Oponerse a la dictadura sanitaria perjudica gravemente la salud

Opposing the health dictatorship seriously harms health

Burundi y Tanzania compartieron la oposición de sus dirigentes ante las medidas de la OMS. El presidente de Burundi, Pierre Nkurunziza, expulsó a los sicarios de la OMS de su país, mientras que el presidente tanzano, John Magufuli, químico, hizo lo propio, tras demostrar al mundo que los test PCR con los que querían justificar la inexistente epidemia, ofrecían falsos positivos, tanto en muestras obtenidas en papayas, como en aceite de coche o en cabras. Twitter.

La osadía de estos presidentes les ha costado la vida, ambos han sufrido un desafortunado “infarto” como advertencia al resto sobre que va a suceder a cualquiera que no colabore con los psicópatas que controlan el mundo

Estamos ante dos mártires de la lucha contra la dictadura mundial, pero una historia escrita por estos asesinos, olvidará pronto y pervertirá la memoria sobre estos y todos los que se oponen a el N.O.M.

Por supuesto sus sucesores han tomado buena nota de lo que les espera si no colaboran y de lo rentable que puede resultar para ellos que lo hagan. No habrá que extrañarse, pues, de que de las ínfimas cifras de muertes atribuidas al coronavirus en dichos países (recordemos que los diez países más pobres de Africa han tenido, en conjunto, menos víctimas mortales del Covid que la Comunidad Autónoma de Madrid, por tener un referente) pasemos en breve a elevadas tasas de mortalidad que “obliguen” a las autoridades a abrir las puertas a las “salvadoras” compañías farmacéuticas.

A estas alturas debería entenderse que a pesar de ser un negocio millonario, no se trata solo de dinero. También que estamos solo al principio de algo mucho peor de lo que las mentes más retorcidas puedan sospechar.

(Fuente: Astillas de realidad)

31 Razones por las que no tomaré la vacuna

Por el Rabino Chananya Weissman

  1. No es una vacuna. Una vacuna por definición proporciona inmunidad a una enfermedad. Esto no proporciona inmunidad a nada. En el mejor de los casos, simplemente reduce la posibilidad de obtener un caso grave de un virus si uno lo atrapa. Por lo tanto, es un tratamiento médico, no una vacuna. No quiero tomar un tratamiento médico para una enfermedad que no tengo.
  2. Las compañías farmacéuticas, los políticos, el establecimiento médico y los medios de comunicación han unido sus fuerzas para referirse universalmente a esto como una vacuna cuando no es una, con la intención de manipular a las personas para que se sientan más seguras a la hora de someterse a un tratamiento médico. Debido a que están siendo engañosos, no confío en ellos, y no quiero tener nada que ver con su tratamiento médico.
  3. Los supuestos beneficios de este tratamiento médico son mínimos y no durarían mucho en ningún caso. El establecimiento lo reconoce, y ya está hablando de vacunas adicionales y un número cada vez mayor de nuevas “vacunas” que se requerirían regularmente. Me niego a convertirme en un paciente crónico que recibe inyecciones de nuevos productos farmacéuticos de forma regular simplemente para reducir mis posibilidades de obtener un caso grave de un virus que estas inyecciones ni siquiera previenen.
  4. Puedo reducir mis posibilidades de tener un caso grave de un virus fortaleciendo mi sistema inmunológico naturalmente. En el caso de que contrate un virus, hay vitaminas y medicamentos bien establecidos que han tenido resultados maravillosos en la protección de la enfermedad, sin los riesgos y incógnitas de este tratamiento médico.
  5. El establecimiento insiste en que este tratamiento médico es seguro. No pueden saber esto porque los efectos a largo plazo son totalmente desconocidos, y no se conocerán durante muchos años. Pueden especular que es seguro, pero es falso para ellos hacer tal afirmación que no puede ser conocida. Debido a que están siendo falsos, no confío en ellos, y no quiero ninguna parte de su tratamiento.
  6. Las compañías farmacéuticas tienen cero responsabilidad si algo sale mal, y no pueden ser demandadas. Lo mismo para los políticos que están impulsando este tratamiento. No me inyectaré un nuevo dispositivo médico experimental cuando las personas detrás de él no acepten ninguna responsabilidad si algo sale mal. No arriesgaré mi salud y mi vida cuando se nieguen a arriesgar nada.
  7. El primer ministro de Israel ha admitido abiertamente que el pueblo israelí es el laboratorio mundial para este tratamiento experimental. No me interesa ser conejillo de indias ni donar mi cuerpo a la ciencia.
  8. Israel aceptó compartir datos médicos de sus ciudadanos con una compañía farmacéutica extranjera como parte fundamental de su acuerdo para recibir este tratamiento. Nunca consiento que mis datos médicos personales fueran compartidos con ninguna de esas entidades, ni siquiera me lo pidieron. No contribuiré a esta empresa sórdida.
  9. Los ejecutivos y miembros de la junta directiva de Pfizer están registrados en que no han tomado su propio tratamiento, a pesar de toda la fanfarria y las garantías. Alegan que considerarían injusto “cortar la línea”. Esta es una excusa absurda, y se necesita una cantidad increíble de chutzpah para decir tal cosa. Tal “línea” es un producto de su propia imaginación; si acapararan un par de inyecciones por sí mismos nadie lloraría mal. Además, los multimillonarios con aviones privados e islas privadas no son conocidos por esperar en la fila hasta que cientos de millones de campesinos en todo el mundo van primero a recibir lo que estos multimillonarios quieren para sí mismos.
  10. Los medios de comunicación han aceptado esta absurda excusa sin preguntas ni preocupaciones. Además, elogian a los ejecutivos de Pfizer por su supuesto sacrificio en no tomar su propio tratamiento experimental hasta que vayamos primero. Ya que nos consideran tan tontos, no confío en ellos, y no quiero su nuevo tratamiento. Pueden tener mi lugar en la fila. Iré a la parte de atrás de la línea.
  11. Tres hechos que deben ser reunidos:
  • Bill Gates está promocionando estas vacunas como esenciales para la supervivencia de la raza humana.
  • Bill Gates cree que el mundo tiene demasiada gente y necesita ser “despoblado”.
  • Bill Gates, quizás el hombre más rico del mundo, tampoco ha sido inyectado. No hay prisa.

No. Transmitiré cualquier tratamiento médico que quiera que tome.

  1. El establecimiento ha sido totalmente unilateral en la celebración de este tratamiento. Los políticos y los medios de comunicación están instando a la gente a tomarlo como un deber moral y cívico. Los beneficios del tratamiento están siendo muy exagerados, los riesgos están siendo ignorados y las incógnitas están siendo desechadas. Debido a que están siendo engañosos y manipuladores, no apostaré mi bienestar personal en su integridad.
  2. Hay una intensa campaña de propaganda para que la gente tome este tratamiento. Los políticos y las celebridades se están tomando selfies de sí mismos inyectados (tal vez en algunos casos fingiendo ser inyectados), los medios de comunicación están exagerando esto como lo más genial, inteligente, feliz y divertido de hacer. Es la campaña de marketing más extendida de la historia. Esto no es en absoluto apropiado para ningún tratamiento médico, y mucho menos uno nuevo, y me hace retroceder.
  3. Las masas están siguiendo en remolque, publicando fotos de sí mismos siendo inyectados con un medicamento, alimentando la presión de los compañeros de masa para hacer lo mismo. Hay algo muy alarmante y enfermo en esto, y no quiero formar parte de ello. Nunca tomé drogas sólo porque “todo el mundo lo está haciendo” y está bien. Ciertamente no voy a empezar ahora.
  4. Aquellos que plantean preocupaciones sobre este tratamiento médico están siendo intimidados, calumniados, burlados, censurados, ostracizados, amenazados y despedidos de sus trabajos. Esto incluye profesionales médicos que tienen preocupaciones basadas en la ciencia sobre la droga y cuidadores que han sido testigos de personas bajo su cargo que sufren reacciones horribles y la muerte poco después de ser inyectados. Cuando el establecimiento está purgando buenas personas que arriesgan todo simplemente para plantear preocupaciones sobre un nuevo tratamiento médico , incluso si no se oponen abiertamente a él – confiaré en estas personas valientes sobre el establecimiento cada vez. No puedo pensar en un solo caso similar en la historia cuando la verdad y la moralidad resultaron estar del lado del establishment.
  5. Este es el mayor experimento médico en la historia de la raza humana.
  6. A propósito no está siendo retratado como el mayor experimento médico en la historia de la raza humana, y el hecho de que sea un experimento médico en absoluto está siendo severamente minimizado.
  7. Si estuvieran al frente con las masas, muy pocos aceptarían participar en un experimento de este tipo. Manipular a las masas para participar en un experimento médico bajo falsas pretensiones viola los fundamentos de la ética médica y el derecho democrático. No permitiré que personas poco éticas que se dedican a tal conducta me inyecten nada.
  8. El establecimiento médico no está informando a la gente sobre nada de esto. Se han convertido en agentes de marketing para una droga experimental, sirviendo a grandes empresas y políticos que han hecho tratos con ellos. Se trata de un conflicto directo con su mandato de preocuparse exclusivamente por el bienestar de las personas a su cargo. Dado que el establecimiento médico se ha corrompido, y se ha convertido en nada más que una herramienta corporativa y política, no confío en la droga experimental de la que tanto quieren inyectarme.
  9. Estamos siendo presionados de varias maneras para que nos inyecten, lo que viola la ética médica y los fundamentos de la sociedad democrática. La mejor manera de conseguir que no haga algo es presionarme para que lo haga.
  10. El gobierno ha sellado su protocolo relacionado con el virus y los tratamientos durante TREINTA AÑOS. Esta es la información que el público tiene derecho a conocer, y el gobierno tiene la responsabilidad de compartir. ¿Qué están encubriendo? ¿Realmente esperan que crea que todo es kosher sobre todo esto, y que están preocupados ante todo por mi salud? La última vez que lo hicieron fue con el Asunto de los Niños Yemeníes. Si no estás familiarizado con eso, ísralo. Ahora están tirando del mismo shtick. No me engañaron la primera vez, y definitivamente no me están engañando ahora.
  11. ¿El gobierno puede compartir nuestros datos médicos personales con corporaciones extranjeras, pero no compartirán su propio protocolo sobre el asunto con nosotros? Estoy fuera.
  12. El establecimiento ha reclutado médicos, rabinos, medios de comunicación y masas para arengar a personas que no quieren que se les inyecte un nuevo medicamento. Nos llaman el peor tipo de nombres. Nos dicen que creemos en conspiraciones locas, que estamos en contra de la ciencia, que somos egoístas, que somos asesinos, que no nos importan los ancianos, que es culpa nuestra que el gobierno siga imponiendo restricciones draconianas al público. Todo se debe a que no queremos que nos inyecten un tratamiento experimental, sin preguntas. Incluso se nos dice que tenemos la obligación religiosa de hacer esto, y que somos pecadores graves si no lo hacemos. Dicen que si no estamos de acuerdo en que nos inyecten, debemos ser obligados a permanecer dentro de nuestros hogares para siempre y ser excluidos de la vida pública.Esto es horrible, repugnante, una perversión del sentido común, la moralidad y la Torá. Me hace retroceder, y sólo consolida aún más mi desconfianza hacia estas personas y mi oposición a tomar su droga experimental. ¿Cómo se atreven?
  13. Sé de muchas personas que se inyectaron, pero ninguna de ellas estudió la ciencia en profundidad, sopesó cuidadosamente los beneficios potenciales contra los riesgos, comparó esta opción con otras alternativas, fue verdaderamente informada, y decidió que este tratamiento médico era la mejor opción para ellos. Por el contrario, se les inyectó por el bombo, la propaganda, la presión, el miedo, la confianza ciega en lo que supuestamente creían “la mayoría de los expertos” (suponiendo que todos estudiaran todo en profundidad y fueran completamente objetivos, lo cual es altamente dudoso), la confianza ciega en lo que ciertos rabinos influyentes les instaron a hacer (ditto lo anterior), o el miedo histérico de que la única opción era inyectarse o enfermarse gravemente por el virus. Cuando vea histeria masiva y comportamiento similar a un culto en torno a un tratamiento médico, sospecharé mucho y lo evitaré.
  14. Las compañías farmacéuticas tienen una larga y gloriosa historia de causar carnicería masiva con drogas maravillosas que empujaban a poblaciones desprevenidas, incluso después de que ya se conocieran problemas graves. En lugar de presionar el botón de pausa y detener la comercialización de estos medicamentos hasta que estos problemas pudieran ser investigados adecuadamente, las compañías farmacéuticas hicieron todo lo que estaba en su poder para suprimir la información y seguir empujando sus productos. Cuando las empresas y las personas han demostrado una falta tan grave de preocupación por la vida humana, no confiaré en ellas cuando bombeen una nueva droga maravilla. Este no es nuestro primer rodeo.
  15. De hecho, las historias de terror ya están llegando a velocidad warp, pero los políticos no están lo menos preocupados, el establecimiento médico los está dejando de lado como no relacionados o insignificantes, los medios de comunicación lo ignoran, las compañías farmacéuticas están avanzando a toda velocidad, y aquellos que levantan una bandera roja siguen siendo intimidados, censurados y castigados. Claramente mi vida y mi bienestar no son su principal preocupación. No seré su próximo conejillo de indias en su laboratorio. No me arriesgaré a ser la próxima “coincidencia”.
  16. Aunque muchas personas han muerto poco después de ser inyectadas – incluyendo jóvenes perfectamente sanos – no se nos permite dar a entender que la inyección tuvo algo que ver con ella. De alguna manera esto es anti-ciencia y hará que más personas mueran. Creo que negar cualquier posible vínculo, abusar de la gente que especula que puede haber un vínculo, y demostrar no la más mínima curiosidad para explorar si puede haber un vínculo es lo que es anti-ciencia y muy bien podría causar la muerte de más personas. Esta misma gente cree que estoy obligado a inyectarme también. No hay un maldito agradecimiento.
  17. Estoy repulsado por la adoración religiosa, culta de un producto farmacéutico, y no participaré en este ritual.
  18. Mi proveedor de “atención médica” me sigue molestando para que me inyecten, sin embargo, no me han proporcionado ninguna información sobre este tratamiento o cualquier posible alternativa. Todo lo que sé lo aprendí de otros fuera del establecimiento. El consentimiento informado se ha convertido en consentimiento conforme. Me niego.
  19. Veo todas las mentiras, corrupción, propaganda, manipulación, censura, intimidación, violación de la ética médica, falta de integridad en el proceso científico, represión de reacciones adversas inconvenientes, desestimación de preocupaciones legítimas, histeria, comportamiento de culto, ignorancia, mente cerrada, miedo, tiranía médica y política, ocultación de protocolos, falta de verdadera preocupación por la vida humana, falta de respeto a los derechos humanos básicos y libertades, perversión de la Torá y sentido común , demonización de las buenas personas, el mayor experimento médico de todos los tiempos que llevan a cabo las personas codiciosas, poco confiables, sin dios, la falta de responsabilidad para aquellos que exigen que arriesgue todo… Veo todo esto y he decidido que todos pueden tener mi lugar en la fila. Pondré mi confianza en Dios. Usaré la mente con la que Él me bendijo y confiaré en mis instintos naturales. Lo que lleva a la razón final que resume por qué no voy a “vacunar”.
  20. Todo apesta.

ChananyaWeissman.com

No creas todo lo que lees sobre las muertes por gripe (2014)

Este artículo es de 2014. Saquen vuestras propias conclusiones. Es muy interesante y clarificador. Nada se sabía de la pandemia del Covid-19.

01/24/2014 05:40 EST | Actualizado:03/26/2014 05:59h

No creas todo lo que lees sobre las muertes por gripe

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional.

Lawrence Salomón Columnista

La gripe provoca “entre 250.000 y 500.000 muertes anuales” en todo el mundo, nos dice Wikipedia. “La estimación típica es de 36,000 [muertes] al año en los Estados Unidos”, informa NBC, citando los Centros para el Control de Enfermedades. “Entre 4.000 y 8.000 canadienses al año mueren de gripe y sus complicaciones relacionadas, según la Agencia de Salud Pública de Canadá”, dice el Globe and Mail, agregando que “esas cifras son controvertidas porque son estimaciones”.

“Controversial” es un eufemismo, y no sólo en Canadá, y no sólo porque las cifras son estimaciones. Las cifras difieren enormemente de los sobrios recuentos registrados en los certificados de defunción -por ley cada certificado debe mostrar una causa- y reportados por las agencias oficiales que recopilan y mantienen estadísticas vitales.

Según el Sistema Nacional de Estadísticas Vitales en los EE.UU., por ejemplo, las muertes anuales por gripe en 2010 ascendieron a sólo 500 por año– menos que las muertes por úlceras (2.977), hernias (1.832) y embarazo y parto (825), y muy lejos de las grandes causas de muerte como las cardiopatías (597.689) y los cánceres (574.743). La historia es similar en Canadá, donde los asesinos poco probables también empequeñecen el recuento de muertes por gripe en Canadá.

Incluso esa cifra de 500 para Estados Unidos podría ser demasiado alta, según análisis en revistas autorizadas como el American Journal of Public Health y el British Medical Journal. Sólo alrededor del 15-20% de las personas que presentan síntomas similares a los de la gripe tienen el virus de la gripe– el otro 80-85% realmente contagió rinovirus u otros gérmenes que son indistinguibles de la verdadera gripe sin pruebas de laboratorio, que rara vez se hacen. En 2001, un año en el que los certificados de defunción enumeraban a 257 estadounidenses como que habían muerto de gripe, sólo 18 fueron identificados positivamente como verdaderas gripes. Los otros 239 simplemente se suponía que eran gripes y muy probablemente tenían pocas gripes verdaderas entre ellos.

“Los datos estadounidenses sobre las muertes por gripe son un desastre”, afirma un artículo de 2005 en el British Medical Journal titulado “¿Las cifras de mortalidad por gripe en Ee.UU. son más relaciones públicas que científicas?” Este artículo cuestiona la cifra de 36.000 muertes por gripe comúnmente reclamada, y con la descripción de la “gripe/neumonía” como la séptima causa de muerte en los Estados Unidos.

“¿Pero por qué se agrupan la gripe y la neumonía?”, se pregunta el artículo. “¿Es la relación tan fuerte o única para justificar su caracterización como una sola causa de muerte?”

La respuesta del artículo es no. La mayoría de las muertes por neumonía no están relacionadas con la gripe. Por ejemplo, “los medicamentos supresores del ácido estomacal están asociados con un mayor riesgo de neumonía adquirida por la comunidad, pero estos medicamentos y neumonía no se compilan como una sola estadística”, explicó el Dr. David Rosenthal, director de los Servicios de Salud de la Universidad de Harvard. “La gente no necesariamente muere, per se, del virus [de la gripe]: la viremia. De lo que mueren es de una neumonía secundaria”.

La neumonía, según la Asociación Americana del Pulmón, tiene más de 30 causas diferentes,siendo la gripe sólo una de ellas. El propio CDC reconoce la escasa relación, diciendo que “sólo una pequeña proporción de las muertes… sólo el 8,5% de todas las muertes por neumonía y gripe [están] relacionadas con la gripe.”

Debido a que los certificados de defunción desmienten las afirmaciones de numerosas muertes por gripe, los CDC reclutaron modelos informáticos para llegar a su estimación de 36.000 muertes por gripe. Pero incluso aquí necesitaba doblar la terminología médica convencional para llegar a cifras de muerte convincentes.

“Las estadísticas de causa de muerte se basan únicamente en la causa subyacente de la muerte [definida internacionalmente] como ‘la enfermedad o lesión que inició el tren de eventos que condujeron directamente a la muerte'”, explica el Centro Nacional de Estadísticas de Salud. Debido a que la gripe rara vez fue una “causa subyacente de muerte”, los CDC crearon el término sólido, “muerte asociada a la gripe”.

Usando esta nueva definición suelta, los modelos informáticos de los CDC podrían contar a las personas que murieron de una dolencia cardíaca u otras causas después de tener gripe. Como admitió William Thompson, del Programa Nacional de Inmunización de los CDC, la mortalidad asociada a la gripe es “una asociación estadística … No sé si diríamos que es la causa subyacente de la muerte”.

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional. “Realmente parecía que necesitábamos hacer algo para animar a la gente a vacunarse contra la gripe”.

La respuesta de los CDC fue su “receta de siete pasos para generar interés en la vacunación contra la gripe (o cualquier otra) vacuna”, una muestra de diapositivas que Nowak presentó en la Cumbre Nacional de Vacunas contra la Gripe de 2004.

Aquí está la “Receta que fomenta el interés y la demanda de la vacuna antigripal”, en el lenguaje truncado que aparece en sus diapositivas: “Los expertos médicos y las autoridades de salud pública [deberían] públicamente (por ejemplo a través de los medios de comunicación) declarar preocupación y alarma (y predecir resultados nefastos) – e instar a la vacunación contra la gripe.” Esta receta, indicó su presentación de diapositivas, daría lugar a “un interés y atención significativas de los medios de comunicación … en términos que motivan el comportamiento (por ejemplo, como ‘muy grave’, ‘más grave que los últimos o años pasados’, ‘mortal’). Otras recomendaciones emotivas incluyeron fomentar “la percepción de que muchas personas son susceptibles a un mal caso de gripe” y “Ejemplos visibles/tangibles de la gravedad de la enfermedad (por ejemplo, imágenes de niños, familias de los afectados que se acercan) y personas que se vacunan (las primeras para motivar, esta última para reforzar) “.

Los CDC decidieron descaradamente crear un mercado masivo para la vacuna antigripal al reclutar a los medios de comunicación para que entraran en pánico entre el público. Un medio de comunicación obediente e incuestionable obligado por la hipnotización de los números, y 10 años después todavía lo está obligando.

Don’t Believe Everything You Read About Flu Deaths | HuffPost Canada (huffingtonpost.ca)

COVID, GRIPE Y RESFRIADO (SENTIDO) COMÚN

Seré breve. Según la Universidad de Maryland, EE.UU. hizo un estudio allá por el “lejano” 2018: “Descubrimos que las personas que tienen gripe contaminan con virus el aire que les rodea simplemente al respirar, sin necesidad de toser ni estornudar“, reconoce Donald Milton, profesor de salud ambiental en Maryland y principal investigador del estudio. Este especialista explica que las personas con gripe generan aerosoles infecciosos, que son pequeñas gotas que permanecen suspendidas en el aire durante mucho tiempo, incluso cuando no están tosiendo, y especialmente durante los primeros días de la enfermedad.

¿Les suena? Por tanto la gripe no ha podido desaparecer, si así fuera, tampoco habría contagio por aerosoles de la Covid-19. Es curioso. Hasta ahora, ¡¡¡SEIS CASOS DE GRIPE en la temporada 2020/21 en España!!! Con sentido común, esto es imposible de creer.

Conclusión: Si tengo gripe y el año pasado o hace dos pasé un resfriado común por coronavirus, las PCR dan positivos en bastantes casos y tenemos parte de la ecuación resuelta. Un positivo por covid que en realidad es una gripe. Incluso muertes por gripe achacadas con PCR a la covid.

Si los aerosoles son el vehículo y el SarsCov-2 y el resfriado son coronavirus y viajan en el mismo vehículo, el resfriado común no ha desaparecido y la gripe tampoco. ¿Por qué motivo iban a desaparecer si utilizan la misma forma de propagarse? Quiero decir, si hay Covid, hay aerosoles y si hay aerosoles, hay gripe y resfriado común.

G.R.M.

COVID, FLU AND THE COMMON COLD

I’ll be quick. According to the University of Maryland, USA did a study back in the “distant” 2018: “We discovered that people who have the flu contaminate the air around them with viruses simply by breathing, without the need to cough or sneeze,” he acknowledges. Donald Milton, a Maryland professor of environmental health and the study’s principal investigator. This specialist explains that people with the flu generate infectious aerosols, which are small droplets that remain suspended in the air for a long time, even when they are not coughing, and especially during the first days of the illness.

Does it ring a bell? Therefore, the flu has not been able to disappear, if it were, there would be no spread by Covid-19 aerosols. It’s curious. So far, SIX CASES OF FLU in the 2020/21 season in Spain !!! With common sense, this is impossible to believe.

Bottom Line: If I have the flu and I had a common cold from coronavirus last year or two, PCR tests are positive in quite a few cases and we have part of the equation solved. A positive for covid that is actually a flu. Even deaths from influenza attributed with PCR to covid.

If the aerosols are the vehicle and the SarsCov-2 and the cold are coronavirus and they travel in the same vehicle, the common cold has not disappeared and neither has the flu. For what reason would they disappear if they use the same way of spreading? I mean, if there is Covid, there are sprays and if there are sprays, there is flu and the common cold.

¿POR QUÉ NO HAY UNA VACUNA CON VIRUS ATENUADO? (Covid19)

Supongo que en el mundo en el que vivimos hoy en día, se puede preguntar sin ser borrado de Internet y sin que te señalen como “negacionista”. Peligro.

Según la CDC (Centros para el Control y la Prevención de Enfermedades de EE.UU.), hay o habrá tres clases de vacunas para el COVID-19: 1) Las vacunas ARNm; 2) Las vacunas de subunidades proteicas y 3) Las vacunas de vectores.

Como bien dice la CDC, Para despertar la respuesta inmunitaria, el sistema de muchas vacunas consiste en inyectar el germen atenuado o inactivado en nuestros organismos. Pero ninguna de las tres vacunas propuestas, son del tipo “tradicional”. Pero ¿Por qué?

Hay tres opciones, empecemos por la última, no les da la gana. La primera, el virus SARS-Cov-2 no existe y la segunda, no han conseguido secuenciarlo y aislarlo al completo. Creo que la última es la correcta. No se puede hacer una vacuna de virus atenuado si este no se conoce del todo. Lógico.

Y hay más preguntas ¿saben los Gobiernos y estas grandes farmacéuticas algo que el vulgo no sabe? ¿Se ha traficado con información? ¿Puede que el SARS-Cov-2 sea una quimera de tres virus y al menos uno de ellos no tenga vacuna descubierta ni “futurible” ni “tradicional”?

Como alguien dijo, las preguntas no son indiscretas, lo son las respuestas… Pero en este caso, ¿Por qué?

G.R.M.

WHY IS THERE NO VACCINE WITH VIRUS ATTENUATED? (Covid19)

I suppose that in the world we live in today, you can ask without being deleted from the Internet and without being singled out as a “denier”. Danger.

According to the CDC, there are or will be three classes of vaccines for COVID-19: 1) mRNA vaccines; 2) Protein subunit vaccines and 3) Vector vaccines.

As the CDC says, To awaken the immune response, the system of many vaccines consists of injecting the attenuated or inactivated germ into our organisms. But none of the three proposed vaccines are of the “traditional” type. But why?

There are three options, let’s start with the last one, they don’t feel like it. The first, the SARS-Cov-2 virus does not exist and the second, they have not managed to sequence and isolate it completely. I think the last one is correct. An attenuated virus vaccine cannot be made if the virus is not fully known. Logical.

And there are more questions. Do the governments and these big pharmaceutical companies know something that the common people do not? Has information been trafficked? Could it be that SARS-Cov-2 is a chimera of three viruses and at least one of them does not have a discovered, “future” or “traditional” vaccine?

As someone said, the questions are not indiscreet, the answers are … But in this case, why?

En la gripe asiática de 1957-58, rechazaron los encierros

Jeffrey A. Tucker – 12 de enero de 2021

La gripe asiática de 1957-58 fue una pandemia mortal con un alcance más amplio para resultados graves que Covid-19 de 2020. Mató entre 1 y 4 millones de personas en todo el mundo, y 116.000 en los Estados Unidos en un tiempo con la mitad de la población. Fue un importante contribuyente a un año en el que Estados Unidos vio 62.000 muertes en exceso.

A nivel mundial, podría haber sido cinco veces más mortal que Covid-19, medido por muertes per cápita. Era inusualmente letal para las personas más jóvenes: el 40 por ciento de las muertes se habían producido entre personas menores de 65 años, mientras que la edad promedio de muerte de Covid-19 es de 80, con sólo el 10-20% de las muertes menores de 65 años.

Lo que llama la atención es cómo los funcionarios de salud pública manejaron la pandemia. Tuvo una respuesta diametralmente opuesta a la que los responsables políticos persiguieron en 2020. Se podría suponer que esto se debió a la negligencia y la falta de sofisticación en la comprensión de la necesidad de encierro. ¡Seguro que no sabían hace 65 años lo que sabemos hoy!

En realidad, esto es completamente falso. De hecho, los expertos en salud pública consideraron el cierre de escuelas, el cierre de negocios y la prohibición de los eventos públicos, pero todo el espíritu de la profesión los rechazó. Había dos motivos para este rechazo: los bloqueos serían demasiado perturbadores, inhabilitando la capacidad de los profesionales médicos para hacer frente competentemente a la crisis, y también porque esas políticas serían inútiles porque el virus ya estaba aquí y se estaba propagando.

Mientras que los bloqueos en el caso Covid-19 podrían haber contribuido a alargar la crisis retrasando la inmunidad del rebaño, el período en el que la gripe asiática tuvo las consecuencias más graves fue de sólo tres meses. Los periódicos apenas lo cubrían y la mayoría de la gente no se daba cuenta. Las historias de la época apenas lo mencionan, mientras que la historia temprana de 2020 hablará principalmente sobre el virus y los encierros. Esto no se debe a la pandemia, sino a la brutal respuesta de la política de pandemia.

El mejor artículo único sobre la respuesta de la política de gripe asiática de 1957-58 es “Salud Pública y Respuestas Médicas a la Pandemia de Influenza 1957-58” por el gran epidemiólogo Donald A. Henderson y otros entre sus colegas en Johns Hopkins. Apareció en 2009 en la revista Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science. Se incrusta al final de este artículo.

El artículo es de vital importancia porque demuestra que no bloquear fue una decisión deliberada, no algún tipo de fracaso. La negativa a perturbar la sociedad y restringir la libertad en presencia de un patógeno fue un logro de las ideas modernas de salud pública. Desde el mundo antiguo hasta el siglo XIX, la respuesta típica a la enfermedad era atribuirla al aire corrupto y huir mientras demonizaba y excluyeba a los enfermos. Los avances médicos modernos, con el descubrimiento de virus y bacterias, antibióticos, terapias antivirales y el funcionamiento del sistema inmunitario humano, aconsejaron la calma de la comunidad y las relaciones médico-paciente.

El organismo de salud pública más influyente en ese momento era la Asociación de Oficiales de Salud Estatales y Territoriales (ASTHO). Se conocieron el 27 de agosto de 1957. Llegaron a la conclusión de que deberían recomendar la atención domiciliaria tanto como sea posible para evitar que los hospitales se abarroten. Instruirían a las personas a buscar atención médica si los síntomas se vuelven graves.

De lo contrario, ASTHO concluyó de la siguiente manera: «’No hay ninguna ventaja práctica en el cierre de escuelas ni en la restricción de las reuniones públicas en lo que se refiere a la propagación de esta enfermedad».

En particular, las escuelas no estaban cerradas porque los expertos en salud pública observaron que los niños simplemente recogerían el virus en otros lugares. “El Comisionado de Salud del Condado de Nassau en Nueva York”, señala Henderson, “declaró que ‘las escuelas públicas deben permanecer abiertas incluso en una epidemia’ y que ‘los niños se enfermarían con la misma facilidad para salir de la escuela'”.

