consideró “positiva”. El desastre del creciente pánico del SARS, que mutó en la crisis mundial del coronavirus, siguió su curso.

Li Wenliang difundió este resultado en Internet con las siguientes palabras: “Hoy las pruebas de ácido nucleico han dado un resultado positivo, el polvo se ha asentado, finalmente diagnosticado”.

Este anuncio aumentó el pánico ya existente. Todo se descontroló por completo cuando publicó su declaración firmada de cese y desistimiento del 03/01/2020 en Internet. Esta publicación de su declaración de cesación, que era peligrosa para él, fue y sigue siendo considerada por todas las personas presas del pánico, como prueba de que hay una nueva epidemia de SARS, porque un médico, que a su vez está afectado, sigue informando y advirtiendo al público a pesar de la amenaza de sanciones.

El pánico aumentó aún más porque la salud de Li Wenliang se deterioró a pesar del uso intensivo de una variedad de sustancias antibióticas y el público participó regularmente de esto. La situación estaba al borde de la escalada porque el informe de su muerte fue más que caótico y contradictorio.

Esta fue y sigue siendo la razón central por la que el público chino y mundial asumió que se había producido otro brote de SARS en Wuhan, pero que se había redefinido como una nueva epidemia, una pandemia con un nuevo nombre, Covid-19.

2. Una, de dos posibles causas del miedo de Li Wenliang

El temor del oftalmólogo Li Wenliang se basa en los acontecimientos de 2003 en China, cuando los científicos occidentales afirmaron que se había producido una acumulación de neumonía atípica en el sur de China. Dos días después de la creación mental de una cadena genética del supuesto nuevo virus (SARS-CoV-1), en la que el Prof. Drosten estuvo significativamente involucrado, el Prof. Drosten ofreció un supuesto procedimiento de prueba para este supuesto virus.

Aproximadamente 800 personas con neumonía atípica, es decir, neumonía en la que no se detectan patógenos conocidos, pero que resultó “positiva” con la prueba del Prof. Drosten, murieron, por lo tanto -posiblemente de forma incorrecta y sobre tratada- con el diagnóstico de SARS en lugar de “neumonía atípica”.

La base de que el temor al SARS se mantuviese y aumentara hasta 2019, son dos publicaciones de 2013 y 2017 que dieron lugar a especulaciones sobre la posibilidad de que aparecieran nuevos coronavirus del SARS. Los autores de ambas publicaciones afirman que los murciélagos sanos proporcionan pruebas de la existencia de secuencias genéticas cortas que pueden ser interpretadas como componentes de un virus.

Estas secuencias genéticas cortas tendrían similitudes con las secuencias genéticas cortas que se declararon componentes del supuesto coronavirus del SRAS-1 (SARS-CoV-1) en 2003.

SARS significa Síndrome Respiratorio Agudo Severo, que es otra descripción de los síntomas de la neumonía atípica.

Se dice que estas hebras genéticas mentales (ficticias, transformadas en realidad) son capaces de desarrollarse en la realidad y formar un virus real. Este virus, que se afirma está en murciélagos y otros animales salvajes pero que sigue siendo inofensivo, podría saltar a los humanos a través de la mordedura, el contacto o el consumo y convertirse en un asesino mortal.

En los seres humanos, este inofensivo virus podría, a través de cambios (mutaciones), convertirse en un coronavirus del SARS que es realmente nuevo y podría causar una enfermedad. Tal acontecimiento y la consiguiente oleada de enfermedades, como la neumonía atípica, deben esperarse en cualquier momento.

Hasta la fecha, los virólogos no han podido aislar un virus del SARS de un paciente, un murciélago, otro animal o en el laboratorio, ni han podido detectar una cadena genética intacta y completa de un virus del SARS. Hasta la fecha no se ha podido confirmar la suposición de los virólogos de que existen de hecho cadenas genéticas virales que están construidas de la misma manera que las cadenas genéticas compuestas de secuencias genéticas cortas.

Hay otras formas en que aún no se ha demostrado la existencia y la presencia de una cadena genética completa de un virus del SARS, aunque desde hace mucho tiempo se dispone de técnicas estándar muy sencillas para determinar la longitud de las secuencias genéticas.

Los temores alimentados masivamente por tales afirmaciones falsas fueron la base de los temores del oftalmólogo Li Wenliang, así como de otros médicos e infectólogos no sólo en Wuhan.

Estas alegaciones son la razón por la que los epidemiólogos y virólogos de la CCDC, a partir del 31 de diciembre de 2019, se centraron en encontrar secuencias de genes similares que se definieron como componentes del coronavirus del SARS en 2003 (véanse las explicaciones que figuran a continuación).

