Cómo la gripe se convirtió en COVID

Cuando empezamos a saber de la “nueva enfermedad” supuestamente producida por el nuevo virus chino Sars-CoV-2, en el invierno 2019-20, apenas sabíamos que era una neumonía intersticial bilateral. Luego supimos que había enfermos que fallecían por un síndrome inflamatorio hiperagudo o “Tormenta de Citoquinas” y finalmente, cuando desoyendo las recomendaciones de la OMS un grupo de patólogos italianos empezó a hacer autopsias supimos que los endotelios de diversos vasos sanguíneos, incluidas arterias, estaban dañados, con microtrombos y en ellos se producía acúmulo de NETs (trampas o redes de cromatina de neutrófilos apoptóticos).

A partir de entonces y aunque se ha estado repitiendo reiterativamente por el oficialismo y los mass media que estábamos inmersos en supuestos rebrotes y “sucesivas olas” de covid-19, la clínica y fisiopatología de la citada covid no tenía nada que ver con la epidemia primaveral de 2020, que se produjo de forma cuasi sincrónica, en muchos países del viejo mundo. Durante el verano de 2020 apenas catarros y asintomáticos: casos PCR positivo y en el otoño-invierno, además, alguna neumonía…hasta que llegaron las vacunas covid y entonces “surgieron las variantes” del virus: la británica y sudafricana apenas empezaron las inoculaciones. La delta (que ya no convenía llamarla con nombre de un país) con las segundas dosis y ahora la omicron coincidiendo con la tercera. Y esto no es pura coincidencia puesto que según el estudio titulado “Mecanismos de la evolución del SARS-CoV-2 que revelan mutaciones resistentes a las vacunas en Europa y América” las variantes se dan justamente en los países con una mayor tasa de vacunación covid.

En el otoño-invierno de 2020: año en que desapareció la gripe en toda Europa, la patóloga de la Universidad de Ulm, Dra. Schmied, utilizando fotos hechas con microscopio electrónico del lavado bronquial de pacientes con Covid y haciendo posteriormente un cultivo celular, encuentra sólo en pacientes inmunodeprimidos con sintomatología pulmonar, algunas partículas virales, de las cuales las menos son coronavirus. Sobre todo encuentra estafilococos, estreptococos, adenovirus y muy frecuentemente, Borrelia, y las Borrelias sabemos que aparecen en inmunosupresión.

Si la covid-19 fuera una enfermedad, tal y como se describe en nosología médica, todos los enfermos y en todas las estaciones, presentarían el mismo cuadro clínico con muy poca variación pero puesto que, como sabemos, se da tanta variabilidad de síntomas, covid-19 no es una nueva enfermedad sino un síndrome que cursa como una complicación de la gripe ( o de las vacunas covid) y que se caracteriza por una alteración o desregulación de la inmunidad innata.

¿En qué consiste esta desregulación?

Hasta el presente no se ha demostrado científicamente que el síndrome covid esté producido inequívocamente o exclusivamente por el virus SARS-CoV-2, ya que la manera de diagnosticarlo es mediante test PCR autorizados por la vía de emergencia, en cuyo prospecto pone claramente que no son adecuados para diagnóstico clínico y que, como sabemos, pueden dar falsos positivos a otros virus relacionados con síndromes gripales.

Es absurdo decir que un mismo virus puede producir cuadros clínicos tan diversos como la ausencia de síntomas, el resfriado leve, la neumonía intersticial bilateral y la vasculitis multiorgánica con tormenta de citoquinas aguda y mortal. Si se producen estas enormes diferencias clínicas es debido al paciente, a su estado inmunológico, no al virus. Por lo tanto urge estudiar qué determina dicho estado inmune. Además el cuadro clínico de covid grave, caracterizado principalmente por la neumonía inflamatoria aparece a partir de los siete u ocho días de evolución de un cuadro gripal, es decir, cuando ya no hay en el organismo virus activos, aunque el test PCR siga siendo positivo y esto ha sido demostrado inequívocamente mediante cultivo viral.

El estallido inflamatorio que se produjo en la primavera de 2020 se correlaciona inmunológicamente con un síndrome de ADE o enfermedad aumentada por vacuna y hay que destacar que ADE también puede ser producido o facilitado por el antígeno HA (hemaglutinina) de las vacunas antigripales, que se ha demostrado reacciona de forma cruzada con la proteína espiga de los coronavirus. Es muy significativo que en 2019 se introdujeron, tanto en China como en Europa, nuevas vacunas antigripales de cultivo celular que contenían cepas de coronavirus, teóricamente no replicantes, como ha sido reconocido por la OMS.

Por otra parte, en diversos estudios inmunológicos se han encontrado autoanticuerpos dirigidos contra diferentes proteínas inmunes, entre ellas el interferón (imprescindible para el control de la proliferación viral) y que son mucho más frecuentes en personas que desarrollan covid grave o lo que se ha venido a llamar “covid persistente”

Además, la producción mantenida de anticuerpos contra antígenos víricos que son compatibles con antígenos expresados por retrovirus endógenos, puede dar lugar a fenómenos autoinmunes o al mantenimiento de un perfil inflamatorio crónico de bajo grado que favorezca el ADE o síndromes similares como el Síndrome hemofagocítico, es decir cuadros clínicos de inmunodeficiencia hiperinflamatoria.

En las autopsias de fallecidos por covid se ha visto que la patogenia afecta esencialmente a los vasos sanguíneos, pues la covid grave es básicamente una vasculitis autoinmune y esta vasculitis puede ser igualmente producida por la proteína espiga que las mal llamadas vacunas génicas covid obligarán a nuestras células a producir.

En conclusión, la supuesta epidemia de covid, en caso de haber sido desencadenada (no causada: lo cual es muy relevante desde el punto de vista epidemiológico) por un hipotético virus SARS-CoV-2 del que ningún organismo oficial tiene cultivos ni referencia, podría haber terminado hace mucho tiempo si se la hubiera dejado seguir su evolución natural pero, como demostraremos en otra ocasión, está siendo mantenida artificialmente por los fármacos génicos que se hacen llamar vacunas anticovid.

María José Martínez Albarracín
(Visto en https://elcorreodeespana.com/)

Fuente: http://astillasderealidad2.blogspot.com/2022/01/como-la-gripe-se-convirtio-en-covid.html

Los CDC admiten que la pandemia de Covid fue producto de una prueba inapropiada

[Se empieza a hundir el barco. No dejaremos ni una rata viva. (LTC)]


Silenciosamente sin la atención de los medios, los Centros para el Control y la Prevención de Enfermedades (CDC) han retirado el proceso de PCR como una prueba válida para detectar e identificar el SARS-CoV-2.

«Después del 31 de diciembre de 2021, los CDC retirarán la solicitud a la Administración de Alimentos y Medicamentos de los Estados Unidos (FDA) para la Autorización de Uso de Emergencia (EUA) del Panel de Diagnóstico de RT-PCR en Tiempo Real del Nuevo Coronavirus (2019-nCoV) de los CDC 2019-nCoV, el ensayo introducido por primera vez en febrero de 2020 solo para la detección del SARS-CoV-2».


Los CDC admiten que la prueba PCR no puede diferenciar entre el SARS-CoV-2 y los virus de la influenza.

Informé hace varios meses que las «autoridades sanitarias» habían llegado a esta decisión, pero estaban reteniendo su implementación hasta finales de 2021. Necesitaban la prueba falsa para mantener el miedo en marcha con el fin de lograr la mayor cantidad de vacunación y, por lo tanto, la mayor ganancia posible.

Es extraordinario que la retirada de la prueba por parte de los CDC no haya recibido atención de los medios de comunicación o los políticos.

El Dr. Kary Mullis, Premio Nobel e inventor del proceso de PCR dijo hace varios años que «el PCR es un proceso. No te dice que estás enfermo». Nunca estuvo destinado a ser una prueba de Covid.

El Dr. Pascal Sacre, el famoso belga especializado en cuidados críticos, dijo que el proceso de RT-PCR fue mal utilizado y aplicado como una estrategia implacable e intencional para crear la apariencia de una pandemia basada en resultados de pruebas falsas y no en pacientes reales de Covid para violar los derechos humanos y constitucionales de los ciudadanos.

Como he informado consistentemente, la prueba de PCR se realizó intencionalmente a ciclos altos que se sabía que producían falsos positivos. La mayoría de los supuestos «casos de Covid» no fueron más que invenciones intencionales. Los hospitales fueron parte de la estafa engañosa, porque fueron incentivados por recompensas financieras para reportar prácticamente todas las muertes como muertes por Covid. Fue fácil de hacer ya que a cada persona moribunda por cualquier causa se le realizó una prueba PCR que produce hasta un 97% de falsos positivos y, por lo tanto, se declaró una «muerte por Covid».

La pregunta ante el mundo es si las «autoridades de salud», en realidad solo se esfuerzan por las ganancias de las grandes farmacéuticas, como Robert F. Kennedy, Jr. ha demostrado, los políticos y los medios de comunicación mentirosos serán responsables de las lesiones y muertes causadas por la «vacuna» en sí, de los negocios perdidos y cerrados causados por los bloqueos sin sentido, y de las violaciones extraordinarias de las Leyes de Nuremberg por la vacunación obligatoria.

Los pueblos del mundo deben entender que la orquestada «pandemia de Covid» es el crimen masivo más horrible jamás cometido en la historia de la humanidad. Fue el «Occidente Libre» el que organizó y perpetró este horrible crimen.

Las personas que confiaron en Fauci, que confiaron en Biden, que confiaron en el establecimiento médico y que confiaron en los medios de comunicación vieron sus vidas arruinadas.

¿Será la raza humana demasiado estúpida para comprender su engaño y las consecuencias para los derechos humanos y la libertad humana? ¿Seguirán confiando en las autoridades y los medios de comunicación que los engañaron con una narrativa controlada que requería silenciar y castigar a todos los verdaderos expertos? Si es así, habrán sido efectivamente esclavizados.

Ver también:


Fuente: https://www.unz.com/proberts/cdc-admits-that-the-covid-pandemic-was-the-product-of-an-inappropriate-test/

Los 5 signos de que NO tienes «Ómicron»… tienes un resfriado y una prueba PCR

El gobierno está creando una «nueva ola» justo a tiempo para Navidad, y están usando el mismo truco que usaron la última vez.

Por Kit Knightly

Están decididos a hacer que la «Variante Omicron» parezca lo más aterradora posible, eso significa obtener tantos casos como sea posible, lo que significa voltear todo el camino al frente del libro de jugadas Covid.

Entra en «Las 5 señales de que puedes tener Omicron Covid», un artículo en el Metro ayer, y repetido en espíritu en docenas de otros medios.

Para aquellos de ustedes que sienten una curiosidad mórbida, aquí están los cinco signos de Omicron:

  1. garganta áspera
  2. Fatiga
  3. dolores musculares leves
  4. tos seca
  5. sudores nocturnos

El lector astuto sin duda captará que estos son los síntomas de cada uno de los virus del resfriado común que infectan a millones de personas en todo el mundo cada año.

Es solo la vieja broma de Los Simpson sobre «hambre leve, sed ocasional y cansancio por la noche»,solo que esperan que lo tomemos en serio.

Lo más probable es que haya experimentado estos síntomas al menos una o dos veces en el último año más o menos. Esto no significa que tuvieras Omicron. No significa que Omicron exista.

Más bien, es solo una estratagema para que sigas la guía del gobierno y, en las palabras del artículo:

solicite una prueba PCR gratuita lo antes posible».

El sitio del gobierno para ordenar pruebas PCR ya se ha cerrado debido a millones de solicitudes. Hemos repetido, ad infinitum, que estas pruebas carecen de sentido científico y devuelven un gran número de falsos positivos.

Sin embargo, se están realizando cientos de miles de pruebas PCR en personas con nada más que síntomas leves de resfriado mientras hablamos, y en estos hisopos nasales se encuentra la incipiente «onda Omicron».

Es por eso que Sajid Javid sale en la televisión diciendo que espera que los casos de Omicron «aumenten dramáticamente» en el período previo a la Navidad, porque van a hacer que suceda.

Entonces probablemente harán que el Primer Ministro anuncie nuevas restricciones… justo después de que el Parlamento suspenda las vacaciones de Navidad, por lo que no pueden ser revisados ni votados.

Es el mismo truco de siempre, una y otra y otra vez. Con suerte, la gente dejará de caer en él pronto.

Fuente: https://off-guardian.org/2021/12/15/the-5-signs-you-dont-have-omicron-you-have-a-cold-and-a-pcr-test/


El hombre que quiere pisar Marte, no sabe en realidad de qué trata la enfermedad Covid. La enfermedad no ha causado la pandemia, la ha causado una prueba (PCR), que utilizada fraudulentamente, a propósito, ha dado con esta no pandemia.

Pero vayamos por pasos. Después de leer durante casi dos años los sitios oficiales y oficialistas del Covid, dígase OMS para abajo, no encuentro una respuesta adecuada, simplificada, cognitiva, académica o popular que encaje en cualquier entendimiento formal de un individuo medio. El doctor no sabe explicar la enfermedad a su paciente.

Hablemos claro, son unos ineptos, con perdón. Veamos un ejemplo, un artículo cualquiera de hoy mismo, titulado La covid te engaña: te ahogas y no lo notas, pondré una parte:

«[¿Por qué ocurre?

La hipoxia o neumonía silenciosa, pese a no pillarnos tan desprevenidos, sigue siendo un misterio casi dos años después del inicio de la covid.

Se especula que el coronavirus afecta a la sensibilidad de los receptores que informan al cerebro

Hay varios ensayos que han analizado y especulado sus causas, aunque sin certezas sobre los motivos exactos.

Lo que se especuló es que había una insensibilidad de los quimiorreceptores, que se encuentran en la arteria carótida y en los pulmones”, explica el doctor Torres.

Los quimiorreceptores son los sensores encargados de transmitir al cerebro si nos estamos ahogando o nos llega suficiente oxígeno.

El coronavirus afecta al cerebro

La conclusión es que el coronavirus de una manera u otra también afecta a las conexiones neuronales en este sentido.

La afectación cerebral de la covid era algo que los neurólogos descartaban inicialmente. Aunque poco a poco se fueron viendo más ejemplos de pacientes a los que se había detectado el coronavirus en las neuronas.

  • Cuando se extendieron los problemas de pérdida de gusto y olfato ya se empezó a ver que sí había afectaciones.
  • Con los pacientes recuperados de covid grave o los que tienen una covid persistente se están viendo más ejemplos.

Hay muchas alteraciones relacionadas con el cerebro: trastornos cognitivos, insomnio, ansiedad, entre otros”, enumera el doctor Torres.]»

Bueno, un virus por sí solo no crea una enfermedad y una enfermedad sí puede crear trastornos, insomnio, ansiedad y depresión, pongamos por ejemplo el cáncer, sobre todo cuando te lo comunican. Odio esta frase, pero para que me entiendan, es un daño colateral. Pero ellos dicen que es el virus, no la enfermedad. Que es un síntoma que crea el virus. Pues yo tengo mis dudas que un coronavirus cree eso, las mismas que tienen ellos.

Otra cuestión es la falta de oxígeno: Gripe, un coronavirus, neumonía bacteriana o radiaciones.

Y aquí está la clave. Si estudian todos los síntomas de la Covid-19 ¿Dónde encajan de las cuatro enfermedades escritas ahí arriba?

Veamos, ¿un coronavirus que en algunos pacientes produce pérdida de cabello? NO.

¿Una gripe con quemazón en manos y pies y/o uñas deformadas? NO.

¿Neumonía bacteriana con el síntoma de Guillain-Barré? NO.

¿Radiación? SÍ. O puede ser, como nadie sabe nada, como a los que se les paga para saber no saben nada, tanto vale mi opinión.

¡Ah!, se me olvidaba, eran 4+1: La vacuna es o creará otra enfermedad. O visto de otro modo, la radiación y las vacunas son un verdadero cóctel mortal. O puede ser.

¡Miren ustedes! Si hubiera un virus (que hay millones) y una vacuna, estaríamos todos vacunados. Lo qué sí hay es una enfermedad, pero como no es lo que dicen ser porque no lo saben (unos pocos supongo que sí), ¿Qué coño hay en la vacuna?

Ahí abajo hay 201 síntomas que crea un coronavirus. ¡Vamos, ni el ébola, SIDA, sarampión, varicela, rubeola juntos! Para mí es todo un poco raro ¿no?

Investiguen ustedes mismos. No se crean nada de nadie desde la OMS para abajo. Y abajo somos más. Cuídense.


¡No diga ni MU!

Sólo tiene que cambiar Delta por MA, ME, MI, MO, MU. Puede elegir. O esperar.

La falsa «variante Delta» y la cuarta ola: ¿otro confinamiento? ¿Próxima crisis financiera? ¿Sabotaje económico y social en todo el mundo?

Por el Prof. Michel Chossudovsky Global Research, 04 de septiembre de 2021

Publicado por primera vez el 11 de agosto de 2021


¿Se prevé un nuevo confinamiento mundial como un medio para combatir la variante «peligrosa» de Covid titulada «Delta»?

La campaña del miedo ha vuelto a ponerse en marcha.

Permítanme repasar brevemente la historia de esta crisis.