Hemos oído incesantemente que Covid-19 requirió cierres porque es una nueva cepa para la que no hubo una vacuna. Bueno, la gripe asiática ya era nueva y tampoco había vacuna. Para cuando llegó uno, era sólo 60% eficaz y no ampliamente utilizado. Henderson comenta: “Es evidente que la vacuna no tuvo ningún efecto apreciable en la tendencia de la pandemia”.

¿Tal vez tuvimos que cerrar debido a casos asintomáticos? No es verdad. Henderson señala sobre la gripe asiática: “Las tasas de ataque en las escuelas oscilaron entre el 40% y el 60%. Las encuestas serológicas revelaron que la mitad de los que no reportan enfermedad de la gripe mostraban evidencia serológica de infección”.

Para estar seguro de que hubo interrupciones. No ocurrieron por la fuerza, sino por necesidad debido al ausentismo. Fueron efímeros. Los millones de personas expuestas al virus desarrollaron anticuerpos y continuaron. Esto era cierto en particular para los escolares:

“El ausentismo escolar alcanzó su máximo con 280.000 ausencias el 7 de octubre. Esto equivalía al 29% de todos los asistentes a la escuela. La tasa más alta se registró para las escuelas de Manhattan, que tenían una tasa general de 43% de ausencia. Ese día, 4.642 profesores (11%) no se reportó al trabajo debido a estar enfermo. Los establecimientos comerciales, sin embargo, no reportaron un aumento significativo del ausentismo. Dentro de las 2 semanas después del pico,las tasas de absentismo escolar casi volvieron a la normalidad, alrededor del 7%”.

Los informes de periódicos en ese momento no ofrecen ningún registro de cancelaciones generalizadas de eventos públicos y mucho menos cierres forzosos. A veces, los partidos de fútbol de la universidad y de la escuela secundaria se pospusieron debido a ausencias por enfermedad. Algunas convenciones fueron canceladas por los organizadores. Pero eso es todo.

El único editorial del New York Timessobre la gripe asiática reflejó la sabiduría de salud pública: “Mantengamos la cabeza fría sobre la gripe asiática a medida que comienzan a acumularse las estadísticas sobre la propagación y la virulencia de la enfermedad”.

Henderson concluye lo siguiente:

La pandemia de 1957-58 fue una enfermedad tan rápidamente diseminada que se hizo rápidamente evidente para los funcionarios de salud estadounidenses que los esfuerzos para detener o frenar su propagación eran inútiles. Por lo tanto, no se hicieron esfuerzos para poner en cuarentena a individuos o grupos, y se tomó la decisión deliberada de no cancelar o posponer grandes reuniones como conferencias, reuniones de la iglesia o eventos deportivos con el fin de reducir la transmisión.

No se hizo ningún intento de limitar el viaje o de otros casos examinar a los viajeros. Se hizo hincapié en la prestación de atención médica a las personas afectadas y en mantener el funcionamiento continuo de los servicios comunitarios y de salud. Las enfermedades febriles y respiratorias llevaron a un gran número de pacientes a clínicas, consultorios médicos y salas de emergencia, pero un porcentaje relativamente pequeño de los infectados requirieron hospitalización.

El ausentismo escolar debido a la gripe era alto, pero las escuelas no estaban cerradas a menos que el número de estudiantes o maestros cayera a un número lo suficientemente bajo como para justificar el cierre. Sin embargo, el curso del brote en las escuelas fue relativamente breve, y muchos podrían volver fácilmente a las actividades en un plazo de 3 a 5 días. Se dijo que un número significativo de trabajadores sanitarios estaban afectados por la gripe, pero los informes indican que los hospitales eran capaces de adaptarse adecuadamente para hacer frente a las cargas de los pacientes.

Los datos disponibles sobre el absentismo industrial indican que las tarifas eran bajas y que no se interrumpió los servicios esenciales ni de la producción. El impacto global sobre el PIB fue insignificante y probablemente dentro del rango de variación económica normal.

Los funcionarios de salud tenían la esperanza de que los suministros significativos de vacunas pudieran estar disponibles a su debido tiempo, y se hicieron esfuerzos especiales para acelerar la producción de vacunas, pero las cantidades que se disponían eran demasiado tarde para afectar el impacto de la epidemia. La propagación nacional de la enfermedad fue tan rápida que en 3 meses había arrasado por todo el país y había desaparecido en gran medida.

Uno lee este relato detallado de cómo la salud pública respondió entonces en comparación con ahora y la respuesta es llorar. ¿Cómo pudo pasarnos esto? Sabíamos con seguridad que los encierros eran terribles para la salud pública. Lo sabemos desde hace 100 años.

El cierre de una economía contradice rotundamente un principio fundacional de la Organización Mundial de la Salud: “El desarrollo económico y la salud pública son inseparables y complementarios… el desarrollo social, cultural y económico de una comunidad, y su estado de salud, son interdependientes”.

En 1957-58, los funcionarios de salud pública se tomaron en serio esa observación. Esta gripe muy grave se produjo y se produjo con una mínima perturbación social y económica. Sistemas inmunes en los Estados Unidos y en todo el mundo adaptados a la nueva cepa de la gripe.

Diez años más tarde, llegó una nueva mutación de esta gripe. La salud pública respondió de la misma manera, con sabiduría, calma y sin intervenciones en los derechos y libertades de las personas. El funcionamiento social y económico se consideró acertadamente crucial para una visión global de la salud pública.

Los bloqueos fueron descartados en el pasado precisamente para que el daño de una pandemia se minimizara y pudiéramos superarlo más rápidamente. Esta era la ciencia. Esta fue la ciencia hasta la primavera de 2020, cuando todo cambió. De repente, la “ciencia” favoreció olvidar todo lo que hemos aprendido del pasado y reemplazarlo por políticas brutales que destrozaron la economía y la vida de las personas, al tiempo que no lograban nada en términos de minimizar el daño pandémico.

Habíamos pensado en nosotros un vocabulario completamente nuevo diseñado para disfrazar lo que se nos estaba haciendo. No estábamos bajo arresto domiciliario, nuestros negocios destrozados, las escuelas cerradas, las artes en vivo y los deportes abolidos, nuestros planes de viaje destrozados y separados por la fuerza de sus seres queridos. No, sólo estábamos experimentando “mitigación de enfermedades” a través de “contención en capas dirigidas”, “intervenciones no farmacológicas” y “distanciamiento social”.

Todo esto es Owelliano con la sabiduría tradicional de salud pública habiendo sido derribado por el agujero de la memoria. La ciencia real no cambió. La salud pública tradicional nos implora que consideremos no sólo un patógeno, sino todas las variables que afectan a la salud, no sólo a corto plazo, sino también a largo plazo. Así fue y así es hoy.

In the Asian Flu of 1957-58, They Rejected Lockdowns – AIER

EL VIRUS CAE DEL CIELO

The virus falls from the sky

Que no del espacio exterior. Buscando y leyendo desde que empezó el tema del coronavirus, a falta de la coherencia oficial, como que en octubre de 2020 la OMS cambiara la versión y significado de “inmunidad de rebaño”, he leído de todo, hay que saber buscar. En los medios de comunicación masivos sólo hay un mensaje, dirigido y teledirigido a base de acallar al otro, al que piensa diferente pero también científicamente. Hay de todo, malo, bueno y barato, tanto en el mensaje oficial (ridículo, porque en realidad están diciendo que no sabemos nada de este virus, y más bien de los virus en general) como en los mensajes digamos extraoficiales, al menos llenos de matices y colmando un vacío que proporcionado a sabiendas, la propia naturaleza humana lo ocupa a veces hasta rebozar. Bueno, somos humanos, tan naturales como un virus, bueno, o no.

Yoichi Shimatsu, periodista y escritor en una saga de 28 escritos o artículos que van del 9 de enero al 16 de noviembre de 2020 para rense.com que hacen de el un verdadero ensayo. En la entrega o parte 20 tiene una teoría de la propagación de esta quimera (virus) al menos un tanto curiosa y no menos científica, nunca antes ni oída ni vista para con los virus y su propagación.

Os dejo aquí la parte del artículo que nos concierne, y yo me pregunto, ¿alguien nos está ocultando información? Si se dan cuenta, las autoridades tienen una obsesión con la noche, no quieren que salgamos a la calle digamos de 12 a 6 am. ¿Pero porqué? ¿Qué nos esconden?

Aquí la parte del artículo 20, por cierto, está escrito (los tiempos son importantes) el 23 de abril de 2020 titulado Nublado con una probabilidad de caídas de los cadáveres dispersos COVID en las islas de calor urbano – Parte 20 / Cloudy With A Chance Of Scattered Cadavers COVID Fallout On Urban Heat Islands – Part 20 :

Arquitecto de soluciones Urban Heat Island

Mi área de especialización en periodismo de crisis con especial atención a los desastres, con enfoque en los factores humano-causales y el impacto social, se enriqueció mucho al cooperar con el profesor de arquitectura Stephen Lau, el pionero más importante de Asia en los efectos de la isla de calor urbana (UHI) entonces en la Universidad de Hong Kong y más recientemente en la Universidad Nacional de Singapur. La concentración de calor sobre ciudades y ciudades más grandes es un fenómeno probado por la investigación con un impacto importante en la salud pública, como se muestra en este contagio del coronavirus.

Fuera del campo arquitectónico, el efecto Isla de Calor Urbano (UHI) no es bien conocido debido a la desafortunada dominación mediática por dudosos estudios ambientales de la teoría del “calentamiento global”, la mayoría de ellos un fraude promovido por la industria de la energía nuclear para perpetuar el mito de que el uranio es seguro, limpio, barato y “verde” (como la kriptonita es para Superman). El monopolio mediático de la agenda climática alimentada por la energía nuclear es el principal factor para que el público desconocie el papel de la corriente de chorro en la transmisión del COV a las metrópolis del hemisferio norte.

Ciudades en una burbuja

En la parte superior de una burbuja de calor sobre cualquier ciudad dada, hay un diferencial de temperatura de mediodía diario mensurable de alrededor de 7 grados C (alrededor de 12 F) más alto que la atmósfera circundante, mientras que los modelos de cambio climático, que no se basan en la investigación de campo real, estiman menos de un aumento de 1 grado durante un siglo. LA UHI es palpable y a veces insoportable, mientras que el “calentamiento global” es imperceptible en un termómetro de mercurio. Casi todos los activistas del cambio climático residen y crecen en las grandes ciudades, confundiendo un punto de calor localizado para una condición general del mundo. En esta premisa falsa, la percepción distorsionada se extrapola utilizando datos de estaciones meteorológicas metropolitanas para aumentar los hallazgos de los centros de meteorología rurales, sesgando los resultados a un nivel más alto posible de 1 grado C durante cien años, no es gran cosa en absoluto. Cientos de millones de dólares.han sido desperdiciados en este ejercicio de distracción por la industria de la energía nuclear, mientras que las grandes ciudades se han quedado indefensas contra las enfermedades infecciosas transmitidas por la corriente de chorro y el efecto UHI. Nuclear siempre se escapa de sus crímenes, incluyendo Three Mile Island, Chernobyl y Fukushima, castigados con una bofetada en la mano y nada cercano a la indemnización para las víctimas de sus inversores, y mucho menos multas punitivas.

Este tipo de fraude científico y colusión política han suscitado malas decisiones políticas por parte de los ayuntamientos y los gobiernos nacionales en favor de la urbanización de alta densidad y la concentración de población dentro de las megaciudades en beneficio de los grandes bancos, el capital privado, los inversores institucionales, los desarrolladores inmobiliarios y las cadenas minoristas corporativas. Desde esta perspectiva, el contagio del coronavirus es principalmente culpa de la política estatal corrupta en favor de los desarrolladores de propiedades y el capitalismo de consumo en oposición al interés nacional a largo plazo servido por una mezcla de baja densidad de ciudades rodeadas por un campo financieramente estable de granjas familiares, el modelo basado en la democracia Jeffersoniana en lugar del favoritismo hamiltoniano hacia los bancos centrales y las finanzas de Wall Street.

Plume sobre Wuhan

Para comprender cómo los virus de Wuhan y Chongqing rodearon el planeta para converger e infectar ciudades con una enorme bio-caída, debemos comenzar al principio, en los 84 hornos en crematorios en Wuhan y aproximadamente la mitad de ese número aguas arriba en la guarnición de Chongqing del Grupo PLA 77, donde posiblemente más de 2.000 soldados murieron de infección por COV por el ataque de la guerra contra el CISM. Como se evidencia en la larga franja amarilla a la izquierda de la imagen del satélite Windy, sus cuerpos de soldados infectados durante y después de los juegos militares de Wuhan fueron eliminados en secreto en los crematorios en todo el municipio de Chongqing, aparentemente todavía sin notificación de sus parientes más cercanos. Este trato de los jóvenes caídos no es el honor que se debe dar a los jóvenes patrióticos que protegieron a los atletas militares extranjeros, se reunieron en defensa de la ciudadanía wuhan y evitaron una propagación aún peor por todo el mundo. Especialmente después de meditar en el aro de los medios de comunicación de Beijing sobre “ganar una guerra popular en Wuhan”, me entristece aún más pensar en términos del costo humano de las profundidades a las que la propaganda del régimen puede hundirse a expensas de vidas innecesariamente perdidas consideradas meras carnes de cañón. ¿Qué tan importante es salvar la cara cuando las víctimas inocentes están perdiendo la vida en masa?

Dado el recuento repetido de falsos cuerpos, el número total de cremaciones sigue siendo cuestionable, incluso con el nuevo recuento revisado de 3.869 muertes en Wuhan, aparentemente sin incluir a los oficiales de policía y a los condenados a prisiones. Una estimación conservadora de 6.000 muertes militares y civiles también puede ser una subestimación, al considerar el tamaño de la neblina de azufre sobre las dos ciudades durante más de un mes de cremaciones sin parar. El aparejo de números es intolerable, bárbaro e inhumano, especialmente para los parientes más cercanos de los muertos.

La temperatura dentro de un horno de crematorio es ideal en el rango de 975 C (1.750 F), más o menos cien grados, para hacer un cuerpo a cenizas en una hora. Durante las semanas centrales de la crisis de Wuhan, las temperaturas de combustión deben haber aumentado para acelerar la eliminación de cuerpos para evitar la descomposición y la liberación de virus. Las altas temperaturas constantes del horno, sin embargo, causan la descamación y roturas de las tuberías de alimentación de gas, añadiendo más presión sobre los equipos de trabajo agotados. El intervalo entre cremaciones implica la reducción de la temperatura con el fin de eliminar las cenizas e insertar el siguiente cadáver. Este nivel de calor más bajo durante el período de reinicio permitió a los virus escapar a través de las chimeneas relativamente cortas para montar el penacho de calor de enfriamiento en el cielo.

Debido a la amenaza potencial para que los equipos de emergencia que transportaban cuerpos de los hospitales a los crematorios, los cadáveres frescos fueron desempolvados con polvo de azufre para evitar que las infecciones bacterianas se expandieran las pústulas en llagas abiertas que liberan virus en el aire. Este tipo de método pragmático es uno de los aspectos más desconcertantes para manejar los cuerpos de los muertos, que no se reporta en los medios de comunicación o incluso en la literatura académica, que presencié cuando era un niño y ayudante en la funeraria de mi tío para crear un parecido del difunto para una visión de ataúd abierto por los dolientes. Bombear formaldehído en las venas como un antiséptico, un conservante, consume demasiado tiempo e inapropiado para una emergencia como Wuhan y tal arte no tiene sentido cuando un cuerpo requiere eliminación inmediata a medida que la descomposición se instala, la propagación del hedor, los líquidos y las bacterias junto con los virus en el aire. Un cadáver infectado que se desintegró en una acera en Wuhan habría sido desastroso, por lo que algunas toallas y azufre tuvieron que ser suficientes para el traseso del hospital y el viaje en furgoneta de una hora de duración a un crematorio. Saludo a esos héroes no cantados, los trabajadores de emergencia, por su gran resistencia a luchar a través de ese infierno en la Tierra.

Cube-Sat infrarrojo sobre la pira

El sitio de desinformación de la CIA Snopes, hace mucho tiempo desacreditado en mis artículos de años atrás, está arrojando tonterías sobre supuestos gráficos falsos del servicio meteorológico Windy. Además del polvo de azufre para evitar la descomposición de la piel, se encuentran cantidades adicionales de dióxido de azufre y óxido nitroso en el gas natural de menor calidad de las plantas de separación de gases. Por el contrario, se filtra el gas de cocina para su cocina a un alto costo. Como nadie está cenando en la carne asada, el gas más barato tiene que ser suficiente. Las imágenes ventosas de las emisiones de azufre y nitrógeno no son gráficos informáticos fantasiosos basados en el modelado teórico, como afirma falsamente Snopes, sino basados en la vigilancia de los satélites de observación de la Tierra utilizados para detectar liberaciones y explosiones químicas.

El EOS de teledetección (satélite de observación de la Tierra) es un dispositivo de monitoreo en forma de cubo o “cúbico” con un detector hiperespectral (multi-longitud de onda altamente sensible) en el ancho de banda infrarrojo, que también se puede utilizar para detectar preparaciones de lanzamiento para cohetes y rastrear incendios forestales, cualquier cosa que emita calor. Los datos son procesados por ordenador en imágenes precisas codificadas por colores, en este caso particular por el servicio meteorológico Windy con sede en Praga, República Checa. Lo imaginante no es una especie de ficción, como afirma Snopes, pero es muy precisa y científica.

Esta distorsión es otro ejemplo de la gran cantidad de desinformación oficial en respuesta al peor evento terrorista de la historia reciente, mucho más allá del 911. La operación de desninfo del Estado Profundo debe ser investigada, desmantelada y los funcionarios a cargo encarcelados. Demasiada gente está muerta y muriendo por este tipo de interferencia política y chicanería mediática. ¡Muchas gracias al equipo Windy por la gran captura, Dekuji!

Exploding Body Fat

Los virus del COV permanecen activos dentro de los cadáveres y pueden ser infecciosos durante un período indeterminable, como recientemente se descubrió en el shock de un forense en Tailandia. El cuerpo de un adulto no se convierte fácilmente en cenizas, siendo tan pesado como una vaquilla con contenido de agua en alrededor del 55 por ciento del peso corporal. La fase inicial de la cremación tiene que representar gran parte del contenido de agua como vapor, lo que impide la incineración. Otro problema para la quemadura es la grasa subcutánea, y los chinos de hoy tienden a tener sobrepeso de una dieta aceitosa. La grasa del vientre explota y silba, soplando partículas de sangre y carne en la columna de calor hacia el cielo. Sería como poner al máximo tu parrilla de barbacoa y añadir un lanzallamas, soplando ese asado de cerdo como un petardo en pocos segundos.

Dado que las chimeneas del crematorio son más cortas que una chimenea de chimenea, liberando prematuramente partículas de carne crujientes en la superficie exterior, pero no completamente “cocinadas”, ni siquiera medio rara pero rara. La incineración apresurada dio lugar a miles de millones y probablemente billones de virus en espiral hacia arriba en el borde del vórtice de calor que se elevan a los confines más bajos de la corriente de chorro para ser transportados a tierras extranjeras.

En un día normal, el penacho de cremación se elevará a 3.000 metros, pero Wuhan fue un extraordinario evento de super-bonfire, que va las 24 horas del día durante semanas, con una enorme efusión de energía térmica que proporciona un enorme aumento, alcanzando fácilmente 8.000 metros (5 millas), la altitud del último invierno y la corriente de chorro de primavera temprana moviéndose a más de 250 mph. Las bacterias, que contienen agua, se congelarán y morirán en estas condiciones. Los virus, sin embargo, no son organismos, sino más bien máquinas y pueden sobrevivir al frío extremo durante una larga duración, como lo muestran las partículas de ARN en el permafrost siberiano a -50C o -55F, que pueden ser revividos por los microbiólogos.

A estas alturas, un mes después del final de las cremaciones masivas, probablemente sea demasiado tarde para llevar un paraguas contra cualquier consecuencia de carne humana y virus activos. El peligro inmediato de los cielos ha pasado, aparte de la posibilidad de que los virus escapen de las cremaciones en Corea del Sur, Japón, partes de Estados Unidos y Europa, y en todo el planeta. Has oído la expresión “Está lloviendo gatos y perros afuera” para que puedas decirle a tus nietos: “Yo estaba allí cuando llovía cadáveres”.

Decencia del entierro

La indignidad de la incineración masiva en una fría y cruel respuesta urbana a una epidemia contrasta con los lentos ritos que presencié en el sur de Tailandia, como voluntario para la labor de búsqueda y rescate después del tsunami asiático que azotó el día después de la Navidad de 2004. Un cuidador con un templo local al norte de Phuket apiló madera alrededor de una víctima de ahogamiento mientras un monje cantaba una bendición, y luego puso una antorcha en los troncos. La pira ardió durante horas hasta la reducción final a cenizas y algunos huesos, que fueron rastrillados y colocados en una caja de madera con otra oración. En ese momento, me dirigí de regreso a la costa para reincorporarme a un equipo tailandés y coreano mientras el explorador olfateaba cuerpos atrapados bajo edificios, bajo montones de escombros o embistido por la presión de las olas en las raíces de las palmeras. Mi sentido del olfato era mucho mejor que otros, debido al hábito coreano de comer kimchee y los tailandeses que consumen salsa picante tipo Sri Racha, así que se dejó a mi nariz de tofu aburridamente sosa para ser el perro de búsqueda.

Días más tarde llegó una reunión de Nochevieja en silencio para voluntarios cansados desgastados por el hedor de cuerpos hinchables en descomposición mientras buscaban marcas de identificación para escribir en carteles para familias angustiadas antes de cerrar las bolsas del cuerpo. En una colina era el único lugar para que los voluntarios pasaran la noche en las vacaciones. Los tailandeses de Bangkok, canadienses, holandeses y algunos otros se reunieron sobre cajas de cerveza y almuerzos de cajas de expiración pasada para compartir tranquilamente su trauma una larga sombra del sol que se pone en el mar de Andamán se deslizó a través del amplio balcón.

Cuando un joven expresó su sentimiento de culpa por beber después de una experiencia tan horrible, como la persona mayor allí les dije a todos que cada uno de ellos se ganó este momento y relajarse en una rara noche especial aparta un año aterrador y dará a todos fuerzas para el calvario de mañana por la mañana y para el resto de sus vidas. Por cualquier razón que hayamos venido aquí, cada uno sabe ahora a través del testimonio personal que la vida termina con la muerte y por eso hemos aprendido a acercarnos a la muerte con calma no como algo horrible, sino como un tributo a la vida de otra persona. Entonces, ¿qué mejor momento para un brindis por ustedes valientes voluntarios? En los primeros albores del año 2005, cada individuo partió por un camino diferente a lo largo de la interminable línea del tsunami, cada uno de acuerdo en que aunque llegamos como extraños y quedamos traumatizados por esta experiencia fue la mejor Nochevieja que esta breve existencia podría permitirse.

Arco de la pandemia

Tokio – El penacho que sale de Wuhan llega a la costa del Pacífico en media hora, en el Mar de China Oriental, donde los primeros aviones de primavera se curvan hacia el noreste hacia Japón, mientras que las nevadas de finales de primavera se convierten en lluvias lluviosas sobre las primeras grandes islas de calor urbano de los distritos de negocios de Shinjuku, Maruchiuno y Shimbashi de Tokio. A medida que los equipos de limpieza apagan las luces de las torres de oficinas, una corriente descendente empuja innumerables virus hacia los suburbios periféricos donde sus compañeros de oficina se dirigen a la estación local, sin saber que están caminando a través de una niebla viral. En la hora punta de la mañana temprano, los virus llegan al centro con las hordas de viajeros empacados en el metro.

La capital japonesa es altamente radiactiva, como se muestra en el monitoreo de datos de un grupo ciudadano que ha encontrado docenas de puntos críticos. El nivel de radiactividad ha matado las algas en la bahía de Tokio, pero los virus corona son sólo 120 nanómetros de ancho, tres veces más pequeños que los poros en una máscara facial médica. No se ha investigado, pero los virus son probablemente lo suficientemente pequeños como para evitar impactos directos de la radiación gamma sobre la región de Tokio. Los pasajeros a bordo del crucero Diamond Princess nunca tuvieron la oportunidad, especialmente una noche, contra los miles de millones de virus que caen de la corriente de chorro hacia la bahía de Tokio, siendo estos lo suficientemente pequeños como para pasar a través del sistema de filtración de aire de la nave. Esta es la razón por la que mi equipo de microbiólogos en la crisis del SARS de Hong Kong abogó por los limpiadores de aire con la generación UV de radicales libres de dióxido de titanio para desinfectar el aire interior. El resto del mundo no se ha puesto al día y no ha mostrado mucho interés en estas tecnologías eficaces.

Trans-Pacífico – El flujo continuo de virus en el chorro de flujo que viaja hacia el norte hasta el estrecho de Bering y luego hacer una trayectoria balística hacia el sur para hacer tierra en Seattle, la primera ciudad estadounidense con una gran cantidad de infecciones, aunque muchos de ellos son parientes de Navy SEALS que participaron en los juegos de Wuhan, y luego procediendo hacia el sur a través del área de la bahía y Los Angeles , girando antes de la frontera con México hacia vastos tramos vacíos de Texas. La población de la costa oeste ha sufrido mucho daño en el tejido pulmonar por Fukushima y la radiactividad local, los incendios forestales relacionados y ahora las pruebas 5G, por lo que una alta tasa de mortalidad por virus transmitidos por chorros es una inaltería.

Nueva Orleans – Los celebrantes que convergían para Mardi Gras a finales de febrero capturaron la altura misma de las consecuencias del virus de origen Wuhan. Contrariamente a la historia de brujas sin sentido de Fauci y sus brujos, los que se fueron de fiesta de esos estados del medio oeste y del sur estaban libres de infecciones, y en su lugar los virus cayeron sobre sus cabezas después de descender a lo largo del camino de deslizamiento sobre las frías aguas del Misisipi. Nueva Orleans es una isla de calor urbano ubicada entre dos cuerpos de agua que atraen virus, el Poderoso Misisipi y el Golfo de México. Sea cual sea la forma en que sopla el viento, los virus están fluyendo hacia Bourbon Street, lo cual es una pena ya que un buen momento es tener un linint up de botellas de cerveza Dixie, pero no se trague las ostras de aguas profundas. El mundo se ha deteriorado desde aquellos días universitarios que me autogané a Nawlins para disfrutar de música y toda la noche.

Fort Lauderdale y Miami – El diferencial de temperatura de Sunny Florida entre las áreas interiores y la costa significa que las cascadas de coronavirus fluyen en corriente descendente directamente hacia las playas y son soplados de vuelta hacia la costa por la brisa de las olas, empapando en parte a los estudiantes universitarios vestidos en las vacaciones de primavera y de Pascua. Ya no enseñan ciencias en la universidad cuando la mojito mixología y el sexo son las especialidades más populares entre los jóvenes y tontos.

Nueva York – Poco después de que el Polar Vortex se desplazara hacia el este desde la región de Ohio hacia el noreste, la siguiente gran oportunidad para la infección masiva fue en la línea de abejas a Nueva York y Boston, ambos puertos con ríos y rascacielos imponentes con calor de vapor a plena ráfaga. Estas son las clásicas Islas de Calor Urbana, con potentes cambios de presión de aire como pistones. Por lo tanto, durante el día, la burbuja de calor de Manhattan arroja virus hasta los espacios abiertos de Brooklyn y Staten Island. Por la noche, después de que las oficinas cierran sus puertas y la temperatura del suelo se desploma, los virus bajan en Central Park y luego en las aceras llenas de visitantes a la Gran Manzana. Los cañones de estructuras altas atrapan virus, vertiendo por las entradas del metro, a través de puertas giratorias y en los conductos de ventilación de los taxis. El Apple es un refugio de virus, que se remata cada noche, mientras que los equipos de emergencia en carretillas elevadoras que cargan cuerpos en camiones refrigerados que están sirviendo a una morgue temporal hasta que 45 nuevas unidades de almacenamiento de cadáveres se establecen en toda la metrópolis. Hart Island se utiliza como un lugar de entierro masivo. Esto es primitivo, de vuelta a la Edad Oscura. La ciudad de Nueva York no tiene espacio para los cuerpos, que comenzarán a engordarse con billones de nuevos virus a medida que el clima se calienta a finales de abril. Wall Street está rodeada por la ola de la muerte que creó.

Londres, Madrid y Milán – Lo mismo ocurre con Europa, cuando la corriente de propulsión giraba hacia el sur sobre Londres, se dirigió a Madrid y se desmayó sobre Milán, en la peor campaña de bombardeos desde la Segunda Guerra Mundial. Desde allí el flujo de aire cruzó sobre Moscú “inmune”, que ahora se está descongelando a una floración viral. El chorro de agua ya se ha ido hacia el norte sobre Beijing y la región de Dongbei del noreste de China alrededor de Shenyang y luego Corea del Norte, donde el Gran Líder cayó repentinamente enfermo cuando CoV comenzó a mejorar en el calentamiento de las temperaturas al aire libre. El Grim Reaper es una bestia de mil millones de virus acechando la tierra para nuevas víctimas.

Aprender de los desafíos de la vida

Basado en la práctica de las contramedidas de Urban Heat Island, incluyendo “techos verdes” para reducir la burbuja de calor y el uso de agua subterránea como refrigerante en lugar de sistemas de enfriamiento de techos generadores de calor, los virus no caerían al nivel del suelo en tal abundancia, sino que circularían en la corriente de chorro hasta que la radiación solar los destruyera. La solución es así de simple. Los flujos de aire en oficinas, restaurantes y hogares que canalizan el aire rancio hacia arriba y fuera de los interiores hasta el nivel del techo reducirían las probabilidades de infección en un millón de veces más. Un mejor diseño de inodoros y urinarios, y especialmente secadores de manos, que ahora soplan virus de las manos a la cara, era parte de las propuestas de mi equipo de microbiología, con algunos adoptados en Hong Kong y el continente y otros ignorados, lo que de hecho ha ahorrado a Hong Kong la peor parte de este contagio. Pequeños pasos marcan una gran diferencia en la salud pública, ya que es más eficaz para combatir enfermedades infecciosas en el entorno construido que dentro de su cuerpo.

Si la sociedad va a revivir y sobrevivir, no puedes olvidar esta pandemia como un mal sueño cuando el encierro ha terminado y vuelve a vivir como un cerdo en un estilete. Si no se realizan cambios, entonces el próximo brote podría ser el último. Es muy importante, ya que he estado haciendo hincapié en no quedar atrapado en conceptos abstractos sin apoyo por datos convincentes, como el calentamiento global y la teoría del cambio climático, que son responsables de descarrilar los pasos básicos que fueron defendidos por el movimiento temprano del Día de la Tierra de desarrollar una sociedad de reciclaje para hacer frente a las montañas de residuos tóxicos, para eliminar radicalmente la mayoría de los pesticidas y otras contaminaciones químicas , para promover estilos de vida saludables en una mezcla de campo y ciudad en lugar de mega-ciudades, y homeopatía y terapias herbales en lugar de montones de productos farmacéuticos.

El coronavirus está aquí porque las personas eran perezosas y mentalmente laxas, permitiendo que algunos actores cínicos desarrollaran virus en armas de destrucción masiva porque se dieron cuenta de que no había medidas de bioseguridad en su lugar, ni siquiera los hábitos simplemente de saneamiento personal. Esta es probablemente la última llamada, porque si no respondes y actúas y aplicas presiones políticas y boicoteas a las corporaciones malvadas, la próxima será la última llamada.