3. La segunda de las posibles causas de miedo de Li Wenliang

Las crisis del SARS y del Coronavirus comenzaron con la afirmación en los medios de comunicación de que hay una acumulación de pacientes con neumonía atípica. Esta alegación nunca fue corroborada. Sólo se afirmó que la neumonía atípica que se produjo podía explicarse por la suposición de la aparición de un nuevo virus, porque algunas de las personas con neumonía atípica tenían contacto con los mercados de animales.

Para poder confirmar la suposición de que un virus desconocido podría ser la causa de la neumonía atípica, se suprimieron los hechos conocidos descritos en la literatura médica y científica. De hecho, hay varios y amplios espectros de causas no infecciosas de neumonía atípica. Por varias razones, esta neumonía atípica tiene más probabilidades de ser mortal que la típica.

Las causas son, entre otras, la inhalación de vapores, disolventes y sustancias tóxicas. La entrada de alimentos, bebidas o contenidos estomacales en los pulmones en caso de dificultades para tragar o de la pérdida del conocimiento también puede causar una neumonía extremadamente grave (neumonía por aspiración).

El agua por sí sola es suficiente, si entra en los pulmones de las personas que se están ahogando, para causar una neumonía atípica grave. Otra causa es el reconocido espectro de disfunciones inmunológicas, como las alergias y las reacciones auto-inmunes. También se sabe que la radiación desencadena una inflamación de los pulmones en el cáncer, que no puede distinguirse de la típica neumonía.

La neumonía congestiva es particularmente conocida en las personas mayores. Éstas se desarrollan debido a la retención de agua (edema), a la permanencia prolongada en cama, a la debilidad del corazón y/o de los riñones, que puede conducir a una ventilación y circulación sanguínea inadecuadas en los pulmones, y como consecuencia directa de la inflamación de los pulmones, es decir, de la neumonía atípica.

Lógicamente, una combinación de causas subyacentes también causa neumonía atípica. Una neumonía atípica puede convertirse rápidamente en una neumonía típica si se produce una colonización secundaria del pulmón inflamado. Esta es la razón por la que el porcentaje de neumonía atípica es probablemente más alto que el 20-30% estimado.

En los estudios de las cinco personas documentadas en las dos publicaciones pertinentes a la crisis del coronavirus, no se investigaron la posible presencia o la historia, los signos, los mecanismos y los efectos de estas causas conocidas de la neumonía atípica. Los virólogos no suelen hacerlo de todos modos, y los miembros de la CCDC no pudieron hacerlo ni siquiera en las circunstancias de pánico.

Excluir la mención de la neumonía atípica demuestra una grave negligencia médica e impide el tratamiento correcto de los pacientes. Por consiguiente, los afectados corren el riesgo de que se les manipule mal con un cóctel de sustancias antibióticas ricas en efectos secundarios, que es capaz de causar de forma independiente la muerte de los pacientes, especialmente en caso de sobredosis. El pánico puede ser incluso fatal en muy poco tiempo, no sólo en el caso de problemas cardiovasculares.

La respuesta a la pregunta crucial de si se ha detectado realmente un nuevo virus o si sólo se emiten piezas cortas y endógenas de material genético como componentes de un virus o se interpretan erróneamente como tales, es decisiva para que la crisis del coronavirus pueda terminar rápidamente. Al igual que con el H1N1, los responsables de la crisis del coronavirus dicen que ésta sólo se puede acabar con la vacunación. Sin embargo, la idea de la vacunación ha sido refutada tanto como la de los virus.

Para la evaluación y clasificación de los acontecimientos que rodearon el desencadenamiento y el mantenimiento de la crisis del coronavirus es útil el recuerdo de la pandemia de gripe porcina de 2009, que ya ha sido olvidada.

La mayoría de la población en ese momento estaba preparada para vacunarse contra los supuestos virus de la gripe porcina. Luego hubo un retraso en la entrega anunciada de las vacunas. Las vacunas no podían llenarse en jeringas listas para usar, ya que los nuevos potenciadores de ingredientes activos utilizados por primera vez dañaban la mezcla de la vacuna y la inutilizaban. Por esta razón, la vacuna se llenó en ampollas para 10 personas cada una, a las que sólo se permitió añadir los potenciadores de la sustancia activa poco antes del acto de la vacunación.