Hay una secuencia de mentiras descaradas e invenciones utilizadas para justificar decisiones políticas de gran alcance en el transcurso de los últimos 18 meses.

La mayor mentira, que es firmemente reconocida tanto por la opinión científica como por la OMS, es que la prueba RT-PCR utilizada para «detectar» la propagación del virus (así como las variantes) no solo es defectuosa sino TOTALMENTE INVÁLIDA. (Michel Chossudovsky, Capítulo III)

Desde el principio, en enero de 2020, todas las decisiones políticas de gran alcance confirmadas y presentadas al público como un «medio para salvar vidas» se basaron en casos positivos de RT-PCR defectuosos e inválidos junto con datos falsos de mortalidad relacionados con muertes relacionadas con Covid-19: «La causa subyacente de muerte» es Covid-19 «más a menudo o no». No se requiere autopsia

Estas «estimaciones» del Covid se utilizaron para justificar el confinamiento, el distanciamiento social, la mascarilla, la prohibición de reuniones sociales, eventos culturales y deportivos, el cierre de la actividad económica.

La crisis estuvo marcada por varias etapas importantes:

1. Crisis en los viajes aéreos y el transporte internacional

La convocatoria de una emergencia de salud pública de importancia internacional (ESPII) por parte del Director General de la OMS el 30 de enero fue fundamental para lanzar la crisis coronal. Hubo 83 casos positivos fuera de China de una población de 6.400 millones. No hubo emergencia:Irónicamente, se utilizó la prueba RT-PCR defectuosa e inválida para estimar esos 83 casos positivos.

Al día siguiente, el presidente Trump ordenó el cierre de los viajes aéreos con China, lo que marcó el inicio de una crisis en los viajes aéreos y el transporte internacional que ha extendido su control durante un período de 18 meses que ha llevado a la quiebra de las compañías aéreas en todo el mundo, la destrucción de la industria turística, una gran crisis en el comercio de productos básicos, etc. Este fue un acto deliberado para dar a conocer la desaparición de Air Travel Worldwide. Hubo 5 casos positivos en los Estados Unidos, que se utilizaron para justificar la decisión de Trump el 31 de enero de 2020.

2. La crisis financiera de febrero del 20 de febrero de 2020

Fue la crisis financiera más grave de la historia mundial, superando con creces la de 1929. Ocurrió inmediatamente después de las «advertencias» de la OMS de que una pandemia de covid-19 era inminente, encabezando así la campaña del miedo. Había amplia evidencia de «conflicto de intereses» y fraude, incluido el conocimiento previo, la información privilegiada, etc., lo que resultó en una concentración masiva de la riqueza monetaria por parte de un puñado de multimillonarios. Ese mismo día, millones de personas en todo el mundo perdieron sus ahorros de por vida. ¿Cuál fue la justificación de las declaraciones de conmoción y asombro de la OMS? Esta amenaza inminente se basó en 1078 (defectuosos) casos positivos de COVID RT-PCR fuera de China.

3. Apenas tres semanas después, el confinamiento del 11 de marzo de 2020 con 44.279 casos en todo el mundo fuera de China se utilizó para justificar el confinamiento domiciliario, el distanciamiento social y el cierre de la actividad económica en todo el mundo, lo que llevó a la pobreza y el desempleo masivo.

Y luego, a principios de noviembre, fue el lanzamiento de la «vacuna asesina» mrnmn que ha resultado en una tendencia de mortalidad y morbilidad. Vea las últimas cifras a continuación.

UE/EEE/Suiza hasta el 28 de agosto de 2021: 23 252 muertes relacionadas con la inyección de Covid-19 y 2 166 285 lesiones, según la base de datos EudraVigilance.

Reino Unido hasta el 18 de agosto de 2021: 1,609 muertes relacionadas con la inyección de Covid-19 y 1,165,636 lesiones,según el esquema de tarjeta amarilla de MHRA.

EE.UU. hasta el 20 de agosto de 2021:1 3.627 muertes relacionadas con la inyección de Covid-19 y 2.932.001 lesiones,según la base de datos VAERS.

TOTAL para la UE/Reino Unido/EE.UU.: 38.488 muertes relacionadas con la inyección de Covid-19 y 6.263.922 lesiones notificadas al 30 de agosto de 2021.

Nota Bene: Es importante tener en cuenta que las cifras oficiales anteriores (informadas a las autoridades sanitarias) no son más que un pequeño porcentaje de las cifras reales. Además, las personas continúan muriendo (y sufriendo lesiones) a causa de las inyecciones con cada día que pasa. Ver Declaración D4CE

La variante Delta y «La Cuarta Ola»

Y ahora, a partir de mayo-junio de 2021, tenemos la variante Delta. Es el nuevo tema de conversación.

Los supuestos peligros de la variante Delta se están utilizando para acelerar el programa de vacunación, así como la imposición del pasaporte de vacunación.

«Una cuarta ola» ya ha sido anunciada.

¿Está un segundo confinamiento mundial en la mesa de dibujo, que requiere quedarse en casa con confinamiento, distanciamiento social y el cierre de la actividad económica junto con otra crisis financiera devastadora similar a la que ocurrió el Jueves Negro 12 de marzo de 2020?

Las variantes mortales sostenidas por la desinformación de los medios y la ciencia falsa

La desinformación de los medios de comunicación es un arma mortal que sostiene las 24 semanas del día, los 7 días de la semana, la ilusión de una peligrosa variante delta del SARS-2.

Identificada por primera vez el año pasado en la India, la variante Delta del SARS-CoV-2 «se cree que ha impulsado la segunda ola mortal de infecciones este verano en la India». Según la llamada «opinión científica», ahora se dice que se está extendiendo por todo el mundo, a unos 80 países.

«Aquí está el trato: la variante Delta es más contagiosa, es más mortal y se está propagando rápidamente por todo el mundo, dejando a las personas jóvenes no vacunadas más vulnerables que nunca».

Eso es mentira. El virus original categorizado por la OMS y los CDC como «similar a la influenza estacional» no es un virus asesino. Además, las variantes del virus son siempre «menos vigilantes» y «menos peligrosas» que el virus original.

La «solución» propuesta por Joe Biden es «la vacuna asesina», que ya en el transcurso de los últimos siete meses ha resultado en innumerables muertes y lesiones.

«Por favor, vacúnese si aún no lo ha hecho. Dejemos esta tensión antes de que sea demasiado tarde». (sin cursivas en el original)

Las autoridades sanitarias afirman ahora que los nuevos casos de la variante Delta B1.617,aumentan el riesgo de hospitalización en 2,7 veces.

¿Cuál es la «ciencia» detrás de estas afirmaciones?

El infame «modelo matemático» de ferguson ¿Hacia una «cuarta ola»? Combatiendo «D la peligrosa variante Delta». El «Modelo Matemático de Confinamiento»

Imagen de la derecha: Neil Ferguson (Fuente: Financial Times)

El modelo matemático de Ferguson de marzo de 2020 basado en «predicciones» de 600.000 muertes en el Reino Unido raya en el ridículo. Es más que una mentira. Es un crimen de lesa humanidad. Fue utilizado por el establishment financiero como una justificación para desencadenar el caos económico y social en todo el mundo. Los esfuerzos de Ferguson han sido generosamente financiados por la Fundación Bill y Melinda Gates.

La devastación económica y social del llamado confinamiento de marzo de 2020 está fuera de toda descripción: 190 estados miembros de las Naciones Unidas aceptaron «cerrar» su economía nacional junto con la máscara facial, el distanciamiento social y la derogación de los derechos humanos fundamentales.

La intención declarada era proteger a las personas contra V el virus. El confinamiento del 11 de marzo fue seguido por el «colapso financiero» del Jueves Negro (12 de marzo de 2020), que creó estragos en los mercados bursátiles de todo el mundo. El confinamiento del 11 de marzo de 2020 fue anunciado como un medio para contener la supuesta «pandemia». Tontería.

«Modelo matemático» en apoyo de una «cuarta ola»

Y ahora se está presentando un segundo «modelo matemático» autorizado para «justificar» otro confinamiento.

El mismo «científico» (Ferguson) ha sido llamado a diseñar un nuevo «modelo matemático» que se está utilizando para justificar un «confinamiento de la cuarta ola».

La «suposición» errónea detrás del ejercicio de modelado es que la variante Delta es «mortal».

«Un nuevo modelo para el comité de expertos SAGE del gobierno [al que pertenece Ferguson] ha puesto de relieve el riesgo de una «tercera ola sustancial» de infecciones y hospitalizaciones, …». El panorama oficial es «ahora más pesimista». (Informe de la BBC, junio de 2021, énfasis añadido).

Según el profesor Neil Ferguson:

«la variante Delta del coronavirus es entre un 30% y un 100% más transmisible que la variante anteriormente dominante». (citado por The Guardian).

¿De dónde obtiene Ferguson sus datos y estimaciones? ¿La prueba RT-PCR defectuosa e inválida?

Lo que no menciona es que las variantes del virus son siempre «menos vigilantes» y «menos peligrosas» en comparación con el virus original. ¿Y cómo establece la «identidad» del virus original?

Tanto los funcionarios británicos como los del Reino Unido están insinuando la posibilidad de un confinamiento de la Cuarta Ola, programado tentativamente para el próximo otoño.

Según el director médico de Gran Bretaña, el profesor Chris Whitty (miembro del Comité SAGE)

«El NHS necesita prepararse para otro invierno difícil por delante ,con la posibilidad de un nuevo «aumento muy significativo de Covid».

Según el subgrupo de modelado SPI-M del panel SAGE del gobierno (al que pertenecen Whitty y Ferguson):

«habría que reintroducir las restricciones». … la variante Delta planteaba un «mayor riesgo de hospitalizaciones»

Estos anuncios son frívolos. Su intención es justificar medidas políticas drásticas (confinamiento, mascarilla, distanciamiento social, cierre de la actividad económica, interrupción de los servicios de salud), así como la aceleración del programa de vacunación y la represión del movimiento de protesta.

Además, las declaraciones de los funcionarios de salud británicos, estadounidenses y de la UE sobre la llamada propagación de «la variante más infecciosa del Delta» ahora también se están utilizando para justificar la implementación de políticas de confinamiento de la «Cuarta Ola» a nivel internacional en un gran número de países.

El Foro Económico Mundial al rescate

El Foro Económico Mundial (WEF), que representa a las élites financieras, desempeñó un papel clave en el lanzamiento del confinamiento del 11 de marzo de 2020. Y ahora lo que están diciendo es que es probable que ocurra otra devastadora crisis económica y social mundial a raíz de la pandemia de Covid-19.

El WEF ahora apunta a:

«Unciberataque con características similares a las de COVID», que promete ser mucho más devastador y caótico que la pandemia de Covid-19.

El «Concepto 2021» del Foro Económico Mundial. Escenario de polígono cibernético

En los últimos acontecimientos, el Foro Económico Mundial (WEF) que copatrocinó el Evento 201, la simulación de mesa de la pandemia de coronavirus junto con John Hopkins y la Fundación Gates en octubre de 2019, ahora está involucrado en otro ejercicio estratégico titulado Concepto 2021. Este último se describe como una «iniciativa internacional de desarrollo de capacidades destinada a aumentar la resiliencia cibernética global. No es una simulación de mesa comparable al Evento 201.

El año pasado se llevó a cabo en el apogeo del confinamiento a través de videoconferencia. Este año, la Conferencia de 2021 «discutió los«riesgos clave de la digitalización».

Los participantes en el Ejercicio del Polígono Cibernético incluyeron compañías de alta tecnología como IBM, numerosos bancos e instituciones financieras, compañías de Internet, agencias de seguridad cibernética, medios corporativos y gubernamentales, grupos de expertos, agencias de aplicación de la ley, incluida Interpol, con representantes de 48 países. El ejercicio es un medio obvio para asegurar socios confiables y desarrollar alianzas estratégicas. En este sentido, había numerosos representantes de Rusia y países de la antigua Unión Soviética, incluidos los principales intereses bancarios rusos, las empresas de comunicaciones y medios de comunicación. En total, 42 socios. Ningún socio corporativo / gubernamental de China.

También hubo un programa de entrenamiento con 200 equipos de 48 países.

Vídeo del WEF

Klaus Schwab, fundador y Director Ejecutivo del WEF y arquitecto del «Gran Reinicio» describe el escenario de crisis de la siguiente manera:

« El aterrador escenario de un ataque cibernético integral podría detener por completo el suministro de energía, el transporte, los servicios hospitalarios, nuestra sociedad en su conjunto. La crisis de COVID-19 se vería a este respecto como una pequeña perturbación en comparación con un ciberataque importante». (sin cursivas en el original)

Jeremy Jurgens, Director General del WEF:

«Creo que habrá otra crisis. Será más significativo. Será más rápido de lo que hemos visto con COVID. El impacto será mayor y, como resultado, las implicaciones económicas y sociales serán aún más significativas». (sin cursivas en el original)

Las implicaciones de estas audaces «predicciones» que representan los intereses del establishment financiero son de gran alcance.

Lo que describen es un escenario de caos económico y social que implica la interrupción de los sistemas de comunicaciones, Internet, las transacciones financieras y monetarias (incluido SWIFT), la red eléctrica, el transporte global, el comercio de productos básicos, etc., así como probables «dislocaciones geopolíticas».

La sesión de apertura (julio de 2021) del Cyber Polygon 2021 fue conducida (video a continuación) por el Primer Ministro de la Federación Rusa Mikhail Mishustin junto con el Director General del WEF Klaus Schwab.

¿Es este escenario un ensayo general para una próxima crisis cibernética?

¿Por qué se excluyó a China del Ejercicio del Polígono Cibernético? Los principales socios eran del antiguo bloque soviético.

Vídeo. La sesión de apertura (julio de 2021).

La simulación realizada en julio de 2021 se titula Cyber Polygon 2021

¿Es un «Escenario de Ciberataque» contemplado por el establishment financiero?

Si bien no se puede especular, el asunto debe abordarse.

La variante Delta

¿Se utilizará la «mortal» variante Delta como pretexto para justificar el lanzamiento de una nueva fase de la crisis del coronavirus, lo que resultará en un nuevo proceso de enriquecimiento multimillonario junto con el aumento de las deudas públicas y privadas, la inflación, el desempleo y la pobreza?

Además, en esta coyuntura de una crisis en desarrollo, los gobiernos y los medios de comunicación están ahora involucrados en una campaña de miedo centrada en gran medida en las variantes «mortales» del SARS-CoV-2.

Con el fin de salvar vidas, las autoridades sanitarias están insinuando que si las Variantes no se controlan, se debe contemplar un confinamiento importante.

Esta narrativa se basa en mentiras y distorsiones descaradas. No hay evidencia científica derivada de la prueba RT-PCR defectuosa e inválida que se utiliza para sostener la «evidencia» de estas «variantes» mortales del SARS-CoV-2.

¿Es la agenda Covid parte de un proyecto hegemónico de Estados Unidos?

¿Es la crisis del covid diseñada por el establishment financiero parte de un proyecto hegemónico, relacionado con el control sobre sectores estratégicos de la economía global como lo describe el director general del WEF, Klaus Schwab?

¿Es un acto de guerra económica?

Es «imperialismo con rostro humano», comprometido con «salvar vidas».

Visiblemente, es parte de la agenda de política exterior del presidente Joe Biden. Tiene implicaciones geopolíticas y estratégicas.

La inteligencia estadounidense y el Pentágono (incluido DARPA), así como la OTAN, están directa o indirectamente involucrados en la crisis del coronavirus. Cyber Warfare ya está en la mesa de dibujo.

El confinamiento del 11 de marzo de 2020 que llevó al cierre de las economías nacionales en todo el mundo también ha sido fundamental para desestabilizar a varios países que se clasifican como «Enemigos de Estados Unidos».

No hay necesidad de que Washington imponga sanciones fragmentas a Irán, Venezuela y Cuba. Estos países han respaldado la narrativa del covid. Han aceptado la «sanción final»,es decir, el cierre de su economía nacional como un medio para combatir «V el virus».

La situación en Cuba es particularmente dramática. Como resultado del confinamiento de marzo de 2020, la industria turística de Cuba, que constituye la principal fuente de divisas del país, se destruye. Desde la década de 1980, los ingresos de divisas del turismo se han utilizado para importar alimentos. Y ahora, como resultado del cierre de la industria turística, Cuba está experimentando una grave escasez de alimentos.

Sin embargo, el gobierno cubano ha aceptado la «Gran Mentira» y ha respaldado el confinamiento que literalmente está destruyendo los logros de la Revolución Cubana.

Y desafortunadamente los intelectuales progresistas están totalmente ciegos. No solo apoyan la narrativa de Covid, sino que no entienden cómo las políticas de confinamiento de Covid, así como la mortal vacuna de ARNm, se están utilizando para desestabilizar y destruir países uno tras otro. Estos países ahora están totalmente controlados por los acreedores occidentales y las fundaciones multimillonarias.

Caos económico y social diseñado. ¿No es eso parte de un proyecto hegemónico estadounidense?

Bastilla 2.0: «Cambio de régimen real»

¿Cuál es la solución? Las complejidades de esta crisis deben abordarse, incluidas las estructuras de poder del capitalismo global.

Lo que también debe entenderse son los astutos mecanismos, incluidas las amenazas y los sobornos, que se utilizan sistemáticamente para tomar el control no solo de los políticos corruptos, sino de todo el tejido gubernamental de lo que solían ser «países soberanos».