La vida dentro de una burbuja

Las megaciudades son el problema y no la solución. Los estados centrales del medio oeste tienen los menos niveles de infecciones por coronavirus y también están en las peores condiciones financieras debido al dominio de la agroindustria corporativa que se beneficia de las exportaciones de soja y maíz a China y a los banqueros y comerciantes de materias primas que lo financian. Mientras tanto, las granjas familiares han sufrido deudas crónicas e impagos hipotecarios debido a las políticas de préstamos de ingeniería financiera en favor de los propietarios de tierras corporativas a megaescala implementadas por Wall Street y State Street, los mismos intereses plutocráticos responsables de la actual pandemia del CoV y la guerra biológica que la desató.

La promoción neoliberal de las megaciudades y el despojo de las comunidades agrarias es esencial para el control corporativo-bancario-político de todos los recursos naturales, desde minerales y energía hasta la producción de alimentos y fuentes de agua, mientras empaquetaba a la gente en recintos cada vez más ajustados, con un bloqueo esencial para el reciclaje psicológico de las expectativas “poco realistas” de lo que era normal no hace mucho tiempo, mientras que los miembros multimillonarios de la junta poseen múltiples mansiones, islas de playa y centros personales. El aislamiento social impuesto a los Estados del Medio Oeste sin apenas casos COVID es una prueba del internamiento masivo de una sociedad una vez libre basada en la autonomía de los hogares agrícolas y de la comunidad local. Siempre he entendido que el internamiento en tiempo de guerra de mi kinfolk fue un experimento de lavado de cerebro por parte de los liberales globalistas Roosevelt, un juicio por un eventual asalto total a los derechos constitucionales. El intento desesperado de la élite fascista neoliberal de destruir los valores y formas de vida tradicionales es una agresión sin barnizar, una guerra de clases por parte de las instituciones criminales ricas y poco representativas contra una democracia de base comprometida con la vida, la libertad y la búsqueda de la felicidad.

La OMS elimina la inmunidad adquirida naturalmente de su sitio web

WHO Deletes Naturally Acquired Immunity from Its Website

Jeffrey A. Tucker – 23 de diciembre de 2020. Tiempo de lectura: 5 minutos

¿Quizás tienes la sensación de que algo sospechoso está pasando? Mismo. Si no es una cosa, es otra.

El coronavirus vivió en superficies hasta que no lo hizo. Las máscaras no funcionaban hasta que lo hacían, entonces no lo hicieron. Hay una transmisión asintomática, pero no la hay. Los bloqueos funcionan para controlar el virus, excepto que no lo hacen. Todas estas personas están enfermas sin síntomas hasta que, a mal tiempo, las pruebas de PCR son tremendamente inexactas porque nunca fueron diseñadas para ser herramientas de diagnóstico. Todos están en peligro del virus, excepto que no. Se propaga en las escuelas, pero no lo hace.

En él va. Diario. No es de extrañar que tanta gente haya dejado de creer cualquier cosa que digan “autoridades de salud pública”. En combinación con los gobernadores y otros autócratas que hacen sus órdenes, se propusieron quitarles la libertad y los derechos humanos y esperaban que les agradeciémos por salvarnos la vida. En algún momento de este año (para mí era el 12 de marzo) la vida comenzó a sentirse como una novela distópica de su elección.

Bueno, ahora tengo otra prueba que añadir a la pila de desorden de peces. La Organización Mundial de la Salud, por razones desconocidas, ha cambiado repentinamente su definición de una concepción básica de la inmunología: la inmunidad del rebaño. Su descubrimiento fue uno de los principales logros de la ciencia del siglo XX, emergiendo gradualmente en la década de 1920 y luego cada vez más refinado a lo largo del siglo XX.

La inmunidad al rebaño es una observación fascinante que se puede rastrear a la realidad biológica o a la teoría de probabilidad estadística, lo que prefiera. (Ciertamente no es una “estrategia”, así que ignore cualquier fuente de medios que la describa de esa manera.) La inmunidad del rebaño habla directamente, y con poder explicativo, a la observación empírica de que los virus respiratorios son generalizados y en su mayoría leves (frío común) o muy graves y de corta duración (ébola).

¿Por qué es esto? La razón es que cuando un virus mata a su huésped – es decir, cuando un virus sobrecarga la capacidad del cuerpo para integrarlo, su huésped muere y por lo tanto el virus no se propaga a otros. Cuanto más ocurre esto, menos se propaga. Si el virus no mata a su huésped, puede saltar a otros a través de todos los medios habituales. Cuando obtienes un virus y lo combates, tu sistema inmunitario codifica esa información de una manera que crea inmunidad a él. Cuando le sucede a suficientes personas (y cada caso es diferente por lo que no podemos poner un número claro en él, especialmente dadas tantas inmunidades cruzadas), el virus pierde su calidad de pandemia y se vuelve endémico, es decir predecible y manejable. Cada nueva generación incorpora esa información a través de una mayor exposición.

Esto es lo que uno llamaría Virología/Inmunología 101. Es lo que lees en todos los libros de texto. Se ha enseñado en biología celular de noveno grado durante probablemente 80 años. Observar las operaciones de este fenómeno evolutivo es bastante maravilloso porque aumenta el respeto por la forma en que la biología humana se ha adaptado a la presencia de patógenos sin enloquecer absolutamente.

Y el descubrimiento de esta fascinante dinámica en biología celular es una de las principales razones por las que la salud pública se volvió tan inteligente en el siglo XX. Mantuvimos la calma. Gestionamos virus con profesionales médicos: relaciones médico/paciente. Evitamos la tendencia medieval a correr con el pelo en llamas, sino que usamos racionalidad e inteligencia. Incluso el New York Times reconoce que la inmunidad natural es poderosa con Covid-19, lo cual no es en lo más mínimo sorprendente.

Hasta que un día, esta extraña institución llamada Organización Mundial de la Salud, una vez gloriosa porque era la principal responsable de la erradicación de la viruela, ha decidido de repente eliminar todo lo que acabo de escribir de los conceptos básicos de la biología celular. Literalmente ha cambiado la ciencia de una manera soviética. Se ha eliminado con la clave de eliminación cualquier mención de inmunidades naturales de su página web. Ha dado el paso adicional de caracterizar realmente la estructura y el funcionamiento de las vacunas.

Para que me creas, trataré de ser lo más preciso posible. Aquí está el sitio web del 9 de junio de 2020. Puedes verlo aquí en Archive.org. Usted tiene que mover hacia abajo la página y haga clic en la pregunta sobre la inmunidad del rebaño. Ves lo siguiente.

Eso es bastante preciso en general. Incluso la afirmación de que el umbral “todavía no está claro” es correcta. Hay inmunidades cruzadas a Covid de otros coronavirus y hay memoria de células T que contribuye a la inmunidad natural.

Algunas estimaciones son tan bajas como 10%, que está muy lejos de la estimación modelada del 70% de la inmunidad al virus que es estándar dentro del ámbito farmacéutico. La vida real es mucho más complicada que los modelos, en economía o epidemiología. La declaración pasada de la OMS es una descripción sólida, si “pop”.

Sin embargo, en una captura de pantalla fechada el 13 de noviembre de 2020, leemos la siguiente nota que de alguna manera pretende como si los seres humanos no tuvieran sistemas inmunes en absoluto, sino que dependen enteramente de grandes farmacias para inyectar cosas en nuestra sangre.

Lo que ha hecho esta nota en la Organización Mundial de la Salud es eliminar lo que equivale a toda la historia del millón de años de la humanidad en su delicada danza con patógenos. Sólo se podía obtener de esto que todos nosotros no somos más que pizarras en blanco e inaprobables en las que la industria farmacéutica escribe su firma.

En efecto, este cambio en la OMS ignora e incluso elimina 100 años de avances médicos en virología, inmunología y epidemiología. Es completamente poco científico: chelines para la industria de las vacunas exactamente como los teóricos de la conspiración dicen que la OMS ha estado haciendo desde el comienzo de esta pandemia.

Lo que es aún más extraño es la afirmación de que una vacuna protege a las personas de un virus en lugar de exponerlas a ella. Lo sorprendente de esta afirmación es que una vacuna funciona precisamente disparando el sistema inmunitario a través de la exposición. Por qué tuve que escribir esas palabras está realmente más allá de mí. Esto se conoce desde hace siglos. Simplemente no hay manera para que la ciencia médica reemplace por completo el sistema inmunitario humano. Sólo se puede jugar a través de lo que solía llamarse inoculación.

Toma de esto lo que quieras. Es un signo de los tiempos. Durante casi un año completo, los medios de comunicación nos han estado diciendo que la “ciencia” requiere que cumplamos con sus dictados que van en contra de cada principio del liberalismo, cada expectativa que hemos desarrollado en el mundo moderno que podemos vivir libremente y con la certeza de los derechos. Entonces la “ciencia” se hizo cargo y nuestros derechos humanos fueron criticados. Y ahora la “ciencia” en realidad está eliminando su propia historia, aerógrafo sobre lo que solía saber y reemplazarlo por algo engañoso en el mejor de los casos y evidentemente falso en el peor.

No puedo decir por qué, exactamente, la OMS hizo esto. Sin embargo, dados los acontecimientos de los últimos nueve o diez meses, es razonable suponer que la política está en juego. Desde el comienzo de la pandemia, aquellos que han estado presionando los bloqueos y la histeria sobre el coronavirus han resistido la idea de inmunidad natural del rebaño, en cambio insistiendo en que debemos vivir encerrados hasta que se desarrolle una vacuna.

Es por eso que la Declaración del Gran Barrington,escrita por tres de los epidemiólogos preeminentes del mundo y que abogaba por abrazar el fenómeno de la inmunidad del rebaño como una forma de proteger a los vulnerables y minimizar los daños a la sociedad, fue recibida con tal veneno. Ahora vemos a la OMS también sucumbiendo a la presión política. Esta es la única explicación racional para cambiar la definición de inmunidad del rebaño que ha existido durante el siglo pasado.

La ciencia no ha cambiado; sólo la política tiene. Y es precisamente por eso que es tan peligroso y mortal someter la gestión del virus a las fuerzas de la política. Eventualmente la ciencia también se inclina hacia el carácter duplicado de la industria política.

Cuando los libros de texto existentes que los estudiantes usan en la universidad contradicen los últimos pronunciamientos oficiales de las autoridades durante una crisis en la que la clase dominante claramente está tratando de apoderarse del poder permanente, tenemos un problema.

WHO Deletes Naturally Acquired Immunity from Its Website – AIER

La Agenda Secreta del Banco Mundial y el FMI

Por Peter Koenig

El Banco Mundial y el Fondo Monetario Internacional (FMI) trabajan de la misma mano – sin problemas. No sólo están prestando regularmente enormes sumas de dinero a regímenes de terror de todo el mundo, sino que chantajean a las naciones pobres para que acepten condiciones draconianas impuestas por Occidente. En otras palabras, el BM y el FMI son culpables de los abusos más atroces contra los derechos humanos.

No se podía decir, cuando se lee sobre la entrada del Banco Mundial la noble frase, “Nuestro sueño es mundial libre de pobreza”. A esta hipocresía sólo puedo añadir, “… Y nos aseguramos de que siga siendo un sueño”. Esto dice ambas cosas, la mentira y el carácter criminal de las dos Instituciones Financieras Internacionales, creadas bajo la Carta de las Naciones Unidas, pero instigadas por los Estados Unidos.

El frente de estas instituciones es brillante. Lo que le parece a las inversiones en infraestructura social, en escuelas, sistemas de salud, necesidades básicas como agua potable, saneamiento, incluso protección del medio ambiente, sobre todo “Alivio de la pobreza”, es decir, un mundo libre de pobreza. Pero lo falso que es esto hoy en día y ya estaba en los años 1970 y 1980 es asombroso. Poco a poco la gente está abriendo los ojos a una realidad abyecta, de explotación y coerción y chantaje total. Y eso, bajo los auspicios de las Naciones Unidas. ¿Qué le dice sobre el sistema de las Naciones Unidas? ¿En qué manos están las Naciones Unidas? – La organización mundial fue creada en San Francisco, California, el 24 de octubre de 1945, justo después de la Segunda Guerra Mundial, por 51naciones, comprometidas con el mantenimiento de la paz y la seguridad internacionales, el desarrollo de relaciones amistosas entre las naciones y la promoción del progreso social, mejores niveles de vida y derechos humanos.

La ONU reemplazó a la Sociedad de Naciones que formaba parte del Acuerdo de Paz después de la Primera Guerra Mundial, el Tratado de Versalles. Entró en vigor el 10 de enero de 1920, tenía su sede en Ginebra, Suiza, con el propósito de desarme, prevenir la guerra a través de la seguridad colectiva, resolver disputas entre países, mediante la diplomacia de negociación y mejorar el bienestar mundial. En retrospectiva, es fácil ver que todo el sistema de las Naciones Unidas se estableció como una farsa hipócrita, haciendo creer a la gente que sus poderosos líderes sólo querían la paz. Estos poderosos líderes eran todos occidentales; el mismo que menos de 20 años después de la creación de la noble Sociedad de Naciones, comenzó la Segunda Guerra Mundial.

*

Esta pequeña introducción proporciona el contexto para lo que eventualmente se convertiría en el resultado de las Naciones Unidas para el robo global, para las naciones empobrecidas, en todo el mundo, para la explotación de las personas, para los abusos contra los derechos humanos y para palear enormes cantidades de activos desde el fondo, desde el pueblo hasta la oligarquía, la élite corporativa cada vez más pequeña, las llamadas Instituciones de Bretton Woods.

En julio de 1944, más de 700 delegados de 44 Naciones Aliadas (aliados con los ganadores de la Segunda Guerra Mundial, incluida la Unión Soviética) se reunieron en el Mount Washington Hotel, situado en Bretton Woods, New Hampshire, Estados Unidos, para regular el orden monetario y financiero internacional después de la Segunda Guerra Mundial. Seamos seguros, esta conferencia se llevó a cabo bajo los auspicios de los Estados Unidos, el auto-declarado ganador de la Segunda Guerra Mundial, y a partir de ahora el maestro sobre el orden financiero del mundo, que no era inmediatamente visible, una agenda oculta a simple vista.

El FMI fue creado oficialmente para “regular” las monedas occidentales, llamadas convertibles, aquellas que se suscribieron para aplicar las reglas del nuevo estándar de oro, es decir, US$ 35 / Onza Troya (alrededor de 31,1 gramos). Tenga en cuenta que el patrón oro, aunque aplicable por igual a 44 naciones aliadas estaba vinculado al precio del oro nominado en dólares estadounidenses,no basado en una cesta del valor de las 44 monedas nacionales. Esto ya era razón suficiente para cuestionar el futuro sistema. Y cómo va a salir. Pero nadie cuestionó el arreglo. Difícil de creer, sin embargo, el de todos estos economistas nacionales, ninguno se atrevió a cuestionar la naturaleza traicionera de la configuración del patrón oro.

El Banco Mundial, o el Banco de Reconstrucción y Desarrollo (IBRD), se creó oficialmente para administrar el Plan Marshall para la Reconstrucción de Europa destruida por la guerra. El Plan Marshall fue una donación de los Estados Unidos y fue nombrado en honor al Secretario de Estado de los Estados Unidos George Marshall, quien lo propuso en 1947. El plan dio 13.200 millones de dólares en ayuda exterior a los países europeos que habían sido devastados física y económicamente por la Segunda Guerra Mundial. Se iba a implementar de 1948 a 1952, que por supuesto era un tiempo demasiado corto, y se extendió hasta principios de la década de 1960. En los términos actuales, el plan Marshall valdría unas 10 veces más, o unos 135 mil millones de dólares EE.UU.

El Plan Marshall era y sigue siendo un Fondo Rotatorio, devuelto por los países en cuestión, para que pudiera ser cedido. El dinero del Plan Marshall fue prestado varias veces y, por lo tanto, fue muy eficaz. La contraparte europea del Fondo Marshall administrado por el Banco Mundial fue un banco de reciente creación creado bajo el Ministerio de Finanzas alemán, el Banco Alemán de Reconstrucción y Desarrollo (KfW – acrónimo alemán de “Kreditanstalt f’r Wiederaufbau”).

KfW, como contraparte europea del Banco Mundial sigue existiendo y se dedica principalmente a proyectos de desarrollo en el Sur Global, ahora principalmente con fusores del Gobierno alemán y tomados prestados de los mercados de capitales alemanes y europeos. KfW a menudo coopera en proyectos conjuntos con el Banco Mundial. Hoy en día todavía hay un Departamento especial dentro de KfW que se ocupa exclusivamente del dinero del Fondo del Plan Marshall. Estos fondos todavía rotatorios se utilizan para prestar a las regiones pobres del sur de Europa, y también para apuntalar las economías de Europa del Este, y se utilizaron especialmente para integrar a la antigua Alemania Oriental en la actual “Gran Alemania”.

Dos elementos del Plan Marshall son particularmente llamativos y dignos de mención. En primer lugar, el plan de reconstrucción creó un lazo, una dependencia entre los Estados Unidos y Europa, la misma Europa que fue destruida en gran medida por las fuerzas aliadas occidentales, mientras que básicamente la Segunda Guerra Mundial fue ganada en gran medida por la Unión Soviética, los enormes sacrificios de la URSS, con un estimado de 25 a 30 millones de muertes. Por lo tanto, el Plan Marshall también fue diseñado como un escudo contra la Rusia comunista, es decir, la URSS.

Mientras que oficialmente la Unión Soviética era un aliado de las potencias occidentales, Estados Unidos, Reino Unido y Francia, en realidad la URSS comunista era un archienemigo del oeste, especialmente de los Estados Unidos. Con el dinero del Plan Marshall, Estados Unidos compró la alianza europea, una dependencia que no ha terminado hasta el día de hoy, y que todavía está impidiendo a Europa establecer relaciones normales con Rusia, a pesar de que la Unión Soviética ha desaparecido hace tres décadas. La guerra fría subsiguiente después de la Segunda Guerra Mundial contra la URSS, también basada en mentiras flagrantes, fue un testimonio directo de otra farsa propagandística occidental, que hasta el día de hoy, la mayoría de los europeos aún no han captado.

En segundo lugar, la imposición estadounidense de un fondo de reconstrucción con sede en dólares estadounidenses no sólo estaba creando una dependencia del dólar europeo, sino que también estaba sentando las bases para una moneda singular, eventualmente para invadir Europa – lo que sabemos hoy, se ha convertido en el euro. El euro no es más que el hijo adoptivo del dólar, ya que fue creado bajo la misma imagen que el dólar estadounidense: es una moneda fiduciaria, respaldada por nada. La Europa Unida, o ahora llamada Unión Europea, nunca fue realmente una unión. Nunca fue una idea europea, pero presentada por los Servicios Secretos de los Estados Unidos disfrazados de unos cuantos honchos europeos traicioneros. Y cada intento de crear una Europa Unida, una Federación Europea, con una Constitución Europea, similar a los Estados Unidos, fue amargamente saboteado por los Estados Unidos, principalmente a través del topo estadounidense en la UE, a saber, el Reino Unido.

Estados Unidos no quería una Europa fuerte, tanto económica como posiblemente con el tiempo también militarmente (pop. 450 millones de la UE, frente a US pop. 330 millones; 2019 PIB de la UE US$ 20,3 billones equivalentes, frente al PIB de EE.UU. 21,4 billones. La mayoría de los economistas estarían de acuerdo en que una moneda común para un grupo de países sueltos no tiene futuro, no es sostenible. No existe una Constitución común, por lo tanto, no hay un objetivo común, financiera, económica y militarmente. Una moneda común no es sostenible a largo plazo en estas circunstancias inestables. Esto es más que visible sólo 20 años después del euro. La eurozona es un desastre desesperado. En el Banco Central Europeo (BCE), también una creación inspirada en la FED y el Tesoro de los Estados Unidos. El BCE no tiene realmente ninguna función del Banco Central. Es más bien un perro de observación. Porque cada país miembro de la UE todavía tiene su propio Banco Central, aunque con una soberanía drásticamente reducida que los países de la eurozona concedieron al BCE, sin recibir ningún derecho equivalente.

De los 27 miembros de la UE, sólo 19 forman parte de la zona euro. Aquellos países que no forman parte de la Eurozona, es decir, la República Checa, Dinamarca, Hungría, Suecia, y más, han preservado su política financiera soberana y no dependen del BCE. Esto significa que si Grecia hubiera optado por no participar en la Eurozona cuando se vieron afectados por la “crisis” fabricada en 2008/2009, Grecia estaría ahora en camino hacia la recuperación completa. No habrían sido objeto de los caprichos y dictados del FMI, la infame troika, la Comisión Europea (CE), el BCE y el FMI, pero podrían haber optado por organizar su deuda internamente, ya que la mayor parte de la deuda era deuda interna, sin necesidad de endeudarse del extranjero.

En un referéndum de rescate de 2015, la población griega votó abrumadoramente en contra del rescate, lo que significa contra la nueva deuda gigantesca. Sin embargo, el entonces presidente griego Tsipras, siguió adelante como si el referéndum nunca hubiera tenido lugar y aprobó el enorme rescate a pesar de casi el 70% del voto popular en su contra.

Esto es una clara indicación de fraude, que no estaba pasando juego limpio. Tsipras y / o sus familias pueden haber sido coaccionados para aceptar el rescate – o de lo contrario. Tal vez nunca sepamos la verdadera razón por la que Tsipras vendió a su pueblo, el bienestar del pueblo griego a los oligarcas detrás del FMI y el Banco Mundial, y los puso en abyecta miseria, con el mayor desempleo en Europa, pobreza desenfrenada y tasas de suicidio disparadas.

Grecia puede servir de ejemplo sobre cómo pueden llevar a otros países de la UE si no se “comportan”, lo que significa adherirse a las reglas de oro no escritas de obediencia a los maestros del dinero internacional.

Esto da miedo.

*

Y ahora, en estos tiempos de covid, es relativamente fácil. Los países pobres, en particular en el Sur Mundial, ya endeudados por el plandemic, están aumentando su deuda externa para satisfacer a sus poblaciones necesidades básicas. O eso te hacen creer. Gran parte de la deuda acumulada por los países en desarrollo es deuda interna o interna, como la deuda del Norte Global. Realmente no necesita instituciones de préstamos extranjeras para eliminar la deuda local. ¿O ha visto a uno de los países ricos del Norte Global pedir prestado al FMI o al Banco Mundial para dominar su deuda? – Difícilmente.

Entonces, ¿por qué caería el Sur Global? Corrupción parcial, coacción parcial y chantaje parcial. – Sí, el chantaje, uno de los crímenes más grandes internacionales imaginables, fue cometido por las principales instituciones financieras internacionales de las Naciones Unidas, el BM y el FMI.

Por ejemplo, el mundo entero se pregunta cómo es que un enemigo invisible, un virus coronazo a los 193 países miembros de la ONU a la vez, por lo que el Dr. Tedros, Director General de la OMS, declara el 11 de marzo una pandemia -sin razón alguna ya que sólo hubo 4.617 casos en todo el mundo-, pero el resultado previsto fue un bloqueo mundial total el 16 de marzo de 2020. Sin excepciones. Había algunos países que no se lo tomaban tan en serio, como Brasil, Suecia, Bielorrusia, algunos países africanos, como Madagascar y Tanzania, desarrollaron sus propias reglas y se dieron cuenta de que el uso de máscaras hacía más daño que bien, y el distanciamiento social destruiría el tejido social de sus culturas y las generaciones futuras.

Pero el estado satánico y oscuro no quería tener nada que ver con los países “independientes”. Todos ellos tuvieron que seguir el dictado desde muy arriba, desde las Puertas, Rockefeller, Soroses, et al elite, pronto para ser reforzados por Klaus Schwab, sirviendo como el secuaz jefe del Foro Económico Mundial (WEF). De repente, se ve en Brasil, un aumento drástico en nuevos “casos”, sin preguntas, pruebas masivas, no importa que las infames pruebas de PCR no valen nada, según los científicos más serios – ver “La prueba COVID-19 RT-PCR: Cómo engañar a toda la humanidad. Usando una “Prueba” para encerrar a la Sociedad (por Pascal Sacré – 5 de noviembre de 2020) (sólo los científicos vendidos y corruptos, los pagados por las autoridades nacionales, seguirían insistiendo en las pruebas RT-PCR). El brasileño Bolsonaro se enferma con el virus y el recuento de muertes aumenta exponencialmente, a medida que la economía brasileña se desmorona.

¿Coincidencia? Apenas.

En los países del Banco Mundial y/o el FMI, ofreciendo ayuda masiva principalmente alivio de la deuda, ya sea como subvenciones o como préstamos a bajo interés. Pero con enormes ataduras: Debe seguir las reglas establecidas por la OMS, debe seguir las reglas sobre las pruebas masivas en materia de vacunación, cuando estén disponibles, vacunación de mandatarias – si se ajusta a estas y otras reglas específicas de cada país, como dejar que las corporaciones occidentales toquen sus recursos naturales, continuar privatizando su infraestructura social y servicios – puede recibir asistencia del BM y el FMI.

Ya en mayo de 2020, el Grupo del Banco Mundial anunció que sus operaciones de emergencia para luchar contra el COVID-19 ya habían llegado a 100 países en desarrollo, hogar del 70% de la población mundial con préstamos de 160 mil millones de dólares ee.UU. más. Esto significa, para hoy, 6 meses más tarde y en medio de la “Segunda Ola”, el número de países y el número de préstamos o subvenciones de “alivio” debe haber aumentado exponencialmente, habiendo llegado a cerca de los 193 países miembros de la ONU. Lo que explica cómo todos, literalmente todos los países, incluso los países africanos más importantes, como Madagascar y Tanzania, entre los más pobres de los pobres, han sucumbido a la coacción o chantaje de las infames instituciones de Bretton Woods.

Estas instituciones no tienen disputas en la generación de dólares, ya que el dólar es dinero fiduciario, no respaldado por ninguna economía, sino que puede ser producido literalmente desde el aire caliente y prestado a los países pobres, ya sea como deuda o como subvención. Estos países, a partir de ahora y por la presión de las instituciones financieras internacionales, dependerán para siempre de los maestros occidentales de la salvación. Covid-19 es la herramienta perfecta para que los mercados financieros palanen activos de abajo a arriba.

Con el fin de maximizar la concentración de las riquezas en la parte superior, tal vez una o dos o incluso tres nuevas ondas covid pueden ser necesarias. Todo eso está planeado, el WEF ya ha previsto los próximos escenarios, por su libro tiránico “Covid-19 – El Gran Reinicio”. Está todo dispuesto. Y nuestros intelectuales occidentales lo leen, lo analizan, lo critican, pero no lo destrozamos, lo dejamos pararse y observamos cómo se mueve la palabra en la dirección Restablecer. Y el plan es ejecutado debidamente por el Banco Mundial y el FMI, todo bajo el pretexto de hacer el bien para el mundo.

¿Qué es diferente del papel del Banco Mundial y el FMI ante el plandemic covid? – Nada. Sólo la causa de la explotación, el indevolcimiento, la esclavitud. Cuando Covid llegó se hizo fácil. Antes de eso y hasta finales de 2019, los países en desarrollo, en su mayoría ricos en recursos naturales como los codiciados occidentales, el petróleo, el oro, el cobre y otros minerales, como las tierras raras, serían abordados por el BM, el FMI o ambos.

Podrían recibir alivio de la deuda, los llamados préstamos de ajuste estructural, sin importar si realmente necesitaban o no esa deuda. Hoy en día estos préstamos vienen en todos los nombres, formas, formas y colores, literalmente como las revoluciones de color, por ejemplo, a menudo como operaciones de apoyo presupuestario – simplemente los llamo cheques en blanco – nadie controla lo que está sucediendo con el dinero. Sin embargo, los países tienen que reestructurar sus economías, racionalizar sus servicios públicos, privatizar el agua, la educación, los servicios de salud, la electricidad, las carreteras, los ferrocarriles y otorgar concesiones extranjeras para la explotación de los recursos naturales.

La mayor parte de este fraude –el fraude al “robar” los recursos nacionales, pasa sin ser visto por el público en general, pero los países se vuelven cada vez más dependientes de los paymasters occidentales – la soberanía de los pueblos y la soberanía institucional se ha ido. Siempre hay un corruptor y un corrupto. Desafortunadamente, siguen estando omnipresentes en el Sur Global. A menudo, por una porción de dinero, los países se ven obligados a votar con los Estados Unidos a favor o en contra de ciertas resoluciones de la ONU que son de interés para los Estados Unidos. Aquí vamos, el sistema corrupto de la ONU.

Y, por supuesto, cuando se crearon las dos organizaciones de Bretton Woods en 1944, el sistema de votación decidió que no es un país, un voto como en teoría es en la ONU, pero Estados Unidos tiene un derecho absoluto de veto en ambas organizaciones. Sus derechos de voto se calculan en función de su contribución de capital que deriva de una fórmula compleja, basada en el PIB y otros indicadores económicos. En ambas instituciones, el derecho de voto de los Estados Unidos y también el derecho de veto es de alrededor del 17%. Ambas instituciones tienen 189 países miembros. Ninguno de estos otros países tiene un derecho de voto superior al 17%. La UE lo habría hecho, pero los Estados Unidos nunca les permitieron convertirse en un país o una Federación.

*

Covid ha puesto al descubierto, si no antes, cómo estas instituciones financieras internacionales “oficiales” de Bretton Woods, constituidas por las Naciones Unidas, están plenamente integradas en el sistema de las Naciones Unidas, en el que la mayoría de los países todavía confían, tal vez por falta de algo mejor.

Pregunta, sin embargo: ¿Qué es mejor, un sistema corrupto hipócrita que proporciona la “apariencia”, o la abolición de un sistema distópico y el valor de crear uno nuevo, en nuevas circunstancias democráticas y con derechos soberanos por cada país participante?

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

Este artículo fue publicado originalmente en New Eastern Outlook.

Peter Koenig es economista y analista geopolítico. También es especialista en recursos hídricos y medio ambiente. Trabajó durante más de 30 años con el Banco Mundial y la Organización Mundial de la Salud en todo el mundo en los campos del medio ambiente y el agua. Da conferencias en universidades de Estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea como Global Research; ICH; Nueva Perspectiva Oriental (NEO) y más. Es autor de Implosion – Un Thriller Económico sobre Guerra, Destrucción Ambiental y Codicia Corporativa – ficción basada en hechos y en 30 años de experiencia en el Banco Mundial en todo el mundo.

Peter también es coautor del libro de Cynthia McKinney “When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis” (ClarityPress – 1 de noviembre de 2020)

Peter Koenig es investigador asociado del Centro de Investigación sobre la Globalización.

La fuente original de este artículo es Global Research. Derechos de autor © Peter Koenig, Global Research, 2020

The Secret Agenda of the World Bank and the IMF – Global ResearchGlobal Research – Centre for Research on Globalization

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.

¿Exagero?

Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

La extraña muerte por coronavirus de un anciano argentino que vivía aislado.