Durante este tiempo se supo que los potenciadores del principio activo, llamados adyuvantes, sin los cuales una vacuna no podría desarrollar su efecto, son nuevos y no han sido probados. Se supo que estos novedosos amplificadores de drogas consisten en nanopartículas. Se sabe que las nanopartículas son muy reactivas debido a su diminuto tamaño y, por lo tanto, se utilizan como catalizadores en muchas reacciones químicas. En los procesos técnicos, por ejemplo, hacen que las superficies se comporten de forma completamente diferente a la que se puede conseguir con los métodos convencionales.

Entonces se supo que la Canciller alemana Angela Merkel y las Fuerzas Armadas alemanas iban a recibir esta vacuna, pero sin el novedoso potenciador de sustancias activas de nanopartículas, mientras que la policía y la población iban a recibir la vacuna con las nanopartículas no probadas.

Como resultado, el 93% de la población rechazó la vacuna producida para ellos. Sólo al 7% de los alemanes se les ha administrado esta vacuna.

El metabolismo humano no puede metabolizar y excretar nanopartículas. Debido a esta negativa por parte de casi toda la población, la gripe porcina en realidad desapareció de la noche a la mañana siguiente, como por arte de magia, de los medios de comunicación al basurero y las vacunas al alto horno.

(Se permite una pequeña polémica: sorprendentemente, el virus de la gripe porcina H1N1 despegó al galope de los cerdos, ya no infectó a otras personas, no enfermó a los infectados y su presencia en los medios de comunicación se detuvo inmediatamente. Tal vez el virus de la gripe porcina se ha convertido en virus de la gripe de los peces, para nadar por los ríos en los cuerpos de los salmones, sólo para atacar de nuevo con fuerza concentrada en el mercado de pescado en Wuhan).

Los epidemiólogos, infectólogos y virólogos implicados han aprendido del fracaso de la planificación de la pandemia, que no culminó con la vacunación. Analizaron las causas y publicaron sus conclusiones y recomendaciones para el futuro en el número 12 de diciembre de 2010 del Bundesgesundheitsblatt (Gaceta Federal de Salud). El significativo título de este número: “Pandemias. Lecciones aprendidas” Lo que significa tanto como: ¡Las lecciones que hemos aprendido de la debacle de la gripe porcina H1N1!

Algunos de los artículos de este número están disponibles en Internet, pero no los más importantes. Las principales recomendaciones para la gestión de la pandemia son:

• Asegurarse de que los expertos no se contradigan entre sí en los debates públicos.

• Participación temprana de los medios de comunicación social y de los líderes. – Control de la red Internet. Esto con el fin de evitar que las reivindicaciones y las críticas pongan en peligro el consenso y la aceptación de las medidas en la política y la sociedad.

¡Estas recomendaciones ya se han aplicado con éxito! Se censura en Internet, se excluye a los críticos con insultos, entre otras cosas. Los argumentos obligatorios que refutan la suposición de la pandemia y que han pasado al dominio público simplemente no se abordan. Sólo un experto, el Prof. Drosten, es escuchado en los medios y en la política. La única “crítica” que se le hizo, expresada por un virólogo especializado en VIH, tuvo la función de reforzar la afirmación central de la existencia de un nuevo virus, el SARS-CoV-2.

4. La globalización del pánico por los virus chinos del SARS y la creación de la crisis del coronavirus por el Prof. Drosten

El profesor Christian Drosten, de la Charité de Berlín, afirma que desde el 1/01/2020 ha desarrollado un método de detección genética con el que puede detectar con fiabilidad la presencia del nuevo coronavirus en los seres humanos.

Para a) poder comprender qué supuestos y qué acciones constituyen la base de las afirmaciones del Prof. Drosten y b) comprobar si sus conclusiones de haber desarrollado un procedimiento de prueba seguro para el nuevo coronavirus están lógica y científicamente probadas o no, o incluso refutadas, es necesario explicar los términos y técnicas utilizadas, presentar su argumentación y analizar las dos publicaciones decisivas a las que se refiere el Prof. Drosten.

¿Cómo se definen un virus y un coronavirus?

¿Cómo se definen las secuencias en este contexto? – ¿Cómo funcionan los métodos de detección de secuencias llamadas PCR, RT-PCR y RT-PCR en tiempo real?

¿Cuándo se puede emitir la detección de la presencia de secuencias en humanos como prueba de la presencia de un virus?

¿Cómo se demuestra científicamente la existencia de un virus?


– En la ciencia, un virus se define por su material genético específico, que es único para ese virus.

– El material genético de un virus también se conoce como la cadena genética viral, la molécula genética viral o su genoma. – El material genético viral de un virus contiene las distintas secuencias genéticas para la formación de las distintas proteínas virales, conocidas como genes virales.

– El material genético de un virus puede consistir en ADN o ARN.