¿Se contempla un segundo confinamiento mundial? Debemos asegurarnos de que no se lleve a cabo, lo que significa que debemos enfrentarnos a los poderes de la llamada «gobernanza global».

Los movimientos de protesta deben cuestionar la legitimidad tanto de los actores financieros como de los políticos en altos cargos:

La legitimidad de los políticos y sus poderosos patrocinadores corporativos debe ser cuestionada, incluidas las medidas del estado policial adoptadas para hacer cumplir el cierre de la actividad económica, la imposición de un pasaporte de vacuna digital, así como el uso de la máscara facial, el distanciamiento social, etc.

Esta red debe establecerse (a nivel nacional e internacional) en todos los niveles de la sociedad, en ciudades y pueblos, lugares de trabajo, parroquias. Los sindicatos, las organizaciones de agricultores, las asociaciones profesionales, las asociaciones empresariales, los sindicatos de estudiantes, las asociaciones de veteranos, los grupos eclesiásticos serían llamados a integrar este movimiento.

La primera tarea sería desactivar la campaña del miedo y la desinformación de los medios, así como poner fin al programa de vacunación contra el Covid de las grandes farmacéuticas.

Los medios corporativos deben ser desafiados directamente, sin apuntar específicamente a los periodistas convencionales, muchos de los cuales han recibido instrucciones de cumplir con la narrativa oficial. Este esfuerzo requeriría un proceso paralelo a nivel de base, de sensibilización y educación de los conciudadanos sobre la naturaleza del virus, los impactos de la vacuna y el confinamiento.

«Difundir la palabra» a través de las redes sociales y los medios de comunicación en línea independientes se llevará a cabo teniendo en cuenta que Google y Facebook son instrumentos de censura.

La creación de tal movimiento, que desafía enérgicamente la legitimidad de las élites financieras, así como las estructuras de autoridad política a nivel nacional, no es una tarea fácil. Requerirá un grado de solidaridad, unidad y compromiso sin precedentes en la historia mundial.

También requerirá romper las barreras políticas e ideológicas dentro de la sociedad (es decir, entre partidos políticos) y actuar con una sola voz.

También debemos entender que el «proyecto corona» es una parte integral de la agenda imperial de los Estados Unidos. Tiene implicaciones geopolíticas y estratégicas. También requerirá eventualmente desbancar a los arquitectos de esta diabólica «pandemia» y acusarlos de crímenes contra la humanidad. (Michel Chossudovsky, diciembre de 2020. Con algunos cambios menores)

Lo que se requiere es un «verdadero cambio de régimen», la restauración de la democracia y lo que antes se llamaba «El Estado de Bienestar».

La solidaridad debe prevalecer. Una tarea compleja y un compromiso por delante para toda la humanidad.

Sobre el autor

Michel Chossudovsky es un autor galardonado, profesor de Economía (emérito) en la Universidad de Ottawa, fundador y director del Centro de Investigación sobre la Globalización (CRG), Montreal, editor de Global Research.

Ha realizado investigaciones de campo en América Latina, Asia, Oriente Medio, África subsahariana y el Pacífico y ha escrito extensamente sobre las economías de los países en desarrollo con un enfoque en la pobreza y la desigualdad social. También ha realizado investigaciones en Economía de la Salud (Comisión Económica de las Naciones Unidas para América Latina y el Caribe (CEPAL), UNFPA, CIDA, OMS, Gobierno de Venezuela, John Hopkins International Journal of Health Services (1979, 1983)

Es autor de doce libros, entre ellos The Globalization of Poverty y The New World Order (2003), America’s «War on Terrorism» (2005), The Globalization of War, America’s Long War against Humanity (2015).

Es colaborador de la Enciclopedia Británica. Sus escritos han sido publicados en más de veinte idiomas. En 2014, fue galardonado con la Medalla de Oro al Mérito de la República de Serbia por sus escritos sobre la guerra de agresión de la OTAN contra Yugoslavia. Se puede contactar con él en crgeditor@yahoo.com

Véase Michel Chossudovsky, Nota biográfica

Artículos de Michel Chossudovsky sobre la investigación global


Nota para los lectores: Haga clic en los botones de compartir arriba o abajo. Síguenos en Instagram, @crg_globalresearch. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etc.

Fuente: https://www.globalresearch.ca/fake-delta-variant-fourth-wave-another-lockdown-upcoming-financial-crash-worldwide-economic-social-sabotage/5751819

La narrativa sin sentido predominante del Coronavirus, desacreditada en 10 o 26 minutos

Doctor Thomas Binder

Todo prójimo enfermo y todo familiar de prójimo fallecido tiene mi más profunda empatía pero, ante todo, también tiene derecho a conocer la verdad.

Me gustaría presentar la realidad de la crisis de la corona, entrar en su cronología y confrontar sus numerosos mitos y absurdos intelectuales con la cientificidad. Los estudios más importantes están vinculados en el texto. Se puede encontrar más información científica, incluidos enlaces a otros estudios importantes, en las páginas de inicio de «Aletheia – Medicine and Science for Proportionality», el «Corman-Drosten Review Report» y «Doctors for Covid Ethics», de los cuales soy un miembro.

Epidemia de pruebas de PCR, 2006

Como médicos y científicos responsables, en el caso de infecciones diagnosticadas mediante pruebas rápidas de PCR en el contexto de una supuesta epidemia de alcance nacional o pandemia de alcance internacional, siempre debemos considerar la posibilidad de una pseudoepidemia o epidemia deTests.

El 27 de enero de 2007, el New York Times, virtualmente la biblia de los periodistas en cuya integridad todavía se podía confiar en ese momento, publicó un importante artículo titulado: ‘Faith in Quick Test Leads to Epidemic That Wasn’t’; «La fe en las pruebas rápidas conduce a una epidemia que no fue».

El Dr. Herndon, internista de un centro médico en el estado estadounidense de New Hampshire, tose incesantemente durante quince días a partir de mediados de abril de 2006. Pronto, un especialista en enfermedades infecciosas tiene la inquietante idea de que esto podría ser el comienzo de una tos ferina. epidemia. A finales de abril, otros miembros del personal del hospital también estaban tosiendo. La tos intensa y persistente es un síntoma principal de la tos ferina. Y si se trata de tos ferina, el brote debe ser contenido de inmediato porque la enfermedad puede ser fatal para los bebés en el hospital y provocar una neumonía peligrosa en pacientes ancianos frágiles.

Es el comienzo de un extraño episodio en el centro médico: la historia de la epidemia que no lo fue. Durante meses, casi todos los involucrados creen que hay un gran brote de tos ferina en el centro médico con consecuencias de gran alcance. A casi 1.000 miembros del personal se les realiza una prueba rápida de PCR y se les apartó del trabajo hasta que se obtuviesen los resultados; 142 personas, el 14,2% de las examinadas, incluido el Dr. Herndon, dan positivo en la prueba de PCR rápida, por lo que se les diagnostica tos ferina. Miles, incluidos muchos niños, reciben antibióticos y una vacuna como protección. Las camas de hospital se retiran de servicio como medida de precaución, incluso algunas en la unidad de cuidados intensivos.

Meses después, todos los que aparentemente padecen tos ferina se quedan atónitos al saber que en cultivos bacterianos, el estándar de oro diagnóstico para la tos ferina, la bacteria que causa la tos ferina no se pudo detectar en una sola muestra. Toda la locura fue una falsa alarma.

La supuesta epidemia de tos ferina no había tenido lugar en la realidad, sino solo en las mentes de los involucrados, provocada por la fe ciega en una prueba de PCR rápida altamente sensible que se había vuelto tan moderna. En verdad, todos los que habían caído enfermos habían padecido un resfriado inofensivo. Los infecciosos y epidemiólogos habían dejado de lado su experiencia y sentido común y habían ignorado descaradamente este diagnóstico diferencial más probable del síntoma de tos.

Muchas de las nuevas pruebas moleculares son rápidas pero técnicamente exigentes. Cada laboratorio las elabora a su manera como las denominadas ‘cervezas caseras’. Por lo general, no están disponibles comercialmente y rara vez hay buenas estimaciones de sus tasas de error. Su alta sensibilidad hace que sean probables los falsos positivos. Cuando se hacen las pruebas a cientos o miles de personas, como sucedió aquí, los resultados falsos positivos pueden dar la apariencia de una epidemia.

Un infectólogo dijo: En ese momento tuve la sensación de que esto nos daba una sombra de lo que podría ser durante una epidemia de gripe pandémica.

Y un epidemiólogo explicó: Uno de los aspectos más preocupantes de la pseudoepidemia es que todas las decisiones parecían tan sensatas en ese momento.

La locura de una pseudoepidemia o una epidemia de Tests parecía perfectamente normal para muchos involucrados.

Le recomiendo que lea este artículo publicado en el New York Times en 2007 y se pregunte: «¿No deberíamos haber aprendido mucho de esto para el futuro?»

Escándalo de la gripe porcina, 2009

Como médicos y científicos responsables, en una supuesta o real epidemia de ámbito nacional o pandemia de alcance internacional debemos recordar siempre las presuntas o reales epidemias o pandemias anteriores. Aquí está el último.

En la primavera de 2009, un virus de influenza sumamente contagioso y peligroso, el H1N1, parece amenazar a la humanidad. La enfermedad que causa es clínicamente indistinguible de la gripe estacional y se llama gripe porcina.

Expertos como el virólogo alemán Prof. Christian Drosten difundieron escenarios de terror prediciendo millones de muertes en todo el mundo. En mayo, la OMS flexibiliza los criterios para declarar una pandemia por razones que nunca se han explicado. Elimina la peligrosidad del patógeno causante de la definición de pandemia. Ahora, la propagación rápida y masiva de un patógeno comparativamente inofensivo en al menos dos regiones de la OMS es suficiente. Cualquier endemia, cada ola estacional de cualquier gripe o virus del resfriado, sin importar cuán inofensivo sea, puede llamarse pandemia. Inmediatamente, la OMS declara una pandemia de H1N1 el 11 de junio.

Los políticos se toman en serio las advertencias de los expertos y de la OMS. Sin consultar a la población, están adquiriendo cientos de millones de paquetes de medicamentos antivirales costosos y escasamente efectivos y cientos de millones de dosis de vacunas aprobadas apresuradamente que, después de todo, se producen utilizando métodos convencionales.

Los críticos que describen el virus como comparativamente inofensivo son ridiculizados o ignorados inicialmente. Finalmente, los científicos, en Europa especialmente el microbiólogo y epidemiólogo de infecciones alemán Prof. Sucharit Bhakdi y el neumólogo y político alemán Dr. Wolfgang Wodarg, captan la atención en los medios de comunicación y la política. La locura global que ya amenazaba en ese momento puede evitarse justo a tiempo.

En todo el mundo, entre 150 y 600 mil personas murieron con o por el H1N1, que resultó ser menos peligroso que la influenza estacional. En consecuencia, la preparación para la vacunación fue baja. Sin embargo, solo en Suecia, unos 700 niños contrajeron narcolepsia incapacitante, enfermedad del sueño, causada por vacunas innecesarias e inseguras aprobadas apresuradamente. Solo en Suiza, se vendieron o regalaron 1,8 millones de dosis de vacunas en el extranjero y se eliminaron 8,9 millones.

Apenas hubo cobertura mediática del escándalo de la gripe porcina. El éxito temporal del pánico alimentado por los medios se debió principalmente a la interconexión de los expertos, la industria farmacéutica, la OMS y los políticos de la salud. Al final, las autoridades sanitarias aparentemente abrumadas se habían enamorado de una campaña de propaganda casi perfectamente orquestada.

Te recomiendo que veas el documental „Profiteure der Angst – das Geschäft mit der Schweinegrippe“; «Beneficiarios del miedo – El negocio de la gripe porcina», producido en alemán por Arte en noviembre de 2009, y te preguntes: «¿No deberíamos haber aprendido mucho de esto para el futuro?»

‘Evento 201’: Simulación de la pandemia de Corona, 2019

La situación es amenazadora. Un nuevo virus corona se está extendiendo por todo el mundo. El número de casos en el panel de control de la Universidad Johns Hopkins está aumentando y aumentando. El peligroso virus altamente contagioso, inmunorresistente está paralizando el comercio y el transporte a nivel mundial y haciendo que la economía mundial caiga libremente.

Lo que suena como el supuesto brote de la supuesta pandemia de SARS-CoV-2 en la provincia china de Wuhan en diciembre de 2019, es el escenario del «Evento 201».

El 18 de octubre de 2019, la Fundación Bill y Melinda Gates, la Universidad Johns Hopkins y el WEF están organizando una simulación de pandemia con este nombre. Después de la gripe española, la gripe aviar y la gripe porcina, como patógeno no eligen otro virus de la gripe, sino un coronavirus que hasta ahora es completamente desconocido para los profanos, sobre todo para políticos y periodistas.

Esta simulación de una pandemia de corona que estalló en Sudamérica no es atendida por médicos, sino por representantes occidentales de los organizadores, la ONU, la OMS, gobiernos, autoridades y corporaciones globales de los campos de las altas finanzas, farmacéutica, logística, turismo. y los medios de comunicación, así como por el Dr. George Gao, virólogo y director de los CDC chinos, el equivalente chino de la Oficina Federal Suiza de Salud Pública (BAG).

Los participantes están de acuerdo en que una pandemia de corona es disruptiva, solo puede superarse mediante la cooperación gubernamental y privada global, las corporaciones globales relevantes para el sistema deben apoyarse financieramente, las empresas medianas deben sacrificarse si es necesario, las voces que se desvían de la narrativa prevaleciente deben ser censurada constantemente en los medios de comunicación social y de masas, y la pandemia solo se puede acabar con la vacunación de toda la población mundial.

La simulación termina con 65 millones de muertes en todo el mundo.

Te recomiendo que veas el documental „Event 201: Corona-Pandemie vom Reissbrett“; «Evento 201: La pandemia de Corona desde el tablero de dibujo», producido en alemán con subtítulos en inglés por ExpressZeitung en junio de 2020, y te preguntes: «¿No deberían los medios de comunicación informar sobre esto en detalle?»

Corona escándalo, 2020

Dos meses y medio después, el 31 de diciembre de 2019, los CDC chinos, dirigidos por el Dr. George Gao, informan a la OMS 27 casos de neumonía de causa desconocida, de una población china de 1.400 millones. El 7 de enero de 2020, las autoridades sanitarias chinas identificaron un nuevo coronavirus como agente causante.

El 21 de enero de 2020, el profesor Christian Drosten et al. Presentar un artículo , con cuya receta los laboratorios pueden producir una prueba rápida de RT-PCR para la detección del virus denominada 2019-nCoV. Se acepta al día siguiente y se publica en la revista Eurosurveillance otro día después.

La OMS ya había publicado la prueba rápida Drosten RT-PCR en su sitio web una semana antes y la recomendó como el estándar de oro de diagnóstico mundial.

El 30 de enero, Drosten et al. publicó la justificación de la narrativa de la transmisión asintomática epidemiológicamente relevante de 2019-nCoV en la carta al editor del New England Journal of Medicine, virtualmente una de las biblias de nosotros los médicos en cuya integridad todavía podíamos confiar en ese momento, con el título ‘Transmission of 2019-nCoV Infection from an Asymptomatic Contact in Germany’; «Transmisión de la infección por 2019-nCoV a partir de un contacto asintomático en Alemania».

El 11 de febrero, la OMS nombra al nuevo virus corona SARS-CoV-2, la enfermedad que causa COVID-19; enfermedad del coronavirus. Lo hace en contra de la solicitud de los virólogos chinos. Prefirieron llamarlo HCoV-19, coronavirus humano, debido al peligro de que el nombre SARS-CoV-2 pudiera despertar temores infundados por su falta de similitud biológica y epidemiológica con el mucho más peligroso SARS-CoV-1.

El 11 de marzo, la OMS declara una pandemia de COVID. Mientras tanto, su Director General, el biólogo, inmunólogo y filósofo Dr. Tedros Adhanom Ghebreyesus, fue acusado de genocidio en Etiopía ante la Corte Penal Internacional en La Haya. La presunción de inocencia se aplica, por supuesto.

Ahora, casi todo está sucediendo como sucedió durante el escándalo de la gripe porcina en 2009, pero de una manera aún más lubricada. Expertos, en su mayoría médicos de laboratorio y biólogos que trabajan como virólogos o epidemiólogos, que nunca han examinado a nadie que padezca una infección respiratoria, y mucho menos tratado, declaran que el SARS-CoV-2 es prácticamente un extraterrestre del que no sabemos absolutamente nada y que debemos considerar extremadamente peligroso, hasta que en gran parte los mismos expertos hayan demostrado lo contrario en algún momento. En Suiza, se constituyen como ‘Grupo de Trabajo Científico Nacional Suizo COVID-19’ y se ofrecen al Consejo Federal Suizo como asesores científicos.

Los políticos ejecutivos y legislativos, así como las autoridades sanitarias federales y cantonales, todos aterrorizados por ellos, aceptan su oferta y parecen seguirlos tan ciegamente como el Consejo Federal aparentemente siguió ciegamente a la OMS cuando declaró la pandemia de COVID. A diferencia de cualquier club de nueve bolos, el consejo científico asesor ahora oficial del gobierno suizo a través de lo que se supone que es la mayor crisis de Suiza desde la Segunda Guerra Mundial no mantiene ningún registro de sus actividades.