A veces, a los medios masivos de desinformación se le escapan las evidencias que deberían tapar por ¿decreto ley?. Este caso, por sí solo, desmonta a la omnipresente y prepotente OMS y a cualquier Gobierno con sus expertos de turno. ¿Funcionan verdaderamente los test PCR? ¿Qué está pasando en realidad? ¿Hay tres enfermedades distintas? A saber, la que dice que es pero no está, la que está pero no es y la que mata en dos días. La confusión y el juego de vanidades es tremendo. Ahí va la noticia:

“Inexplicable. Pedro Troncoso es un argentino de 96 años que falleció de covid-19 hace unas semanas en su localidad, Yahuincolo, situada en la región de Neuquén. Se trata de un caso desconcertante puesto que hay pocos residentes en el lugar, que solo aloja varias familias. La ubicación ha sido el principal factor de extrañeza, está muy alejada de los grandes radios urbanos y, de hecho, ni siquiera sale en Google Maps. Troncoso era el más longevo de la zona y, según informa Infobae, era conocido por sus casas confeccionadas con adobe. A su alrededor no contaba con conexión wifi ni tampoco línea telefónica, y para ser atendido por algún médico tendría que haber caminado varias horas hasta llegar al centro de salud más cercano. Trabajó hasta el último día y después fue internado de urgencia, al que ingresó por problemas respiratorios. Un equipo médico se trasladó en ambulancia hasta la casa del anciano para atenderle, llegaron al sitio con ayuda de un chófer que conocía el lugar. “Al examinarlo, noté que tenía sus pulmones comprometidos y que estaba oxigenando bajo. Me imaginaba una gripe común, pero no que podía tener coronavirus”, aseguró el doctor. La sorpresa llegó al realizar el test rápido de Covid-19, que salió positivo. Los sanitarios se quedaron atónitos al no entender cómo el virus había llegado hasta allí, porque la gente apenas tiene contacto con otras localidades. “Quedé asombrado porque se trata de un virus que se gestó del otro lado del mundo y terminó acá, en el medio de la nada. El recorrido fue inmenso. Era ver el resultado del test y no poder creerlo”, agregó. Fue trasladado hasta el Hospital Ramón Carrillo, donde falleció semanas después. Su familia estuvo informada en todo momento de la evolución a través de las dos llamadas diarias que realizaba el médico de Troncoso. Aunque ya preveían lo peor por varias patologías que padecía el anciano, entre ellas hipertensión y diabetes. “Me partía el alma porque nadie lo podía acompañar. Ellos, incluso, tuvieron que aislarse también por prevención, en ese lugar donde ya de por sí viven aislados”, recordó el médico”.

https://www.msn.com/es-es/entretenimiento/noticias/la-extra%C3%B1a-muerte-por-coronavirus-de-un-anciano-argentino-que-viv%C3%ADa-aislado/ar-BB1aIm4l?ocid=msedgntp

The strange death by coronavirus of an elderly Argentine man who lived in isolation.

Sometimes, the mass media of disinformation escape the evidence that they should cover up by decree law? This case, by itself, dismantles the omnipresent and arrogant WHO and any government with its experts on duty. Do PCR tests really work? What is really happening? Are there three different diseases? Namely, the one that says it is but is not there, the one that is there but is not and the one that kills in two days. The confusion and vanity game is tremendous. Here’s the news:

“Inexplicable. Pedro Troncoso is a 96-year-old Argentine who died of covid-19 a few weeks ago in his town, Yahuincolo, located in the Neuquén region. It is a disconcerting case since there are few residents in the place, who only It houses several families. The location has been the main factor of strangeness, it is very far from the large urban radii and, in fact, it does not even appear on Google Maps. Troncoso was the oldest in the area and, according to Infobae, was known For his houses made of adobe. Around him he had no Wi-Fi connection or telephone line, and to be seen by a doctor he would have to walk several hours to get to the nearest health center. He worked until the last day and then went A medical team traveled by ambulance to the old man’s house to treat him, arrived at the site with the help of a driver who knew the place. Innate him, I noticed that he had his lungs compromised and that he was oxygenating low. I imagined a common flu, but not that he could have coronavirus, “said the doctor. The surprise came when performing the rapid test for Covid-19, which came out positive. The toilets were stunned by not understanding how the virus had gotten there, because people hardly have contact with other localities. “I was amazed because it is a virus that originated on the other side of the world and ended up here, in the middle of nowhere. The tour was immense. It was seeing the result of the test and not being able to believe it, “he added. He was transferred to the Ramón Carrillo Hospital, where he died weeks later. His family was informed at all times of the evolution through the two daily calls made by the doctor from Troncoso. Although they already foresaw the worst due to various pathologies suffered by the elderly, including hypertension and diabetes. “He broke my soul because no one could accompany him. They even had to isolate themselves also for prevention, in that place where they already live in isolation, “the doctor recalled”.

CARTAS A LA OMS Y MÁS

Destinatarios


  • Tedros Adhanom Ghebreyesus , Organización Mundial de la Salud;
  • Mario Monti , Jefe de Salud de la Organización Mundial de la Salud;
  • Ursula Von der Leyen , presidenta de la Comisión Europea;
  • David Sassoli , presidente del Parlamento Europeo;
  • a los Presidentes de cada Nación;
  • a los Ministros de Salud de cada nación.

Carta de:

Luc Montagnier ,
Premio Nobel de Medicina, Francia

Estimados presidentes y ministros:

Como grupo internacional de científicos, médicos y abogados, nos comunicamos con usted hoy con respecto a la epidemia de SARS-CoV-2, que ha cambiado la vida de personas en todo el mundo.

Después de un período de perplejidad al formular tanto el diagnóstico de infección por covid-19 como la terapia para los pacientes, parece que, como ocurre con muchas otras infecciones virales, existen tres tipos de características clínicas de esta infección:

  1. asintomático en pacientes con PCR positiva;
  2. sintomático con signos clínicos leves;
  3. sintomático con insuficiencia orgánica grave.

Una terapia experimentada por primera vez en China y desarrollada en Francia por Pr Didier Raoult ha demostrado tener cierta eficacia en los dos primeros grupos de pacientes. Esta terapia implica el uso de hidroxicloroquina en dosis moderadas en combinación con azitromicina, inmunomoduladores y antioxidantes, y tiene como objetivo evitar que estos pacientes evolucionen a la fase tres más grave.

Proponemos que una comisión médica desarrolle un protocolo terapéutico basado en la experiencia clínica. Este comité debe ser independiente de la presión económica de las empresas farmacéuticas, los grupos políticos y los editores de revistas científicas.

Se ha demostrado que la evolución de los pacientes de la fase 2 a la fase 3 podría verse bloqueada por la terapia anterior. Como resultado, la letalidad (proporción de muertes por pacientes con PCR positiva) podría ser un parámetro importante de eficacia de este protocolo.

Si no hay respuesta lo consideraremos de acuerdo con nuestras conclusiones.

Sinceramente

Más cartas y firmas aquí https://www.internationalfreechoice.com/

COVID-21 ¿Película basada en hechos reales?

Traigo aquí un supuesto correo-e de un político del Partido Liberal Canadiense. Como el virus decían que supuestamente declinaría en la época estival y así no ha sido, ya me espero cualquier cosa. Tal texto puede ser una realidad en la estrategia, las tácticas pueden variar dependiendo de muchos factores. Lean como ficción y entiendan como realidad fronteriza que nos ha tocado ver, leer y escuchar en el limbo de la percepción vital. El guion de la película está escrito…

De una fuente anónima:

Comité Estratégico de LPC LeakInboxLPC leaker <LPC_leaker@protonmail.com>1:47 PM (7 horas hace )toHello,

Mensaje Original ‐‐‐‐‐‐‐

El sábado 10 de octubre de 2020 1:38 PM,

REMOVED <REMOVED>

escribió: Querido *******, Quiero proporcionarle información muy importante. Soy miembro del comité dentro del Partido Liberal de Canadá. Me siento dentro de varios grupos de comités, pero la información que estoy proporcionando proviene del comité de Planificación Estratégica (que es dirigido por la PMO).

Necesito empezar diciendo que no soy feliz haciendo esto, pero tengo que
hacerlo. Como canadiense y lo que es más importante como padre que quiere un futuro mejor no sólo para mis hijos, sino también para otros niños. La otra razón por la que estoy haciendo esto es porque aproximadamente el 30% de los miembros del comité no están satisfechos con la dirección que esto llevará a Canadá, pero nuestras opiniones han sido ignoradas y planean avanzar hacia sus metas. También han dejado muy claro que nada detendrá los resultados previstos.

La hoja de ruta y el objetivo fueron establecidos por la PMO y es el siguiente: – Fase en las restricciones de bloqueo secundario sobre una base de rodadura, comenzando con las principales áreas metropolitanas primero y expandiéndose hacia el exterior.

Se espera para noviembre de 2020.

Apresurar la adquisición (o construcción de) instalaciones de aislamiento en todas las provincias y territorios.

Se espera para diciembre de 2020.

– Los nuevos casos diarios de COVID-19 aumentarán más allá de la capacidad de las pruebas, incluyendo aumentos en las muertes relacionadas con COVID después de las mismas curvas de

crecimiento. Se espera para finales de noviembre de 2020. – Bloqueo secundario completo y total (mucho más estricto que la primera y segunda restricciones de fase rodante).

Previsto para finales de diciembre de 2020

– principios de enero de 2021 – Reforma y ampliación del programa de desempleo que se convertirá en el programa de renta básica universal. Se espera para el primer trimestre de 2021.

– Mutación COVID-19 proyectada y/o coinución con virus secundarios(denominado COVID-21)dando lugar a una tercera onda con una tasa de mortalidad mucho mayor y una mayor tasa de infección.

Se espera para febrero de 2021.

– Los nuevos casos diarios de hospitalizaciones COVID-21 y muertes relacionadas con COVID-19 y COVID-21 superarán la capacidad de los centros de atención médica. Esperado Q1 – Q2 2021.

– Se implementarán restricciones de bloqueo mejoradas (denominadas Tercer Bloqueo). Se impondrán restricciones de viaje completas (incluidas las interridades y las interesoreidades). Se espera el segundo trimestre de 2021. – Transición de individuos al programa universal de renta básica.

Se espera a mediados del segundo trimestre de 2021. – Projected cadena de suministro descomponeciones, escasez de inventario, gran inestabilidad económica.

Se espera a finales del segundo trimestre de 2021. – Despliegue de personal militar en las principales áreas metropolitanas, así como en todas las carreteras principales para establecer puestos de control de viaje.

Restringir el viaje y el movimiento. Proporcionar apoyo logístico a la zona. Se espera para el tercer trimestre de 2021.

Junto con eso, se pidió a la comisión de Planificación Estratégica que diseñara una forma eficaz de hacer la transición de los canadienses para hacer frente a un esfuerzo económico sin precedentes.

Uno que cambiaría el rostro de Canadá y alteraría para siempre la vida de los canadienses. Lo que se nos dijo fue que para compensar lo que era esencialmente un colapso económico a escala internacional, que el gobierno federal iba a ofrecer a los canadienses un alivio total de la deuda.

Así es como funciona: el gobierno federal ofrecerá eliminar todas las deudas personales (hipotecas, préstamos, tarjetas de crédito, etc.) que todos los fondos serán proporcionados a Canadá por el FMI bajo lo que se conocerá como el programa de Restablecimiento Mundial dela Deuda .

A cambio de la aceptación de esta condonación total de la deuda, el individuo perdería la propiedad de todos y cada uno de los bienes y activos para siempre.

La persona también tendría que aceptar participar en el calendario de vacunación COVID-19 y COVID-21, que proporcionaría a la persona un viaje sin restricciones y una vida sin restricciones incluso bajo un bloqueo completo (mediante el uso de la identificación con foto conocida como HealthPass de Canadá).

Los miembros del Comité preguntaron quién se convertiría en el propietario de los bienes y activos perdidos en ese escenario y qué sucedería con los prestamistas o instituciones financieras, simplemente nos dijeron “el programa de Restablecimiento Mundial de la Deuda manejará todos los detalles”.

Varios miembros del comité también cuestionaron lo que les pasaría a las personas si se negaban a participar en el programa World Debt Reset, o el HealthPass, o el calendario de vacunación, y la respuesta que obtuvimos fue muy

preocupante. Esencialmente nos dijeron que era nuestro deber asegurarnos de que se nos ocurrió un plan para asegurar que eso nunca sucedería. Nos dijeron que era en el mejor interés para los individuos participar.

Cuando varios miembros del comité presionaron implacablemente para obtener una respuesta, nos dijeron que aquellos que se negaran vivirían primero bajo las restricciones de bloqueo indefinidamente.

Y que en un corto período de tiempo a medida que más canadienses pasaran al programa de condonación de la deuda, los que se negaran a participar se considerarían un riesgo para la seguridad pública y serían reubicados en instalaciones de aislamiento.

Una vez en esas instalaciones se les darían dos opciones, participarían en el programa de condonación de deudas y serían liberados, o permanecerían indefinidamente en la instalación de aislamiento bajo la clasificación de un grave riesgo para la salud pública y tener todos sus activos confiscados.

Así que como pueden imaginar después de escuchar todo esto se convirtió en una discusión acalorada y se intensificó más allá de cualquier cosa que he presenciado
antes. Al final, la OMG insinuó que todo el programa avanzará sin importar quién esté de acuerdo o no. Que no será sólo Canadá, sino que, de hecho, todas las naciones tendrán hojas de ruta y agendas similares.

Que tenemos que aprovechar las situaciones que tenemos ante nosotros para promover el cambio a una escala más grande para el mejoramiento de todos. Los miembros que se opusieron y los que plantearon cuestiones clave que surgirían de tal cosa fueron completamente ignorados. Nuestras opiniones e inquietudes fueron ignoradas. Simplemente nos dijeron que lo hiciéramos.

Todo lo que sé es que no me gusta y creo que va a colocar a los canadienses en un futuro oscuro.

COVID-21 Movie based on real events?

I bring here an alleged e-mail from a politician from the Canadian Liberal Party. As they said the virus would supposedly decline in the summer season and it has not, I expect anything. Such text can be a reality in strategy, tactics can vary depending on many factors. Read as fiction and understand as a border reality that we have had to see, read and hear in the limbo of vital perception. The script for the film is written …

https://www.nexusnewsfeed.com/article/geopolitics/canadian-control-measures-just-the-tip-of-the-earth-sized-iceberg

La hoja de ruta de Covid-19: Hacia el caos económico mundial y la destrucción social

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación del virus no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

Por el profesor Michel Chossudovsky Global Research, 13 de octubre de 2020

Ahora se confirma sin lugar a dudas que la prueba de reacción en cadena de transcripción inversa-polimerasa (RT-PCR) utilizada para estimar casos positivos COVID-19 no tiene sentido. No puede detectar ni identificar el virus. Lo que detecta son partículas o fragmentos de numerosos virus, incluyendo el resfriado común (corona beta) y la gripe estacional (virus A y B)

PCR- Positivo no implica Covid-19 Positivo. Las estadísticas derivadas de la prueba de ITP no miden los “casos confirmados”. La prueba del ITP no proporciona las estadísticas requeridas (por los responsables de la formulación de políticas y las autoridades sanitarias nacionales) para evaluar el número de personas infectadas.

Si bien estas estadísticas oficiales erróneas utilizadas para “medir” la propagación de la infección viral no tienen sentido, se han utilizado para apoyar la campaña de miedo y desinformación en curso.

La prueba de PCR es la pistola humeante. ¿por qué?

Debido a que la prueba de PCR es defectuosa e inválida como medio para identificar la propagación del virus, lo que significa que TODAS LAS DECISIONES PRINCIPALES tomadas por la OMS y los gobiernos nacionales desde finales de enero de 2020 (apoyadas por estadísticas defectuosas) no son válidas. Además, los informes oficiales, incluida la OMS, confirman que Covid-19 no es un virus asesino, tiene características similares a la gripe estacional.

El propósito de este artículo es examinar cómo estas decisiones de gran alcance, invariablemente basadas en mentiras y estadísticas erróneas, han contribuido a un estado de caos económico, social y político en todo el mundo, lo que ha llevado al cierre y cierre de 190 economías nacionales de los Estados miembros de las Naciones Unidas. Sólo tres países, entre ellos Bielorrusia, Nicaragua y Suecia, se negaron a cerrar su economía nacional.

El cierre de las economías nacionales se presentó como un medio para hacer frente al “Virus Asesino” y “Salvar Vidas”. Está muy documentado, sus impactos han llevado al desempleo masivo y a la pobreza en todo el mundo.


Anexo al presente artículo: Detalles relativos a la prueba RT-PCR

Para obtener más detalles sobre la prueba PCR, haga clic aquí


La hoja de ruta hacia el caos económico y la destrucción social

18 de octubre de 2019. 201 Ejercicio de simulación pandémica

El coronavirus fue nombrado inicialmente 2019-nCoV por la OMS, el mismo nombre que el adoptado en el ejercicio de simulación del 18 de octubre de 2019 201 bajo los auspicios de la Escuela de Salud John Hopkins Bloomberg, Centro para la Seguridad de la Salud (un evento patrocinado por la Fundación Gates y el Foro Económico Mundial). (Evento 201)

7 de enero de 2020: Las autoridades chinas “identificaron un nuevo tipo de virus” que (según los informes oficiales) fue aislado el 7 de enero de 2020.

20-24 de enero: Reuniones del Foro Económico Mundial en Davos. El papel de los poderosos intereses financieros

Los intereses financieros dominantes, las fundaciones multimillonarias y las instituciones financieras internacionales desempeñaron un papel clave en la puesta en marcha de la Emergencia de Salud Pública de la OMS (PHEIC). La decisión no fue tomada por la OMS.

En la semana anterior a esta histórica decisión de la OMS. El PHEIC fue objeto de “consultas” en el Foro Económico Mundial (WEF), Davos (21-24 de enero). El Director General de la OMS, Dr. Tedros, estuvo presente en Davos. Estas consultas fueron fundamentales para influir en la decisión histórica de la OMS del 30 de enero.

¿Hubo un conflicto de intereses definido por la OMS? El mayor donante de la OMS es la Fundación Bill y Melinda Gates, que junto con el WEF y el CEPI ya había anunciado en Davos el desarrollo de una vacuna Covid-19 antes del histórico 30 de enero de la PHEIC.

28 de enero de 2020: El Centro para el Control y la Prevención de Enfermedades (CDC) de los Estados Unidos confirmó que el virus de la novela corona había sido aislado. Hasta la fecha, el proceso de identificación del virus no se ha hecho público.

30 de enero de 2020: La Emergencia de Salud Pública de Preocupación Internacional (PHEIC) de la OMS

La primera etapa de esta crisis fue lanzada por la OMS el 30 de enero. Aunque oficialmente no fue designada como una “Pandemia”, sin embargo contribuyó a encabezar la campaña del miedo.

Desde el principio, las estimaciones de “casos positivos confirmados” han sido parte de un “Juego de Números”.

En algunos casos las estadísticas simplemente no se mencionaban y en otros casos los números se inflaban con el fin de crear pánico.

El número de “casos confirmados” basado en estimaciones erróneas (PCR) utilizadas para justificar esta decisión de alcance lejano fue ridículamente bajo.

La población mundial fuera de China es del orden de 6.400 millones. El 30 de enero de 2020 fuera de China había:

83 casos en 18 países, y sólo 7 de ellos no tenían antecedentes de viajes en China. (véase OMS,30 de enero de 2020).

El 29 de enero de 2020, el día anterior al lanzamiento del PHEI(registrado por la OMS), hubo 5 casos en los Estados Unidos, 3 en Canadá, 4 en Francia, 4 en Alemania.

No había una “base científica” que justificara el lanzamiento de una emergencia mundial de salud pública.

Captura de pantalla de la tabla de la OMS, 29 de enero de 2200,

un día antes de la decisión de la OMS de declarar una emergencia mundial de salud pública

Esos números ridículamente bajos (no mencionados por los medios de comunicación) se utilizaron para encabezar una campaña de miedo en todo el mundo.

31 de enero de 2020: Decisión del presidente Trump de suspender los viajes aéreos con China

Mientras que la OMS “no recomendó restricciones a los viajes o al comercio”, los cinco llamados “casos confirmados” en los Estados Unidos fueron suficientes para “justificar” la decisión del presidente Trump el 31 de enero de suspender los viajes aéreos a China mientras precipitaba una campaña de odio contra los chinos étnicos en todo el mundo occidental.

Esta histórica decisión del 31 de enero allanó el camino hacia la interrupción del comercio internacional de productos básicos, así como las restricciones mundiales a los viajes aéreos.

Y esos “casos confirmados” defectuosos fueron en su mayor parte utilizando la prueba RT-PCR estándar.

20-21 de febrero de 2020. Datos de Covid en todo el mundo fuera de China: el crucero Diamond Princess

Si bien China informó de un total de 75.567 casos de COVID-19, (20 de febrero) los casos confirmados fuera de China eran abismáticamente bajos y las estadísticas basadas en gran parte en la prueba de ITP utilizada para confirmar la “propagación mundial del virus” eran cuestionables, por decir lo menos. Además, de los 75.567 casos en China, un gran porcentaje se había recuperado. Y las cifras de recuperación no fueron reconocidas por los medios de comunicación.

El día de la histórica conferencia de prensa del Dr. Tedros (20 de febrero de 2020) el número registrado de casos confirmados fuera de China fue de 1073 de los cuales 621 eran pasajeros y tripulantes en el Diamond Princess Cruise Ship (atrapado en aguas territoriales japonesas).

Desde un punto de vista estadístico, la decisión de la OMS que señalaba una posible “difusión del virus en todo el mundo” no tenía sentido.

El 20 de febrero, el 57,9% de los “casos confirmados” de Covid-19 en todo el mundo eran de la Diamond Princess, apenas representativa de una “tendencia estadística” mundial. La historia oficial es la siguiente:

  • Un pasajero con sede en Hong Kong que había desembarcado de la Princesa Diamante en Hong Kong el 25 de enero desarrolló neumonía y fue positivo para la novela coronavirus el 30 de enero.
  • Se informó que había viajado el 10 de enero a Shenzhen en China continental (que limita con los nuevos territorios de Hong Kong).
  • La Princesa Diamante llegó a Yokohama el 3 de febrero. Se impuso una cuarentena al estudio de la serie de cruceros Ver NCBI.
  • Muchos pasajeros se enfermaron debido al confinamiento en el barco.
  • Todos los pasajeros y la tripulación de la Princesa Diamante emprendieron la prueba de PCR.
  • El número de casos confirmados aumentó a 691 el 23 de febrero.

Desde el punto de vista de la evaluación de las tendencias estadísticas mundiales, los datos no se levantan. Sin los datos de Diamond Princess, los llamados casos confirmados en todo el mundo fuera de China el 2o de febrero habrían sido del orden de 452, de una población de 6.400 millones de habitantes.

Examine el gráfico de la OMS a continuación. El azul indica los casos confirmados sobre la Diamond Princess (transporte internacional) (que llegó a Yokohama el 3 de febrero de 2020), muchos de los cuales estuvieron enfermos, confinados en sus habitaciones durante más de dos semanas (cuarentena impuesta por Japón). Todos los pasajeros y la tripulación realizaron la prueba RT-PCR (que no detecta ni identifica Covid-19).

No hace falta decir que estos supuestos datos fueron fundamentales para encabezar la campaña del miedo y el colapso de los mercados financieros en el transcurso del mes de febrero. (ver sección a continuación)

Fuente OMS, 28 de febrero de 2020

La crisis financiera de febrero de 2020. El choque corona 2020

Del 20 al 21 de febrero de 2020 se cumple el inicio del colapso financiero de 2020.

20 de febrero de 2020: En una conferencia de prensa celebrada el jueves 20 de febrero por la tarde (hora del AEC) en una reunión informativa en Ginebra, el Director General de la OMS. El Dr. Tedros Adhanom Ghebreyesus, dijo que era

“preocupado de que la posibilidad de contener el brote de coronavirus se “cerrara” …

“Creo que la ventana de oportunidad sigue ahí, pero que la ventana se está estrechando.”

Estas declaraciones de “shock and awe” contribuyeron a aumentar la campaña del miedo, a pesar del hecho de que el número de casos confirmados fuera de China era extremadamente bajo.

Oficialmente 1073 casos en todo el mundo.

Excluyendo a la Diamond Princess, 452 los llamados “casos confirmados” en todo el mundo fuera de China, para una población de 6.400 millones registradas por la OMS el 20 de febrero, 15 en los Estados Unidos, 8 en Canadá, 9 en el Reino Unido.

Se registraron un mayor número de casos fuera de China en Corea del Sur (153 casos según la OMS) e Italia (registrados por las autoridades nacionales).

Datos de la OMS registrados en febrero de 2020 al comienzo del llamado Covid Financial Crash (derecha)

La declaración del Dr. Tedros (basada en conceptos y estadísticas defectuosos) puso las bases para el colapso financiero de febrero provocado por información privilegiada, conocimiento previo, comercio de derivados, ventas en corto y una gran parte de las operaciones de los fondos de cobertura.

Quien tuviera conocimiento previo (información privilegiada) de la declaración del Director General de la OMS del 20 de febrero habría cosechado importantes beneficios monetarios.

¿Hubo un conflicto de intereses? La OMS recibe fondos de la Fundación Gates. Y Bill Gates tiene “60% de sus activos invertidos en acciones [incluyendo acciones y fondos de índices]”, según un informe de la CNBC de septiembre de 2019.

El desplome bursátil iniciado el 20 de febrero, conocido como el Accidente coronavirus 2020,fue categorizado como:

“la caída más rápida en los mercados bursátiles globales en la historia financiera, y el desplome más devastador desde el accidente de Wall Street de 1929.”

La causa de la crisis financiera fue (según los analistas), V. El Virus. La propagación del virus fuera de China.

La campaña de miedo del “virus asesino” junto con las oportunas “advertencias” del Dr. Tedros sobre la necesidad de implementar una pandemia mundial sirvieron indeleblemente a los intereses de los especuladores institucionales y fondos de cobertura de Wall Street. El desplome financiero condujo a un cambio importante en la distribución de la riqueza del dinero. (ver análisis a continuación)

En la semana siguiente al anuncio de la OMS del 20 al 21 de febrero,el Dow Jones se derrumbó un 12% (CNBC, 28 de febrero de 2020). Según los analistas, la caída de la DJIA fue el resultado de la propagación mundial del virus. Una declaración sin sentido en contradicción con el (pequeño) número de estimaciones positivas de la OMS Covid, la mayoría de las cuales se basaron en la prueba de PCR defectuosa.El lunes 24 de febrero, tras la reapertura de los mercados bursátiles, hubo una caída sin precedentes en el Dow Jones atribuible a los “peligros inminentes” que“Covid estaba extendiendo en todo el mundo creando incertidumbres en los mercados financieros”..Las existencias cayeron bruscamente el lunes (24 de febrero) a medida que aumentaba el número de casos de coronavirus fuera de China,lo que avivó los temores de una prolongada desaceleración económica mundial debido a la propagación del virus. El promedio industrial Dow Jones cerró 1.031,61 puntos menos, o un 3,56%, en 27.960,80.” (CNBC) (sin cursivas en el apartado de inglés)

Promedio industrial Dow Jones Diciembre 2019 – Marzo 2020

También el 24 de febrero, Trump solicitó una ayuda de emergencia de 1.250 millones de dólares.

Según la BBC, los mercados bursátiles mundiales vieron fuertes caídas “debido a las preocupaciones sobre el impacto económico del virus”, lo que sugiere que el virus era “la “mano” invisible responsable de la disminución de los mercados financieros.

COVID-19 fue identificado por poco como el catalizador de la crisis financiera.

¿Quién estaba detrás de este catalizador? ¿Quién estuvo detrás de la campaña de miedo que contribuyó a desencadenar el caos y la incertidumbre en los mercados financieros?

11 de marzo de 2020: La pandemia Covid-19, encierro, cierre de 190 economías nacionales

El Director General de la OMS había puesto las bases en su Conferencia de Prensa del 21 de febrero. “el mundo debería hacer más para prepararse para una posible pandemia de coronavirus”. La OMS ha pedido a los países que estén “en una fase de preparación”.

El 11 de marzo de 2020: la OMS declaró oficialmente una pandemia mundial en un momento en que había 18.000 casos confirmados y 4291 muertes de una población mundial total fuera de China del orden de 6.400 millones de personas. ¿Qué te dicen estas “estadísticas”?

Inmediatamente después del anuncio del 11 de marzo de la OMS, la campaña del miedo se puso en marcha. Al igual que en el caso del accidente del 20 al 21 de febrero, la declaración del 11 de marzo del Director General de la OMS había puesto las bases. Los mercados bursátiles se desplomaron en todo el mundo. A la mañana siguiente, el Dow (DJIA) se desplomó un 9,99% (una disminución de 2.352,60 para cerrar en 21.200,62). El Jueves Negro, 12 de marzo de 2020, fue “el peor día del Dow” desde 1987. Se había producido una transferencia masiva de la salud de la riqueza financiera en favor de los multimillonarios estadounidenses.

Las instrucciones de confinamiento se transmitieron a 193 Estados miembros de las Naciones Unidas.Los políticos son los instrumentos de poderosos intereses financieros. ¿Se justificó esta decisión de gran alcance como un medio para combatir el Virus?

Sin precedentes en la historia, aplicada casi simultáneamente en un gran número de países, sectores enteros de la economía mundial fueron desestabilizados. Las pequeñas y medianas empresas fueron conducidas a la bancarrota. El desempleo y la pobreza son desenfrenados.

En algunos países han estallado las hambrunas. Los impactos sociales de estas medidas son devastadores. Los impactos en la salud (mortalidad, morbilidad) de estas medidas, incluida la desestabilización del sistema de atención sanitaria nacional (en numerosos países) superan con creces los atribuidos a Covid-19. (Para más detalles ver artículo del autor aquí,

Enriquecimiento multimillonario. La apropiación y redistribución de la riqueza

La riqueza multimillonaria ha aumentado drásticamente desde principios de febrero. Hay tres fases distintas, que están directamente relacionadas con la crisis de la corona, cada una de las cuales está marcada por cambios importantes en la distribución de la riqueza global.

  1. La crisis financiera iniciada el 20 de febrero propiciaba una redistribución dramática de la riqueza monetaria y la propiedad de los activos financieros. El conocimiento previo, la información privilegiada y el comercio especulativo desempeñaron un papel clave. ¿Hubo conocimiento previo de la declaración del Dr. Tedros de la OMS del 20 de febrero?
  2. El cierre y cierre del 11 de marzo de las economías nacionales de 190 Estados miembros de la ONU, que desencadenaron las quiebras tanto de las pymes como de las pymes en todo el mundo. El evento del 11 de marzo también estuvo marcado por la caída de los mercados bursátiles en todo el mundo, comenzando el jueves negro 12 de marzo de 2020.
  3. La tercera etapa del enriquecimiento multimillonario se refiere a la aplicación de la llamada “Segunda Ola”, que consiste en desencadenar una nueva ola de quiebras.

La redistribución de la riqueza en favor de la clase multimillonaria se confirma mediante un estudio de IPS relativo al cierre de la economía mundial.

La riqueza combinada de los multimillonarios estadounidenses aumentó en 850.000 millones de dólares desde el 18 de marzo de 2020,lo que supone un aumento de más del 28 por ciento. (Esta estimación no tiene en cuenta el aumento de la riqueza durante el período anterior al 18 de marzo, que estuvo marcado por una serie de desplomes bursátiles).

El 18 de marzo de 2020, los multimillonarios estadounidenses habían combinado una riqueza de 2.947 billones de dólares. Para el 8 de octubre, su riqueza ha aumentado a 3,8 billones de dólares (3.798 millones de dólares para ser exactos).