– Los virus corona se definen por el hecho de que consisten en una molécula específica de ARN rodeada por una envoltura.

– El material genético de un determinado virus se define por su longitud determinada con precisión y la determinación exacta de la estructura de la cadena del genoma viral.

– La composición del material genético de un virus resulta de la determinación exacta del número y la secuencia específica de los cuatro bloques de construcción que componen un material genético. Los cuatro bloques de construcción de un material genético se llaman nucleótidos. – El proceso de determinar la secuencia específica de los cuatro componentes básicos de un material genético se denomina secuenciación.

– El resultado de la determinación de la secuencia de los componentes básicos de una sustancia hereditaria se denomina secuencia o secuencia genética.

– Los virus patógenos se definen por el hecho de que su secuencia es única y no se da en organismos sanos. – Para detectar y determinar la presencia del material genético de un virus, de acuerdo con las leyes del pensamiento y la lógica que precede a toda ciencia como regla fundamental, este virus debe ser aislado y estar presente en forma pura para que las propias secuencias de genes de la célula no se malinterpreten como componentes de un virus.

– Sólo es posible determinar la secuencia de una sustancia genética si está presente en forma de ADN. – Para determinar la secuencia de una sustancia genética que está presente en forma de ARN, primero debe ser convertida bioquímicamente en ADN.

– El proceso de conversión de una sustancia genética de ARN en ADN se denomina “transcripción inversa” y se abrevia como “RT”.

Las técnicas utilizadas por el Prof. Drosten y las primeras conclusiones

– La presencia y la longitud de un material genético se determina separándolo longitudinalmente en un campo eléctrico. Los trozos cortos migran más rápido, los más largos más lentamente. Al mismo tiempo, para determinar la longitud del material genético a examinar, se añaden piezas de material genético de longitud conocida de diferentes longitudes. Esta fiable técnica estándar para detectar y determinar la longitud del material genético se llama “electroforesis en gel”.

– Si la concentración de un determinado material genético es demasiado baja para ser detectada por la técnica de “electroforesis en gel”, puede ser multiplicada a voluntad por la técnica de multiplicación ilimitada de ADN, llamada Reacción en Cadena de la Polimerasa. De esta manera, el ADN indetectable puede hacerse visible en la electroforesis en gel. Este es un requisito previo para hacer accesible el material genético para investigaciones posteriores, especialmente para la posterior determinación decisiva de su longitud y secuencia. Este método también se conoce como PCR para abreviar.

El inventor de la técnica de la PCR, Kary Mullis, que fue galardonado con el Premio Nobel de Química en 1993 por este invento, señaló desde el principio que este, su método desarrollado para el análisis en sala blanca en las fábricas de chips de ordenador es muy propenso a errores. En su discurso del Premio Nobel, que está documentado en la página del Comité del Premio Nobel, también señaló que no hay ninguna prueba verificable, en realidad científica, de que la sustancia genética conocida como genoma del VIH desencadene realmente una inmunodeficiencia o una de las diversas enfermedades que se agrupan de manera inadmisible bajo el término “SIDA” y se tratan con quimioterapia altamente tóxica. Señaló que sólo hay consenso entre los científicos participantes en que el “VIH” desencadenaría una inmunodeficiencia.

Para poder reproducir un ADN con la técnica de PCR, se requiere el conocimiento de la composición, la secuencia del ADN. Esto se debe a que un ADN sólo puede propagarse por PCR si fragmentos cortos de genes producidos artificialmente se unen al principio y al final del ADN, que corresponden exactamente a la secuencia del principio y del final del ADN que se va a propagar. Estos cortos trozos de ADN producidos artificialmente se llaman, por lo tanto, primers, las moléculas iniciadoras de la PCR. Tienen una media de entre 24 y 30 nucleótidos de largo (los bloques de construcción del material genético).

Así pues, la PCR no puede utilizarse para detectar secuencias o virus desconocidos. Sólo la determinación de la secuencia de un virus permite desarrollar una prueba de PCR para la detección de la secuencia de un gen originado en un virus. – En los primeros días de la PCR, sólo era posible determinar la cantidad de ADN amplificado mediante electroforesis en gel después de que se hubiera detenido la reacción de amplificación de la PCR. Mientras tanto, se añaden ciertos colorantes a las enzimas y sustancias necesarias para la PCR. La detección de estos tintes durante el curso de la PCR muestra aproximadamente qué concentraciones de ADN reproducido artificialmente se produjeron y cuánto ADN estaba realmente presente aproximadamente al comienzo de la PCR. Dado que la cantidad de ADN producido artificialmente puede determinarse aproximadamente mientras la técnica de PCR sigue funcionando, esta extensión de la técnica de PCR se denomina “PCR en tiempo real”. Por lo tanto, una “PCR en tiempo real” que va precedida de otro paso, la conversión de ARN en ADN mediante “transcripción inversa” (RT), se denomina “RTPCR en tiempo real”.