El 16 de marzo, el Consejo Federal Suizo declara la ‘situación excepcional’, el nivel de peligro más alto de la ley epidémica, basado en exactamente cero evidencia científica,

Los medios de comunicación, incluida la emisora ​​pública suiza SRG, asumen la tercera parte de este conglomerado de ignorancia, arrogancia, incompetencia e irresponsabilidad organizada que se intensifican mutuamente. Ellos mismos, sin cerebro y sin corazón, martillean en nuestras cabezas durante todo el día:

Existe una pandemia de un virus corona killer transmisible asintomáticamente, altamente contagioso e incluso epidemiológicamente relevante. ¡Todo ser humano aparentemente sano y cordial puede ser tu ángel de la muerte!

A diferencia de 2009, los medios de comunicación censuran, desacreditan y difaman constantemente a los médicos y científicos que cuestionan, incluidas luminarias como John Ioannidis, profesor de medicina, epidemiología y salud pública en la Facultad de Medicina de la Universidad de Stanford, uno de los científicos más reconocidos y citados del mundo, especializado en fraude científico; el Prof. Sucharit Bhakdi y el Dr. Wolfgang Wodarg. Después de haber sido difamado, incluyendo presuntas amenazas a políticos y mi familia, por parte de un particular muy conocido por mí, fui brutalmente arrestado por una unidad antiterrorista en mi consulta y, después de que inmediatamente resultó que no había amenazado a nadie, simplemente la visión del mundo de gente enferma, fui enviado a un pabellón psiquiátrico cerrado durante seis días debido a ‘ponerme en peligro mientras estaba en la locura COVID’.

Los gobiernos de casi todos los países parecen haber olvidado sus planes epidémicos, que sabiamente preservan a los individuos, la sociedad y la economía. En obediencia ciega a la OMS y a los grupos de presión, llamados expertos, están implementando intervenciones no farmacológicas autodestructivas, incluidos bloqueos nunca antes considerados, siguiendo el modelo autoritario chino. Lo están haciendo casi a nivel mundial, al mismo tiempo.

Sin consultar a la población, obtienen miles de millones de dosis de inyecciones de ARNm y ADN de emergencia, que incluso son aprobadas temporalmente por Swissmedic. Esta tecnología se está utilizando ampliamente en humanos por primera vez. Casi en todo el mundo, la constitución, el estado de derecho, los derechos humanos, las libertades civiles, la ética, la cientificidad y el sentido común están siendo sacrificados a favor de un régimen autoritario cuasi global bajo el control de la OMS: ¡Quién controla a la OMS, controla mundo!

Todos los elementos de la narrativa corona predominante se inventan a partir del vacío libre de hechos

1. El SARS-CoV-2 no surgió en Wuhan en diciembre de 2019. Primero, en noviembre de 2020, un estudio de Milán mostró que el SARS-CoV-2 era endémico en Italia ya en septiembre de 2019, antes de la temporada de gripe 2019/20. Otros estudios mostraron lo mismo más tarde, por ejemplo en Francia.

2. No hay una epidemia de SARS-CoV-2 de alcance nacional, por lo tanto, no hay una pandemia. Esto ya es evidente por la falta de exceso de mortalidad cuando se corrige por demografía, y por la baja ocupación de las unidades de cuidados intensivos, cuyas capacidades, además, se han reducido enormemente desde abril de 2020.

3. La indicación para realizar pruebas, es decir, no solo en pacientes hospitalizados críticamente enfermos con necesidad de una terapia antiviral específica, en el sistema de vigilancia y en una cohorte de estudio, sino también para realizar pruebas incluso asintomáticas, antes llamadas personas sanas y, además de eso, es incorrecto realizar una prueba para uno solo de todos los virus respiratorios que deben considerarse en el diagnóstico diferencial de las infecciones respiratorias .

4. La prueba Drosten RT-PCR no es diagnóstica de una infección por SARS-CoV-2 ni de una enfermedad o muerte por COVID-19. El 27 de noviembre de 2020, un grupo internacional de 22 científicos de la vida, incluyéndome a mí, publicó una «Revisión externa por pares del documento Corman-Drosten».

Explicamos que existen conflictos de interés, que la supuesta revisión por pares dentro de las 24 horas es absurda, y diez fallas científicas fundamentales. Esta publicación médica más importante de 2020, que difícilmente puede ser superada en términos de falta de cientificidad, nunca debería haberse publicado.

El protocolo de prueba Corman-Drosten RT-PCR se fabrica de manera deficiente y vaga, sin validación ni estandarización. Como resultado de la reacción cruzada con otros coronavirus, su especificidad de aproximadamente el 98,6%, y un corresaondiente umbral de 1,4% de falsos positivos, que ya es bajo en ausencia de virus, se reduce aún más hasta el 92,4%, correspondiente a un 7,6% de falsos positivos, durante la temporada de gripe. En todas partes, la prueba se realiza de manera diferente y con umbrales de ciclo demasiado altos. Aunque los estudios han demostrado que no hay virus cultivables presentes en muestras con un valor de Ct superior a 28, las pruebas aún se llevan a cabo con valores de umbral de ciclo superiores a 35. Sus resultados se informan en todo el mundo sin hacer referencia a los síntomas clínicos.

5. Los síntomas, hallazgos clínicos de laboratorio y radiológicos del COVID-19 no se pueden distinguir claramente de las enfermedades causadas por otros virus respiratorios.

6. No hay transmisión asintomática epidemiológicamente relevante de virus respiratorios. Mientras tanto, lo que aprendimos en la escuela de medicina también ha sido confirmado para el SARS-CoV-2 por numerosos estudios. El ‘contacto asintomático’ inventado por el profesor Drosten en la carta al editor del 30 de enero de 2020 fue muy sintomático: la paciente había suprimido sus síntomas con medicación.

Por lo tanto, todas las intervenciones no farmacológicas para personas asintomáticas, antes llamadas sanas, más allá de las medidas efectivas comprobadas para contener la propagación del SARS-CoV-2, la higiene y el autoaislamiento de las personas enfermas, son ineficaces.

7. La alta tasa de letalidad (CFR) del 2%, citada durante mucho tiempo, era engañosa. Todo estudiante de escuela primaria sabe que no es el CFR lo que es relevante, sino la tasa de letalidad por infección (IFR), que fácilmente puede reducirse en un factor de aproximadamente cien debido al número de casos no detectados.

8. La afirmación inicial de que el 5% de las personas infectadas necesitaría un tratamiento de cuidados intensivos fue incorrecta , por las mismas razones que todo estudiante de primaria comprende. Condujo a la adquisición de alrededor de 1.000 ventiladores y al aplazamiento de operaciones que no eran de emergencia pero que eran necesarias.

9. El SARS-CoV-2 no es un asesino en masa. La estimación realista más reciente del IFR global es del 0,15%, por debajo del 0,05% para los menores de 70 años. Después de reemplazar el número de fallecidos en 28 días con una prueba de PCR positiva por cualquier causa por el número de fallecidos por COVID-19, es incluso mucho menor, muy por debajo del de la influenza estacional.

10. Una epidemia no se propaga exponencialmente, sino según una función logística o de Gompertz.

11. Debido a la inmunidad básica y cruzada, solo alrededor del 10-20% de las personas contraen los virus de la corona y la influenza estacionales durante cada temporada de influenza. Es probable que exista inmunidad colectiva desde el final de la temporada Corona-19, en nuestras latitudes medias del norte en abril de 2020. Por lo tanto, una ‘enésima ola de un virus respiratorio’ también es una imposibilidad biológica.

12. Existe una profilaxis eficaz: por ejemplo, estilo de vida saludable, muchos contactos sociales y vitamina D3.

13. Existe una terapia eficaz, bien tolerada y de bajo costo: por ejemplo, budesonida tópica, dosis normales de hidroxicloroquina e ivermectina.

14. Las inyecciones experimentales seriadas de ARNm y ADN son innecesarias (IFR 0.15%; para menores de 70 años menor del 0.05%, incluso mucho menor después de reemplazar el número de fallecidos por cualquier causa dentro de los 28 días con una prueba de PCR positiva por el número de fallecidos de COVID-19, además SARS-CoV-2 está mutando permanentemente y en el sentido de que se vuelve más infeccioso y menos peligroso), ineficaces (según los estudios de registro , que no valen el papel en el que están escritos, las inyecciones de ARNm reducen el riesgo de enfermedad leve COVID-19 absolutamente (!) en <1%, no hay datos para cursos severos y en > 75 años), e inseguras (reacciones anafilácticas, tromboembolismo, trombocitopenia, CID y miocarditis a corto plazo, posible ADE a mediano plazo, posibles enfermedades autoinmunes, cáncer y otras a mediano-largo plazo).

¡El SARS-CoV-2 no es un extraterrestre! Es un miembro recién descubierto de la conocida familia de coronavirus beta. Por lo tanto, evidentemente ocurre estacionalmente de noviembre a abril y muta, sin intervención humana, de tal manera que se vuelve cada vez más contagioso pero menos peligroso. Debido a la inmunidad básica y cruzada existente, solo una fracción de la población se enferma. La enfermedad suele ser autolimitada y deja inmunidad, posiblemente de por vida, y mejor que la mejor vacuna que haya existido. En comparación, mata a pocas personas y, a diferencia de la influenza, a ningún niño.

Toda la narrativa de la corona predominante es una tontería. Justifica la locura inhumana y anticientífica que domina a nivel mundial. Esto se puede ocurrir con cualquier virus respiratorio: si dejamos de hacer pruebas a todas las personas con una prueba RT-PCR hipersensible y poco específica que reacciona de forma cruzada con otros virus por homología con un fragmento de ARN del SARS-CoV-2, y las hacemos para uno de, por ejemplo, la gripe o el metapneumovirus, inmediatamente tendremos una pandemia de pruebas de gripe o metapneumo.

Por cierto, todos los estudiantes de medicina de segundo año deben estudiar los conceptos básicos de epidemiología. Allí se aprende que cuando se declara una epidemia de alcance nacional, se debe conformar inmediatamente una cohorte de estudio representativa de la población. Se utiliza para controlar el número de casos, la gravedad de la enfermedad y el estado de inmunidad, en este caso determinando los anticuerpos y la inmunidad de las células T.

Aunque ha pasado más de un año desde que la OMS declaró la pandemia de COVID, no existe una cohorte de vigilancia tan representativa. Peor aún: de la semana 13 a la 44, la BAG también había detenido el sistema de vigilancia, completando así el vuelo ciego total.

La epidemia es en gran parte una epidemia de pruebas de PCR irreal, pero las medidas opresivas que ha producido son reales; amenazan nuestra libertad, nuestros medios de subsistencia e incluso nuestras vidas.

¡Estimados compañeros responsables!

Recuerden el juramento hipocrático («Primero, no hagas daño, para evitar la tercera cura») y la Declaración de Ginebra de la Asociación Médica Mundial:

No utilizaré mis conocimientos médicos para violar los derechos humanos y las libertades civiles, incluso bajo amenaza.

¡Queridos compañeros humanos responsables!

Despertad, poneos en pie y luchad, pacíficamente pero con firmeza; si no es por ti mismo, ¡por el futuro de Tus hijos y el de sus nietos!


Tres presidentes rechazan las vacunas. Mueren tres presidentes

Tres países que rechazaron las inyecciones experimentales de COVID han visto morir a sus presidentes

O crees que hay una conspiración real o crees que esto no es más que una coincidencia, que va en contra tanto de la lógica como de las Escrituras. Tres presidentes de tres países murieron en circunstancias misteriosas, y con pocos meses de distancia, después de que rechazaran las inyecciones experimentales de COVID para su pueblo.

Aquí están estos hombres.

En Burundi fue presidente Pierre Nkurunziza

En Tanzania, fue el presidente John Magufuli (El que osó ridiculizar a la OMS con sus test PCR positivos a una papaya, una cabra, codorniz y dicen que hasta a aceite de coche usado).

En Haití, fue el presidente Jovenel Moïse

Los tres presidentes están ahora MUERTOS.


¿Cuáles son las probabilidades de que estos tres hombres en particular, todos mueran en el cargo. . . y lo único que tienen en común es que se negaron a aceptar la vacuna para sus países?

Para muchas personas, sus muertes parecen un asesinato; aunque el de Haití fue directamente asesinado, fue asesinado por hombres con armas de fuego.

Todo este esfuerzo y gasto, todo este soborno y coerción, toda esta manipulación e intimidación, toda esta presión y fuerza para protegerse contra un virus que tiene una tasa de supervivencia del 99%.

Y ahora parece haber una clara probabilidad de que tres presidentes hayan sido asesinados porque cada uno rechazó la distribución de las vacunas contra el Covid en sus respectivos países.

A pesar de una densidad de población similar, una mayor población total y una peor atención médica disponible, Haití ha tenido el 1,8% de los casos de Covid que ha tenido Nueva Jersey. Dicho de otra manera, los ciudadanos de Nueva Jersey con una alta tasa de vacunación tienen 53 veces más probabilidades de contraer Covid-19 que los haitianos que no tienen acceso a una vacuna.

Moïse lo sabía. Es una de las razones por las que rechazó las vacunas gratuitas en mayo y junio. Pero no oirán hablar de eso. Ya no. La historia oficial sobre la reticencia a las vacunas en Haití ha cambiado repentinamente tras el asesinato de Moïse. Ahora, los funcionarios de salud en el país afirman que no rechazaron TODAS las vacunas, solo las vacunas de AstraZeneca debido a los mayores riesgos que supuestamente tienen. Por supuesto, esta narrativa no se materializó hasta después de que Moïse fue asesinado.

Con Moïse fuera del camino, las puertas se están abriendo de par en par para la nación que no necesita ni quiere que las vacunas de repente las tengan disponibles. Como si fuera poco, el régimen de Biden ha ofrecido enviar millones de vacunas a la nación muy pronto.

Sorprendentemente, casi todo el mundo está ignorando el hecho de que más estadounidenses han muerto por las vacunas contra el Covid en los primeros CINCO MESES de este año que por todas las vacunas durante los últimos DIEZ AÑOS.

Casi todo el mundo está ignorando el hecho de que un tribunal en Lisboa, Portugal, ha determinado que solo el 0,9% de los «casos verificados» murieron realmente de Covid, que su cifra es de 152, no los 17.000 reclamados. Y la gente también ignora el hecho de que las denuncias fraudulentas sobre muertes por Covid como las de Portugal son universales y se están produciendo donde viven.

Casi todo el mundo está ignorando el hecho de que la Unión Europea ha informado de que hasta el 19 de junio de 2021, ha habido 1,5 millones de heridos por vacuna y más de 15.000 muertes.

Informes como estos son interminables, y casi todo el mundo los ignora por completo.

Y ahora, es cuando Haití se va a contagiar ¿SERÁ HAITÍ LA PRÓXIMA INDIA? | Las termitas del cielo (wordpress.com) escrito el 9 de mayo. En este caso, muerto el perro aparece la rabia.

Conclusión, es la vacuna ¿Qué hay en la vacuna?

Fuentes: (Tres presidentes rechazan las vacunas contra el Covid; Mueren tres presidentes – LewRockwell); (Hal Turner Radio Show – Three Countries on Earth Declined the COVID Vax; Los tres de sus presidentes ahora están MUERTOS)

152 muertes por covid en Portugal desde enero de 2020

PDF de la Sentencia

Desde marzo de 2020 han muerto en Portugal 152 personas de covid, nombradas formalmente por el ministerio de sanidad y confirmadas por un tribunal.

Todos los «otros» murieron de todo lo demás que mata y acaba de tener una prueba PCR positiva inútil!

Los datos son de SICO, el único sistema de certificados de defunción en Portugal. La referencia a «bajo la tutela del MJ es espuria, todos se emiten bajo la tutela del MJ que es la única institución que los emite.

Vivimos en un fraude de dimensiones nunca antes visto.

En respuesta a una acción popular, fue necesario citar al tribunal para que el ministerio respondiera, desesperado por no denunciar el fraude.

Todos los responsables de la manipulación de los datos de «casos» y «muertes» sólo pueden, después de esto, ser juzgados por el delito si queda algo de dignidad en el estado de derecho.

152 mortes de covid em Portugal desde janeiro 2020

Fuente: 152 muertes por covid en Portugal desde enero de 2020 | andre-dias.net

Tribunal Administrativo de Viena: Política coronavirus sin fundamento, prueba de PCR inapropiada

Un fallo que toda Austria, y tal vez el mundo entero, lleva esperando más de un año.

Por fin, un tribunal ha examinado los fundamentos inestables sobre los que descansa la política corona, que reclama una peligrosa pandemia mundial. Recientemente, el reconocido profesor John Ioannidis encontró que la mortalidad por infección por SARS-CoV-19 es sólo del 0,15 por ciento, exactamente la misma que la de la gripe anual. Durante la supuesta pandemia, aproximadamente tantas personas parecen haber contraído covid-19 como de otra manera habría contraído la gripe – mientras que supuestamente no hay o casi ningún caso de gripe en todo el mundo. Esto está dando a más y más personas una pausa para pensar.