A nivel mundial, los multimillonarios son grandes ganadores durante la pandemia de Covid-19. Según un reciente informe de UBS, los aproximadamente 2.189 multimillonarios mundiales tienen actualmente 10,2 billones de dólares. Se trata de un aumento estimado de 1,5 billones de dólares durante la pandemia que examinan los datos multimillonarios de UBS y Forbes de 2019.

La siguiente tabla identifica el aumento de la riqueza personal de los cinco multimillonarios estadounidenses más ricos (del 18 de marzo al 17 de junio de 2020). (No esbozada en el cuadro, la riqueza de los multimillonarios estadounidenses aumentó en otros 266.000 millones de dólares de junio a octubre de 2020).

Reflexionemos ahora brevemente sobre la Segunda Ola que ahora se impone a millones de personas.

La segunda ola

Septiembre-Octubre 2020. El establecimiento financiero ha dado instrucciones a los gobiernos para que apliquen lo que equivale a un segundo programa de bancarrota utilizando el pretexto y la justificación de que el número de casos positivos de Covid ha aumentado.

Con toda probabilidad, esta segunda oleada conducirá a un nuevo proceso de apropiación y concentración de la riqueza.

Al mismo tiempo, hay una tendencia hacia las formas totalitarias de gobierno.

Todas las formas de actividad social se ven afectadas incluyendo reuniones familiares, bodas y funerales, reuniones públicas, por no hablar del cierre de escuelas, universidades, museos, eventos deportivos y culturales. Ahora se están aplicando medidas del estado policial para hacer cumplir el cumplimiento. ¡Y la gente acepta!

Al comienzo de la Segunda Ola, el proceso de posponer la reapertura de la economía mundial contribuirá indeleblemente a acabar con las pequeñas y medianas empresas (regionales y locales) de todo el mundo, al tiempo que precipitará la quiebra de sectores enteros de la economía mundial, incluidas las aerolíneas, las cadenas hoteleras y la industria turística. Esto, a su vez, conducirá a la apropiación de activos reales por parte de poderosos intereses financieros.

La campaña del miedo ha vuelto a estar en marcha.

Las estadísticas oficiales basadas en estimaciones erróneas y manipuladas de los llamados casos positivos “confirmados” de Covid constituyen la base para justificar estas medidas diabólicas.

V el virus se presenta como la amenaza. Pero el virus no tiene un impacto directo en las variables económicas clave.

Lo que está en juego no tiene precedentes: es una agenda neoliberal global llevada a cabo por gobiernos corruptos en nombre del establishment financiero.

El sentido común nos dice que el cierre de la economía global destruye la vida de las personas.

Interrumpir la campaña del miedo constituye el primer paso hacia la reversión de la marea

Para más detalles sobre los impactos económicos. Artículo relacionado

Combatir el virus: El desempleo masivo no es la solución

Por el Prof. Michel Chossudovsky, 05 de octubre de 2020

Michel Chossudovsky, Profesor de Economía


Anexo

La prueba de reacción en cadena de la transcripción inversa-polimerasa (RT-PCR)

La prueba estándar utilizada para detectar / identificar SARS-2 en todo el mundo es la prueba de reacción en cadena de transcripción inversa-polimerasa(RT-PCR) que se utiliza para estimar y tabular el número de casos covid-19 positivos confirmados. (Esta no es la única prueba utilizada. Las observaciones a continuación se refieren únicamente al ITP estándar).

Según el Premio Nobel, la Dra. Kary Mullis, que inventó la prueba de PCR:

“PCR detecta un segmento muy pequeño del ácido nucleico que forma parte de un virus en sí. El fragmento específico detectado está determinado por la elección un tanto arbitraria de las imprimaciones de ADN utilizadas que se convierten en los extremos del fragmento amplificado.”

La prueba de PCR nunca tuvo la intención de identificar el virus.

La prueba pcR estándar aplicada en relación con Covid-19 no detecta ni identifica el virus. Lo que detecta son fragmentos de varios virus, según el reconocido inmunólogo suizo Dr. B. Stadler. Según el Dr. Pascal Sacré, “estas pruebas detectan partículas virales, secuencias genéticas, no todo el virus”

“Fragmentos de virus positivos” no significa“SARS-2 positivo” (o Covid-19 Positivo). La prueba de PCR puede recoger fragmentos de virus de la gripe (A, B) así como coronavirus beta fríos comunes (por ejemplo, OC43, HKU1). Lo que han hecho los gobiernos es dar al ITP positivo una sola etiqueta, a saber, Covid-19, cuando en realidad la prueba positiva de ITP podría ser el resultado de otros virus, incluidos los relacionados con la gripe o el resfriado común coronavirus, que (según los CDC) tienen síntomas similares a Covid-19.

Una vez establecida y aceptada la etiqueta Covid-19 Positive, está sujeta a numerosas formas de manipulación, por no hablar de la falsificación de certificados de defunción.

Qué es Covid-19, SARS-2. ¿Cómo se prueba? ¿Cómo se mide? La campaña del miedo no tiene base científica

Por el Prof. Michel Chossudovsky, 08 de octubre de 2020La fuente original de este artículo es Global ResearchDerechos de autor © Prof. Michel Chossudovsky, Global Research, 2020

Interpretación Errónea del Virus Parte II: Principio y Fin de la Crisis del Coronavirus

Por Dr. Stefan Lanka

Artículo original publicado en la revista: Wissenschafftplus
Enlace al artículo original: https://wissenschafftplus.de/uploads/article/wissenschafftplus-fehldeutung-virus-teil-2.pdf Fuente de la traducción al español: desconocido.

La definición del SARS y del coronavirus o covid-19 significa que se considera que la neumonía atípica es el cuadro clínico que caracteriza a la enfermedad. Si se pueden detectar patógenos conocidos en la neumonía, ésta se considera típica, si no atípica. Uno de los dos hechos decisivos para el SARS y la crisis del coronavirus es que al menos el 20- 30% de todas las neumonías son atípicas. Las causas de la neumonía atípica son claramente conocidas y por lo tanto NO deben presentarse como la causa de un virus desconocido.

Este hecho es suprimido por los infectólogos y virólogos y es la base del miedo y el pánico actuales, porque se crea la impresión entre los afectados, el público y los políticos, de que la neumonía atípica sería especialmente peligrosa y a menudo mortal porque todavía no hay medicamentos ni vacunas para la supuesta nueva enfermedad.

Desde el momento en que se ofrece un procedimiento de prueba para el supuesto nuevo virus, que, oculto por los implicados, también prueba “positivamente” a personas sanas, el número de casos aumenta automáticamente. Inicialmente, las personas con neumonía típica también serán examinadas, luego más y más personas con otras enfermedades.

Esto se considera una prueba práctica de la propagación del virus. Automáticamente, más y más de otras enfermedades se añaden a la enfermedad original “neumonía atípica” y este “síndrome” se muestra como “la nueva enfermedad viral”.

El otro hecho decisivo, no sólo para el SARS y la crisis del coronavirus, es que los virólogos que afirman que los virus causan enfermedades, están suprimiendo una situación obvia abiertamente mentirosa por razones comprensibles.

El método de prueba de virus que se ofrece es un método de detección genética. No aíslan de un virus las secuencias de genes que utilizan para la prueba de detección. Aíslan secuencias genéticas que se liberan típicamente en mayores cantidades cuando los tejidos y las células mueren. Estas secuencias genéticas, generalmente cortas, y componentes del metabolismo humano, constituyen la base para el trabajo de laboratorio posterior.

Sin embargo, con la ayuda de programas informáticos, los virólogos sólo pueden construir mentalmente largas cadenas de material genético a partir de muchas secuencias cortas de genes. Estas son entonces producidas como verdaderas cadenas de ADN viral. Esta es la razón por la que los resultados positivos de las pruebas se obtienen repetidamente incluso en individuos sanos probados.

Para evitar refutarse a sí mismos, estos virólogos ignoran constantemente dos reglas prescritas por la ciencia. Uno es verificar sistemáticamente todas las afirmaciones por sí mismas. La otra es probar todos los supuestos y métodos utilizados mediante experimentos de control.

Si realizaran los experimentos de control, descubrirían que TODAS las secuencias genéticas cortas, que sólo unen mentalmente, para formar una cadena genética viral se originan en el metabolismo humano y no en el exterior, de un supuesto virus.

El impulso de la crisis del coronavirus fue desencadenado por un mensaje de un joven oftalmólogo el 30/12/2019 en Internet, que se difundió de forma inmediata y muy rápidamente. Éste dijo a sus amigos que varias personas estaban en cuarentena en su hospital, que se confirmaron siete casos de SARS, que se cuidaran y protegieran.

El profesor Christian Drosten, de la Charité de Berlín, se enteró de ello e inmediatamente comenzó a elaborar procedimientos de prueba para los virus del SARS antes de que estuviera claro y pudiera determinarse si el informe de China sobre el SARS era verdadero y estaba probado, y especialmente antes de que los virólogos chinos publicaran sus resultados.

Los virólogos autorizados de la Comisión de Control de Enfermedades de China (CCDC) publicaron sus resultados el 24 de enero de 2020 y el 3 de febrero de 2020.

Informan sobre el aislamiento de muchas secuencias genéticas cortas, que, cuando se ensamblan, podrían representar una cadena genética de un nuevo tipo de virus. Los autores señalan expresamente -y todos los demás virólogos implicados hasta la fecha- que aún no se han realizado los experimentos absolutamente necesarios que permitan afirmar que se trata efectivamente de una cadena genética de un virus causante de enfermedades.

Por el contrario: los virólogos chinos incluso señalan explícitamente que la cadena genética construida tiene hasta un 90% de similitud con las cadenas genéticas de los inofensivos y por decenios de antigüedad, reivindicados corona virus en los murciélagos.

El 21/01/2020 (¡3 días antes de la primera publicación de la CCDC!) la OMS recomendó a todas las naciones usar el procedimiento de prueba desarrollado por el Prof. Drosten. Al afirmar que había desarrollado un procedimiento de prueba fiable para el virus, que se estaba extendiendo rápidamente en China, el profesor Drosten, haciendo caso omiso de las normas claramente definidas de la labor científica, que forman parte de su contrato de trabajo, y violando las leyes del pensamiento y la lógica de la virología, ha desencadenado y causado el aumento y la globalización del pánico epidémico chino.



1. El comienzo de la crisis del Coronavirus

Cuando el joven oftalmólogo Li Wenliang informó a siete médicos de Wuhan a través de WhatsApp el 30/12/2019 de que varias personas estaban en cuarentena en su hospital, que se habían confirmado siete casos de SARS, y que debían tener cuidado y protegerse, no tenía la intención de causar pánico.

Si lo hubiera hecho, habría publicado el anuncio en Internet y advertido al público. Uno de los siete destinatarios de este mensaje privado de WhatsApp publicó una “captura de pantalla”, es decir, una foto del mensaje, en Internet sin ser consciente de las posibles consecuencias. Por supuesto, esta información se difundió muy rápidamente dentro de China y luego en todo el mundo.

Este mensaje desencadenó una ola de temor, pánico e indagaciones a las autoridades sanitarias chinas y al gobierno debido al pánico causado por una crisis de SARS en 2003, que la Organización Mundial de la Salud (OMS) clasificó como “amenaza mundial” el 12 de marzo de 2003.

En consecuencia, el Gobierno de Beijing envió una “fuerza de reacción rápida” integrada por epidemiólogos y virólogos del Centro de Control de Enfermedades de China a Wuhan el 31 de diciembre de 2019 para apoyar a las autoridades sanitarias locales y a la provincia circundante de Hubei. El objetivo era comprobar y verificar las afirmaciones de un brote de una epidemia. Si efectivamente se hubiera producido un brote, la situación debería controlarse adecuadamente.

En la primera publicación autorizada de los autores del CCDC sobre los resultados de su investigación, “A New Coronavirus from Patients with Pneumonia in China, 2019”, no se informa de una acumulación de pacientes con neumonía de causa desconocida.

Informan que los pacientes encontrados pueden ser agrupados en un “grupo” con características comunes. La característica común era la visita más o menos frecuente de un mercado mayorista de mariscos en Wuhan. Lo pequeño que era el grupo de pacientes con neumonía atípica puede verse por el hecho de que el CCDC tomó frotis y líquidos del tracto respiratorio inferior de sólo cuatro pacientes, para buscar patógenos conocidos y desconocidos.

Mientras tanto, el pánico en Wuhan y sus alrededores aumentó extremadamente. Ni siquiera las medidas adoptadas por la policía, que el 3 de enero de 2020 pidió al oftalmólogo Li Wenliang que se comprometiera por escrito firmando una declaración punible de cese y desistimiento para no difundir nada más sobre un posible brote de SARS, pudieron frenar la dinámica de pánico que se había desarrollado y que empeoraba peligrosamente.

El 10/01/2020 Wenliang, y poco después también sus padres, desarrollaron los síntomas de la neumonía. Li Wenliang se aisló porque estaba convencido de que había sido infectado con el virus del SARS el día anterior por un paciente ocular. Esto también aumentó el pánico.

Los doctores que lo atendieron realizaron un gran número de pruebas diferentes, todas las cuales resultaron negativas. A medida que su estado de salud se deterioraba y cada vez más personas mostraban la simpatía del público por su destino, las pruebas se continuaron hasta que una primera prueba de SARS, el 30/01/2020, se consideró “positiva”. El desastre del creciente pánico del SARS, que mutó en la crisis mundial del coronavirus, siguió su curso.

Li Wenliang difundió este resultado en Internet con las siguientes palabras: “Hoy las pruebas de ácido nucleico han dado un resultado positivo, el polvo se ha asentado, finalmente diagnosticado”.

Este anuncio aumentó el pánico ya existente. Todo se descontroló por completo cuando publicó su declaración firmada de cese y desistimiento del 03/01/2020 en Internet. Esta publicación de su declaración de cesación, que era peligrosa para él, fue y sigue siendo considerada por todas las personas presas del pánico, como prueba de que hay una nueva epidemia de SARS, porque un médico, que a su vez está afectado, sigue informando y advirtiendo al público a pesar de la amenaza de sanciones.

El pánico aumentó aún más porque la salud de Li Wenliang se deterioró a pesar del uso intensivo de una variedad de sustancias antibióticas y el público participó regularmente de esto. La situación estaba al borde de la escalada porque el informe de su muerte fue más que caótico y contradictorio.

Esta fue y sigue siendo la razón central por la que el público chino y mundial asumió que se había producido otro brote de SARS en Wuhan, pero que se había redefinido como una nueva epidemia, una pandemia con un nuevo nombre, Covid-19.



2. Una, de dos posibles causas del miedo de Li Wenliang

El temor del oftalmólogo Li Wenliang se basa en los acontecimientos de 2003 en China, cuando los científicos occidentales afirmaron que se había producido una acumulación de neumonía atípica en el sur de China. Dos días después de la creación mental de una cadena genética del supuesto nuevo virus (SARS-CoV-1), en la que el Prof. Drosten estuvo significativamente involucrado, el Prof. Drosten ofreció un supuesto procedimiento de prueba para este supuesto virus.

Aproximadamente 800 personas con neumonía atípica, es decir, neumonía en la que no se detectan patógenos conocidos, pero que resultó “positiva” con la prueba del Prof. Drosten, murieron, por lo tanto -posiblemente de forma incorrecta y sobre tratada- con el diagnóstico de SARS en lugar de “neumonía atípica”.

La base de que el temor al SARS se mantuviese y aumentara hasta 2019, son dos publicaciones de 2013 y 2017 que dieron lugar a especulaciones sobre la posibilidad de que aparecieran nuevos coronavirus del SARS. Los autores de ambas publicaciones afirman que los murciélagos sanos proporcionan pruebas de la existencia de secuencias genéticas cortas que pueden ser interpretadas como componentes de un virus.

Estas secuencias genéticas cortas tendrían similitudes con las secuencias genéticas cortas que se declararon componentes del supuesto coronavirus del SRAS-1 (SARS-CoV-1) en 2003.

SARS significa Síndrome Respiratorio Agudo Severo, que es otra descripción de los síntomas de la neumonía atípica.

Se dice que estas hebras genéticas mentales (ficticias, transformadas en realidad) son capaces de desarrollarse en la realidad y formar un virus real. Este virus, que se afirma está en murciélagos y otros animales salvajes pero que sigue siendo inofensivo, podría saltar a los humanos a través de la mordedura, el contacto o el consumo y convertirse en un asesino mortal.

En los seres humanos, este inofensivo virus podría, a través de cambios (mutaciones), convertirse en un coronavirus del SARS que es realmente nuevo y podría causar una enfermedad. Tal acontecimiento y la consiguiente oleada de enfermedades, como la neumonía atípica, deben esperarse en cualquier momento.

Hasta la fecha, los virólogos no han podido aislar un virus del SARS de un paciente, un murciélago, otro animal o en el laboratorio, ni han podido detectar una cadena genética intacta y completa de un virus del SARS. Hasta la fecha no se ha podido confirmar la suposición de los virólogos de que existen de hecho cadenas genéticas virales que están construidas de la misma manera que las cadenas genéticas compuestas de secuencias genéticas cortas.

Hay otras formas en que aún no se ha demostrado la existencia y la presencia de una cadena genética completa de un virus del SARS, aunque desde hace mucho tiempo se dispone de técnicas estándar muy sencillas para determinar la longitud de las secuencias genéticas.

Los temores alimentados masivamente por tales afirmaciones falsas fueron la base de los temores del oftalmólogo Li Wenliang, así como de otros médicos e infectólogos no sólo en Wuhan.

Estas alegaciones son la razón por la que los epidemiólogos y virólogos de la CCDC, a partir del 31 de diciembre de 2019, se centraron en encontrar secuencias de genes similares que se definieron como componentes del coronavirus del SARS en 2003 (véanse las explicaciones que figuran a continuación).



3. La segunda de las posibles causas de miedo de Li Wenliang

Las crisis del SARS y del Coronavirus comenzaron con la afirmación en los medios de comunicación de que hay una acumulación de pacientes con neumonía atípica. Esta alegación nunca fue corroborada. Sólo se afirmó que la neumonía atípica que se produjo podía explicarse por la suposición de la aparición de un nuevo virus, porque algunas de las personas con neumonía atípica tenían contacto con los mercados de animales.

Para poder confirmar la suposición de que un virus desconocido podría ser la causa de la neumonía atípica, se suprimieron los hechos conocidos descritos en la literatura médica y científica. De hecho, hay varios y amplios espectros de causas no infecciosas de neumonía atípica. Por varias razones, esta neumonía atípica tiene más probabilidades de ser mortal que la típica.

Las causas son, entre otras, la inhalación de vapores, disolventes y sustancias tóxicas. La entrada de alimentos, bebidas o contenidos estomacales en los pulmones en caso de dificultades para tragar o de la pérdida del conocimiento también puede causar una neumonía extremadamente grave (neumonía por aspiración).

El agua por sí sola es suficiente, si entra en los pulmones de las personas que se están ahogando, para causar una neumonía atípica grave. Otra causa es el reconocido espectro de disfunciones inmunológicas, como las alergias y las reacciones auto-inmunes. También se sabe que la radiación desencadena una inflamación de los pulmones en el cáncer, que no puede distinguirse de la típica neumonía.

La neumonía congestiva es particularmente conocida en las personas mayores. Éstas se desarrollan debido a la retención de agua (edema), a la permanencia prolongada en cama, a la debilidad del corazón y/o de los riñones, que puede conducir a una ventilación y circulación sanguínea inadecuadas en los pulmones, y como consecuencia directa de la inflamación de los pulmones, es decir, de la neumonía atípica.

Lógicamente, una combinación de causas subyacentes también causa neumonía atípica. Una neumonía atípica puede convertirse rápidamente en una neumonía típica si se produce una colonización secundaria del pulmón inflamado. Esta es la razón por la que el porcentaje de neumonía atípica es probablemente más alto que el 20-30% estimado.

En los estudios de las cinco personas documentadas en las dos publicaciones pertinentes a la crisis del coronavirus, no se investigaron la posible presencia o la historia, los signos, los mecanismos y los efectos de estas causas conocidas de la neumonía atípica. Los virólogos no suelen hacerlo de todos modos, y los miembros de la CCDC no pudieron hacerlo ni siquiera en las circunstancias de pánico.

Excluir la mención de la neumonía atípica demuestra una grave negligencia médica e impide el tratamiento correcto de los pacientes. Por consiguiente, los afectados corren el riesgo de que se les manipule mal con un cóctel de sustancias antibióticas ricas en efectos secundarios, que es capaz de causar de forma independiente la muerte de los pacientes, especialmente en caso de sobredosis. El pánico puede ser incluso fatal en muy poco tiempo, no sólo en el caso de problemas cardiovasculares.

La respuesta a la pregunta crucial de si se ha detectado realmente un nuevo virus o si sólo se emiten piezas cortas y endógenas de material genético como componentes de un virus o se interpretan erróneamente como tales, es decisiva para que la crisis del coronavirus pueda terminar rápidamente. Al igual que con el H1N1, los responsables de la crisis del coronavirus dicen que ésta sólo se puede acabar con la vacunación. Sin embargo, la idea de la vacunación ha sido refutada tanto como la de los virus.

Para la evaluación y clasificación de los acontecimientos que rodearon el desencadenamiento y el mantenimiento de la crisis del coronavirus es útil el recuerdo de la pandemia de gripe porcina de 2009, que ya ha sido olvidada.

La mayoría de la población en ese momento estaba preparada para vacunarse contra los supuestos virus de la gripe porcina. Luego hubo un retraso en la entrega anunciada de las vacunas. Las vacunas no podían llenarse en jeringas listas para usar, ya que los nuevos potenciadores de ingredientes activos utilizados por primera vez dañaban la mezcla de la vacuna y la inutilizaban. Por esta razón, la vacuna se llenó en ampollas para 10 personas cada una, a las que sólo se permitió añadir los potenciadores de la sustancia activa poco antes del acto de la vacunación.

Durante este tiempo se supo que los potenciadores del principio activo, llamados adyuvantes, sin los cuales una vacuna no podría desarrollar su efecto, son nuevos y no han sido probados. Se supo que estos novedosos amplificadores de drogas consisten en nanopartículas. Se sabe que las nanopartículas son muy reactivas debido a su diminuto tamaño y, por lo tanto, se utilizan como catalizadores en muchas reacciones químicas. En los procesos técnicos, por ejemplo, hacen que las superficies se comporten de forma completamente diferente a la que se puede conseguir con los métodos convencionales.

Entonces se supo que la Canciller alemana Angela Merkel y las Fuerzas Armadas alemanas iban a recibir esta vacuna, pero sin el novedoso potenciador de sustancias activas de nanopartículas, mientras que la policía y la población iban a recibir la vacuna con las nanopartículas no probadas.

Como resultado, el 93% de la población rechazó la vacuna producida para ellos. Sólo al 7% de los alemanes se les ha administrado esta vacuna.

El metabolismo humano no puede metabolizar y excretar nanopartículas. Debido a esta negativa por parte de casi toda la población, la gripe porcina en realidad desapareció de la noche a la mañana siguiente, como por arte de magia, de los medios de comunicación al basurero y las vacunas al alto horno.

(Se permite una pequeña polémica: sorprendentemente, el virus de la gripe porcina H1N1 despegó al galope de los cerdos, ya no infectó a otras personas, no enfermó a los infectados y su presencia en los medios de comunicación se detuvo inmediatamente. Tal vez el virus de la gripe porcina se ha convertido en virus de la gripe de los peces, para nadar por los ríos en los cuerpos de los salmones, sólo para atacar de nuevo con fuerza concentrada en el mercado de pescado en Wuhan).

Los epidemiólogos, infectólogos y virólogos implicados han aprendido del fracaso de la planificación de la pandemia, que no culminó con la vacunación. Analizaron las causas y publicaron sus conclusiones y recomendaciones para el futuro en el número 12 de diciembre de 2010 del Bundesgesundheitsblatt (Gaceta Federal de Salud). El significativo título de este número: “Pandemias. Lecciones aprendidas” Lo que significa tanto como: ¡Las lecciones que hemos aprendido de la debacle de la gripe porcina H1N1!

Algunos de los artículos de este número están disponibles en Internet, pero no los más importantes. Las principales recomendaciones para la gestión de la pandemia son:

• Asegurarse de que los expertos no se contradigan entre sí en los debates públicos.

• Participación temprana de los medios de comunicación social y de los líderes. – Control de la red Internet. Esto con el fin de evitar que las reivindicaciones y las críticas pongan en peligro el consenso y la aceptación de las medidas en la política y la sociedad.

¡Estas recomendaciones ya se han aplicado con éxito! Se censura en Internet, se excluye a los críticos con insultos, entre otras cosas. Los argumentos obligatorios que refutan la suposición de la pandemia y que han pasado al dominio público simplemente no se abordan. Sólo un experto, el Prof. Drosten, es escuchado en los medios y en la política. La única “crítica” que se le hizo, expresada por un virólogo especializado en VIH, tuvo la función de reforzar la afirmación central de la existencia de un nuevo virus, el SARS-CoV-2.



4. La globalización del pánico por los virus chinos del SARS y la creación de la crisis del coronavirus por el Prof. Drosten

El profesor Christian Drosten, de la Charité de Berlín, afirma que desde el 1/01/2020 ha desarrollado un método de detección genética con el que puede detectar con fiabilidad la presencia del nuevo coronavirus en los seres humanos.

Para a) poder comprender qué supuestos y qué acciones constituyen la base de las afirmaciones del Prof. Drosten y b) comprobar si sus conclusiones de haber desarrollado un procedimiento de prueba seguro para el nuevo coronavirus están lógica y científicamente probadas o no, o incluso refutadas, es necesario explicar los términos y técnicas utilizadas, presentar su argumentación y analizar las dos publicaciones decisivas a las que se refiere el Prof. Drosten.

¿Cómo se definen un virus y un coronavirus?

¿Cómo se definen las secuencias en este contexto? – ¿Cómo funcionan los métodos de detección de secuencias llamadas PCR, RT-PCR y RT-PCR en tiempo real?

¿Cuándo se puede emitir la detección de la presencia de secuencias en humanos como prueba de la presencia de un virus?

¿Cómo se demuestra científicamente la existencia de un virus?

 
Términos

– En la ciencia, un virus se define por su material genético específico, que es único para ese virus.

– El material genético de un virus también se conoce como la cadena genética viral, la molécula genética viral o su genoma. – El material genético viral de un virus contiene las distintas secuencias genéticas para la formación de las distintas proteínas virales, conocidas como genes virales.

– El material genético de un virus puede consistir en ADN o ARN.

– Los virus corona se definen por el hecho de que consisten en una molécula específica de ARN rodeada por una envoltura.

– El material genético de un determinado virus se define por su longitud determinada con precisión y la determinación exacta de la estructura de la cadena del genoma viral.

– La composición del material genético de un virus resulta de la determinación exacta del número y la secuencia específica de los cuatro bloques de construcción que componen un material genético. Los cuatro bloques de construcción de un material genético se llaman nucleótidos. – El proceso de determinar la secuencia específica de los cuatro componentes básicos de un material genético se denomina secuenciación.

– El resultado de la determinación de la secuencia de los componentes básicos de una sustancia hereditaria se denomina secuencia o secuencia genética.

– Los virus patógenos se definen por el hecho de que su secuencia es única y no se da en organismos sanos. – Para detectar y determinar la presencia del material genético de un virus, de acuerdo con las leyes del pensamiento y la lógica que precede a toda ciencia como regla fundamental, este virus debe ser aislado y estar presente en forma pura para que las propias secuencias de genes de la célula no se malinterpreten como componentes de un virus.

– Sólo es posible determinar la secuencia de una sustancia genética si está presente en forma de ADN. – Para determinar la secuencia de una sustancia genética que está presente en forma de ARN, primero debe ser convertida bioquímicamente en ADN.

– El proceso de conversión de una sustancia genética de ARN en ADN se denomina “transcripción inversa” y se abrevia como “RT”.


Las técnicas utilizadas por el Prof. Drosten y las primeras conclusiones

– La presencia y la longitud de un material genético se determina separándolo longitudinalmente en un campo eléctrico. Los trozos cortos migran más rápido, los más largos más lentamente. Al mismo tiempo, para determinar la longitud del material genético a examinar, se añaden piezas de material genético de longitud conocida de diferentes longitudes. Esta fiable técnica estándar para detectar y determinar la longitud del material genético se llama “electroforesis en gel”.

– Si la concentración de un determinado material genético es demasiado baja para ser detectada por la técnica de “electroforesis en gel”, puede ser multiplicada a voluntad por la técnica de multiplicación ilimitada de ADN, llamada Reacción en Cadena de la Polimerasa. De esta manera, el ADN indetectable puede hacerse visible en la electroforesis en gel. Este es un requisito previo para hacer accesible el material genético para investigaciones posteriores, especialmente para la posterior determinación decisiva de su longitud y secuencia. Este método también se conoce como PCR para abreviar.

El inventor de la técnica de la PCR, Kary Mullis, que fue galardonado con el Premio Nobel de Química en 1993 por este invento, señaló desde el principio que este, su método desarrollado para el análisis en sala blanca en las fábricas de chips de ordenador es muy propenso a errores. En su discurso del Premio Nobel, que está documentado en la página del Comité del Premio Nobel, también señaló que no hay ninguna prueba verificable, en realidad científica, de que la sustancia genética conocida como genoma del VIH desencadene realmente una inmunodeficiencia o una de las diversas enfermedades que se agrupan de manera inadmisible bajo el término “SIDA” y se tratan con quimioterapia altamente tóxica. Señaló que sólo hay consenso entre los científicos participantes en que el “VIH” desencadenaría una inmunodeficiencia.

Para poder reproducir un ADN con la técnica de PCR, se requiere el conocimiento de la composición, la secuencia del ADN. Esto se debe a que un ADN sólo puede propagarse por PCR si fragmentos cortos de genes producidos artificialmente se unen al principio y al final del ADN, que corresponden exactamente a la secuencia del principio y del final del ADN que se va a propagar. Estos cortos trozos de ADN producidos artificialmente se llaman, por lo tanto, primers, las moléculas iniciadoras de la PCR. Tienen una media de entre 24 y 30 nucleótidos de largo (los bloques de construcción del material genético).

Así pues, la PCR no puede utilizarse para detectar secuencias o virus desconocidos. Sólo la determinación de la secuencia de un virus permite desarrollar una prueba de PCR para la detección de la secuencia de un gen originado en un virus. – En los primeros días de la PCR, sólo era posible determinar la cantidad de ADN amplificado mediante electroforesis en gel después de que se hubiera detenido la reacción de amplificación de la PCR. Mientras tanto, se añaden ciertos colorantes a las enzimas y sustancias necesarias para la PCR. La detección de estos tintes durante el curso de la PCR muestra aproximadamente qué concentraciones de ADN reproducido artificialmente se produjeron y cuánto ADN estaba realmente presente aproximadamente al comienzo de la PCR. Dado que la cantidad de ADN producido artificialmente puede determinarse aproximadamente mientras la técnica de PCR sigue funcionando, esta extensión de la técnica de PCR se denomina “PCR en tiempo real”. Por lo tanto, una “PCR en tiempo real” que va precedida de otro paso, la conversión de ARN en ADN mediante “transcripción inversa” (RT), se denomina “RTPCR en tiempo real”.

– El Prof. Drosten utiliza la técnica de “RT-PCR en tiempo real” en la prueba que ha desarrollado para la detección del nuevo virus corona. Con ese fin, ha seleccionado secuencias genéticas cortas de un conjunto de datos de Internet del 1/01/2020 que se atribuyen a los virus del SARS. Sobre la base de esas secuencias de fragmentos genéticos cortos, que se interpretan como posibles componentes de los virus del SARS, él diseñó las secuencias de cebadores de la PCR decisivas para la PCR a fin de detectar el virus “todavía” desconocido en China con su “RT-PCR en tiempo real”.