– El Prof. Drosten utiliza la técnica de “RT-PCR en tiempo real” en la prueba que ha desarrollado para la detección del nuevo virus corona. Con ese fin, ha seleccionado secuencias genéticas cortas de un conjunto de datos de Internet del 1/01/2020 que se atribuyen a los virus del SARS. Sobre la base de esas secuencias de fragmentos genéticos cortos, que se interpretan como posibles componentes de los virus del SARS, él diseñó las secuencias de cebadores de la PCR decisivas para la PCR a fin de detectar el virus “todavía” desconocido en China con su “RT-PCR en tiempo real”.

Cuando aparecieron en Internet compilaciones preliminares de secuencias el 10/01/2020 y el 12/01/2020, que posteriormente fueron modificadas y publicadas el 24/01/2020 y el 3/02/2020, esto representó el resultado de los dos primeros intentos de identificar el virus aún desconocido. Con este fin, los virólogos de la CCDC usaron programas de computadora para ensamblar teóricamente las secuencias de fragmentos cortos de genes en una posible cadena genética.

En ambas publicaciones, los virólogos de la CCDC afirman que no hay evidencia de que estas sugerencias de secuencias puedan realmente causar enfermedades. El 10/01/2020 y el 12/01/2020, las propuestas de secuencias chinas eran todavía provisionales y no se habían sometido todavía al estricto proceso de revisión prescrito científicamente.

El hecho de que la Organización Mundial de la Salud (OMS) recomiende la prueba de detección PCR desarrollada por el Prof. Drosten para la detección del nuevo virus el 21/01/2020, incluso antes de la publicación de las publicaciones de las dos primeras propuestas de secuencias chinas, demuestra un primer hecho: El Prof. Drosten utilizó datos no verificados científicamente para su prueba de PCR rápidamente globalizada del 2019-nCoV, que fue rebautizada como SARS-CoV-2 el 7 de febrero de 2020 con la participación del mismo Prof. Drosten.

El cambio de nombre el 7 de febrero de 2020 de la designación de “nCoV” a “SARS-CoV-2”, una mera presunción de virus posiblemente defectuoso o inofensivo, en un patógeno peligroso, dio a la opinión pública la impresión de que se había descubierto un virus real del SARS en China, que causa una enfermedad peligrosa, a saber, el SARS, y mató al nuevo ídolo de China, Li Wenliang, que empequeñeció a la dirección del partido.

El Prof. Drosten y sus colegas del Grupo de Nomenclatura de Virus cumplieron así las expectativas de la población, que estaba aterrorizada hasta la médula: “finalmente diagnosticado”, “finalmente diagnosticado”. Esta expectativa fue despertada por el impulso del pánico masivo desencadenado por el Dr. med. Li Wengling y aparentemente cumplido por el Prof. Drosten.

El factor decisivo en la evaluación de este acto es el hecho de que en aquel momento todos los virólogos directamente implicados testificaron -y todavía testifican hoy- que no hay pruebas de que este nuevo virus cause realmente la enfermedad. ¿O sólo ocurre en paralelo en enfermedades, en procesos de curación, después de procesos de curación, en algunas personas sanas, en muchas personas sanas o en todas las personas?

Esto demuestra que el Prof. Drosten ha cruzado la línea claramente reconocible de la acción científicamente justificada en un fraude reconocible y trascendental. También no podrá salir de esto utilizando una revista para la publicación de su procedimiento de prueba del 23/01/2020 que no comprueba las declaraciones hechas en ella antes de ir a la imprenta.

5. Las preguntas decisivas para un rápido final de la crisis del Coronavirus

La cuestión central y decisiva es si el Prof. Drosten ha cumplido con su deber científico, que forma parte de su contrato de trabajo, consigo mismo y verifica sistemáticamente todas las afirmaciones hechas en su publicación sobre el método de detección que desarrolló y las declaraciones públicas basadas en él.

Este deber científico central da lugar a tres preguntas centrales:

¿Comprobó el Prof. Drosten si las secuencias de genes que forman la base de su procedimiento de prueba y que le fueron proporcionadas por virólogos chinos son en realidad secuencias que se originan en un virus?