Definición de enfermedad completamente incorrecta

El Tribunal Administrativo de Viena examinó de cerca las bases de la política histérica del gobierno federal austriaco y constató que la definición de enfermedad del ministro Anschober por sí sola es completamente errónea e infundada.

Si uno va por las definiciones del Ministro de Salud, «Definición de caso Covid-19» de 23.12.2020, un «caso confirmado» es:

1) cualquier persona con detección de ácido nucleico específico SARS-CoV-2 (prueba de PCR, nota), independientemente de la manifestación clínica, o

2) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios clínicos, o

3) cualquier persona, con detección de antígeno específico sars-cov, que cumpla con los criterios epidemiológicos.

Por lo tanto, ninguno de los tres «casos confirmados» definidos por el Ministro de Salud cumple con los requisitos del término de la OMS «persona enferma/infectada». La OMS rechaza la única invocación de la prueba del ITP (caso confirmado 1).

Motivo de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Si viviéramos en una democracia, este juicio sería capaz de cambiarlo todo. Todas las medidas tendrían que ser revocadas inmediatamente, todo el gobierno federal tendría que renunciar y tendría que ser procesado legalmente por la destrucción sin sentido de innumerables medios de vida.

Una cita igualmente memorable, que muestra hasta qué punto la política, pero también los medios comprados han engañado al público en el último año:

En él, el Servicio de Salud de la Ciudad de Viena utiliza las palabras «números de caso», «resultados de pruebas», «incidencia de casos», así como «número de infecciones». Esta mezcla de términos no hace justicia a una evaluación científica de la situación epidémica. (…) Para la OMS, el factor decisivo es el número de infecciones/enfermedades y no el número de personas que dieron positivo u otros «números de casos».

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, 24 de marzo de 2021

Como base de la parte médica de las razones de la sentencia, el tribunal se basó en lo siguiente:

Aviso de información de la OMS para usuarios de IVD 2020/05, tecnoloqies de testinq (NAT) de ácido nucleico que utilizan reacción en cadena de polimerasa (PCR) para la detección de SARS-CoV-2, 20 de enero de 2021.

Estudio de 2020 (Bullard, J., Dust, K., Funk, D., Strong, J. E., Alexander, D., Garnett, L., & Poliquin, G. (2020). Predecir el coronavirus del síndrome respiratorio agudo grave infeccioso 2 a partir de muestras diagnósticas. Enfermedades Infecciosas Clínicas, 7j(10), 2663-2666.)

Dr. Cary Mullis (inventor de la prueba de PCR): «… que una prueba de PCR no es diagnóstica y, por lo tanto, por sí sola no revela nada sobre la enfermedad o infección de una persona.»

El tribunal afirma que un médico por sí solo tiene derecho a determinar si una persona está enferma o sana (2 párr. 2 Z 1 y 2 Ärztegesetz1998, BGBI. I. Nº 169/1998 modificado por BGBI. I No. 31/2021).

También se menciona la extrema tendencia a errores de las pruebas de antígeno, y se critica que la Comisión Corona se basaría exclusivamente en tales pruebas de antígeno para los análisis actuales. Esta pequeña información por sí sola es una bomba política.

Si la Comisión Corona hubiera utilizado la definición de caso del Ministro de Salud y no la de la OMS; cualquier determinación del número de «números enfermos/infectados para «enfermos/infectados» es errónea.

Motivos de la sentencia VGW-103/048/3227/2021-2, Tribunal Administrativo de Viena, de 24 de marzo de 2021.

El veredicto aún puede ser apelado ante el Tribunal Constitucional o se puede presentar un recurso extraordinario ante el Tribunal Contencioso Administrativo.

Vienna Administrative Court: Corona Policy Without Basis, PCR Test Inappropriate | Europe Reloaded

Oponerse a la dictadura sanitaria perjudica gravemente la salud

Opposing the health dictatorship seriously harms health

Burundi y Tanzania compartieron la oposición de sus dirigentes ante las medidas de la OMS. El presidente de Burundi, Pierre Nkurunziza, expulsó a los sicarios de la OMS de su país, mientras que el presidente tanzano, John Magufuli, químico, hizo lo propio, tras demostrar al mundo que los test PCR con los que querían justificar la inexistente epidemia, ofrecían falsos positivos, tanto en muestras obtenidas en papayas, como en aceite de coche o en cabras. Twitter.

La osadía de estos presidentes les ha costado la vida, ambos han sufrido un desafortunado «infarto» como advertencia al resto sobre que va a suceder a cualquiera que no colabore con los psicópatas que controlan el mundo

Estamos ante dos mártires de la lucha contra la dictadura mundial, pero una historia escrita por estos asesinos, olvidará pronto y pervertirá la memoria sobre estos y todos los que se oponen a el N.O.M.

Por supuesto sus sucesores han tomado buena nota de lo que les espera si no colaboran y de lo rentable que puede resultar para ellos que lo hagan. No habrá que extrañarse, pues, de que de las ínfimas cifras de muertes atribuidas al coronavirus en dichos países (recordemos que los diez países más pobres de Africa han tenido, en conjunto, menos víctimas mortales del Covid que la Comunidad Autónoma de Madrid, por tener un referente) pasemos en breve a elevadas tasas de mortalidad que «obliguen» a las autoridades a abrir las puertas a las «salvadoras» compañías farmacéuticas.

A estas alturas debería entenderse que a pesar de ser un negocio millonario, no se trata solo de dinero. También que estamos solo al principio de algo mucho peor de lo que las mentes más retorcidas puedan sospechar.

(Fuente: Astillas de realidad)

El médico Sciuto desmonta versión oficial del coronavirus

Con el aplomo y la seguridad en sí mismo de quien se sabe portavoz de la verdad, el médico uruguayo Javier Sciuto, que en esta entrevista de 18 minutos aparece acompañado por los empresarios Fernando Vega y Fernando Ferreira, pone las cartas sobre la mesa y demuele la versión oficial de la Plandemia con la precisión de un cirujano:


Lo que dice este médico será en cuestión de tiempo aceptado como evidente, aunque ahora prevalezcan en los medios las mentiras de quienes mercadean con nuestra salud y nuestros derechos:

* “Si hacemos test serológicos a toda la población –que son los test que de verdad hay que hacer y no las PCRs-, en una semana se acaba la pandemia”.

* «Esto que estamos viviendo no es una pandemia causada por un virus, es una pandemia de falsos positivos por PCR».

Tribunal Portugués: Pruebas PCR «poco fiables» y Cuarentenas «Ilegales»

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de «alto riesgo de infección» basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.


La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta «clase de parásitos» ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.»

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.»

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.»

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de «información de secuencia» porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible «aislar» un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos «infectaron» varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.»

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este «virus» secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

«No observamos ninguna liberación del virus del lado basolateral de la cultura HAE».

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de «origen desconocido».

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.»

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba «ahí». Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

«Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas»

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.»

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado».

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.»

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.»

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.»

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del «virus». Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, «esta afirmación sugiere que cada prueba debe ser positiva», (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

«Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.»

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada «basura», ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

«Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.»

La definición legal de una conspiración es:

«Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo»

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada «nueva normalidad», que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

«Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico».


The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

«Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, «said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, «he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, «the doctor recalled».

La hoja de ruta de Covid-19: Hacia el caos económico mundial y la destrucción social

Si bien estas estadísticas oficiales erróneas utilizadas para «medir» la propagación del virus no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

Por el profesor Michel Chossudovsky Global Research, 13 de octubre de 2020

Ahora se confirma sin lugar a dudas que la prueba de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizada para estimar casos positivos COVID-19 no tiene sentido. No puede detectar ni identificar el virus. Lo que detecta son partículas o fragmentos de numerosos virus, incluyendo el resfriado común (corona beta) y la gripe estacional (virus A y B)

PCR- Positivo no implica Covid-19 Positivo. Las estadísticas derivadas de la prueba de ITP no miden los «casos confirmados». La prueba del ITP no proporciona las estadísticas requeridas (por los responsables de la formulación de políticas y las autoridades sanitarias nacionales) para evaluar el número de personas infectadas.

Si bien estas estadísticas oficiales erróneas utilizadas para «medir» la propagación de la infección viral no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

La prueba de PCR es la pistola humeante. ¿por qué?

Debido a que la prueba de PCR es defectuosa e inválida como medio para identificar la propagación del virus, lo que significa que TODAS LAS DECISIONES PRINCIPALES tomadas por la OMS y los gobiernos nacionales desde finales de enero de 2020 (apoyadas por estadísticas defectuosas) no son válidas. Además, los informes oficiales, incluida la OMS, confirman que Covid-19 no es un virus asesino, tiene características similares a la gripe estacional.

El propósito de este artículo es examinar cómo estas decisiones de gran alcance, invariablemente basadas en mentiras y estadísticas erróneas, han contribuido a un estado de caos económico, social y político en todo el mundo, lo que ha llevado al cierre y cierre de 190 economías nacionales de los Estados miembros de las Naciones Unidas. Sólo tres países, entre ellos Bielorrusia, Nicaragua y Suecia, se negaron a cerrar su economía nacional.

El cierre de las economías nacionales se presentó como un medio para hacer frente al «Virus Asesino» y «Salvar Vidas». Está muy documentado, sus impactos han llevado al desempleo masivo y a la pobreza en todo el mundo.

Anexo al presente artículo: Detalles relativos a la prueba RT-PCR

Para obtener más detalles sobre la prueba PCR, haga clic aquí

La hoja de ruta hacia el caos económico y la destrucción social

18 de octubre de 2019. 201 Ejercicio de simulación pandémica

El coronavirus fue nombrado inicialmente 2019-nCoV por la OMS, el mismo nombre que el adoptado en el ejercicio de simulación del 18 de octubre de 2019 201 bajo los auspicios de la Escuela de Salud John Hopkins Bloomberg, Centro para la Seguridad de la Salud (un evento patrocinado por la Fundación Gates y el Foro Económico Mundial). (Evento 201)

7 de enero de 2020: Las autoridades chinas «identificaron un nuevo tipo de virus» que (según los informes oficiales) fue aislado el 7 de enero de 2020.

20-24 de enero: Reuniones del Foro Económico Mundial en Davos. El papel de los poderosos intereses financieros

Los intereses financieros dominantes, las fundaciones multimillonarias y las instituciones financieras internacionales desempeñaron un papel clave en la puesta en marcha de la Emergencia de Salud Pública de la OMS (PHEIC). La decisión no fue tomada por la OMS.

En la semana anterior a esta histórica decisión de la OMS. El PHEIC fue objeto de «consultas» en el Foro Económico Mundial (WEF), Davos (21-24 de enero). El Director General de la OMS, Dr. Tedros, estuvo presente en Davos. Estas consultas fueron fundamentales para influir en la decisión histórica de la OMS del 30 de enero.

¿Hubo un conflicto de intereses definido por la OMS? El mayor donante de la OMS es la Fundación Bill y Melinda Gates, que junto con el WEF y el CEPI ya había anunciado en Davos el desarrollo de una vacuna Covid-19 antes del histórico 30 de enero de la PHEIC.

28 de enero de 2020: El Centro para el Control y la Prevención de Enfermedades (CDC) de los Estados Unidos confirmó que el virus de la novela corona había sido aislado. Hasta la fecha, el proceso de identificación del virus no se ha hecho público.

30 de enero de 2020: La Emergencia de Salud Pública de Preocupación Internacional (PHEIC) de la OMS

La primera etapa de esta crisis fue lanzada por la OMS el 30 de enero. Aunque oficialmente no fue designada como una «Pandemia», sin embargo contribuyó a encabezar la campaña del miedo.

Desde el principio, las estimaciones de «casos positivos confirmados» han sido parte de un «Juego de Números».

En algunos casos las estadísticas simplemente no se mencionaban y en otros casos los números se inflaban con el fin de crear pánico.

El número de «casos confirmados» basado en estimaciones erróneas (PCR) utilizadas para justificar esta decisión de alcance lejano fue ridículamente bajo.

La población mundial fuera de China es del orden de 6.400 millones. El 30 de enero de 2020 fuera de China había:

83 casos en 18 países, y sólo 7 de ellos no tenían antecedentes de viajes en China. (véase OMS,30 de enero de 2020).

El 29 de enero de 2020, el día anterior al lanzamiento del PHEI(registrado por la OMS), hubo 5 casos en los Estados Unidos, 3 en Canadá, 4 en Francia, 4 en Alemania.

No había una «base científica» que justificara el lanzamiento de una emergencia mundial de salud pública.

Captura de pantalla de la tabla de la OMS, 29 de enero de 2200,

un día antes de la decisión de la OMS de declarar una emergencia mundial de salud pública

Esos números ridículamente bajos (no mencionados por los medios de comunicación) se utilizaron para encabezar una campaña de miedo en todo el mundo.

31 de enero de 2020: Decisión del presidente Trump de suspender los viajes aéreos con China

Mientras que la OMS «no recomendó restricciones a los viajes o al comercio», los cinco llamados «casos confirmados» en los Estados Unidos fueron suficientes para «justificar» la decisión del presidente Trump el 31 de enero de suspender los viajes aéreos a China mientras precipitaba una campaña de odio contra los chinos étnicos en todo el mundo occidental.

Esta histórica decisión del 31 de enero allanó el camino hacia la interrupción del comercio internacional de productos básicos, así como las restricciones mundiales a los viajes aéreos.

Y esos «casos confirmados» defectuosos fueron en su mayor parte utilizando la prueba RT-PCR estándar.

20-21 de febrero de 2020. Datos de Covid en todo el mundo fuera de China: el crucero Diamond Princess

Si bien China informó de un total de 75.567 casos de COVID-19, (20 de febrero) los casos confirmados fuera de China eran abismáticamente bajos y las estadísticas basadas en gran parte en la prueba de ITP utilizada para confirmar la «propagación mundial del virus» eran cuestionables, por decir lo menos. Además, de los 75.567 casos en China, un gran porcentaje se había recuperado. Y las cifras de recuperación no fueron reconocidas por los medios de comunicación.

El día de la histórica conferencia de prensa del Dr. Tedros (20 de febrero de 2020) el número registrado de casos confirmados fuera de China fue de 1073 de los cuales 621 eran pasajeros y tripulantes en el Diamond Princess Cruise Ship (atrapado en aguas territoriales japonesas).

Desde un punto de vista estadístico, la decisión de la OMS que señalaba una posible «difusión del virus en todo el mundo» no tenía sentido.

El 20 de febrero, el 57,9% de los «casos confirmados» de Covid-19 en todo el mundo eran de la Diamond Princess, apenas representativa de una «tendencia estadística» mundial. La historia oficial es la siguiente:

  • Un pasajero con sede en Hong Kong que había desembarcado de la Princesa Diamante en Hong Kong el 25 de enero desarrolló neumonía y fue positivo para la novela coronavirus el 30 de enero.
  • Se informó que había viajado el 10 de enero a Shenzhen en China continental (que limita con los nuevos territorios de Hong Kong).
  • La Princesa Diamante llegó a Yokohama el 3 de febrero. Se impuso una cuarentena al estudio de la serie de cruceros Ver NCBI.
  • Muchos pasajeros se enfermaron debido al confinamiento en el barco.
  • Todos los pasajeros y la tripulación de la Princesa Diamante emprendieron la prueba de PCR.
  • El número de casos confirmados aumentó a 691 el 23 de febrero.

Desde el punto de vista de la evaluación de las tendencias estadísticas mundiales, los datos no se levantan. Sin los datos de Diamond Princess, los llamados casos confirmados en todo el mundo fuera de China el 2o de febrero habrían sido del orden de 452, de una población de 6.400 millones de habitantes.

Examine el gráfico de la OMS a continuación. El azul indica los casos confirmados sobre la Diamond Princess (transporte internacional) (que llegó a Yokohama el 3 de febrero de 2020), muchos de los cuales estuvieron enfermos, confinados en sus habitaciones durante más de dos semanas (cuarentena impuesta por Japón). Todos los pasajeros y la tripulación realizaron la prueba RT-PCR (que no detecta ni identifica Covid-19).

No hace falta decir que estos supuestos datos fueron fundamentales para encabezar la campaña del miedo y el colapso de los mercados financieros en el transcurso del mes de febrero. (ver sección a continuación)

Fuente OMS, 28 de febrero de 2020

La crisis financiera de febrero de 2020. El choque corona 2020

Del 20 al 21 de febrero de 2020 se cumple el inicio del colapso financiero de 2020.

20 de febrero de 2020: En una conferencia de prensa celebrada el jueves 20 de febrero por la tarde (hora del AEC) en una reunión informativa en Ginebra, el Director General de la OMS. El Dr. Tedros Adhanom Ghebreyesus, dijo que era

«preocupado de que la posibilidad de contener el brote de coronavirus se «cerrara» …

«Creo que la ventana de oportunidad sigue ahí, pero que la ventana se está estrechando.»

Estas declaraciones de «shock and awe» contribuyeron a aumentar la campaña del miedo, a pesar del hecho de que el número de casos confirmados fuera de China era extremadamente bajo.

Oficialmente 1073 casos en todo el mundo.

Excluyendo a la Diamond Princess, 452 los llamados «casos confirmados» en todo el mundo fuera de China, para una población de 6.400 millones registradas por la OMS el 20 de febrero, 15 en los Estados Unidos, 8 en Canadá, 9 en el Reino Unido.