Cuando aparecieron en Internet compilaciones preliminares de secuencias el 10/01/2020 y el 12/01/2020, que posteriormente fueron modificadas y publicadas el 24/01/2020 y el 3/02/2020, esto representó el resultado de los dos primeros intentos de identificar el virus aún desconocido. Con este fin, los virólogos de la CCDC usaron programas de computadora para ensamblar teóricamente las secuencias de fragmentos cortos de genes en una posible cadena genética.

En ambas publicaciones, los virólogos de la CCDC afirman que no hay evidencia de que estas sugerencias de secuencias puedan realmente causar enfermedades. El 10/01/2020 y el 12/01/2020, las propuestas de secuencias chinas eran todavía provisionales y no se habían sometido todavía al estricto proceso de revisión prescrito científicamente.

El hecho de que la Organización Mundial de la Salud (OMS) recomiende la prueba de detección PCR desarrollada por el Prof. Drosten para la detección del nuevo virus el 21/01/2020, incluso antes de la publicación de las publicaciones de las dos primeras propuestas de secuencias chinas, demuestra un primer hecho: El Prof. Drosten utilizó datos no verificados científicamente para su prueba de PCR rápidamente globalizada del 2019-nCoV, que fue rebautizada como SARS-CoV-2 el 7 de febrero de 2020 con la participación del mismo Prof. Drosten.

El cambio de nombre el 7 de febrero de 2020 de la designación de “nCoV” a “SARS-CoV-2”, una mera presunción de virus posiblemente defectuoso o inofensivo, en un patógeno peligroso, dio a la opinión pública la impresión de que se había descubierto un virus real del SARS en China, que causa una enfermedad peligrosa, a saber, el SARS, y mató al nuevo ídolo de China, Li Wenliang, que empequeñeció a la dirección del partido.

El Prof. Drosten y sus colegas del Grupo de Nomenclatura de Virus cumplieron así las expectativas de la población, que estaba aterrorizada hasta la médula: “finalmente diagnosticado”, “finalmente diagnosticado”. Esta expectativa fue despertada por el impulso del pánico masivo desencadenado por el Dr. med. Li Wengling y aparentemente cumplido por el Prof. Drosten.

El factor decisivo en la evaluación de este acto es el hecho de que en aquel momento todos los virólogos directamente implicados testificaron -y todavía testifican hoy- que no hay pruebas de que este nuevo virus cause realmente la enfermedad. ¿O sólo ocurre en paralelo en enfermedades, en procesos de curación, después de procesos de curación, en algunas personas sanas, en muchas personas sanas o en todas las personas?

Esto demuestra que el Prof. Drosten ha cruzado la línea claramente reconocible de la acción científicamente justificada en un fraude reconocible y trascendental. También no podrá salir de esto utilizando una revista para la publicación de su procedimiento de prueba del 23/01/2020 que no comprueba las declaraciones hechas en ella antes de ir a la imprenta.



5. Las preguntas decisivas para un rápido final de la crisis del Coronavirus

La cuestión central y decisiva es si el Prof. Drosten ha cumplido con su deber científico, que forma parte de su contrato de trabajo, consigo mismo y verifica sistemáticamente todas las afirmaciones hechas en su publicación sobre el método de detección que desarrolló y las declaraciones públicas basadas en él.

Este deber científico central da lugar a tres preguntas centrales:

¿Comprobó el Prof. Drosten si las secuencias de genes que forman la base de su procedimiento de prueba y que le fueron proporcionadas por virólogos chinos son en realidad secuencias que se originan en un virus?

¿Llevó a cabo el Prof. Drosten los experimentos de control que son obligatorios en la ciencia y que prueban si las secuencias que utilizó realmente se originan en un virus? ¿Llevó a cabo los experimentos de control que prueban si las secuencias que utiliza, que atribuye al nuevo virus, son en realidad secuencias que no son secuencias que se producen en todos los metabolismos, tal vez incluso en plantas, como las papayas de Tanzanía o que se producen en mayor número en el metabolismo de las enfermedades?

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su método de prueba, con el que sólo detecta áreas parciales de 2 (dos) genes del genoma de un total de 10 (diez) genes del coronavirus, detecta un virus completo, activo y causante de la enfermedad? ¿Y no sólo fragmentos de un virus, después de una supuesta batalla exitosa del sistema inmunológico o la presencia de virus “defectuosos” o “incompletos” o “inofensivos” en nuestro material genético, que son típicos y constituyen el 50% de las masas genéticas de nuestros cromosomas?

Las respuestas son el resultado de la realización documentada del Prof. Drosten durante el desarrollo del procedimiento de la prueba y de la no realización documentada del Prof. Drosten hasta hoy. El virólogo Prof. Drosten, que desarrolló el método de detección del nuevo coronavirus (primero llamado 2019-nCoV y luego, a partir del 7/02/2020 llamado SARS- CoV-2), describe el desarrollo del método de prueba en una publicación publicada el 23/01/2020 en la página 3 de este artículo, en la columna de la izquierda, a 8 líneas de distancia, describe el primer y decisivo paso de su enfoque:

“Antes del anuncio público de las secuencias del virus de 2019-nCoV, nos basamos en los informes de los medios de comunicación social que anunciaban la detección de un virus similar al SARS. Por lo tanto, asumimos que un CoV relacionado con el SARS estuvo involucrado en el brote”.

Esto significa que el Prof. Drosten y sus colaboradores han asumido, basándose en los informes de los medios de comunicación social, que un coronavirus relacionado con el SARS podría estar implicado en el supuesto brote de neumonía atípica. En ese momento no se disponía de datos clínicos que apoyaran esa hipótesis. ¿Cuál era su siguiente paso?

“Descargamos todas las secuencias completas y parciales (longitud media >400 nucleótidos) de virus relacionados con el SARS que estaban disponibles en el GenBank el 1 de enero de 2020.”

Continúa en la columna derecha de la página 3, tercera fila desde la parte superior:

“Alineamos estas secuencias [Nota mía, SL: contra una secuencia estándar dada del virus del SARS] y utilizamos las secuencias alineadas para desarrollar nuestras pruebas (Figura S1 en el suplemento de esta publicación).

“Tras la publicación de la primera secuencia de 2019 nCoV en virological.org, seleccionamos tres pruebas basadas en lo bien que se ajustaban al genoma de 2019 nCoV (Figura 1). (“Descargamos todas las secuencias completas y parciales (si >400 nt) de virus relacionados con el SARS disponibles en el GenBank antes del 1 de enero de 2020 […] Estas secuencias fueron alineadas y la alineación se utilizó para el diseño del ensayo (Figura suplementaria S1).

De sus explicaciones se pueden extraer respuestas, conclusiones y consecuencias claras:

¿Comprobó el Prof. Drosten si las secuencias de genes, que son la base de su procedimiento de prueba y que fueron proporcionadas por virólogos chinos, son en realidad secuencias de un virus? ¡La respuesta es NO! No pudo comprobar si las secuencias proporcionadas eran de un virus, porque las dos publicaciones decisivas que describían la extracción de las secuencias de genes que utilizó no estaban disponibles para él antes de que su prueba fuera lanzada al mercado.

¿Llevó a cabo el Prof. Drosten los experimentos de control obligatorios en la ciencia para probar si las secuencias que usó realmente se originaron de un virus? ¿Llevó a cabo los experimentos de control para averiguar si las secuencias que utilizó, que atribuyó al nuevo virus, son en realidad secuencias que se producen en cualquier metabolismo, tal vez incluso en las plantas, o que se producen de forma metabolizada en las enfermedades?

La respuesta es: ¡NO! Ni él, ni los virólogos de la CCDC, ni otros han llevado a cabo de forma demostrable estos experimentos de control necesarios hasta el día de hoy, y si lo han hecho, no los han publicado. Para estos cruciales experimentos de control, deben utilizarse secuencias genéticas cortas del metabolismo de individuos sanos para secuenciarlos. Estas cortas secuencias genéticas, como las de los enfermos, deben ser ensambladas con los mismos programas informáticos para formar una larga cadena genética de un virus. Este experimento nunca se llevó a cabo o nunca se publicó. Ni siquiera se menciona este experimento de control obligatorio, que resulta de las leyes del pensamiento y la lógica de la virología – para controlar consistentemente los propios resultados. En el momento en que este experimento se lleva a cabo y se publica, la crisis del coronavirus termina inmediatamente.

El otro experimento de control resultante de la lógica científica es el ensayo intensivo, mediante el procedimiento PCR desarrollado (RT-PCR en tiempo real), con muestras clínicas de personas con enfermedades distintas de las atribuidas al virus y utilizando muestras de personas, animales y plantas sanas para comprobar si estas muestras no dan también resultados “positivos”.

Estos nuevos experimentos de control, que son lógicamente necesarios para validar un procedimiento de prueba, es decir, para comprobar si es válido y tiene alguna importancia, aún no se han realizado y ni siquiera se ha afirmado que se hayan realizado. Por consiguiente, los inventores y productores de estos procedimientos de prueba se han asegurado, mediante la información apropiada en los rótulos, por ejemplo, que la prueba sólo debe utilizarse para fines de estudio y no es adecuada para fines de diagnóstico.

Puedo predecir con certeza que las personas que liberan mayores cantidades de secuencias genéticas del tipo de tejido de los epitelios escamosos, por ejemplo, los pacientes renales, darán “positivo” con la PCR desarrollada por el Prof. Drosten a más tardar cuando su cantidad de frotis se multiplique y se concentre un poco. Es muy probable que incluso todos los organismos puedan dar positivo.

Hago un llamamiento a bioquímicos, bioinformáticos, virólogos y especialistas en cultivos celulares para que lleven a cabo estos experimentos de control, los publiquen y me informen sobre ellos. He diseñado un experimento de control que excluye de entrada la excusa de que el material de muestra utilizado ha sido contaminado con el virus del SARS Cov-2 antes o durante el experimento de control.

Los costos de la realización de los experimentos de control están cubiertos si se permite que yo y observadores neutrales estemos presentes durante la realización de los experimentos de control y se documenta cada paso. Por favor, póngase en contacto con la editorial para que se ponga en contacto. Los resultados pondrán fin a la crisis del coronavirus inmediatamente. No sirve de nada si sólo presento los resultados de los experimentos de control.

¿En base a qué suposiciones, experimentos y controles puede el Prof. Drosten afirmar que su procedimiento de prueba, con el que sólo detecta áreas parciales de sólo 2 (dos) genes del genoma de un total de 10 (diez) genes del virus del Corona, detecta un virus completo, activo y causante de enfermedad y no sólo fragmentos de un virus después de una supuesta batalla exitosa del sistema inmunológico o debido a la presencia de numerosos virus “defectuosos”, “incompletos” e “inofensivos” en nuestro material genético?

El Prof. Drosten no consideró estas preguntas lógicas en absoluto, porque no aparecen en ninguna parte de sus publicaciones y afirmaciones. La detección de sólo secuencias genéticas cortas de una cadena genética larga de un virus nunca puede probar la presencia de un virus intacto y por lo tanto reproducible. Para poder calificar de válida una prueba de PCR de este tipo, habría que realizar primero estudios cuyos resultados demuestren que la detección de secuencias genéticas cortas prueba automáticamente la presencia de una cadena genómica completa e intacta de un virus. Esos estudios lógicamente convincentes aún no se han realizado ni mencionado.

Al comienzo de la crisis del coronavirus, la principal viróloga, la Prof. Karin Mölling, una destacada experta en el campo de los virus asociados a las células, inofensivos, incompletos o defectuosos conocidos como endógenos, describió las medidas adoptadas como injustificadas. Ha demostrado en publicaciones y en un libro, que la mitad del material genético de los humanos, es decir, la mitad de las secuencias de la que están formados nuestros cromosomas consiste en secuencias genéticas inactivas y defectuosas de virus.

Lo que no sabe, o está ocultando, es que el metabolismo produce constantemente una gran cantidad de secuencias genéticas de ARN de cualquier composición, que no aparecen en forma de secuencias de ADN en los cromosomas.

Este hecho pone en tela de juicio las afirmaciones de existencia de todos los virus ARN, como los coronavirus, el virus del Ébola, el VIH, el virus del sarampión y los virus del SARS.

Este hecho es también la base por la que, con los experimentos de control, se pone fin inmediatamente no sólo a la crisis del coronavirus, sino también al miedo y al mal manejo por parte de toda la virología de los supuestos virus de la enfermedad. Puedo asegurarle que las causas reales y los fenómenos de infección atribuidos a los virus han sido probados en el sentido “positivo” de la palabra “ciencia”.

Referencias

https://www.loveproductions.org/english/articles/misinterpretation-of-virus/

Wrong Interpretation of the Virus Part II: Beginning and End of the Coronavirus Crisis

COMPARTIR

MÉDICOS Y PROFESIONALES DE LA SALUD AFIRMAN QUE LA “PANDEMIA COVID-19” ES LA MAYOR ESTAFA SANITARIA DEL SIGLO EN CURSO

Centenares de médicos y profesionales de la salud de todo el mundo, reunidos en el Colectivo “United Health Professionnals” publicaron el mes pasado un extenso comunicado (en francés y en inglés) en el que piden que se detenga de inmediato “el clima de terror, la sinrazón, la manipulación y las mentiras” ligadas a “la mayor estafa sanitaria del siglo XXI”. En el comunicado, hecho público en diferentes idiomas a través de Change.org, los firmantes dicen “‘alto’ a todas las medidas demenciales y desproporcionadas que se han tomado desde un principio para luchar contra el (coronavirus) SARS-CoV-2 (encierro, bloqueo de la economía y la educación, distanciamiento social, uso de mascarillas para todos, etc.) porque están completamente injustificadas, no se basan en ninguna evidencia científica y violan los principios básicos de la medicina basada en la evidencia. Por otro lado, por supuesto, apoyan medidas razonables, como las recomendaciones de lavarse las manos, estornudar o toser en el codo, utilizar un pañuelo desechable, etc”. 

Los firmantes iniciales del documento, más casi el millar de profesionales que lo han hecho a través de Change.org, recuerdan que la Humanidad se ha enfrentado en numerosas ocasiones a nuevos virus, y que no es cierto que en esta ocasión sea distinto por un mayor contagio del Covid. “Es absolutamente falso. Una simple comparación con otros virus deja ver que la contagiosidad del SARS-CoV-2 es moderada. Son enfermedades como el sarampión las que pueden describirse como altamente contagiosas. Por ejemplo, una persona con sarampión puede infectar hasta a 20 personas, mientras que una persona infectada con este coronavirus solo infecta a 2 o 3: 10 veces menos que el sarampión”.

Los profesionales de la salud de Europa y América que hasta el momento se han sumado al comunicado niegan, además, la premisa mayor: “Es absolutamente falso que el Covid-19 sea mucho más mortal que otros virus”. Solo en comparación con la gripe, explican estos expertos, y si tenemos en cuenta el período comprendido entre el 1 de noviembre de 2019 y el 31 de marzo de 2020, hubo a nivel mundial 860.000 casos y 40.000 muertes de Covid-19, mientras que la gripe en el mismo período de cinco meses, infectó, en promedio, a 420 millones de personas y mató a 270.000. Además, la tasa de letalidad anunciada por la OMS (3,4%) estaba “muy sobreestimada y fue rechazada desde el principio por eminentes expertos en epidemiología. Pero, incluso aceptando esta tasa de letalidad, vemos que este coronavirus es tres veces menos mortal que el de 2003 (10%) y 10 veces menos mortal que el de 2012 (35%)”.

Los firmantes del documento explican que es absolutamente falso que el Covid-19 conlleve la saturación de los hospitales. “La saturación sólo afecta a algunos hospitales, pero se hace creer a la gente que todo el sistema hospitalario está saturado o que la saturación es inminente, cuando hay miles de hospitales en algunos países. ¿Es razonable y verdadero atribuir, por ejemplo, a 1.000 o 2.000 hospitales una situación que solo afecta a 4 o 5 hospitales? Tampoco es de extrañar que algunos hospitales estén saturados por ser centros epidémicos (como la región de la Lombardía en Italia o Nueva York en Estados Unidos). No hay que olvidar que los hospitales de muchos países se han visto desbordados (incluidos los cuidados intensivos) en anteriores epidemias de gripe y que en esas épocas se hablaba también de ‘tsunami’ de pacientes en los hospitales, ‘hospitales saturados’, carpas levantadas fuera de los hospitales, ‘zonas de guerra’, ‘hospitales colapsados’ y un ‘estado de emergencia’. Y, sin embargo, no confinamos países enteros, no bloqueamos la economía mundial, no paralizamos el sistema educativo, no practicamos el distanciamiento social y no les dijimos a las personas sanas que usaran mascarillas”.

Los firmantes del documento, todos ellos médicos y profesionales de la salud de múltiples países del mundo, explican que “las medidas demenciales” que se han tomado tienen “catastróficas consecuencias que ya han comenzado a aparecer: suicidio de personas angustiada como se ha reportado en China, desarrollo de patologías psiquiátricas, paralización de los itinerarios educativos de los escolares y estudiantes universitarios, impactos negativos y peligros en los animales, desatención de otras enfermedades (especialmente crónicas) y aumento de su mortalidad, violencia doméstica, pérdidas económicas, desempleo, crisis económica importante (pocas personas saben que la crisis económica de 2007-2008 conllevó el suicidio de al menos 13.000 personas sólo en Europa y América del Norte), graves consecuencias para la agricultura, desestabilización de países y paz social y riesgo de estallido de guerras. Un editorial publicado en el European Journal Of Clinical Investigation denunció, desde el principio, las daños de las medidas extremas tomadas sin fundamento en evidencias, información exagerada sobre la peligrosidad real del virus y difusión de noticias falsas (incluso por revistas prestigiosas). Algunos incluso llegaron a comparar esta pandemia con la de la gripe de 1918, lo que es una mentira y una manipulación, ya que aquella mató a 50 millones de personas, cosa que no tiene absolutamente nada que ver con la tasa de muertos de este coronavirus”.

Los profesionales firmantes del llamamiento señalan que “compartimos la opinión de los expertos que denuncian el hecho de que no se hace distinción entre personas que han muerto ‘por’ el virus y personas que han muerto ‘con’ el virus (con patologías concomitantes), el hecho de que la causa de la muerte se atribuya al SARS-CoV-2 sin una prueba o autopsia y que se presione a los médicos para que marquen el Covid-19 como la causa de la muerte, a pesar de que el paciente haya muerto por otras causas. Esto lleva a una sobreestimación del número de muertes y constituye una manipulación escandalosa de las cifras porque durante las epidemias de gripe estacional, por ejemplo, no se obra de la misma manera. Incluso más del 20% de los pacientes con Covid-19 también están coinfectados con otros virus respiratorios. Después de la reevaluación, solo el 12% de los certificados de defunción en un país europeo (Italia) mostraron una causa directa del coronavirus. El director de los CDC (Centres for Disease Control and Prevention, Centros para el Control y la Prevención de Enfermedades) de un país de América del Norte reconoció el 31 de julio que los hospitales tenían un incentivo financiero perverso para inflar las cifras de muertes por coronavirus”.

“Les decimos a los Gobiernos: levantad todas las restricciones y obligaciones a los ciudadanos (estado de emergencia, uso obligatorio de la mascarilla, distanciamiento social, etc.) porque son estúpidas y puramente dictatoriales y no tienen nada que ver con la medicina o la higiene o la preservación de la salud pública. No hay ninguna razón científica o médica para que los ciudadanos no enfermos usen una mascarilla. El doctor Pascal Sacré, anestesiólogo-reanimador, dijo: ‘obligar a todos a usarlas todo el tiempo, mientras la epidemia desaparece, es una aberración científica y médica’. El profesor Didier Raoult dice: ‘La decisión de confinar, como la decisión de usar mascarillas… no se basan en datos científicos…’. Las Dra. Lisa Brosseau y Margaret Sietsema, expertas en protección respiratoria, dicen: ‘No recomendamos exigir al público en general que no tenga síntomas de la enfermedad Covid-19 que usen con regularidad mascarillas de tela o quirúrgicas porque: no hay ninguna evidencia científica de que sean efectivas para reducir el riesgo de transmisión del SARS-CoV-2… ‘. El profesor Maël Lemoine también precisó que el cambio de discurso sobre las mascarillas es ‘político, no científico’. 

En algunos países asiáticos, las personas usan mascarillas durante todo el año (para protegerse de la contaminación, entre otras cosas). ¿Este uso generalizado de mascarillas en estos países les impide que tengan epidemias de coronavirus? ¿Este uso generalizado de mascarillas en estos países evita que cada año tengan epidemias de gripe u otros virus respiratorios? La respuesta es, por supuesto, no. Por otro lado, con los 8 millones de toneladas de plástico que ya se vierten en los océanos cada año, las mascarillas y guantes añaden una nueva amenaza y constituyen una contaminación particularmente peligrosa para nuestra salud y para la vida silvestre. Solo en Italia, si solo el 1% de las mascarillas actualmente en uso fueran arrojadas a la naturaleza, 10 millones de mascarillas terminarían en el océano cada mes. Además, las mascarillas quirúrgicas tardan hasta 450 años en descomponerse. Por lo tanto, decimos a los gobiernos: alto a estas medidas ilegales y peligrosas de uso obligatorio de mascarillas”.

“Decimos que es necesaria una reforma total de la OMS. Los éxitos de la OMS son indiscutibles: se han salvado millones de vidas gracias a los programas de vacunación contra la viruela y se ha reducido el consumo de tabaco en todo el mundo. Pero el mayor problema de la OMS es que durante varios años ha sido financiada en un 80% por empresas (especialmente farmacéuticas) y donantes privados (en concreto, la “filantrópica” undación Bill y Melinda Gates) y los escándalos se van acumulando: falsa alarma sobre el H1N1 bajo la influencia de los grupos de presión farmacéuticos, inquietante complacencia hacia el glifosato que la OMS había declarado seguro a pesar de las víctimas del herbicida, ceguera ante las consecuencias de la contaminación vinculada a las empresas petroleras en África, minusvaloración de la mortalidad humana de los desastres nucleares de Chernobyl a Fukushima y los desastres del uso de municiones de uranio empobrecido en Irak o los Balcanes, no reconocimiento de la ‘Artemisia’ para proteger los intereses de las empresas farmacéuticas a pesar de su probada eficacia en el tratamiento de la malaria.

La independencia de la organización se ve comprometida tanto por la influencia de los grupos de presión industriales, especialmente farmacéuticos, como por los intereses de sus estados miembros, en particular China. El presidente de un país dijo: ‘Creo que la Organización Mundial de la Salud debería avergonzarse de sí misma porque se han convertido en portavoz de China’. La institución ginebrina, que había subestimado la amenaza del ébola (más de once mil muertos) también está acusada de desatender las enfermedades tropicales en pos de mercados más jugosos. Una encuesta realizada en 2016 (La OMS en las garras de los grupos de presión) proporcionó una radiografía edificante de la OMS al dibujar el retrato de una estructura debilitada, sujeta a múltiples conflictos de intereses. Esta investigación ha demostrado cuánto y cómo predominan los intereses privados sobre los problemas de salud pública en la OMS. No es aceptable que el dinero que la financia provenga principalmente de un único empresario, y que esté infiltrada por ‘lobbies’”.

“Recientemente, la OMS se desacreditó aún más al caer en la trampa de Lancet Gate cuando un simple estudiante podría haber descubierto que era un estudio fraudulento. En el momento de la gripe H1N1, el Dr. Wolfgang Wodarg, presidente del Comité de Salud de la Asamblea Parlamentaria del Consejo de Europa, criticó la influencia de la industria farmacéutica en los científicos y funcionarios de la OMS, diciendo que ha llevado a una situación en la que ‘innecesariamente millones de personas sanas estaban en riesgo por vacunas mal probadas’ (…) También culpó a la OMS de alimentar los temores de una ‘falsa pandemia’, lo llamó ‘uno de los mayores escándalos médicos de este siglo’ y pidió que se abriera una investigación. 

De hecho, la OMS ha cambiado los criterios para declarar una pandemia (así como la gravedad) bajo la influencia de los grupos de presión farmacéuticos para que puedan vender vacunas a países de todo el mundo. Según un informe de la Asamblea Parlamentaria del Consejo de Europa sobre el manejo de la gripe H1N1, la OMS incurrió en ‘el desperdicio de importantes fondos públicos y la existencia de temores injustificados relacionados con los riesgos para la salud… Se han identificado graves lagunas con respecto a la transparencia de los procesos de toma de decisiones relacionados con la pandemia, lo que suscita preocupaciones sobre la posible influencia que la industria farmacéutica podría haber ejercido en las decisiones clave relacionadas con la pandemia. La Asamblea teme que esta falta de transparencia y rendición de cuentas debilite la confianza de los ciudadanos en las opiniones de las principales organizaciones de salud pública’”.

“Decimos que se debe abrir una investigación y que se interrogue a ciertos funcionarios de la OMS, en particular al que ha estado promoviendo el confinamiento internacional, lo que es una herejía desde el punto de vista médico y una estafa que ha llevado al mundo por mal camino. De hecho, el 25 de febrero de 2020, el jefe de la misión internacional de observación del coronavirus en China elogió la respuesta de Beijing a la epidemia. Dijo que China ha tenido éxito con métodos ‘anticuados’, enfatizó que ‘el mundo necesitaba las lecciones de China’, de las que se debía aprender y que si él tuviera el Covid-19, buscaría tratamiento gustosamente en China. Otra vez, también describió a China como ‘muy abierta’ y ‘muy transparente’. ¿Cómo podemos creer estas declaraciones? ¿Cómo puede alguien creer que si él tuviera COVID-19 iría a China para recibir tratamiento? ¿Cómo puede alguien creer que el mundo debería inspirarse en China y que la lucha contra la epidemia debería hacerse ‘con métodos anticuados’? Lo que es alucinante es que consiguió hacer tragar sus mentiras al mundo entero. Porque, lamentablemente, desde sus declaraciones y el informe que supervisó (donde podemos leer que los métodos chinos son: ‘ágiles y ambiciosos’), los países del mundo han puesto en marcha medidas desproporcionadas y han seguido ciegamente a la OMS confinando sus poblaciones. 

El miedo y la psicosis se han propagado al presentar el SARS-CoV-2 como un virus muy peligroso o de mortalidad masiva, cuando no lo es en absoluto. Afortunadamente, una entrevista con el vicedirector de la OMS, Bruce Aylward mostró una parte significativa de la verdad y el conflicto de intereses de la OMS con China cuando una periodista le preguntó sobre la negativa de la adhesión de Taiwán (que está en conflicto con China) por la OMS: fingió no escuchar la pregunta y, cuando se le volvió a hacer, ¡cortó la comunicación! (el vídeo ha sido visto más de 8 millones de veces). Él también dijo a fines de febrero: ‘Actualmente, solo hay un medicamento que creemos que podría tener alguna efectividad real: el Remdesivir’. ¿Cómo puede decir eso incluso antes de que salgan los resultados? ¿Y por qué lo dijo?

”https://www.youtube.com/embed/VM8G73hdXro

“Los canadienses electos en la Cámara de los Comunes incluso convocaron a este funcionario de la OMS a comparecer después de que rechazara las invitaciones a testificar ante el Comité Permanente de Salud. Incluso el líder interino del Partido Conservador Canadiense ha cuestionado la exactitud de los datos de la OMS sobre el Covid-19. De hecho, decir que China ha reducido el número de casos o gestionado bien la epidemia y aplanado la curva gracias al confinamiento es pura mentira, y no se basa en ninguna evidencia porque nadie es capaz de dar la cifra del número de casos o muertes en China si no hubiera impuesto el confinamiento. Además, meses después: ¡el mundo descubrió que esos números ni siquiera eran ciertos! Recientemente, tres países africanos expulsaron a funcionarios de la OMS porque, según algunos de estos estados, estaban falsificando el número de casos inflándolos”.

Los científicos firmantes del comunicado concluyen señalando que “las personas que están detrás de este encierro, de la psicosis y el terror global, cuando ven la avalancha de gente hacia las tiendas, la gente discutiendo por harina o papel higiénico, las distancias de un metro como si fuera la peste, personas confinadas como si fueran animales, calles desinfectadas, policías golpeando a los ciudadanos que salen, drones y helicópteros movilizados, personas que salen con salvoconductos, la utilización de mascarillas a pesar del final de la epidemia y el hecho de que la gente no esté enferma, no se excluye que se rían de la facilidad con la que han manejado países enteros cuyos ciudadanos son manejados como borregos … 

La locura ha llegado al punto de que en algunos países las playas han sido desinfectadas con lejía, se ha prohibido la barba y bigote a los bomberos, se ha instalado plexiglás en todas partes (incluso en las aulas de las escuelas) como si fuese la Peste Negra, se detuvo un tren porque una persona no llevaba la mascarilla puesta, familias privadas de ver a sus muertos (como si el virus fuera a saltar de su cuerpo y morderlos), septuagenarios multados por haber salido a tirar la basura y ¡hasta se han ‘aislado’ monedas y billetes procedentes del extranjero! ¿Cómo han podido los países aceptar caer en este nivel de locura, estupidez y dictadura? Especialmente aquellos que dicen ser democráticos. 

Todo esto por un virus que causa el 85% de las formas leves y del que se recupera más del 99% de las personas infectadas. 

La OMS instó al mundo a copiar la respuesta de China al Covid -19 y lo ha logrado: todos los países del mundo, siguiendo ciegamente a la OMS, se han convertido en una copia certificada de China. Solo unos pocos países se han negado a imitar tontamente a otros, como Suecia o Bielorrusia, por lo que pueden ser elogiados. 

El presidente de un país europeo tenía razón al decir: ‘Esto es solo una psicosis más peligrosa que el propio virus’”.

(Visto en https://www.prevencia.net/)

https://astillasderealidad.blogspot.com/2020/10/medicos-y-profesionales-de-la-salud.html

DOCTORS AND HEALTH PROFESSIONALS AFFIRM THAT THE “COVID-19 PANDEMIC” IS THE LARGEST SANITARY SCAM OF THE CURRENT CENTURY

MÉDICO DENUNCIA LA CORRELACIÓN ENTRE LAS FASES DEL COVID Y LAS DE LA IRRADIACIÓN 5G

Hasta ahora, la incidencia de leucemia infantil, derrames cerebrales, cánceres de todo tipo y otras enfermedades producidas por las radiaciones de las ondas de telefonía móvil, habían quedado medio solapadas debido a varios factores: la falta de estudios oficiales concluyentes, el soborno de las operadoras y el silencio de los medios de comunicación. Añadiría quizá un cuarto factor: la falta de formación e información de los usuarios. A estas alturas y con los datos en la mano no es difícil concluir que somos una sociedad de irresponsables que solo se preocupa por lo inmediato, por lo lúdico y las distracciones, en definitiva, por el “pan y circo”. No es un juicio, y mucho menos una condena, sino una descripción de la realidad.

Información sobre ello hay para dar y regalar. El estudio CERENAT, del 2014, fue publicado en “Ocupational Environnement Medicine” y concluye que el uso del móvil, aunque sea solo durante treinta minutos, duplica o triplica el riesgo de padecer un tumor cerebral. Pero casi nadie se ha enterado.