¿Llevó a cabo el Prof. Drosten los experimentos de control que son obligatorios en la ciencia y que prueban si las secuencias que utilizó realmente se originan en un virus? ¿Llevó a cabo los experimentos de control que prueban si las secuencias que utiliza, que atribuye al nuevo virus, son en realidad secuencias que no son secuencias que se producen en todos los metabolismos, tal vez incluso en plantas, como las papayas de Tanzanía o que se producen en mayor número en el metabolismo de las enfermedades?

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su método de prueba, con el que sólo detecta áreas parciales de 2 (dos) genes del genoma de un total de 10 (diez) genes del coronavirus, detecta un virus completo, activo y causante de la enfermedad? ¿Y no sólo fragmentos de un virus, después de una supuesta batalla exitosa del sistema inmunológico o la presencia de virus “defectuosos” o “incompletos” o “inofensivos” en nuestro material genético, que son típicos y constituyen el 50% de las masas genéticas de nuestros cromosomas?

Las respuestas son el resultado de la realización documentada del Prof. Drosten durante el desarrollo del procedimiento de la prueba y de la no realización documentada del Prof. Drosten hasta hoy. El virólogo Prof. Drosten, que desarrolló el método de detección del nuevo coronavirus (primero llamado 2019-nCoV y luego, a partir del 7/02/2020 llamado SARS- CoV-2), describe el desarrollo del método de prueba en una publicación publicada el 23/01/2020 en la página 3 de este artículo, en la columna de la izquierda, a 8 líneas de distancia, describe el primer y decisivo paso de su enfoque:

“Antes del anuncio público de las secuencias del virus de 2019-nCoV, nos basamos en los informes de los medios de comunicación social que anunciaban la detección de un virus similar al SARS. Por lo tanto, asumimos que un CoV relacionado con el SARS estuvo involucrado en el brote”.

Esto significa que el Prof. Drosten y sus colaboradores han asumido, basándose en los informes de los medios de comunicación social, que un coronavirus relacionado con el SARS podría estar implicado en el supuesto brote de neumonía atípica. En ese momento no se disponía de datos clínicos que apoyaran esa hipótesis. ¿Cuál era su siguiente paso?

“Descargamos todas las secuencias completas y parciales (longitud media >400 nucleótidos) de virus relacionados con el SARS que estaban disponibles en el GenBank el 1 de enero de 2020.”

Continúa en la columna derecha de la página 3, tercera fila desde la parte superior:

“Alineamos estas secuencias [Nota mía, SL: contra una secuencia estándar dada del virus del SARS] y utilizamos las secuencias alineadas para desarrollar nuestras pruebas (Figura S1 en el suplemento de esta publicación).

“Tras la publicación de la primera secuencia de 2019 nCoV en, seleccionamos tres pruebas basadas en lo bien que se ajustaban al genoma de 2019 nCoV (Figura 1). (“Descargamos todas las secuencias completas y parciales (si >400 nt) de virus relacionados con el SARS disponibles en el GenBank antes del 1 de enero de 2020 […] Estas secuencias fueron alineadas y la alineación se utilizó para el diseño del ensayo (Figura suplementaria S1).

De sus explicaciones se pueden extraer respuestas, conclusiones y consecuencias claras:

¿Comprobó el Prof. Drosten si las secuencias de genes, que son la base de su procedimiento de prueba y que fueron proporcionadas por virólogos chinos, son en realidad secuencias de un virus? ¡La respuesta es NO! No pudo comprobar si las secuencias proporcionadas eran de un virus, porque las dos publicaciones decisivas que describían la extracción de las secuencias de genes que utilizó no estaban disponibles para él antes de que su prueba fuera lanzada al mercado.

¿Llevó a cabo el Prof. Drosten los experimentos de control obligatorios en la ciencia para probar si las secuencias que usó realmente se originaron de un virus? ¿Llevó a cabo los experimentos de control para averiguar si las secuencias que utilizó, que atribuyó al nuevo virus, son en realidad secuencias que se producen en cualquier metabolismo, tal vez incluso en las plantas, o que se producen de forma metabolizada en las enfermedades?

La respuesta es: ¡NO! Ni él, ni los virólogos de la CCDC, ni otros han llevado a cabo de forma demostrable estos experimentos de control necesarios hasta el día de hoy, y si lo han hecho, no los han publicado. Para estos cruciales experimentos de control, deben utilizarse secuencias genéticas cortas del metabolismo de individuos sanos para secuenciarlos. Estas cortas secuencias genéticas, como las de los enfermos, deben ser ensambladas con los mismos programas informáticos para formar una larga cadena genética de un virus. Este experimento nunca se llevó a cabo o nunca se publicó. Ni siquiera se menciona este experimento de control obligatorio, que resulta de las leyes del pensamiento y la lógica de la virología – para controlar consistentemente los propios resultados. En el momento en que este experimento se lleva a cabo y se publica, la crisis del coronavirus termina inmediatamente.