Se registraron un mayor número de casos fuera de China en Corea del Sur (153 casos según la OMS) e Italia (registrados por las autoridades nacionales).

Datos de la OMS registrados en febrero de 2020 al comienzo del llamado Covid Financial Crash (derecha)

La declaración del Dr. Tedros (basada en conceptos y estadísticas defectuosos) puso las bases para el colapso financiero de febrero provocado por información privilegiada, conocimiento previo, comercio de derivados, ventas en corto y una gran parte de las operaciones de los fondos de cobertura.

Quien tuviera conocimiento previo (información privilegiada) de la declaración del Director General de la OMS del 20 de febrero habría cosechado importantes beneficios monetarios.

¿Hubo un conflicto de intereses? La OMS recibe fondos de la Fundación Gates. Y Bill Gates tiene «60% de sus activos invertidos en acciones [incluyendo acciones y fondos de índices]», según un informe de la CNBC de septiembre de 2019.

El desplome bursátil iniciado el 20 de febrero, conocido como el Accidente coronavirus 2020,fue categorizado como:

«la caída más rápida en los mercados bursátiles globales en la historia financiera, y el desplome más devastador desde el accidente de Wall Street de 1929.»

La causa de la crisis financiera fue (según los analistas), V. El Virus. La propagación del virus fuera de China.

La campaña de miedo del «virus asesino» junto con las oportunas «advertencias» del Dr. Tedros sobre la necesidad de implementar una pandemia mundial sirvieron indeleblemente a los intereses de los especuladores institucionales y fondos de cobertura de Wall Street. El desplome financiero condujo a un cambio importante en la distribución de la riqueza del dinero. (ver análisis a continuación)

En la semana siguiente al anuncio de la OMS del 20 al 21 de febrero,el Dow Jones se derrumbó un 12% (CNBC, 28 de febrero de 2020). Según los analistas, la caída de la DJIA fue el resultado de la propagación mundial del virus. Una declaración sin sentido en contradicción con el (pequeño) número de estimaciones positivas de la OMS Covid, la mayoría de las cuales se basaron en la prueba de PCR defectuosa.El lunes 24 de febrero, tras la reapertura de los mercados bursátiles, hubo una caída sin precedentes en el Dow Jones atribuible a los «peligros inminentes» que«Covid estaba extendiendo en todo el mundo creando incertidumbres en los mercados financieros»..Las existencias cayeron bruscamente el lunes (24 de febrero) a medida que aumentaba el número de casos de coronavirus fuera de China,lo que avivó los temores de una prolongada desaceleración económica mundial debido a la propagación del virus. El promedio industrial Dow Jones cerró 1.031,61 puntos menos, o un 3,56%, en 27.960,80.» (CNBC) (sin cursivas en el apartado de inglés)

Promedio industrial Dow Jones Diciembre 2019 – Marzo 2020

También el 24 de febrero, Trump solicitó una ayuda de emergencia de 1.250 millones de dólares.

Según la BBC, los mercados bursátiles mundiales vieron fuertes caídas «debido a las preocupaciones sobre el impacto económico del virus», lo que sugiere que el virus era «la «mano» invisible responsable de la disminución de los mercados financieros.

COVID-19 fue identificado por poco como el catalizador de la crisis financiera.

¿Quién estaba detrás de este catalizador? ¿Quién estuvo detrás de la campaña de miedo que contribuyó a desencadenar el caos y la incertidumbre en los mercados financieros?

11 de marzo de 2020: La pandemia Covid-19, encierro, cierre de 190 economías nacionales

El Director General de la OMS había puesto las bases en su Conferencia de Prensa del 21 de febrero. «el mundo debería hacer más para prepararse para una posible pandemia de coronavirus». La OMS ha pedido a los países que estén «en una fase de preparación».

El 11 de marzo de 2020: la OMS declaró oficialmente una pandemia mundial en un momento en que había 18.000 casos confirmados y 4291 muertes de una población mundial total fuera de China del orden de 6.400 millones de personas. ¿Qué te dicen estas «estadísticas»?

Inmediatamente después del anuncio del 11 de marzo de la OMS, la campaña del miedo se puso en marcha. Al igual que en el caso del accidente del 20 al 21 de febrero, la declaración del 11 de marzo del Director General de la OMS había puesto las bases. Los mercados bursátiles se desplomaron en todo el mundo. A la mañana siguiente, el Dow (DJIA) se desplomó un 9,99% (una disminución de 2.352,60 para cerrar en 21.200,62). El Jueves Negro, 12 de marzo de 2020, fue «el peor día del Dow» desde 1987. Se había producido una transferencia masiva de la salud de la riqueza financiera en favor de los multimillonarios estadounidenses.

Las instrucciones de confinamiento se transmitieron a 193 Estados miembros de las Naciones Unidas.Los políticos son los instrumentos de poderosos intereses financieros. ¿Se justificó esta decisión de gran alcance como un medio para combatir el Virus?

Sin precedentes en la historia, aplicada casi simultáneamente en un gran número de países, sectores enteros de la economía mundial fueron desestabilizados. Las pequeñas y medianas empresas fueron conducidas a la bancarrota. El desempleo y la pobreza son desenfrenados.

En algunos países han estallado las hambrunas. Los impactos sociales de estas medidas son devastadores. Los impactos en la salud (mortalidad, morbilidad) de estas medidas, incluida la desestabilización del sistema de atención sanitaria nacional (en numerosos países) superan con creces los atribuidos a Covid-19. (Para más detalles ver artículo del autor aquí,

Enriquecimiento multimillonario. La apropiación y redistribución de la riqueza

La riqueza multimillonaria ha aumentado drásticamente desde principios de febrero. Hay tres fases distintas, que están directamente relacionadas con la crisis de la corona, cada una de las cuales está marcada por cambios importantes en la distribución de la riqueza global.

  1. La crisis financiera iniciada el 20 de febrero propiciaba una redistribución dramática de la riqueza monetaria y la propiedad de los activos financieros. El conocimiento previo, la información privilegiada y el comercio especulativo desempeñaron un papel clave. ¿Hubo conocimiento previo de la declaración del Dr. Tedros de la OMS del 20 de febrero?
  2. El cierre y cierre del 11 de marzo de las economías nacionales de 190 Estados miembros de la ONU, que desencadenaron las quiebras tanto de las pymes como de las pymes en todo el mundo. El evento del 11 de marzo también estuvo marcado por la caída de los mercados bursátiles en todo el mundo, comenzando el jueves negro 12 de marzo de 2020.
  3. La tercera etapa del enriquecimiento multimillonario se refiere a la aplicación de la llamada «Segunda Ola», que consiste en desencadenar una nueva ola de quiebras.

La redistribución de la riqueza en favor de la clase multimillonaria se confirma mediante un estudio de IPS relativo al cierre de la economía mundial.

La riqueza combinada de los multimillonarios estadounidenses aumentó en 850.000 millones de dólares desde el 18 de marzo de 2020,lo que supone un aumento de más del 28 por ciento. (Esta estimación no tiene en cuenta el aumento de la riqueza durante el período anterior al 18 de marzo, que estuvo marcado por una serie de desplomes bursátiles).

El 18 de marzo de 2020, los multimillonarios estadounidenses habían combinado una riqueza de 2.947 billones de dólares. Para el 8 de octubre, su riqueza ha aumentado a 3,8 billones de dólares (3.798 millones de dólares para ser exactos).

A nivel mundial, los multimillonarios son grandes ganadores durante la pandemia de Covid-19. Según un reciente informe de UBS, los aproximadamente 2.189 multimillonarios mundiales tienen actualmente 10,2 billones de dólares. Se trata de un aumento estimado de 1,5 billones de dólares durante la pandemia que examinan los datos multimillonarios de UBS y Forbes de 2019.

La siguiente tabla identifica el aumento de la riqueza personal de los cinco multimillonarios estadounidenses más ricos (del 18 de marzo al 17 de junio de 2020). (No esbozada en el cuadro, la riqueza de los multimillonarios estadounidenses aumentó en otros 266.000 millones de dólares de junio a octubre de 2020).

Reflexionemos ahora brevemente sobre la Segunda Ola que ahora se impone a millones de personas.

La segunda ola

Septiembre-Octubre 2020. El establecimiento financiero ha dado instrucciones a los gobiernos para que apliquen lo que equivale a un segundo programa de bancarrota utilizando el pretexto y la justificación de que el número de casos positivos de Covid ha aumentado.

Con toda probabilidad, esta segunda oleada conducirá a un nuevo proceso de apropiación y concentración de la riqueza.

Al mismo tiempo, hay una tendencia hacia las formas totalitarias de gobierno.

Todas las formas de actividad social se ven afectadas incluyendo reuniones familiares, bodas y funerales, reuniones públicas, por no hablar del cierre de escuelas, universidades, museos, eventos deportivos y culturales. Ahora se están aplicando medidas del estado policial para hacer cumplir el cumplimiento. ¡Y la gente acepta!

Al comienzo de la Segunda Ola, el proceso de posponer la reapertura de la economía mundial contribuirá indeleblemente a acabar con las pequeñas y medianas empresas (regionales y locales) de todo el mundo, al tiempo que precipitará la quiebra de sectores enteros de la economía mundial, incluidas las aerolíneas, las cadenas hoteleras y la industria turística. Esto, a su vez, conducirá a la apropiación de activos reales por parte de poderosos intereses financieros.

La campaña del miedo ha vuelto a estar en marcha.

Las estadísticas oficiales basadas en estimaciones erróneas y manipuladas de los llamados casos positivos «confirmados» de Covid constituyen la base para justificar estas medidas diabólicas.

V el virus se presenta como la amenaza. Pero el virus no tiene un impacto directo en las variables económicas clave.

Lo que está en juego no tiene precedentes: es una agenda neoliberal global llevada a cabo por gobiernos corruptos en nombre del establishment financiero.

El sentido común nos dice que el cierre de la economía global destruye la vida de las personas.

Interrumpir la campaña del miedo constituye el primer paso hacia la reversión de la marea

Para más detalles sobre los impactos económicos. Artículo relacionado

Combatir el virus: El desempleo masivo no es la solución

Por el Prof. Michel Chossudovsky, 05 de octubre de 2020

Michel Chossudovsky, Profesor de Economía


La prueba de reacción en cadena de la transcripción inversa-polimerasa (RT-PCR)

La prueba estándar utilizada para detectar / identificar SARS-2 en todo el mundo es la prueba de reacción en cadena de transcripción inversa-polimerasa(RT-PCR) que se utiliza para estimar y tabular el número de casos covid-19 positivos confirmados. (Esta no es la única prueba utilizada. Las observaciones a continuación se refieren únicamente al ITP estándar).

Según el Premio Nobel, la Dra. Kary Mullis, que inventó la prueba de PCR:

«PCR detecta un segmento muy pequeño del ácido nucleico que forma parte de un virus en sí. El fragmento específico detectado está determinado por la elección un tanto arbitraria de las imprimaciones de ADN utilizadas que se convierten en los extremos del fragmento amplificado.»

La prueba de PCR nunca tuvo la intención de identificar el virus.

La prueba pcR estándar aplicada en relación con Covid-19 no detecta ni identifica el virus. Lo que detecta son fragmentos de varios virus, según el reconocido inmunólogo suizo Dr. B. Stadler. Según el Dr. Pascal Sacré, «estas pruebas detectan partículas virales, secuencias genéticas, no todo el virus»

«Fragmentos de virus positivos» no significa«SARS-2 positivo» (o Covid-19 Positivo). La prueba de PCR puede recoger fragmentos de virus de la gripe (A, B) así como coronavirus beta fríos comunes (por ejemplo, OC43, HKU1). Lo que han hecho los gobiernos es dar al ITP positivo una sola etiqueta, a saber, Covid-19, cuando en realidad la prueba positiva de ITP podría ser el resultado de otros virus, incluidos los relacionados con la gripe o el resfriado común coronavirus, que (según los CDC) tienen síntomas similares a Covid-19.

Una vez establecida y aceptada la etiqueta Covid-19 Positive, está sujeta a numerosas formas de manipulación, por no hablar de la falsificación de certificados de defunción.

Qué es Covid-19, SARS-2. ¿Cómo se prueba? ¿Cómo se mide? La campaña del miedo no tiene base científica

Por el Prof. Michel Chossudovsky, 08 de octubre de 2020La fuente original de este artículo es Global ResearchDerechos de autor © Prof. Michel Chossudovsky, Global Research, 2020

Interpretación Errónea del Virus Parte II: Principio y Fin de la Crisis del Coronavirus

Por Dr. Stefan Lanka

Artículo original publicado en la revista: Wissenschafftplus
Enlace al artículo original: https://wissenschafftplus.de/uploads/article/wissenschafftplus-fehldeutung-virus-teil-2.pdf Fuente de la traducción al español: desconocido.

La definición del SARS y del coronavirus o covid-19 significa que se considera que la neumonía atípica es el cuadro clínico que caracteriza a la enfermedad. Si se pueden detectar patógenos conocidos en la neumonía, ésta se considera típica, si no atípica. Uno de los dos hechos decisivos para el SARS y la crisis del coronavirus es que al menos el 20- 30% de todas las neumonías son atípicas. Las causas de la neumonía atípica son claramente conocidas y por lo tanto NO deben presentarse como la causa de un virus desconocido.

Este hecho es suprimido por los infectólogos y virólogos y es la base del miedo y el pánico actuales, porque se crea la impresión entre los afectados, el público y los políticos, de que la neumonía atípica sería especialmente peligrosa y a menudo mortal porque todavía no hay medicamentos ni vacunas para la supuesta nueva enfermedad.

Desde el momento en que se ofrece un procedimiento de prueba para el supuesto nuevo virus, que, oculto por los implicados, también prueba “positivamente” a personas sanas, el número de casos aumenta automáticamente. Inicialmente, las personas con neumonía típica también serán examinadas, luego más y más personas con otras enfermedades.

Esto se considera una prueba práctica de la propagación del virus. Automáticamente, más y más de otras enfermedades se añaden a la enfermedad original “neumonía atípica” y este “síndrome” se muestra como “la nueva enfermedad viral”.

El otro hecho decisivo, no sólo para el SARS y la crisis del coronavirus, es que los virólogos que afirman que los virus causan enfermedades, están suprimiendo una situación obvia abiertamente mentirosa por razones comprensibles.

El método de prueba de virus que se ofrece es un método de detección genética. No aíslan de un virus las secuencias de genes que utilizan para la prueba de detección. Aíslan secuencias genéticas que se liberan típicamente en mayores cantidades cuando los tejidos y las células mueren. Estas secuencias genéticas, generalmente cortas, y componentes del metabolismo humano, constituyen la base para el trabajo de laboratorio posterior.

Sin embargo, con la ayuda de programas informáticos, los virólogos sólo pueden construir mentalmente largas cadenas de material genético a partir de muchas secuencias cortas de genes. Estas son entonces producidas como verdaderas cadenas de ADN viral. Esta es la razón por la que los resultados positivos de las pruebas se obtienen repetidamente incluso en individuos sanos probados.

Para evitar refutarse a sí mismos, estos virólogos ignoran constantemente dos reglas prescritas por la ciencia. Uno es verificar sistemáticamente todas las afirmaciones por sí mismas. La otra es probar todos los supuestos y métodos utilizados mediante experimentos de control.

Si realizaran los experimentos de control, descubrirían que TODAS las secuencias genéticas cortas, que sólo unen mentalmente, para formar una cadena genética viral se originan en el metabolismo humano y no en el exterior, de un supuesto virus.

El impulso de la crisis del coronavirus fue desencadenado por un mensaje de un joven oftalmólogo el 30/12/2019 en Internet, que se difundió de forma inmediata y muy rápidamente. Éste dijo a sus amigos que varias personas estaban en cuarentena en su hospital, que se confirmaron siete casos de SARS, que se cuidaran y protegieran.

El profesor Christian Drosten, de la Charité de Berlín, se enteró de ello e inmediatamente comenzó a elaborar procedimientos de prueba para los virus del SARS antes de que estuviera claro y pudiera determinarse si el informe de China sobre el SARS era verdadero y estaba probado, y especialmente antes de que los virólogos chinos publicaran sus resultados.

Los virólogos autorizados de la Comisión de Control de Enfermedades de China (CCDC) publicaron sus resultados el 24 de enero de 2020 y el 3 de febrero de 2020.

Informan sobre el aislamiento de muchas secuencias genéticas cortas, que, cuando se ensamblan, podrían representar una cadena genética de un nuevo tipo de virus. Los autores señalan expresamente -y todos los demás virólogos implicados hasta la fecha- que aún no se han realizado los experimentos absolutamente necesarios que permitan afirmar que se trata efectivamente de una cadena genética de un virus causante de enfermedades.

Por el contrario: los virólogos chinos incluso señalan explícitamente que la cadena genética construida tiene hasta un 90% de similitud con las cadenas genéticas de los inofensivos y por decenios de antigüedad, reivindicados corona virus en los murciélagos.

El 21/01/2020 (¡3 días antes de la primera publicación de la CCDC!) la OMS recomendó a todas las naciones usar el procedimiento de prueba desarrollado por el Prof. Drosten. Al afirmar que había desarrollado un procedimiento de prueba fiable para el virus, que se estaba extendiendo rápidamente en China, el profesor Drosten, haciendo caso omiso de las normas claramente definidas de la labor científica, que forman parte de su contrato de trabajo, y violando las leyes del pensamiento y la lógica de la virología, ha desencadenado y causado el aumento y la globalización del pánico epidémico chino.