En el 2018, el Instituto Ramazzini también vinculó el padecimiento de schwannoma maligno de corazón y el glioma al teléfono móvil. Por su parte, el macroestudio del National Toxicology Program del Instituto Nacional para la Salud y Seguridad Ambiental de Estados Unidos constata las evidencias de carcinogenidad y daños cardiacos por el uso de la radiación del móvil. Pero esto no se cuenta.

En cuanto al sector más joven de la población, la Comisión Europea tiene en su poder el estudio Mobi-Kids, un trabajo muy interesante realizado en catorce países con niños y adolescentes de edades comprendidas entre los siete y los veinticuatro años, que vincula la relación entre los tumores cerebrales y la telefonía móvil. La exdirectora de epidemiología del Instituto Nacional de la Salud y la Investigación médica de Francia, manifiesta que la Agencia Internacional para la Investigación del Cáncer (IARC, por sus siglas en inglés) podría elevar la clasificación de “probablemente cancerígeno” por su mecanismo de neurotoxicidad. Pero esto se silencia.

La implantación de la red 5G ha vuelto a abrir el debate sobre la peligrosidad de los campos electromagnéticos, sobre todo, cuando se empezaron a relacionar estas radiaciones con el desarrollo de los virus, extremo en el que coinciden varios investigadores. Veamos someramente en qué consiste la 5G, por qué es peligrosa, quiénes lo dicen y en qué se basan. Se trata de una supertecnología que implica el uso de altas frecuencias, entre 53 y 58 GHz, las cuales tienen mayor capacidad para penetrar en toda la materia viva. Las personas con sensibilidad electromagnética (CEM) tendrán que meterse en una burbuja para sobrevivir, y no estamos exagerando. Muchos científicos han dado la voz de alarma, entre ellos, Ceferino Maeztu, director del laboratorio de bioelectromagnetismo del Centro de Tecnología Biomédica dependiente de la Universidad Politécnica de Madrid. La preocupación es compartida por David Carpenter, coautor del informe internacional “Bioinitiativa” y director del Instituto de Salud y Medio Ambiente de Nueva York, centro colaborador de la OMS. Según sus palabras “ya es imposible decir que las radiofrecuencias no producen cáncer”. Pero de esto no se informa a los ciudadanos.

Los científicos no adscritos al sistema coinciden en que cada vez habrá más casos de leucemia infantil, infertilidad, cardiopatías, enfermedades neurológicas, psiquiátricas, cognitivas y más cánceres de todo tipo, especialmente, cerebrales. Pero está prohibido hablar de esto.

La doctora Magda Havas, profesora de ciencias ambientales de las universidades canadienses de Toronto y Trent hace tiempo que alertó sobre la aparición de un tercer tipo de diabetes, desencadenada por la contaminación electromagnética. Silencio ante esto.

La tecnología 5G ya está implantada en varios países. En España se está instalando y piensan tener todo listo en diciembre. Habrá que hacer un seguimiento por zonas y observar la incidencia de ingresados. En algunos lugares, como Suiza, se paralizó su instalación y, curiosamente, han tenido mucha menos incidencia de Covid, no han estado confinados y no utilizan mascarilla. Según tomamos de una ficha técnica, la 5G es “una tecnología inalámbrica que, en lugar de emitir cientos de vatios de radiaciones de microondas, emitirá haces con una potencia efectiva de hasta decenas de miles de vatios de radiación de onda milimétrica, con lo cual se pretende que 20.000 satélites en órbita baja irradien cada centímetro cuadrado del planeta”. Lo aterrador de esto es que las pruebas de esta tecnología han provocado una repentina muerte de miles de aves, aparte de los síntomas humanos de fatiga, hipoxia, trombosis, desorientación e inquietud, y otros. Tampoco sobre esto es consciente el ciudadano.

La ONU y su organismo la OMS, así como la UE, el Consejo de Europa, los gobiernos de todas las naciones y los medios de comunicación tienen en su poder el dosier que los científicos conocedores de estos efectos devastadores para la vida humana y la del planeta han elaborado y enviado. Nosotros lo hemos recibido en su día y publicamos al respecto. Es una declaración de alarma, en la que solicitan que se paralice con carácter de urgencia el despliegue de la red inalámbrica 5G, incluida la red 5G de los satélites espaciales. La razón es el incremento de la exposición a la radiación de radiofrecuencia de las telecomunicaciones, la cual se acumula a las que ya están implantadas: 2G, 3G y 4G. Inciden en su perjuicio para el medio ambiente y tachan la 5G de un experimento que tiene a la sociedad como conejillo de Indias, lo cual podría definirse como un crimen contra la humanidad, si nos atenemos a la letra del Derecho Internacional.

EL DOCTOR SEVILLANO ENTRA EN ACCIÓN

Pero ¿y si no fuera la 5G la causante de la Covid-19, y el quid estuviera en las antenas ya instaladas desde las que se está irradiando? Es una nueva hipótesis y muy interesante. Hace muchos meses que leo y escucho todo lo alternativo que se publica sobre el desarrollo de esta epidemia y sus múltiples flecos. Este nuevo planteamiento añade una nueva pieza al fresco de la epidemia. La hipótesis de trabajo es del doctor español, afincado en Francia, José Luis Sevillano. La entrevista que le hizo José Miguel, del canal Apellido Obligatorio, de donde tomo estos datos, dio la vuelta al mundo y así le conocimos.

El doctor Sevillano, desde su propia experiencia con enfermos de Covid en los últimos meses, y haciendo uso de la epidemiología y la radiología médica, ha llegado a unas conclusiones provisionales que deben tenerse en cuenta. La ciencia se basa en la observación y en la comprobación, por tanto, esto es pura ciencia. Al cabo de unas semanas de examinar pacientes con síntomas Covid, el doctor observó que una buena parte de ellos vivía en una zona concreta y esto le llamó la atención. Ante la duda de si pudiera haber algún foco en ese entorno que estuviese causando la enfermedad, decidió inspeccionar el lugar y comprobó que había una antena de telefonía móvil. En la localidad hay tres en total y aún no existe la red 5G.

Con esta pista en la mano, la deducción no fue difícil, máxime conociendo la radiología médica y la cronología de los efectos que causa que, coincidentemente, son los mismos que se están viendo en los enfermos de Covid en sus diferentes fases. También la 5G produce estos efectos, pero en la zona no está desplegada. ¿Podría ser se estuviera irradiando en tiempos determinados desde esas antenas? Dejamos la pregunta en el aire.

En una irradiación, cuanto más potente sea la emisión, mayor es el daño causado, y este depende de tres factores: la proximidad al foco, el tiempo de exposición y la edad de la persona. Existe un cuarto factor radiomédico que es la radiosensibilidad, es decir, la reacción del tejido humano ante la misma radiación, ya que no todos los tejidos reaccionan igual.

Oficialmente, la Covid-19 es una enfermedad respiratoria aguda grave, producida por el Sars-Cov-2. Sin embargo, el doctor Sevillano, como muchos otros profesionales de la salud, entre ellos la brillante doctora María José Martínez Albarracín, sostiene que no es una enfermedad respiratoria, sino una enfermedad inflamatoria sistémica, esto es, “afecta a todo el organismo, es decir, desde un pelo a las uñas de los pies”. Por eso se habla de endotelitis, miocarditis, arteritis, embolias, infartos o incluso dermatitis, amén de síntomas neurológicos, como mareos, vértigos, cefaleas, nerviosismo, agitación o pérdida de conciencia. ¿Puede un virus ser el causante de todo esto o habría que dirigir el foco a una radiación electromagnética como causa de esta complicada enfermedad?

El doctor Sevillano, con su nomenclatura particular, nos habla de los diferentes cuadros de los pacientes diagnosticados de Covid-19. Los hiperagudos son aquellos que mueren en cuestión de horas o que incluso caen redondos en la calle asfixiados. Hemos visto algunas de estas imágenes, sobre todo, en países de Hispanoamérica. “Cuando una persona es sometida a una radiación electromagnética en proximidad de alta o media energía, es fácil que muera en poco tiempo, a las pocas horas o a los pocos días. Puede ser que muera ahogada, por efecto de las ondas electromagnéticas o de la hemoglobina. La hemoglobina tiene átomos de hierro y esto supondría una desnaturalización de estas proteínas o un bloqueo de la liberación del intercambio de oxígeno”, asegura el doctor Sevillano, y añade que, personalmente, no ha tenido casos de este tipo, quizá porque las antenas de la localidad de Francia donde vive, se encuentran a unos trescientos metros de distancia. Como hemos expresado, cuanto más lejos, menor es el daño. Cosa distinta es cuando la antena se encuentra en el tejado de enfrente. Esto se denomina efecto gradiente, que no se da si el causante es un agente biológico. Habría que investigar si estos casos extremos de muerte fulminante, están relacionados con las antenas. También ha habido muertes súbitas por fallo en el sistema de conducción eléctrica del corazón, cosa que también se da en los casos de radiación.

Los cuadros agudos de Covid se presentan en dos o tres días y cursan con vómitos, diarreas, tos seca, fiebre y disnea, o sea, dificultad para respirar. Según la explicación de la radiación electromagnética, esto ocurre porque “los primeros tejidos afectados por una radiación son los que tienen mayor índice mitótico, es decir, aquellos que se reproducen más rápidamente porque están expuestos a mayores agresiones. Son los epitelios, o sea, las cubiertas respiratoria y digestiva principalmente. Estas células están habituadas a que al menor traumatismo se eliminan, se caen, se pelan, es decir, hay que intercambiarlas rápido, están hechas para eso. Cuando el cuerpo recibe una agresión, es lo primero que se elimina. Así, cuando se ataca con una radiación electromagnética se tiene tos seca no reproductiva, se vomita y se tiene diarrea porque todos los epitelios del digestivo y el respiratorio se están eliminando”. El doctor pone el ejemplo de la película The Widowmaker, basada en la historia real del K-19, en la que los marineros vomitaban tras acercarse al reactor nuclear. Esto ocurre en cuestión de horas o de días.

En la fase aguda, el cuerpo se deshace de todo el material de desecho, por la vía respiratoria y digestiva. Algunas personas pueden recuperarse en esta etapa sin más complicaciones, pero en cambio otras, aparte de toser, su pulmón empieza a encharcarse por una reacción natural ante la agresión. La inflamación produce una vasodilatación que hace que todo el líquido de los vasos del pulmón pase al espacio respiratorio, donde se hace el intercambio gaseoso. Muchos de estos pacientes pasan a la fase de neumonía bilateral, intersticial. Como no pueden respirar, sobre todo al principio de la epidemia, que andaban tan perdidos, se les reanimaba e intubaba, “y salían o no salían”.

La siguiente fase es la inflamación de otras cubiertas del tejido intersticial, los tejidos más profundos y más difíciles de atacar. Son los endotelios, es decir, el revestimiento de los vasos sanguíneos, arterias, venas, vasos linfáticos, todos los conductos del cuerpo. Se habla de endotelitis, porque cuando se hacían las autopsias veían que las arterias y, sobre todo, las venas estaban llenas de trombos, pero no porque hubiese nada en la sangre que los estuviera produciendo, sino porque el endotelio se estaba “barriendo”, como el epitelio de los tractos respiratorio y digestivo que acabamos de explicar. El endotelio es el segundo tejido más radiosensible del organismo y cuando se daña propicia los fenómenos de coagulación.

A las dos o tres semanas, pueden aparecer pericarditis y derrames pleurales, que a falta de un test positivo, sobre todo en personas de edad, suelen atribuirse a insuficiencias cardiacas. Cuando los endotelios del pulmón y el corazón, esto es, las membranas que los cubren, están dañados producen agua, la cual causa derrames pleurales y pericárdicos. También pueden aparecer infartos de miocardio y cerebrales.

Para José Luis Sevillano la evolución de la enfermedad no tiene una fácil explicación si tomamos como origen un agente biológico, en este caso un virus. En cambio, todo queda mucho más diáfano si se tiene en cuenta la cronología de una irradiación.

En cuanto a la fase crónica aún no se conoce. Se habla de fibrosis pulmonar. La fibrosis pulmonar está descrita en todos los cuadros de irradiación por radioterapia como neumonitis por radiación. Los síntomas son fiebre, tos seca y dificultad para respirar. Esta secuela puede aparecer al cabo de meses o incluso de años.

Esta investigación no debe caer en saco roto, y alguien debería ponerse manos a la obra para despejar toda sombra de duda. El doctor está esperando que más médicos se unan para establecer protocolos de futuro ante nuevos rebrotes. Ahora bien, personalmente, sigo creyendo que la red 5G está unida íntimamente a la Covid y que forman parte del mismo plan, y lo mismo los famosos chemtrails, de los que nadie habla. Todo está en el HAARP, que solo unos cuantos “locos” conocen. Es perfectamente compatible con el bombardeo electromagnético que, supuestamente, se estaría emitiendo desde las antenas “antiguas”. Hay que llegar al fondo de esto. Es muy preocupante que nos estén dando gato por liebre, lo que equivale a decir que desde el sistema de salud se puedan estar haciendo pasar cuadros radiológicos por cuadros virales. Para ello hacen falta muchos cómplices y ya no estaríamos hablando de desconocimiento, sino de traición a los ciudadanos. ¡Médicos del mundo, no consistáis esto!

Magdalena del Amo
(Fuente: https://www.periodistadigital.com/)

Reblogueado de https://astillasderealidad.blogspot.com/2020/10/medico-denuncia-la-correlacion-entre.html

DOCTOR DECLINES THE CORRELATION BETWEEN THE PHASES OF COVID AND THOSE OF 5G IRRADIATION

Until now, the incidence of childhood leukemia, strokes, cancers of all kinds and other diseases caused by radiation from mobile phone waves, had been partially overlapped due to several factors: the lack of conclusive official studies, the bribery of the operators and the silence of the media. I would perhaps add a fourth factor: the lack of user training and information. At this point and with the data in hand, it is not difficult to conclude that we are an irresponsible society that only cares about the immediate, the playful and distractions, in short, about the “bread and circuses.” It is not a trial, much less a conviction, but a description of reality.

Information about it is there to give and give away. The CERENAT study, from 2014, was published in “Occupational Environnement Medicine” and concludes that the use of a mobile phone, even for only thirty minutes, doubles or triples the risk of suffering from a brain tumor. But hardly anyone has found out.

In 2018, the Ramazzini Institute also linked malignant heart schwannoma and glioma to mobile phones. For its part, the macro-study of the National Toxicology Program of the National Institute for Environmental Health and Safety in the United States confirms the evidence of carcinogenicity and heart damage due to the use of mobile radiation. But this is not counted.

As for the youngest sector of the population, the European Commission has in its possession the Mobi-Kids study, a very interesting study carried out in fourteen countries with children and adolescents between the ages of seven and twenty-four, which links the relationship between brain tumors and mobile phones. The former director of epidemiology at the French National Institute of Health and Medical Research, states that the International Agency for Research on Cancer (IARC, for its acronym in English) could raise the classification of “probably carcinogenic” due to its neurotoxicity mechanism . But this is silenced.

The implementation of the 5G network has reopened the debate on the dangerousness of electromagnetic fields, especially when these radiations began to be related to the development of viruses, an end in which several researchers agree. Let’s see briefly what 5G consists of, why it is dangerous, who says it and what they are based on. It is a super-technology that involves the use of high frequencies, between 53 and 58 GHz, which have a greater capacity to penetrate all living matter. People with electromagnetic sensitivity (EMF) will have to get into a bubble to survive, and we are not exaggerating. Many scientists have sounded the alarm, among them Ceferino Maeztu, director of the bioelectromagnetism laboratory at the Center for Biomedical Technology under the Polytechnic University of Madrid. The concern is shared by David Carpenter, co-author of the international report “Bioinitiativa” and director of the New York Institute for Health and Environment, a WHO collaborating center. In his words “it is impossible to say that radio frequencies do not cause cancer.” But citizens are not informed of this.

Scientists not attached to the system agree that there will be more and more cases of childhood leukemia, infertility, heart disease, neurological, psychiatric, cognitive diseases and more cancers of all kinds, especially brain. But it is forbidden to talk about this.

Dr. Magda Havas, a professor of environmental sciences at the Canadian universities of Toronto and Trent, has long warned of the appearance of a third type of diabetes, triggered by electromagnetic pollution. Silence at this.

5G technology is already implemented in several countries. In Spain it is being installed and they plan to have everything ready in December. It will be necessary to do a follow-up by areas and observe the incidence of admitted. In some places, such as Switzerland, their installation was paralyzed and, curiously, they have had much less incidence of Covid, they have not been confined and do not use a mask. As we take from a datasheet, 5G is “a wireless technology that, instead of emitting hundreds of watts of microwave radiation, will emit beams with an effective power of up to tens of thousands of watts of millimeter wave radiation, thereby 20,000 satellites in low orbit are expected to radiate every square centimeter of the planet ”. The scary thing about this is that testing of this technology has resulted in the sudden death of thousands of birds, apart from human symptoms of fatigue, hypoxia, thrombosis, disorientation and restlessness, and others. The citizen is not aware of this either.

The UN and its body the WHO, as well as the EU, the Council of Europe, the governments of all nations and the media have in their possession the dossier that scientists aware of these devastating effects on human life and that of the planet have drawn up and shipped. We have received it in its day and we publish about it. It is a declaration of alarm, in which they request that the deployment of the 5G wireless network, including the 5G network of space satellites, be stopped as a matter of urgency. The reason is the increase in exposure to radiofrequency radiation from telecommunications, which is added to those that are already implemented: 2G, 3G and 4G. They affect their detriment to the environment and cross out 5G as an experiment that has society as a guinea pig, which could be defined as a crime against humanity, if we abide by the letter of International Law.

DOCTOR SEVILLANO TAKES ACTION

But what if 5G were not the cause of Covid-19, and the crux was in the antennas already installed from which it is being irradiated? It is a new and very interesting hypothesis. For many months I have been reading and listening to everything alternative that is published about the development of this epidemic and its many fringes. This new approach adds a new piece to the fresco of the epidemic. The working hypothesis is that of the Spanish doctor, based in France, José Luis Sevillano. The interview that José Miguel, from the Surname Obligatorio channel, from which he took this data, went around the world and that’s how we met him.

Dr. Sevillano, from his own experience with Covid patients in recent months, and using epidemiology and medical radiology, has reached some provisional conclusions that must be taken into account. Science is based on observation and verification, therefore, this is pure science. After a few weeks of examining patients with Covid symptoms, the doctor observed that a good part of them lived in a specific area and this caught his attention. Doubting whether there could be any source in that environment that was causing the disease, he decided to inspect the place and found that there was a mobile phone antenna. In the town there are three in total and the 5G network does not yet exist.

With this clue in hand, the deduction was not difficult, especially knowing medical radiology and the chronology of the effects it causes, which, coincidentally, are the same as those seen in Covid patients in their different phases. 5G also produces these effects, but it is not deployed in the area. Could it be that it was radiating at certain times from those antennas? We leave the question in the air.

In an irradiation, the more powerful the emission, the greater the damage caused, and this depends on three factors: the proximity to the source, the exposure time and the age of the person. There is a fourth radiomedical factor which is radiosensitivity, that is, the reaction of human tissue to the same radiation, since not all tissues react the same.

Officially, Covid-19 is a serious acute respiratory disease, caused by Sars-Cov-2. However, Dr. Sevillano, like many other health professionals, including the brilliant Dr. María José Martínez Albarracín, maintains that it is not a respiratory disease, but a systemic inflammatory disease, that is, “it affects the entire organism, it is say, from a hair to the toenails ”. That is why we speak of endothelitis, myocarditis, arteritis, emboli, heart attacks or even dermatitis, in addition to neurological symptoms, such as dizziness, vertigo, headaches, nervousness, agitation or loss of consciousness. Can a virus be the cause of all this or should the focus be directed to electromagnetic radiation as the cause of this complicated disease?

Dr. Sevillano, with his particular nomenclature, tells us about the different pictures of patients diagnosed with Covid-19. The hyperacute are those who die in a matter of hours or even fall round the street asphyxiated. We have seen some of these images, especially in Latin American countries. “When a person is subjected to electromagnetic radiation in high or medium energy proximity, it is easy for him to die in a short time, a few hours or a few days. It may be that he dies from drowning, caused by electromagnetic waves or hemoglobin. Hemoglobin has iron atoms and this would mean a denaturation of these proteins or a blockage of the release of oxygen exchange ”, says Dr. Sevillano, adding that, personally, he has not had cases of this type, perhaps because the antennas of the town in France where you live, are about three hundred meters away. As we have expressed, the further away, the less the damage. A different thing is when the antenna is on the opposite roof. This is called the gradient effect, which does not occur if the cause is a biological agent. It would be necessary to investigate whether these extreme cases of sudden death are related to antennas. There have also been sudden deaths due to failure in the electrical conduction system of the heart, which is also the case in radiation cases.

Acute Covid pictures appear in two or three days and present with vomiting, diarrhea, dry cough, fever and dyspnea, that is, difficulty breathing. According to the explanation of electromagnetic radiation, this occurs because “the first tissues affected by radiation are those with the highest mitotic index, that is, those that reproduce more quickly because they are exposed to greater aggressions. They are the epithelia, that is, the respiratory and digestive covers mainly. These cells are used to the fact that at the slightest trauma they are eliminated, they fall off, they peel, that is, they have to be exchanged quickly, they are made for that. When the body receives an attack, it is the first thing that is eliminated. Thus, when you attack with electromagnetic radiation you have a non-reproductive dry cough, you vomit and you have diarrhea because all the digestive and respiratory epithelia are being eliminated ”. The doctor uses the example of the movie The Widowmaker, based on the true story of the K-19, in which the sailors vomited after approaching the nuclear reactor. This happens in a matter of hours or days.

In the acute phase, the body gets rid of all waste material, through the respiratory and digestive routes. Some people can recover in this stage without further complications, but others, apart from coughing, their lungs begin to flood due to a natural reaction to the aggression. The inflammation produces a vasodilation that causes all the fluid in the lung vessels to pass into the respiratory space, where gas exchange takes place. Many of these patients progress to the phase of bilateral, interstitial pneumonia. Since they cannot breathe, especially at the beginning of the epidemic, when they were so lost, they were resuscitated and intubated, “and they came out or they didn’t come out.”

The next phase is the inflammation of other coverings of the interstitial tissue, the deeper and more difficult tissues to attack. They are the endotheliums, that is, the lining of the blood vessels, arteries, veins, lymphatic vessels, all the ducts of the body. There is talk of endothelitis, because when the autopsies were done they saw that the arteries and, above all, the veins were full of thrombi, but not because there was nothing in the blood that was producing them, but because the endothelium was being “swept”. as the epithelium of the respiratory and digestive tracts that we have just explained. The endothelium is the second most radiosensitive tissue in the body and when it is damaged it favors coagulation phenomena.

After two or three weeks, pericarditis and pleural effusions may appear, which in the absence of a positive test, especially in the elderly, are usually attributed to heart failure. When the endotheliums of the lung and heart, that is, the membranes that cover them, are damaged they produce water, which causes pleural and pericardial effusions. Myocardial and cerebral infarcts can also appear.

For José Luis Sevillano the evolution of the disease does not have an easy explanation if we take as its origin a biological agent, in this case a virus. On the other hand, everything is much more transparent if the chronology of an irradiation is taken into account.

As for the chronic phase, it is not yet known. There is talk of pulmonary fibrosis. Pulmonary fibrosis is described in all radiotherapy irradiation conditions as radiation pneumonitis. Symptoms are fever, dry cough, and shortness of breath. This sequel can appear after months or even years.

This investigation should not fall on deaf ears, and someone should get down to business to dispel any shadow of doubt. The doctor is waiting for more doctors to come together to establish future protocols for new outbreaks. Now, personally, I still believe that the 5G network is closely linked to the Covid and that they are part of the same plan, and the same are the famous chemtrails, which nobody talks about. Everything is in HAARP, which only a few “crazy” know. It is perfectly compatible with the electromagnetic bombardment that, supposedly, would be emitting from the “old” antennas. You have to get to the bottom of this. It is very worrying that they are giving us a hoot, which is to say that the health system may be passing radiological pictures through viral pictures. For this, many accomplices are needed and we would no longer be talking about ignorance, but about betrayal of the citizens. Doctors of the world, do not consist of this!

¿Te acuerdas de un invierno sin un resfriado común?

Reflexiones sobre la crisis del coronavirus y cómo seguir adelante a partir de ahora.

Dr. Daniel Jeanmonod

En el contexto de la actual ola de pánico mundial del COVID-19 abrumadora, este texto tiene como objetivo proporcionar, sobre una base científica diferenciada, una visión diferente de la crisis del coronavirus que la que todavía se presenta de manera predominante en los principales medios de comunicación y es utilizada por muchos gobiernos. y sus expertos para mantener las medidas de protección impuestas a poblaciones enteras.

Se presentarán tanto datos científicos como propuestas basadas en ellos, reuniendo lo que muchos científicos, médicos, economistas y abogados ya han afirmado en los últimos meses. La ola de pánico y el posterior alarmismo no han permitido hasta hoy que estas voces se escuchen lo suficiente. La presente contribución específica se referirá al papel potencialmente nocivo e incluso fatal de las emociones en el contexto de la pandemia de COVID-19.

El Dr. Joel Kettner, profesor de Ciencias de la Salud Comunitaria en la Universidad de Manitoba y Director Médico del Centro Internacional de Enfermedades Infecciosas declaró en marzo de 2020 :

Nunca había visto nada como esto… no hablo de la pandemia, porque he visto 30 de ellas, una cada año… Pero nunca he visto esta reacción, y estoy tratando de entender por qué… ”

El Dr. David Jones declaró recientemente, con respecto a la crisis de la corona, en el New England Journal of Medicine :

La historia sugiere que, en realidad, corremos un riesgo mucho mayor de tener miedos exagerados y prioridades fuera de lugar ”.

Los virus del resfriado común invaden el planeta cada año causando múltiples “pandemias” anuales predominantemente benignas (usando como el Dr. Kettner el término pandemia para definir una distribución viral mundial, sin considerar su peligrosidad). De hecho, producen, en una gran mayoría ( hasta el 99,5% ) de sus infecciones, síntomas leves o nulos como dolor de garganta, secreción / congestión nasal, tos, estornudos o dolor de cabeza.

Representan la enfermedad infecciosa humana más común, los adultos suelen tener dos o tres infecciones por año y los niños incluso más. Están implicados más de 200 tipos de virus, los principales son rino, corona, adeno y enterovirus, así como influenza, parainfluenza, sincitial respiratorio humano y metapneumovirus. Pueden volverse peligrosos principalmente para personas frágiles, enfermas y ancianas, y su letalidad puede llegar hasta el 8% en los hogares de ancianos ( Ioannidis ).

Al igual que el virus de la influenza, mutan regularmente para contrarrestar la protección obtenida por la población humana gracias a su inmunización. Los virus del resfriado común y la influenza producen infecciones del tracto respiratorio (ITR), que son fatales para 2,6 millones de seres humanos por año en todo el mundo ( Roussel ).

LA PANDEMIA DE COVID-19

Algunas epidemias o pandemias virales del resfriado común (y la gripe) son más fuertes que otras. Duran al menos dos meses, subiendo, estabilizándose y retrocediendo espontáneamente. El episodio pandémico COVID-19 tiene como origen el virus SARS-CoV-2, la última mutación corona. En muchos puntos, obedece a las características típicas de las infecciones por resfriado común.

Por ejemplo, en Italia, el 95% de las muertes ocurrieron en pacientes que padecían de una a tres o más morbilidades preexistentes, y la edad media de los pacientes fallecidos era de 82 años . Esta edad media de mortalidad está muy cerca de la esperanza de vida media de los países desarrollados, por ejemplo, europeos (83,6 años para Suiza).

Muchos estudios han indicado recientemente que al menos el 80% de las infecciones por COVID-19 son de hecho asintomáticas, lo que lleva a una tasa final de letalidad por infección corregida (IFR) de entre 0,1 y 0,2% . Esto es comparable a una pandemia de gripe.

INMUNIDAD Y LA “SEGUNDA OLA”

Recientemente, ha surgido la evidencia de que la respuesta inmunológica del organismo humano sigue al menos 4 mecanismos, tres usando anticuerpos y un cuarto un tipo de linfocito, la célula T. Boyman y sus colaboradores estiman que los porcentajes publicados de presencia de anticuerpos positivos en varias poblaciones se pueden multiplicar por 5 (por ejemplo, un resultado del 15% equivale a una inmunización de la población del 60%).

Esto va bien con la evidencia presentada anteriormente de un gran número de infecciones con pocos o ningún síntoma, y ​​representa un porcentaje capaz de proporcionar la denominada inmunidad colectiva.

También se está acumulando firmemente más evidencia de que las inmunizaciones cruzadas entre diferentes cepas corona son frecuentes, de modo que los seres humanos ya infectados anteriormente por otra cepa corona estarán protegidos contra el riesgo de contraer una forma grave e incluso podrían permanecer asintomáticos (ver aquí , aquí , aquí y aquí ).

Esto puede explicar la gran cantidad de formas benignas o incluso asintomáticas en los niños, que comparten sus cargas de virus de manera frecuente y eficiente gracias a sus comportamientos de juego e interacción cercanos.

El hecho de que se pueda desarrollar una cantidad suficiente y eficiente de inmunidad colectiva en la población humana actual encaja bien con la presencia de curvas completas de número de muertes diarias (número de muertes por día) del episodio epidémico de COVID-19 en un gran número de países. De hecho, las curvas de número de muertes diarias han comenzado su regresión desde principios de abril en muchos países del mundo.

Estas curvas manifiestan la dinámica típica de los sistemas biológicos autoorganizados en desequilibrio, desarrollados en este caso entre la población humana y un virus [ 1 ]: la población humana reacciona inmunizando contra el virus, que para su próxima invasión desarrolla una mutación que permite para colonizar nuevamente los organismos humanos.

Para seguir teniendo nuevos huéspedes humanos, tiene sentido que el virus sea letal solo para una pequeña proporción de ellos y mute para contrarrestar la inmunización colectiva humana. Como se mencionó en la Introducción, los virus del resfriado común están continuamente presentes entre nosotros, con fluctuaciones estacionales, y las pruebas positivas recolectadas hoy bien pueden representar la cantidad de presencia viral estacional (ver más abajo).

Las mutaciones y propagaciones virales, así como la inmunización de la población humana, son parte de nuestra realidad biológica planetaria desde que sabemos. La inmunidad obtenida actualmente permite constatar que la mutación corona del SARS-CoV-2 es ahora bien conocida por la población humana, eliminando así el riesgo de una “segunda ola” severa, perfilada repetidamente estos días.

La temerosa expectativa de una “segunda ola” tan severa descansa en la historia de la gripe española: no hay base para una comparación adecuada entre entonces y hoy: en ese momento, no había antibióticos, y la gripe, peor que el resfriado común virus, mata las células de la mucosa, abriendo los tejidos pulmonares a la agresión de bacterias, con estimaciones de hasta el 97% de las muertes en 1918 causadas por sobreinfecciones bacterianas [ 2 ].

Para cuestionar aún más este temor de la “segunda ola”, hay evidencia de la presencia de otra epidemia viral entre las dos guerras mundiales, que causó una infección cerebral y proporcionó una explicación adicional para la presencia de más de un pico.

PRUEBAS POSITIVAS

El recuento de pruebas de PCR positivas, que se presentan regularmente en los medios y que los políticos utilizan actualmente para reinstalar medidas, no es un marcador adecuado para tal fin. Debe usarse solo para contextos de diagnóstico basados ​​en pacientes.