El otro experimento de control resultante de la lógica científica es el ensayo intensivo, mediante el procedimiento PCR desarrollado (RT-PCR en tiempo real), con muestras clínicas de personas con enfermedades distintas de las atribuidas al virus y utilizando muestras de personas, animales y plantas sanas para comprobar si estas muestras no dan también resultados “positivos”.

Estos nuevos experimentos de control, que son lógicamente necesarios para validar un procedimiento de prueba, es decir, para comprobar si es válido y tiene alguna importancia, aún no se han realizado y ni siquiera se ha afirmado que se hayan realizado. Por consiguiente, los inventores y productores de estos procedimientos de prueba se han asegurado, mediante la información apropiada en los rótulos, por ejemplo, que la prueba sólo debe utilizarse para fines de estudio y no es adecuada para fines de diagnóstico.

Puedo predecir con certeza que las personas que liberan mayores cantidades de secuencias genéticas del tipo de tejido de los epitelios escamosos, por ejemplo, los pacientes renales, darán “positivo” con la PCR desarrollada por el Prof. Drosten a más tardar cuando su cantidad de frotis se multiplique y se concentre un poco. Es muy probable que incluso todos los organismos puedan dar positivo.

Hago un llamamiento a bioquímicos, bioinformáticos, virólogos y especialistas en cultivos celulares para que lleven a cabo estos experimentos de control, los publiquen y me informen sobre ellos. He diseñado un experimento de control que excluye de entrada la excusa de que el material de muestra utilizado ha sido contaminado con el virus del SARS Cov-2 antes o durante el experimento de control.

Los costos de la realización de los experimentos de control están cubiertos si se permite que yo y observadores neutrales estemos presentes durante la realización de los experimentos de control y se documenta cada paso. Por favor, póngase en contacto con la editorial para que se ponga en contacto. Los resultados pondrán fin a la crisis del coronavirus inmediatamente. No sirve de nada si sólo presento los resultados de los experimentos de control.

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su procedimiento de prueba, con el que sólo detecta áreas parciales de sólo 2 (dos) genes del genoma de un total de 10 (diez) genes del virus del Corona, detecta un virus completo, activo y causante de enfermedad y no sólo fragmentos de un virus después de una supuesta batalla exitosa del sistema inmunológico o debido a la presencia de numerosos virus “defectuosos”, “incompletos” e “inofensivos” en nuestro material genético?

El Prof. Drosten no consideró estas preguntas lógicas en absoluto, porque no aparecen en ninguna parte de sus publicaciones y afirmaciones. La detección de sólo secuencias genéticas cortas de una cadena genética larga de un virus nunca puede probar la presencia de un virus intacto y por lo tanto reproducible. Para poder calificar de válida una prueba de PCR de este tipo, habría que realizar primero estudios cuyos resultados demuestren que la detección de secuencias genéticas cortas prueba automáticamente la presencia de una cadena genómica completa e intacta de un virus. Esos estudios lógicamente convincentes aún no se han realizado ni mencionado.

Al comienzo de la crisis del coronavirus, la principal viróloga, la Prof. Karin Mölling, una destacada experta en el campo de los virus asociados a las células, inofensivos, incompletos o defectuosos conocidos como endógenos, describió las medidas adoptadas como injustificadas. Ha demostrado en publicaciones y en un libro, que la mitad del material genético de los humanos, es decir, la mitad de las secuencias de la que están formados nuestros cromosomas consiste en secuencias genéticas inactivas y defectuosas de virus.

Lo que no sabe, o está ocultando, es que el metabolismo produce constantemente una gran cantidad de secuencias genéticas de ARN de cualquier composición, que no aparecen en forma de secuencias de ADN en los cromosomas.

Este hecho pone en tela de juicio las afirmaciones de existencia de todos los virus ARN, como los coronavirus, el virus del Ébola, el VIH, el virus del sarampión y los virus del SARS.

Este hecho es también la base por la que, con los experimentos de control, se pone fin inmediatamente no sólo a la crisis del coronavirus, sino también al miedo y al mal manejo por parte de toda la virología de los supuestos virus de la enfermedad. Puedo asegurarle que las causas reales y los fenómenos de infección atribuidos a los virus han sido probados en el sentido “positivo” de la palabra “ciencia”.


Wrong Interpretation of the Virus Part II: Beginning and End of the Coronavirus Crisis



covid_Nada más que decir. Esto no es más que un “resfriado común” causado por coronavirus que ha mutado al igual que muta la gripe (influenza) casi todos los años. Y eso que soy analfabeto. O lo han mutado. No miréis el dedo, mirar la luna. Paralizar la economía mundial. Ellos saben por qué.