1. El comienzo de la crisis del Coronavirus

Cuando el joven oftalmólogo Li Wenliang informó a siete médicos de Wuhan a través de WhatsApp el 30/12/2019 de que varias personas estaban en cuarentena en su hospital, que se habían confirmado siete casos de SARS, y que debían tener cuidado y protegerse, no tenía la intención de causar pánico.

Si lo hubiera hecho, habría publicado el anuncio en Internet y advertido al público. Uno de los siete destinatarios de este mensaje privado de WhatsApp publicó una “captura de pantalla”, es decir, una foto del mensaje, en Internet sin ser consciente de las posibles consecuencias. Por supuesto, esta información se difundió muy rápidamente dentro de China y luego en todo el mundo.

Este mensaje desencadenó una ola de temor, pánico e indagaciones a las autoridades sanitarias chinas y al gobierno debido al pánico causado por una crisis de SARS en 2003, que la Organización Mundial de la Salud (OMS) clasificó como “amenaza mundial” el 12 de marzo de 2003.

En consecuencia, el Gobierno de Beijing envió una “fuerza de reacción rápida” integrada por epidemiólogos y virólogos del Centro de Control de Enfermedades de China a Wuhan el 31 de diciembre de 2019 para apoyar a las autoridades sanitarias locales y a la provincia circundante de Hubei. El objetivo era comprobar y verificar las afirmaciones de un brote de una epidemia. Si efectivamente se hubiera producido un brote, la situación debería controlarse adecuadamente.

En la primera publicación autorizada de los autores del CCDC sobre los resultados de su investigación, “A New Coronavirus from Patients with Pneumonia in China, 2019”, no se informa de una acumulación de pacientes con neumonía de causa desconocida.

Informan que los pacientes encontrados pueden ser agrupados en un “grupo” con características comunes. La característica común era la visita más o menos frecuente de un mercado mayorista de mariscos en Wuhan. Lo pequeño que era el grupo de pacientes con neumonía atípica puede verse por el hecho de que el CCDC tomó frotis y líquidos del tracto respiratorio inferior de sólo cuatro pacientes, para buscar patógenos conocidos y desconocidos.

Mientras tanto, el pánico en Wuhan y sus alrededores aumentó extremadamente. Ni siquiera las medidas adoptadas por la policía, que el 3 de enero de 2020 pidió al oftalmólogo Li Wenliang que se comprometiera por escrito firmando una declaración punible de cese y desistimiento para no difundir nada más sobre un posible brote de SARS, pudieron frenar la dinámica de pánico que se había desarrollado y que empeoraba peligrosamente.

El 10/01/2020 Wenliang, y poco después también sus padres, desarrollaron los síntomas de la neumonía. Li Wenliang se aisló porque estaba convencido de que había sido infectado con el virus del SARS el día anterior por un paciente ocular. Esto también aumentó el pánico.

Los doctores que lo atendieron realizaron un gran número de pruebas diferentes, todas las cuales resultaron negativas. A medida que su estado de salud se deterioraba y cada vez más personas mostraban la simpatía del público por su destino, las pruebas se continuaron hasta que una primera prueba de SARS, el 30/01/2020, se consideró “positiva”. El desastre del creciente pánico del SARS, que mutó en la crisis mundial del coronavirus, siguió su curso.

Li Wenliang difundió este resultado en Internet con las siguientes palabras: “Hoy las pruebas de ácido nucleico han dado un resultado positivo, el polvo se ha asentado, finalmente diagnosticado”.

Este anuncio aumentó el pánico ya existente. Todo se descontroló por completo cuando publicó su declaración firmada de cese y desistimiento del 03/01/2020 en Internet. Esta publicación de su declaración de cesación, que era peligrosa para él, fue y sigue siendo considerada por todas las personas presas del pánico, como prueba de que hay una nueva epidemia de SARS, porque un médico, que a su vez está afectado, sigue informando y advirtiendo al público a pesar de la amenaza de sanciones.

El pánico aumentó aún más porque la salud de Li Wenliang se deterioró a pesar del uso intensivo de una variedad de sustancias antibióticas y el público participó regularmente de esto. La situación estaba al borde de la escalada porque el informe de su muerte fue más que caótico y contradictorio.

Esta fue y sigue siendo la razón central por la que el público chino y mundial asumió que se había producido otro brote de SARS en Wuhan, pero que se había redefinido como una nueva epidemia, una pandemia con un nuevo nombre, Covid-19.

2. Una, de dos posibles causas del miedo de Li Wenliang

El temor del oftalmólogo Li Wenliang se basa en los acontecimientos de 2003 en China, cuando los científicos occidentales afirmaron que se había producido una acumulación de neumonía atípica en el sur de China. Dos días después de la creación mental de una cadena genética del supuesto nuevo virus (SARS-CoV-1), en la que el Prof. Drosten estuvo significativamente involucrado, el Prof. Drosten ofreció un supuesto procedimiento de prueba para este supuesto virus.

Aproximadamente 800 personas con neumonía atípica, es decir, neumonía en la que no se detectan patógenos conocidos, pero que resultó “positiva” con la prueba del Prof. Drosten, murieron, por lo tanto -posiblemente de forma incorrecta y sobre tratada- con el diagnóstico de SARS en lugar de “neumonía atípica”.

La base de que el temor al SARS se mantuviese y aumentara hasta 2019, son dos publicaciones de 2013 y 2017 que dieron lugar a especulaciones sobre la posibilidad de que aparecieran nuevos coronavirus del SARS. Los autores de ambas publicaciones afirman que los murciélagos sanos proporcionan pruebas de la existencia de secuencias genéticas cortas que pueden ser interpretadas como componentes de un virus.

Estas secuencias genéticas cortas tendrían similitudes con las secuencias genéticas cortas que se declararon componentes del supuesto coronavirus del SRAS-1 (SARS-CoV-1) en 2003.

SARS significa Síndrome Respiratorio Agudo Severo, que es otra descripción de los síntomas de la neumonía atípica.

Se dice que estas hebras genéticas mentales (ficticias, transformadas en realidad) son capaces de desarrollarse en la realidad y formar un virus real. Este virus, que se afirma está en murciélagos y otros animales salvajes pero que sigue siendo inofensivo, podría saltar a los humanos a través de la mordedura, el contacto o el consumo y convertirse en un asesino mortal.

En los seres humanos, este inofensivo virus podría, a través de cambios (mutaciones), convertirse en un coronavirus del SARS que es realmente nuevo y podría causar una enfermedad. Tal acontecimiento y la consiguiente oleada de enfermedades, como la neumonía atípica, deben esperarse en cualquier momento.

Hasta la fecha, los virólogos no han podido aislar un virus del SARS de un paciente, un murciélago, otro animal o en el laboratorio, ni han podido detectar una cadena genética intacta y completa de un virus del SARS. Hasta la fecha no se ha podido confirmar la suposición de los virólogos de que existen de hecho cadenas genéticas virales que están construidas de la misma manera que las cadenas genéticas compuestas de secuencias genéticas cortas.

Hay otras formas en que aún no se ha demostrado la existencia y la presencia de una cadena genética completa de un virus del SARS, aunque desde hace mucho tiempo se dispone de técnicas estándar muy sencillas para determinar la longitud de las secuencias genéticas.

Los temores alimentados masivamente por tales afirmaciones falsas fueron la base de los temores del oftalmólogo Li Wenliang, así como de otros médicos e infectólogos no sólo en Wuhan.

Estas alegaciones son la razón por la que los epidemiólogos y virólogos de la CCDC, a partir del 31 de diciembre de 2019, se centraron en encontrar secuencias de genes similares que se definieron como componentes del coronavirus del SARS en 2003 (véanse las explicaciones que figuran a continuación).

3. La segunda de las posibles causas de miedo de Li Wenliang

Las crisis del SARS y del Coronavirus comenzaron con la afirmación en los medios de comunicación de que hay una acumulación de pacientes con neumonía atípica. Esta alegación nunca fue corroborada. Sólo se afirmó que la neumonía atípica que se produjo podía explicarse por la suposición de la aparición de un nuevo virus, porque algunas de las personas con neumonía atípica tenían contacto con los mercados de animales.

Para poder confirmar la suposición de que un virus desconocido podría ser la causa de la neumonía atípica, se suprimieron los hechos conocidos descritos en la literatura médica y científica. De hecho, hay varios y amplios espectros de causas no infecciosas de neumonía atípica. Por varias razones, esta neumonía atípica tiene más probabilidades de ser mortal que la típica.

Las causas son, entre otras, la inhalación de vapores, disolventes y sustancias tóxicas. La entrada de alimentos, bebidas o contenidos estomacales en los pulmones en caso de dificultades para tragar o de la pérdida del conocimiento también puede causar una neumonía extremadamente grave (neumonía por aspiración).

El agua por sí sola es suficiente, si entra en los pulmones de las personas que se están ahogando, para causar una neumonía atípica grave. Otra causa es el reconocido espectro de disfunciones inmunológicas, como las alergias y las reacciones auto-inmunes. También se sabe que la radiación desencadena una inflamación de los pulmones en el cáncer, que no puede distinguirse de la típica neumonía.

La neumonía congestiva es particularmente conocida en las personas mayores. Éstas se desarrollan debido a la retención de agua (edema), a la permanencia prolongada en cama, a la debilidad del corazón y/o de los riñones, que puede conducir a una ventilación y circulación sanguínea inadecuadas en los pulmones, y como consecuencia directa de la inflamación de los pulmones, es decir, de la neumonía atípica.

Lógicamente, una combinación de causas subyacentes también causa neumonía atípica. Una neumonía atípica puede convertirse rápidamente en una neumonía típica si se produce una colonización secundaria del pulmón inflamado. Esta es la razón por la que el porcentaje de neumonía atípica es probablemente más alto que el 20-30% estimado.

En los estudios de las cinco personas documentadas en las dos publicaciones pertinentes a la crisis del coronavirus, no se investigaron la posible presencia o la historia, los signos, los mecanismos y los efectos de estas causas conocidas de la neumonía atípica. Los virólogos no suelen hacerlo de todos modos, y los miembros de la CCDC no pudieron hacerlo ni siquiera en las circunstancias de pánico.

Excluir la mención de la neumonía atípica demuestra una grave negligencia médica e impide el tratamiento correcto de los pacientes. Por consiguiente, los afectados corren el riesgo de que se les manipule mal con un cóctel de sustancias antibióticas ricas en efectos secundarios, que es capaz de causar de forma independiente la muerte de los pacientes, especialmente en caso de sobredosis. El pánico puede ser incluso fatal en muy poco tiempo, no sólo en el caso de problemas cardiovasculares.

La respuesta a la pregunta crucial de si se ha detectado realmente un nuevo virus o si sólo se emiten piezas cortas y endógenas de material genético como componentes de un virus o se interpretan erróneamente como tales, es decisiva para que la crisis del coronavirus pueda terminar rápidamente. Al igual que con el H1N1, los responsables de la crisis del coronavirus dicen que ésta sólo se puede acabar con la vacunación. Sin embargo, la idea de la vacunación ha sido refutada tanto como la de los virus.

Para la evaluación y clasificación de los acontecimientos que rodearon el desencadenamiento y el mantenimiento de la crisis del coronavirus es útil el recuerdo de la pandemia de gripe porcina de 2009, que ya ha sido olvidada.

La mayoría de la población en ese momento estaba preparada para vacunarse contra los supuestos virus de la gripe porcina. Luego hubo un retraso en la entrega anunciada de las vacunas. Las vacunas no podían llenarse en jeringas listas para usar, ya que los nuevos potenciadores de ingredientes activos utilizados por primera vez dañaban la mezcla de la vacuna y la inutilizaban. Por esta razón, la vacuna se llenó en ampollas para 10 personas cada una, a las que sólo se permitió añadir los potenciadores de la sustancia activa poco antes del acto de la vacunación.

Durante este tiempo se supo que los potenciadores del principio activo, llamados adyuvantes, sin los cuales una vacuna no podría desarrollar su efecto, son nuevos y no han sido probados. Se supo que estos novedosos amplificadores de drogas consisten en nanopartículas. Se sabe que las nanopartículas son muy reactivas debido a su diminuto tamaño y, por lo tanto, se utilizan como catalizadores en muchas reacciones químicas. En los procesos técnicos, por ejemplo, hacen que las superficies se comporten de forma completamente diferente a la que se puede conseguir con los métodos convencionales.

Entonces se supo que la Canciller alemana Angela Merkel y las Fuerzas Armadas alemanas iban a recibir esta vacuna, pero sin el novedoso potenciador de sustancias activas de nanopartículas, mientras que la policía y la población iban a recibir la vacuna con las nanopartículas no probadas.

Como resultado, el 93% de la población rechazó la vacuna producida para ellos. Sólo al 7% de los alemanes se les ha administrado esta vacuna.

El metabolismo humano no puede metabolizar y excretar nanopartículas. Debido a esta negativa por parte de casi toda la población, la gripe porcina en realidad desapareció de la noche a la mañana siguiente, como por arte de magia, de los medios de comunicación al basurero y las vacunas al alto horno.

(Se permite una pequeña polémica: sorprendentemente, el virus de la gripe porcina H1N1 despegó al galope de los cerdos, ya no infectó a otras personas, no enfermó a los infectados y su presencia en los medios de comunicación se detuvo inmediatamente. Tal vez el virus de la gripe porcina se ha convertido en virus de la gripe de los peces, para nadar por los ríos en los cuerpos de los salmones, sólo para atacar de nuevo con fuerza concentrada en el mercado de pescado en Wuhan).

Los epidemiólogos, infectólogos y virólogos implicados han aprendido del fracaso de la planificación de la pandemia, que no culminó con la vacunación. Analizaron las causas y publicaron sus conclusiones y recomendaciones para el futuro en el número 12 de diciembre de 2010 del Bundesgesundheitsblatt (Gaceta Federal de Salud). El significativo título de este número: “Pandemias. Lecciones aprendidas” Lo que significa tanto como: ¡Las lecciones que hemos aprendido de la debacle de la gripe porcina H1N1!

Algunos de los artículos de este número están disponibles en Internet, pero no los más importantes. Las principales recomendaciones para la gestión de la pandemia son:

• Asegurarse de que los expertos no se contradigan entre sí en los debates públicos.

• Participación temprana de los medios de comunicación social y de los líderes. – Control de la red Internet. Esto con el fin de evitar que las reivindicaciones y las críticas pongan en peligro el consenso y la aceptación de las medidas en la política y la sociedad.

¡Estas recomendaciones ya se han aplicado con éxito! Se censura en Internet, se excluye a los críticos con insultos, entre otras cosas. Los argumentos obligatorios que refutan la suposición de la pandemia y que han pasado al dominio público simplemente no se abordan. Sólo un experto, el Prof. Drosten, es escuchado en los medios y en la política. La única “crítica” que se le hizo, expresada por un virólogo especializado en VIH, tuvo la función de reforzar la afirmación central de la existencia de un nuevo virus, el SARS-CoV-2.

4. La globalización del pánico por los virus chinos del SARS y la creación de la crisis del coronavirus por el Prof. Drosten

El profesor Christian Drosten, de la Charité de Berlín, afirma que desde el 1/01/2020 ha desarrollado un método de detección genética con el que puede detectar con fiabilidad la presencia del nuevo coronavirus en los seres humanos.

Para a) poder comprender qué supuestos y qué acciones constituyen la base de las afirmaciones del Prof. Drosten y b) comprobar si sus conclusiones de haber desarrollado un procedimiento de prueba seguro para el nuevo coronavirus están lógica y científicamente probadas o no, o incluso refutadas, es necesario explicar los términos y técnicas utilizadas, presentar su argumentación y analizar las dos publicaciones decisivas a las que se refiere el Prof. Drosten.

¿Cómo se definen un virus y un coronavirus?

¿Cómo se definen las secuencias en este contexto? – ¿Cómo funcionan los métodos de detección de secuencias llamadas PCR, RT-PCR y RT-PCR en tiempo real?

¿Cuándo se puede emitir la detección de la presencia de secuencias en humanos como prueba de la presencia de un virus?

¿Cómo se demuestra científicamente la existencia de un virus?


– En la ciencia, un virus se define por su material genético específico, que es único para ese virus.

– El material genético de un virus también se conoce como la cadena genética viral, la molécula genética viral o su genoma. – El material genético viral de un virus contiene las distintas secuencias genéticas para la formación de las distintas proteínas virales, conocidas como genes virales.

– El material genético de un virus puede consistir en ADN o ARN.

– Los virus corona se definen por el hecho de que consisten en una molécula específica de ARN rodeada por una envoltura.

– El material genético de un determinado virus se define por su longitud determinada con precisión y la determinación exacta de la estructura de la cadena del genoma viral.

– La composición del material genético de un virus resulta de la determinación exacta del número y la secuencia específica de los cuatro bloques de construcción que componen un material genético. Los cuatro bloques de construcción de un material genético se llaman nucleótidos. – El proceso de determinar la secuencia específica de los cuatro componentes básicos de un material genético se denomina secuenciación.

– El resultado de la determinación de la secuencia de los componentes básicos de una sustancia hereditaria se denomina secuencia o secuencia genética.

– Los virus patógenos se definen por el hecho de que su secuencia es única y no se da en organismos sanos. – Para detectar y determinar la presencia del material genético de un virus, de acuerdo con las leyes del pensamiento y la lógica que precede a toda ciencia como regla fundamental, este virus debe ser aislado y estar presente en forma pura para que las propias secuencias de genes de la célula no se malinterpreten como componentes de un virus.

– Sólo es posible determinar la secuencia de una sustancia genética si está presente en forma de ADN. – Para determinar la secuencia de una sustancia genética que está presente en forma de ARN, primero debe ser convertida bioquímicamente en ADN.

– El proceso de conversión de una sustancia genética de ARN en ADN se denomina “transcripción inversa” y se abrevia como “RT”.

Las técnicas utilizadas por el Prof. Drosten y las primeras conclusiones

– La presencia y la longitud de un material genético se determina separándolo longitudinalmente en un campo eléctrico. Los trozos cortos migran más rápido, los más largos más lentamente. Al mismo tiempo, para determinar la longitud del material genético a examinar, se añaden piezas de material genético de longitud conocida de diferentes longitudes. Esta fiable técnica estándar para detectar y determinar la longitud del material genético se llama “electroforesis en gel”.

– Si la concentración de un determinado material genético es demasiado baja para ser detectada por la técnica de “electroforesis en gel”, puede ser multiplicada a voluntad por la técnica de multiplicación ilimitada de ADN, llamada Reacción en Cadena de la Polimerasa. De esta manera, el ADN indetectable puede hacerse visible en la electroforesis en gel. Este es un requisito previo para hacer accesible el material genético para investigaciones posteriores, especialmente para la posterior determinación decisiva de su longitud y secuencia. Este método también se conoce como PCR para abreviar.

El inventor de la técnica de la PCR, Kary Mullis, que fue galardonado con el Premio Nobel de Química en 1993 por este invento, señaló desde el principio que este, su método desarrollado para el análisis en sala blanca en las fábricas de chips de ordenador es muy propenso a errores. En su discurso del Premio Nobel, que está documentado en la página del Comité del Premio Nobel, también señaló que no hay ninguna prueba verificable, en realidad científica, de que la sustancia genética conocida como genoma del VIH desencadene realmente una inmunodeficiencia o una de las diversas enfermedades que se agrupan de manera inadmisible bajo el término “SIDA” y se tratan con quimioterapia altamente tóxica. Señaló que sólo hay consenso entre los científicos participantes en que el “VIH” desencadenaría una inmunodeficiencia.

Para poder reproducir un ADN con la técnica de PCR, se requiere el conocimiento de la composición, la secuencia del ADN. Esto se debe a que un ADN sólo puede propagarse por PCR si fragmentos cortos de genes producidos artificialmente se unen al principio y al final del ADN, que corresponden exactamente a la secuencia del principio y del final del ADN que se va a propagar. Estos cortos trozos de ADN producidos artificialmente se llaman, por lo tanto, primers, las moléculas iniciadoras de la PCR. Tienen una media de entre 24 y 30 nucleótidos de largo (los bloques de construcción del material genético).

Así pues, la PCR no puede utilizarse para detectar secuencias o virus desconocidos. Sólo la determinación de la secuencia de un virus permite desarrollar una prueba de PCR para la detección de la secuencia de un gen originado en un virus. – En los primeros días de la PCR, sólo era posible determinar la cantidad de ADN amplificado mediante electroforesis en gel después de que se hubiera detenido la reacción de amplificación de la PCR. Mientras tanto, se añaden ciertos colorantes a las enzimas y sustancias necesarias para la PCR. La detección de estos tintes durante el curso de la PCR muestra aproximadamente qué concentraciones de ADN reproducido artificialmente se produjeron y cuánto ADN estaba realmente presente aproximadamente al comienzo de la PCR. Dado que la cantidad de ADN producido artificialmente puede determinarse aproximadamente mientras la técnica de PCR sigue funcionando, esta extensión de la técnica de PCR se denomina “PCR en tiempo real”. Por lo tanto, una “PCR en tiempo real” que va precedida de otro paso, la conversión de ARN en ADN mediante “transcripción inversa” (RT), se denomina “RTPCR en tiempo real”.

– El Prof. Drosten utiliza la técnica de “RT-PCR en tiempo real” en la prueba que ha desarrollado para la detección del nuevo virus corona. Con ese fin, ha seleccionado secuencias genéticas cortas de un conjunto de datos de Internet del 1/01/2020 que se atribuyen a los virus del SARS. Sobre la base de esas secuencias de fragmentos genéticos cortos, que se interpretan como posibles componentes de los virus del SARS, él diseñó las secuencias de cebadores de la PCR decisivas para la PCR a fin de detectar el virus “todavía” desconocido en China con su “RT-PCR en tiempo real”.

Cuando aparecieron en Internet compilaciones preliminares de secuencias el 10/01/2020 y el 12/01/2020, que posteriormente fueron modificadas y publicadas el 24/01/2020 y el 3/02/2020, esto representó el resultado de los dos primeros intentos de identificar el virus aún desconocido. Con este fin, los virólogos de la CCDC usaron programas de computadora para ensamblar teóricamente las secuencias de fragmentos cortos de genes en una posible cadena genética.

En ambas publicaciones, los virólogos de la CCDC afirman que no hay evidencia de que estas sugerencias de secuencias puedan realmente causar enfermedades. El 10/01/2020 y el 12/01/2020, las propuestas de secuencias chinas eran todavía provisionales y no se habían sometido todavía al estricto proceso de revisión prescrito científicamente.

El hecho de que la Organización Mundial de la Salud (OMS) recomiende la prueba de detección PCR desarrollada por el Prof. Drosten para la detección del nuevo virus el 21/01/2020, incluso antes de la publicación de las publicaciones de las dos primeras propuestas de secuencias chinas, demuestra un primer hecho: El Prof. Drosten utilizó datos no verificados científicamente para su prueba de PCR rápidamente globalizada del 2019-nCoV, que fue rebautizada como SARS-CoV-2 el 7 de febrero de 2020 con la participación del mismo Prof. Drosten.

El cambio de nombre el 7 de febrero de 2020 de la designación de “nCoV” a “SARS-CoV-2”, una mera presunción de virus posiblemente defectuoso o inofensivo, en un patógeno peligroso, dio a la opinión pública la impresión de que se había descubierto un virus real del SARS en China, que causa una enfermedad peligrosa, a saber, el SARS, y mató al nuevo ídolo de China, Li Wenliang, que empequeñeció a la dirección del partido.

El Prof. Drosten y sus colegas del Grupo de Nomenclatura de Virus cumplieron así las expectativas de la población, que estaba aterrorizada hasta la médula: “finalmente diagnosticado”, “finalmente diagnosticado”. Esta expectativa fue despertada por el impulso del pánico masivo desencadenado por el Dr. med. Li Wengling y aparentemente cumplido por el Prof. Drosten.

El factor decisivo en la evaluación de este acto es el hecho de que en aquel momento todos los virólogos directamente implicados testificaron -y todavía testifican hoy- que no hay pruebas de que este nuevo virus cause realmente la enfermedad. ¿O sólo ocurre en paralelo en enfermedades, en procesos de curación, después de procesos de curación, en algunas personas sanas, en muchas personas sanas o en todas las personas?

Esto demuestra que el Prof. Drosten ha cruzado la línea claramente reconocible de la acción científicamente justificada en un fraude reconocible y trascendental. También no podrá salir de esto utilizando una revista para la publicación de su procedimiento de prueba del 23/01/2020 que no comprueba las declaraciones hechas en ella antes de ir a la imprenta.

5. Las preguntas decisivas para un rápido final de la crisis del Coronavirus

La cuestión central y decisiva es si el Prof. Drosten ha cumplido con su deber científico, que forma parte de su contrato de trabajo, consigo mismo y verifica sistemáticamente todas las afirmaciones hechas en su publicación sobre el método de detección que desarrolló y las declaraciones públicas basadas en él.

Este deber científico central da lugar a tres preguntas centrales:

¿Comprobó el Prof. Drosten si las secuencias de genes que forman la base de su procedimiento de prueba y que le fueron proporcionadas por virólogos chinos son en realidad secuencias que se originan en un virus?

¿Llevó a cabo el Prof. Drosten los experimentos de control que son obligatorios en la ciencia y que prueban si las secuencias que utilizó realmente se originan en un virus? ¿Llevó a cabo los experimentos de control que prueban si las secuencias que utiliza, que atribuye al nuevo virus, son en realidad secuencias que no son secuencias que se producen en todos los metabolismos, tal vez incluso en plantas, como las papayas de Tanzanía o que se producen en mayor número en el metabolismo de las enfermedades?

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su método de prueba, con el que sólo detecta áreas parciales de 2 (dos) genes del genoma de un total de 10 (diez) genes del coronavirus, detecta un virus completo, activo y causante de la enfermedad? ¿Y no sólo fragmentos de un virus, después de una supuesta batalla exitosa del sistema inmunológico o la presencia de virus “defectuosos” o “incompletos” o “inofensivos” en nuestro material genético, que son típicos y constituyen el 50% de las masas genéticas de nuestros cromosomas?

Las respuestas son el resultado de la realización documentada del Prof. Drosten durante el desarrollo del procedimiento de la prueba y de la no realización documentada del Prof. Drosten hasta hoy. El virólogo Prof. Drosten, que desarrolló el método de detección del nuevo coronavirus (primero llamado 2019-nCoV y luego, a partir del 7/02/2020 llamado SARS- CoV-2), describe el desarrollo del método de prueba en una publicación publicada el 23/01/2020 en la página 3 de este artículo, en la columna de la izquierda, a 8 líneas de distancia, describe el primer y decisivo paso de su enfoque:

“Antes del anuncio público de las secuencias del virus de 2019-nCoV, nos basamos en los informes de los medios de comunicación social que anunciaban la detección de un virus similar al SARS. Por lo tanto, asumimos que un CoV relacionado con el SARS estuvo involucrado en el brote”.

Esto significa que el Prof. Drosten y sus colaboradores han asumido, basándose en los informes de los medios de comunicación social, que un coronavirus relacionado con el SARS podría estar implicado en el supuesto brote de neumonía atípica. En ese momento no se disponía de datos clínicos que apoyaran esa hipótesis. ¿Cuál era su siguiente paso?

“Descargamos todas las secuencias completas y parciales (longitud media >400 nucleótidos) de virus relacionados con el SARS que estaban disponibles en el GenBank el 1 de enero de 2020.”

Continúa en la columna derecha de la página 3, tercera fila desde la parte superior:

“Alineamos estas secuencias [Nota mía, SL: contra una secuencia estándar dada del virus del SARS] y utilizamos las secuencias alineadas para desarrollar nuestras pruebas (Figura S1 en el suplemento de esta publicación).

“Tras la publicación de la primera secuencia de 2019 nCoV en virological.org, seleccionamos tres pruebas basadas en lo bien que se ajustaban al genoma de 2019 nCoV (Figura 1). (“Descargamos todas las secuencias completas y parciales (si >400 nt) de virus relacionados con el SARS disponibles en el GenBank antes del 1 de enero de 2020 […] Estas secuencias fueron alineadas y la alineación se utilizó para el diseño del ensayo (Figura suplementaria S1).

De sus explicaciones se pueden extraer respuestas, conclusiones y consecuencias claras:

¿Comprobó el Prof. Drosten si las secuencias de genes, que son la base de su procedimiento de prueba y que fueron proporcionadas por virólogos chinos, son en realidad secuencias de un virus? ¡La respuesta es NO! No pudo comprobar si las secuencias proporcionadas eran de un virus, porque las dos publicaciones decisivas que describían la extracción de las secuencias de genes que utilizó no estaban disponibles para él antes de que su prueba fuera lanzada al mercado.

¿Llevó a cabo el Prof. Drosten los experimentos de control obligatorios en la ciencia para probar si las secuencias que usó realmente se originaron de un virus? ¿Llevó a cabo los experimentos de control para averiguar si las secuencias que utilizó, que atribuyó al nuevo virus, son en realidad secuencias que se producen en cualquier metabolismo, tal vez incluso en las plantas, o que se producen de forma metabolizada en las enfermedades?

La respuesta es: ¡NO! Ni él, ni los virólogos de la CCDC, ni otros han llevado a cabo de forma demostrable estos experimentos de control necesarios hasta el día de hoy, y si lo han hecho, no los han publicado. Para estos cruciales experimentos de control, deben utilizarse secuencias genéticas cortas del metabolismo de individuos sanos para secuenciarlos. Estas cortas secuencias genéticas, como las de los enfermos, deben ser ensambladas con los mismos programas informáticos para formar una larga cadena genética de un virus. Este experimento nunca se llevó a cabo o nunca se publicó. Ni siquiera se menciona este experimento de control obligatorio, que resulta de las leyes del pensamiento y la lógica de la virología – para controlar consistentemente los propios resultados. En el momento en que este experimento se lleva a cabo y se publica, la crisis del coronavirus termina inmediatamente.

El otro experimento de control resultante de la lógica científica es el ensayo intensivo, mediante el procedimiento PCR desarrollado (RT-PCR en tiempo real), con muestras clínicas de personas con enfermedades distintas de las atribuidas al virus y utilizando muestras de personas, animales y plantas sanas para comprobar si estas muestras no dan también resultados “positivos”.

Estos nuevos experimentos de control, que son lógicamente necesarios para validar un procedimiento de prueba, es decir, para comprobar si es válido y tiene alguna importancia, aún no se han realizado y ni siquiera se ha afirmado que se hayan realizado. Por consiguiente, los inventores y productores de estos procedimientos de prueba se han asegurado, mediante la información apropiada en los rótulos, por ejemplo, que la prueba sólo debe utilizarse para fines de estudio y no es adecuada para fines de diagnóstico.

Puedo predecir con certeza que las personas que liberan mayores cantidades de secuencias genéticas del tipo de tejido de los epitelios escamosos, por ejemplo, los pacientes renales, darán “positivo” con la PCR desarrollada por el Prof. Drosten a más tardar cuando su cantidad de frotis se multiplique y se concentre un poco. Es muy probable que incluso todos los organismos puedan dar positivo.

Hago un llamamiento a bioquímicos, bioinformáticos, virólogos y especialistas en cultivos celulares para que lleven a cabo estos experimentos de control, los publiquen y me informen sobre ellos. He diseñado un experimento de control que excluye de entrada la excusa de que el material de muestra utilizado ha sido contaminado con el virus del SARS Cov-2 antes o durante el experimento de control.

Los costos de la realización de los experimentos de control están cubiertos si se permite que yo y observadores neutrales estemos presentes durante la realización de los experimentos de control y se documenta cada paso. Por favor, póngase en contacto con la editorial para que se ponga en contacto. Los resultados pondrán fin a la crisis del coronavirus inmediatamente. No sirve de nada si sólo presento los resultados de los experimentos de control.

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su procedimiento de prueba, con el que sólo detecta áreas parciales de sólo 2 (dos) genes del genoma de un total de 10 (diez) genes del virus del Corona, detecta un virus completo, activo y causante de enfermedad y no sólo fragmentos de un virus después de una supuesta batalla exitosa del sistema inmunológico o debido a la presencia de numerosos virus “defectuosos”, “incompletos” e “inofensivos” en nuestro material genético?

El Prof. Drosten no consideró estas preguntas lógicas en absoluto, porque no aparecen en ninguna parte de sus publicaciones y afirmaciones. La detección de sólo secuencias genéticas cortas de una cadena genética larga de un virus nunca puede probar la presencia de un virus intacto y por lo tanto reproducible. Para poder calificar de válida una prueba de PCR de este tipo, habría que realizar primero estudios cuyos resultados demuestren que la detección de secuencias genéticas cortas prueba automáticamente la presencia de una cadena genómica completa e intacta de un virus. Esos estudios lógicamente convincentes aún no se han realizado ni mencionado.

Al comienzo de la crisis del coronavirus, la principal viróloga, la Prof. Karin Mölling, una destacada experta en el campo de los virus asociados a las células, inofensivos, incompletos o defectuosos conocidos como endógenos, describió las medidas adoptadas como injustificadas. Ha demostrado en publicaciones y en un libro, que la mitad del material genético de los humanos, es decir, la mitad de las secuencias de la que están formados nuestros cromosomas consiste en secuencias genéticas inactivas y defectuosas de virus.

Lo que no sabe, o está ocultando, es que el metabolismo produce constantemente una gran cantidad de secuencias genéticas de ARN de cualquier composición, que no aparecen en forma de secuencias de ADN en los cromosomas.

Este hecho pone en tela de juicio las afirmaciones de existencia de todos los virus ARN, como los coronavirus, el virus del Ébola, el VIH, el virus del sarampión y los virus del SARS.

Este hecho es también la base por la que, con los experimentos de control, se pone fin inmediatamente no sólo a la crisis del coronavirus, sino también al miedo y al mal manejo por parte de toda la virología de los supuestos virus de la enfermedad. Puedo asegurarle que las causas reales y los fenómenos de infección atribuidos a los virus han sido probados en el sentido “positivo” de la palabra “ciencia”.



Wrong Interpretation of the Virus Part II: Beginning and End of the Coronavirus Crisis