Sacado de:

Los coronavirus humanos fueron descritos por primera vez en la década de 1960 en cavidades nasales de pacientes con un resfriado común. Estos virus fueron nombrados posteriormente coronavirus humano 229E y OC43. Otros dos miembros de esta familia han sido identificados, el HCoV-NL63 en 2004 y HKU1 en 2005. Los cuales circulan globalmente en la población humana y causan aproximadamente un tercio de los casos de resfriado común. Al igual que otros tipos de virus pueden causar enfermedades más graves del sistema respiratorio como bronquitis o neumonía especialmente en personas con factores de riesgo, ancianos, niños y pacientes inmunodeprimidos. Además de afecciones respiratorias también pueden causar enfermedades intestinales y neurológicas.30

Existen registros de siete cepas de coronavirus relacionados con enfermedades respiratorias en humanos (HCoV):

  1. Coronavirus humano 229E
  2. Coronavirus humano OC43
  3. SARS-CoV
  4. Coronavirus humano NL63
  5. Coronavirus humano HKU1
  6. Coronavirus del síndrome respiratorio de Oriente Medio (MERS-CoV).
  7. SARS-CoV-2 (COVID-19).3132

Después de la publicación del perfil de los brotes de SARS en 2003, resucitó entre los virólogos un interés por los coronavirus. Durante muchos años, los científicos sabían de solo dos coronavirus humanos (HCoV-229E y OC43-HCoV). El descubrimiento de SARS-CoV añadió un tercer coronavirus humano. A finales de 2004, tres laboratorios de investigación independientes informaron del descubrimiento de un cuarto coronavirus humano, nombrado NL63, NL, y coronavirus de New Haven simultáneamente por varios grupos de investigación. Los tres laboratorios siguen discutiendo sobre cuál de ellos descubrió el virus en primer lugar y por tanto tiene derecho a nombrarlo. A principios de 2005, un equipo de investigación de la Universidad de Hong Kong informó del hallazgo de un quinto coronavirus humano en dos pacientes con neumonía. Lo llamaron coronavirus humano HKU1. El brote de neumonía 2019-20 en Wuhan, China, llevó al hallazgo de un coronavirus nuevo, catalogado como 2019-nCoV por la OMS.

P.D.: Los medios de comunicación convencionales funcionan a base de talonarios, no a bases de noticias que regeneran beneficios. Esto es, vivir en un piso sobre papel sin construir.



Nothing more to say. This is nothing more than a “common cold” caused by a coronavirus that has mutated like the flu (influenza) almost every year. And that I am illiterate. Or they have mutated it. Don’t look at the finger, look at the moon. Paralyze the world economy. They know why.

Taken from:

Human coronaviruses were first described in the 1960s in the nasal cavities of patients with a common cold. These viruses were later named human coronavirus 229E and OC43. Two other members of this family have been identified, HCoV-NL63 in 2004 and HKU1 in 2005. Both of them circulate globally in the human population and cause approximately one third of the common cold cases. Like other types of viruses, they can cause more serious diseases of the respiratory system such as bronchitis or pneumonia, especially in people with risk factors, the elderly, children and immunosuppressed patients. In addition to respiratory conditions, they can also cause intestinal and neurological diseases.30

There are records of seven strains of coronavirus related to respiratory diseases in humans (HCoV):

Human coronavirus 229E
Human coronavirus OC43
Human coronavirus NL63
Human coronavirus HKU1
Middle East respiratory syndrome coronavirus (MERS-CoV).
SARS-CoV-2 (COVID-19) .31 32

After the publication of the profile of the SARS outbreaks in 2003, an interest in coronaviruses was resurrected among virologists. For many years, scientists knew of only two human coronaviruses (HCoV-229E and OC43-HCoV). The discovery of SARS-CoV added a third human coronavirus. In late 2004, three independent research labs reported the discovery of a fourth human coronavirus, named NL63, NL, and New Haven coronavirus simultaneously by multiple research groups. The three labs are still arguing over which of them discovered the virus first and therefore has the right to name it. In early 2005, a research team from the University of Hong Kong reported the finding of a fifth human coronavirus in two patients with pneumonia. They called it human coronavirus HKU1. The 2019-20 pneumonia outbreak in Wuhan, China, led to the discovery of a new coronavirus, listed as 2019-nCoV by the WHO.

PS: The mainstream media works on the basis of checkbooks, not news bases that generate profits. That is, living in a flat on unbuilt paper.