Como se describió anteriormente, los virus del resfriado común están presentes todos los años en la población humana, con máximos invernales. Como hasta hace poco no han recibido mucha atención por parte de virólogos y epidemiólogos, no tenemos idea de cómo se distribuyen exactamente y fluctúan a lo largo de todo el año.

Por lo tanto, no disponemos de datos de referencia o de normas sobre la situación habitual para compararlos con las pruebas positivas registradas ahora: no hay forma de afirmar que los datos actuales sean normales o anormales. Por lo tanto, carece de base científica para introducir la obligación de usar máscaras en diferentes actividades al aire libre y al aire libre, particularmente en un momento en que muchos países presentan una curva de mortalidad diaria completa.

El número de pruebas positivas, que depende directamente del número de pruebas que se realicen, nunca debe utilizarse, sino solo el porcentaje de pruebas positivas. Por el momento, por ejemplo, el porcentaje de pruebas positivas en Suiza es del 3,1% .

Este pequeño porcentaje comprenderá, además de las infecciones activas, una serie de falsos positivos de la prueba de PCR (resultados erróneamente positivos de la prueba), pruebas positivas por reacción a fragmentos virales no infecciosos residuales y otras adicionales debidas a la reacción cruzada con otras cepas corona. .

Como mencionó recientemente el Prof. Gupta , solo la tasa de mortalidad (dada por las cifras de muertes diarias y por el exceso de mortalidad de la población) es realmente relevante para monitorear una situación pandémica. Usar pruebas positivas para hacer esto representa un enfoque científicamente poco sólido. Un enfoque que mantiene una activación permanente de amenaza y miedo en la población.

ESTRÉS, PÁNICO Y EXCESO DE MORTALIDAD

Al igual que otros virus, incluido el virus de la influenza, la infección por coronavirus puede activar, en un pequeño porcentaje de personas infectadas, una sobrerrespuesta inflamatoria e inmunológica (autoinmune), denominada “tormenta de citocinas”. Éste puede conducir a daños transitorios o potencialmente mortales en los tejidos de los pulmones , y es el mecanismo que origina diferentes trastornos autoinmunes.

En experimentos con animales, se ha demostrado que el estrés activa la muerte celular en el cerebro límbico (conductual / emocional) (ver aquí , aquí y aquí ).

En los seres humanos, hay evidencia firme de que los correlatos de estrés con la aparición de muchas enfermedades [ 3 ] [ 4 ] [ 5 ], incluyendo auto-inmunes queridos .

Un cerebro humano emocional estresado (paralímbico) puede volverse hiperactivo , alterar los tejidos corporales y causar la muerte celular a través de sus múltiples vías de salida.

Estos pueden activar mecanismos excitotóxicos, oxidativos, autoinmunes, inflamatorios, endocrinos y vegetativos. Por lo tanto, las emociones humanas negativas como el miedo, la tristeza y la ira están en condiciones de poner en peligro la salud humana, hasta un nivel fatal . Esto ha sido descrito en el campo de la antropología a través de la descripción de la evolución potencialmente fatal después de la práctica chamánica de los hombres kurdaitcha llamada “señalar el hueso” . Consiste en señalar a la víctima un hueso ritual que activa una letal “lanza del pensamiento” que le induce a la muerte, sin gran sufrimiento, durante días o semanas.

Este ritual puede haber servido a los hombres kurdaitcha a lo largo de los milenios cuando un miembro de su comunidad se volvía peligroso. El poder de una idea y su emoción relacionada, es decir, el miedo y la convicción de la necesidad de morir, se ejemplifica aquí de la manera más impresionante.

También se pueden citar, entre muchas otras enfermedades basadas en el estrés, la miocardiopatía por estrés de Takotsubo o síndrome del corazón roto.

Una integración del factor psicoemocional, tan importante en la medicina humana en general, se vuelve inmensamente relevante en el contexto de la crisis de la corona: las evoluciones dramáticas hasta fatales (ver más abajo) deben ser consideradas como causadas por el aislamiento social y las medidas de confinamiento que conducen a la reducción / supresión de la libertad democrática y los derechos y actividades humanos básicos. Aquí se proponen tres factores para co-influir directamente en la cantidad de casos críticos y muertes:

  1. el nivel de referencia de ansiedad en una población humana determinada
  2. la supresión de la libertad mediante la limitación de los derechos humanos democráticos
  3. la supresión de interacciones humanas básicas mediante el aislamiento y el confinamiento.

La ruptura de los lazos sociales es un problema grave para todas las sociedades de primates, y en los primates no humanos, el aislamiento en sí mismo puede conducir a la muerte.

El análisis de la mortalidad de una población con el objetivo de comprobar si existe el llamado exceso de mortalidad, permite documentar si una determinada epidemia es particularmente peligrosa y, por lo tanto, provoca una tasa de muertes inusual. En algunos países o regiones, efectivamente se han registrado picos de mortalidad excesiva, que han retrocedido por completo desde mediados de mayo .

Tenemos que integrar que un porcentaje del exceso de mortalidad secundaria relacionado con el COVID-19 se deberá 1) al estrés, principalmente miedo y pánico, asociado a la amenaza de pandemia, pero también 2) a las consecuencias del bloqueo general aplicado y medidas de aislamiento.

Solo por mencionar algunos: desestabilización psicosocial y económica con aumentos de violencia, estados ansio-depresivos y suicidios, descompensación de la fragilidad de la salud por aislamiento social, desestabilización de individuos psiquiátricos y dementes, reducción de la atención médica a toda la población (principalmente en el dominios de la atención del cáncer y los trastornos cardiovasculares) y la reducción de la calidad de la atención en los hogares y hospitales.

Después de haber sobrecargado hospitales y consultorios médicos, la gente los rehuía y se mostraba reacia a visitarlos, se quedaba en casa y corría el riesgo de evoluciones peligrosas y muerte sin las intervenciones terapéuticas adecuadas.

Además, los gobiernos bloquearon los tratamientos electivos y las intervenciones en los hospitales, con el riesgo de una mayor morbilidad y mortalidad. Estudios recientes indican una mayor mortalidad de la técnica de intubación, que inicialmente fue promulgada ampliamente por los médicos chinos, en comparación con el suministro mucho menos drástico de oxígeno mediante máscara o tubo nasal . El bloqueo general impidió también una optimización de la protección de los asilos de ancianos, donde, como se esperaba, ocurrieron la mayoría de las muertes.

Se puede esperar que el exceso de mortalidad como consecuencia de las medidas de bloqueo general , ya en la actualidad , esté en el rango de los 100 mil (por ejemplo, entre muchos otros, 10,000 muertes adicionales por demencia no causadas por COVID en el Reino Unido).

Se deben hacer dos últimos comentarios sobre la letalidad / exceso de mortalidad de COVID-19:

  1. En muchos países se han implementado diferentes métodos de certificación cuestionables hasta totalmente inadecuados (por ejemplo, certificados de defunción COVID-19 basados ​​en sospecha, sin pruebas ni autopsias), lo que ha dado lugar a valores de letalidad inapropiadamente altos.
  2. un análisis italiano ha demostrado que 88% de todas las muertes atribuidas al virus SARS-CoV-2 ocurrió de hecho en presencia de, pero no debido a que, por lo tanto las expresiones a morir de o a morir con el virus.

Aquí hay que integrar un contexto multicausal que conduce a un problema fatal, siendo el virus la gota de agua que hace que el jarrón se desborde [ 6 ] para personas frágiles, enfermas y ancianas, debido a condiciones premórbidas, combinaciones virales 46 y sobreinfecciones bacterianas [ 2 ].

ENCIERRO, DISTANCIAMIENTO Y AISLAMIENTO

Las medidas generales de confinamiento / encierro y aislamiento han llevado a la distribución mundial por los medios de imágenes y situaciones aterradoras, por ejemplo, familias chinas encerradas (¡con pernos y tornillos!) En sus apartamentos, calles muertas de Wuhan barridas con desinfectantes, pacientes rodeados de extraterrestres. médicos y enfermeras totalmente enmascarados y disfrazados, control policial que mantiene el cierre total de las aldeas del norte de Italia, etc.

Cualquier ser humano llevado a la unidad de cuidados intensivos y al darse cuenta de que ya no es libre para dejar toda esta pesadilla, para volver a casa con su familia, experimentó sin ninguna duda el peor estrés emocional posible: estar atrapado indefenso en una vida. -Situación amenazante.

El miedo a no sobrevivir, la soledad desesperada y el pánico invaden el cerebro emocional, los mecanismos de defensa caen y pueden abrir el camino a una infección viral en toda regla potencialmente mortal . El confinamiento puede aumentar además la vulnerabilidad del organismo humano a nuevos patógenos, como pudo haber sido el caso del confinamiento de guerra al final de la Primera Guerra Mundial durante el desarrollo de la pandemia de gripe de 1918 .

La evidencia de la relevancia y la eficiencia muy parcial de las medidas generales de confinamiento la proporciona la ausencia de un mayor número de muertos experimentado por Suecia, que tiene una tasa de mortalidad incluso más baja que países como el Reino Unido y España, donde estas medidas se aplicaron en gran medida.

La aplicación de medidas generales de distanciamiento y confinamiento conduce inevitablemente a una gran cantidad de decisiones cuestionables o incluso inmanejables. El tema de la adopción de medidas más o menos estrictas crea inevitablemente fracturas dentro de los grupos sociales.

Peor aún, diferentes medidas, que tienen un mínimo o incluso ningún sentido, han sido impuestas por los estados y empujadas por personas y grupos temerosos, invadiendo la libertad democrática y los derechos humanos básicos. Es evidente que no es deseable que la gente se vea limitada, controlada o amenazada por el gobierno que ha elegido.

Un ejemplo de una medida de bloqueo cuestionable son los cierres de escuelas. Esta medida no está basada en evidencias, es decir, no hay ningún estudio científico disponible que demuestre su eficacia, se ha introducido de un país a otro porque otro país lo había hecho antes.

Dejar que los niños interactúen en la escuela y en el patio de recreo (y dejar que los adultos activos trabajen y también interactúen) puede verse como la mejor manera de promover la inmunidad colectiva, que debe desarrollarse lo más rápido posible para reducir el tiempo de exposición de las personas mayores, frágiles y enfermas. .

Por casualidad y lo que es más importante, los niños y los adultos activos sanos tienen un riesgo absolutamente mínimo de estar en peligro por el SARS-CoV-2 . Por tanto, existen sólidas razones para dudar de la utilidad de la introducción de esta medida e incluso para considerarla contraproducente.

Encerrar a las personas en el interior y cerrar los espacios públicos y naturales, especialmente los parques de las ciudades, son medidas sin sentido: el contacto con la naturaleza y el aire puro y los movimientos son tan imprescindibles como ir al trabajo, son de suma importancia para la salud de todos, optimizando las defensas corporales contra las agresiones. Se ha exigido a la gente que mantenga la distancia en las calles, pero no se confiaba en que hiciera lo mismo en los parques o en las playas, donde había más espacio para mantener la distancia.

Encerrar a las personas en el interior ha sido una medida sin sentido y deletérea, y uno puede preguntarse cómo los habitantes de las grandes ciudades podrían enfrentarlo. Se ha escuchado de las experiencias de personas mayores encerradas en sus habitaciones en hogares de ancianos, recibiendo su comida frente a su puerta cerrada en ausencia del proveedor, y visitas de familias que se asemejan a una visita a la cárcel …

La supresión / limitación del acceso a los dominios médico y espiritual fue totalmente inapropiada, perjudicial e inhumana. No respetó los derechos humanos básicos del cuidado del cuerpo, la mente y el alma. No solo los pacientes con COVID-19, sino también todos los demás pacientes hospitalizados por otras razones, no pudieron obtener sus visitas.

En general, pero particularmente en medio de una crisis, el apoyo de los seres queridos satisface las necesidades sociales y espirituales que nunca deben ser tocadas o retiradas, corriendo el riesgo de alienar al ser humano de su entorno vital psicosocial y espiritual.

¿Por qué un familiar cercano que lo visita no puede aplicar las mismas precauciones de seguridad en el hospital que el personal médico? Y los servicios religiosos podrían haberse realizado con las mismas recomendaciones a distancia que para otras sesiones civiles, que se han mantenido por considerarse indispensables.

Las medidas generales de confinamiento, debido a su peligrosidad psicosocial, deben mantenerse solo en el contexto de una letalidad epidémica excepcionalmente alta. Ahora que está claro, al contrario de lo que ha propagado la OMS, que no estamos ante un virus asesino con una tasa de letalidad del 3,4% y, por tanto, 30 veces más mortal que la gripe, estas medidas impuestas deberían abandonarse por completo.

Obviamente, el aislamiento de las personas enfermas y las medidas habituales de precaución o aislamiento para reducir la transmisión viral alrededor de las personas ancianas, enfermas y frágiles siguen siendo relevantes como siempre.

Vista en el plano ético, la crisis de la corona resalta el hecho de que cualquier limitación considerada del derecho a la autodeterminación, la libertad y los derechos humanos básicos debería basarse en un análisis multidisciplinario sólido, profundo, abierto y equilibrado, con un claro positivo. relación riesgo / beneficio. Tendría que ser presentado a la gente y votado.

Con la crisis de la corona, hemos acumulado, en ausencia de tal análisis, daños colaterales severos, con medidas aplicadas contra una amenaza que no las justificaba.

SEGUIMIENTO DE CONTACTOS

El seguimiento de las personas infectadas puede cuestionarse tanto desde el punto de vista ético como desde el de la eficiencia.

Primero, el control de la población en sí mismo representa una brecha inaceptable en la esfera privada de los ciudadanos, y todo grupo humano debe defenderse de cualquier intento de limitar su libertad democrática.

En segundo lugar, la rapidez con la que los países europeos, por ejemplo, perdieron la pista de la cadena desde los “pacientes 1” en adelante, subraya una propagación viral extremadamente rápida y eficiente bien conocida, cuestionando la posibilidad de detenerla rastreando virus y portadores en la población humana.

Esto sucedió en el norte de Italia en cuestión de uno o dos días ya pesar de las medidas de confinamiento muy rápidas y extensas. Se han mencionado muchos ejemplos adicionales en los que no se pudieron encontrar explicaciones para la transmisión viral. Al igual que para las medidas de confinamiento (ver arriba), tal rastreo solo debería ser considerado en el caso de alta peligrosidad, ausente para COVID-19.

Finalmente, la OMS no recomienda el rastreo de contactos en el manejo de epidemias de influenza .

CIENCIA, POLÍTICA Y MEDIOS

En el campo mundial intensivo y extenso de la crisis de la corona, es fundamental un estudio abierto, profundo, cuidadoso, multidimensional y, por lo tanto, imparcial de toda la situación con presentación de pros y contras y análisis de balance de riesgo / beneficio.

Esto no se proporcionó y no se han proporcionado diálogos abiertos entre diferentes puntos de vista de la situación. Los expertos científicos y médicos, principalmente microbiólogos y epidemiólogos, son los que brindan información relevante a los políticos. Tendrán que darse cuenta de que han tenido en sus manos el poder de modular el estado mental de todo el planeta humano, activando una poderosa reacción en cadena mundial de miedo y pánico.

Los medios tienen y aún transmiten una cantidad muy dominante de información que activa el pánico y mantiene el miedo en toda la población humana. Los hechos de la corona se distorsionan continuamente, números sacados del contexto epidemiológico habitual para inducir miedo.

La amenaza se ha mantenido hasta el día de hoy sobre la inminente posibilidad de reinstalaciones impuestas de medidas de protección, aislamiento y confinamiento y ampliamente retransmitida por los principales medios de comunicación, consolidando un estado de expectación temerosa y de amenaza y fatalidad a largo plazo. Ahora el pueblo debe quedar en paz y debe recuperar su autodeterminación.

Ha habido muy poco debate sobre el tema de la ética en relación con las limitaciones de la libertad, la libre determinación y los derechos humanos básicos. Recientemente, por ejemplo en Alemania y en nuestro país, los movimientos populares y políticos han comenzado a levantarse contra el insidioso riesgo para la democracia de una dictadura de salud impuesta por el estado.

Algunos epidemiólogos que gozan de posiciones de poder como asesores estatales han perfilado repetidamente pronósticos de muerte catastrófica, basándolos en modelos digitales y, afortunadamente, en gran medida más allá de la realidad biológica. En nuestro país, los pronósticos se produjeron efectivamente con un número de muertos entre 22.000 y 60.000 con pico en junio o julio , mientras que hasta el día de hoy el número de muertos en Suiza se sitúa entre 1.700 y 1.800.

Evidentemente, se han aplicado postulados de modelos cuestionables e incluso erróneos, pero estos expertos no parecen estar preparados para reconocer sus errores, con sus devastadoras consecuencias a nivel mundial.

En diferentes países se ha desarrollado un episodio preocupante relacionado con el tratamiento del COVID-19 con el fármaco hidroxicloroquina (HCQ), conocido desde hace años en el tratamiento de la malaria. Es muy interesante y probablemente directamente relevante que esta molécula haya sido reconocida desde hace años como eficaz también contra enfermedades autoinmunes (ver arriba). Al principio, colegas chinos , franceses ( dos veces ), alemanes y estadounidenses (nuevamente, dos veces ) han tratado a pacientes con COVID con HCQ y han publicado sus resultados positivos.

La evidencia de que el tratamiento con HCQ puede reducir la tasa de mortalidad hospitalaria está creciendo de manera constante , lo que plantea una pregunta central sobre la resistencia o incluso la prohibición de usar esta opción de medicación en algunos países.

Por ejemplo, un gobierno europeo y sus expertos, insistiendo en la necesidad de esperar estudios sólidos basados ​​en evidencia pero sin considerar la urgencia de la situación, prohibieron la prescripción de HCQ por parte de los médicos. Esto fue respaldado por un estudio en The Lancet, que afirma no solo la ausencia de beneficio con la ingesta de HCQ, sino también un aumento de las complicaciones cardíacas y una mayor mortalidad . Pronto, se presentó la evidencia de que esta publicación era fraudulenta y tuvo que ser retractada.

Aquí se deben hacer dos observaciones muy preocupantes:

1) se cuestiona la ética de publicación de grupos médicos y científicos que reclaman el más alto nivel de calidad científica, y

2) los gobiernos, al prohibir la prescripción de HCQ, han bloqueado la relación paciente-médico, éticamente fundamental e intocable.

Los expertos políticos y médicos se han presentado aquí bajo la peor luz posible. También debe destacarse que la disponibilidad actual de un medicamento de bajo costo contra el SARS-CoV-2 muestra todo el tema de la vacunación bajo una luz diferente, dejando tiempo para realizar una investigación adecuada hacia una vacunación segura y eficiente para personas frágiles, enfermas y ancianas, simplemente en cuanto a la gripe. De hecho, la letalidad de COVID-19 no implica ningún requisito para una vacunación de amplio espectro.

No es una locura preguntarse por un posible brote de SARS-CoV-2 en un laboratorio, ya que se han considerado posibles manipulaciones de laboratorio o errores de contención para la gripe porcina o incluso afirmados para la gripe aviar y la primera mutación corona del SARS60.

Es el papel de los expertos científicos y políticos descubrir y suprimir cualquier investigación sobre virus que pueda dar lugar a nuevas cepas potencialmente peligrosas, y la OMS debería hacer cumplir ese control en todo el mundo. Además, las reflexiones sobre el cuidado y el mantenimiento de los animales en todo el mundo son muy relevantes.

PROPUESTAS PARA HOY Y MAÑANA

El miedo y el pánico por el COVID-19, avivado por comunicaciones científicas inexactas se extendieron por todo el planeta como un incendio forestal, provocando el caos que observamos todos los días en las noticias. La crisis de la corona ha sacado a la luz que el planeta humano tiene actualmente un alto nivel de ansiedad y debe ser tratado con delicadeza, ¡como un paciente humano en una fase sensible de su vida!

Sobre la base de los datos mencionados anteriormente, se puede afirmar que la pandemia de COVID-19 debería haberse tratado desde el principio como una pandemia de gripe habitual, con protección centrada en los frágiles, enfermos y ancianos, que habrían exigido y recibido los medidas de protección para sí mismos, pero sin obligaciones contraproducentes y limitación de sus actividades y libertad.

Las personas ancianas y debilitadas pueden exigir en cualquier momento medidas de aislamiento voluntarias de su entorno familiar, social y de enfermería. Los hogares de ancianos deben tener máscaras y desinfección de manos a disposición del personal y las familias, si los residentes desean protección. Los miembros del personal no deben trabajar en más de una casa. Se debe inducir a los residentes a salir y caminar (¡por ejemplo, en los parques de la ciudad que se mantienen abiertos!).

La restricción de la libertad y el aislamiento impuestos son inhumanos, contraproducentes y hasta letales para los residentes ancianos y debilitados. En Alemania, ciudadanos alemanes de entre 64 y 78 años dirigieron una petición a la Sra. Merkel, exigiendo autodeterminación y elección en temas relacionados con el final de la vida, y reclamando su preferencia por una muerte digna en medio de sus seres queridos. en lugar de un fallecimiento aislado y despiadado impuesto por el estado.

La propuesta aquí no es extender reproches sobre las medidas tomadas abruptamente y bajo una enorme presión por parte de los gobiernos durante los primeros dos o tres meses del desarrollo de la pandemia. Sin embargo, con los datos disponibles hoy y de hecho concluyentes al menos desde mayo, debe tenerse en cuenta que las medidas generales de confinamiento, aislamiento, distanciamiento y localización deben detenerse en todos los países donde se ha superado el pico de muertes diarias.

Las medidas generales de bloqueo contra COVID-19 ya han contribuido al exceso de mortalidad experimentado en diferentes países y discutido anteriormente. Mantenerlos sería inútil y perjudicial. Los niños y los adultos que trabajan deben interactuar para que la población humana obtenga lo antes posible una inmunidad colectiva suficiente, protegiendo así a los ancianos y frágiles.

La salida progresiva del encierro es una trampa emocional: regocijarse de que las cosas vuelvan a ser más normales se opone constantemente a la ansiosa expectativa de que el desbloqueo sea demasiado rápido, a pesar de la tranquilizadora evidencia científica mencionada anteriormente.

Los medios de comunicación deben transmitir información de todos los entornos y tendencias posibles. Sin embargo, han proporcionado a la población mundial una avalancha de información sesgada homogéneamente que mantiene el mensaje dominante que activa el pánico sobre una supuesta peligrosidad alta del COVID-19.

Con suerte, pronto recibirán el mensaje de no ejercer presiones sobre los políticos en el futuro, y de ser profundamente conscientes de que pueden contribuir a la activación mundial de poderosos mecanismos ansiogénicos, si no proporcionan información equilibrada de fuentes controladas.

Una “nueva normalidad” para nuestro futuro solo puede tener sentido si se centra en una comprensión más profunda de la dinámica integradora entre nosotros y los virus.

Como los virus necesitan que existamos, y como los procesos de la vida siempre parecen tener sentido, podemos considerar que la pesadilla del virus asesino planetario global seguirá siendo objeto de interés para los productores de películas y los aficionados a las emociones fuertes. De hecho, no hay forma de que podamos concebir la vida sin virus. Están en todas partes, alrededor del 50% de nuestro propio genoma es de origen viral, y bien pueden ser “más amigos que enemigos” [ 7 ].

Nuestro principal enemigo es el miedo activado por una ciencia sesgada y despiadada, por los medios propagandistas y por políticos temerosos. Las pandemias más antiguas, que son la fuente de profundos recuerdos de la plaga atávica, se debieron en la mayoría de los casos a bacterias y estaban estrechamente relacionadas con las precarias condiciones de vida humana.

La única pandemia viral catastrófica fue la gripe H1N1 de 1918, que mató a millones de personas, pero se desarrolló en las caóticas y malsanas secuelas de la Primera Guerra Mundial. El pánico no es una forma apropiada, ni siquiera factible, de integrar nuestra vida con los virus.

Traería un futuro lleno de temor por la próxima pandemia y la desestabilización del entorno psicológico y económico humano en todo el mundo. Un cambio de actitud profundo y definitivo debe suscitarse ahora en los contextos científicos y sociopolíticos adecuados, para evitar un futuro tan sombrío e indeseable.

8 MENSAJES PARA LLEVAR A CASA

1. Los virus corona son uno de los agentes virales del resfriado común que, al igual que la gripe, invade cada año todo el planeta. Causan pandemias anuales de infecciones del tracto respiratorio ampliamente generalizadas, en su mayoría benignas.

2. COVID-19, la infección causada por el SARS-CoV-2, la actual mutación corona, no es más letal que la gripe, con una tasa de mortalidad por infección del 0,1% al 0,2%.

3. Una inmensa mayoría (95%) de las evoluciones fatales ocurren en personas ancianas y frágiles con premorbilidades, con una edad promedio de muerte de 80 años o más.

4. Los estudios de anticuerpos, la inmunización cruzada con otras cepas corona y la finalización de la curva del número de muertos en muchos países son pruebas sólidas de que la población humana está desarrollando inmunidad colectiva contra el SARS-CoV-2. En este contexto, es improbable que se produzca una “segunda ola” severa de SARS-CoV-2. Más bien podemos esperar un nuevo episodio de resfriado como cada año, pero de intensidad regular o incluso débil gracias a la inmunidad colectiva ganada.

5. La prueba de PCR de la presencia de SARS-CoV-2 no proporciona ninguna evidencia de pronóstico confiable de su poder infeccioso y letalidad. El seguimiento del estado y la evolución de la pandemia viene dado únicamente por la evolución diaria de las muertes. En Suiza, como en muchos otros países, ya no existe un exceso de mortalidad atribuible a la pandemia de COVID-19. La tasa de pruebas positivas es baja (alrededor del 3%), y las pruebas tienen como siempre una tasa técnica de falsos positivos y reaccionan a fragmentos virales inactivos oa otras cepas corona.

6. Solo en un pequeño porcentaje de pacientes con COVID-19, el virus SARS-CoV-2 puede, al igual que el virus de la gripe, activar una sobrerrespuesta inmunológica e inflamatoria, causando en el peor de los casos una falla orgánica pulmonar fatal.

El estrés y las emociones como el miedo, la ira y la tristeza pueden 1) estimular esta respuesta exagerada, 2) causar la muerte celular en el cerebro emocional y 3) desencadenar en él hiperactividades deletéreas, con el resultado de daños celulares en los tejidos corporales.

Las medidas generales de aislamiento, distanciamiento y encierro, al limitar los contactos sociales, la libertad y los derechos humanos básicos, aumentan el número de muertos a través de un aumento de la desestabilización psicosocial y económica, el empeoramiento de las personas psiquiátricas y dementes y la reducción de la atención médica a toda la población. Por lo tanto, tenemos una causalidad combinada para un exceso de mortalidad de COVID-19, una parte significativa no se debe al virus SARS-CoV-2 en sí, sino a la ola de pánico mundial del COVID-19 y la introducción impuesta de medidas drásticas e inhumanas. .

7. No estamos ante el temido virus asesino planetario, a pesar del inapropiado mensaje inicial de la OMS y diferentes expertos. Los datos presentados hablan de una parada urgente de todas las medidas generales de encierro, distanciamiento y aislamiento. El mundo debería volver al enfoque apropiado y aplicado de forma rutinaria a los virus respiratorios: mantener medidas de protección óptimas para los ancianos, los frágiles y los enfermos, como todos hemos aprendido a hacer año tras año contra la gripe.

8. Los virus del resfriado común (y la gripe) son omnipresentes en el espacio (en todo el planeta) y en el tiempo (año tras año). Por tanto, son inevitables, pero afortunadamente provocan en su mayoría infecciones benignas. Solo necesitamos proteger específicamente a las poblaciones en riesgo cuando una ola viral se vuelve más fuerte de lo habitual.

Texto actualizado y ampliado a partir de la contribución “¡Piensa en profundidad, haz buena ciencia y no te asustes!”, De D. Jeanmonod, R. Jeanmonod y F. Neirynck, publicado por off-guardian.org el 7 de abril de 2020 .
Daniel Jeanmonod MD, profesor emérito de neurocirugía en la Universidad de Zürich y de fisiología y neurociencia en la Universidad de Nueva York

Referencias: –

[1] Smolin L. La vida del cosmos . Prensa de la Universidad de Oxford (1997).

[2] Raoult D. Épidémies, vrais danger et fausses alertes. De la grippe aviaire au COVID-19 . Michel Lafon (2020).

[3] Medicina holística Pelletier KR , del estrés a la salud óptima . Prensa Delacorte (1979)

[4] Pelletier KR Mind como Healer, Mind como Slayer . Allen y Unwin (1979)

[5] Simonton OC y col. Mejorarse de nuevo . Libros bantam (1978)

[6] Reiss K. y Bhakdi S. Corona Fehlalarm? Zahlen, Daten und Hintergründe . Goldegg Verlag (2020)

[7] Moelling K. Virus, más amigos que enemigos . Publicaciones científicas mundiales (2017).

https://off-guardian.org/

Al fin algo de cordura: carta de médicos y profesionales de la salud belgas sobre COVID

Nosotros, médicos y profesionales de la salud belgas, deseamos expresar nuestra seria preocupación por la evolución de la situación en los últimos meses en torno al brote del virus SARS-CoV-2. Hacemos un llamado a los políticos para que estén informados de manera independiente y crítica en el proceso de toma de decisiones y en la implementación obligatoria de las medidas corona. Solicitamos un debate abierto, donde todos los expertos estén representados sin ningún tipo de censura. Después del pánico inicial que rodeó al covid-19, los hechos objetivos ahora muestran una imagen completamente diferente: ya no hay justificación médica para ninguna política de emergencia .

La actual gestión de crisis se ha vuelto totalmente desproporcionada y causa más daño que bien.

Pedimos el fin de todas las medidas y pedimos una restauración inmediata de nuestra gobernanza democrática y estructuras legales normales y de todas nuestras libertades civiles.

Libertades civiles

‘Pedimos la restauración inmediata de nuestras libertades civiles’

‘Una cura no debe ser peor que el problema’ es una tesis más actual que nunca en la situación actual. Sin embargo, observamos que el daño colateral que ahora se está causando a la población tendrá un mayor impacto a corto y largo plazo en todos los sectores de la población que el número de personas que ahora están protegidas del corona virus

En nuestra opinión, las actuales medidas sobre el corona y las estrictas sanciones por su incumplimiento son contrarias a los valores formulados por el Consejo Supremo de Salud de Bélgica, que, hasta hace poco, como autoridad sanitaria, siempre ha asegurado una medicina de calidad en nuestro país: “Ciencia – Experiencia – Calidad – Imparcialidad – Independencia – Transparencia”. (1)

Creemos que la política ha introducido medidas obligatorias que no están suficientemente fundamentadas científicamente, dirigidas unilateralmente, y que no hay suficiente espacio en los medios para un debate abierto en el que se escuchen diferentes puntos de vista y opiniones. Además, cada municipio y provincia tiene ahora la autorización para incorporar sus propias medidas, fundamentadas o no.

Además, la estricta política represiva sobre el corona contrasta fuertemente con la política mínima del gobierno en lo que respecta a la prevención de enfermedades, fortaleciendo nuestro propio sistema inmunológico a través de un estilo de vida saludable, una atención óptima con atención al individuo y la inversión en personal de atención. (2)

El concepto de salud

En 1948, la OMS definió la salud de la siguiente manera: “La salud es un estado de completo bienestar físico, mental y social y no meramente la ausencia de enfermedad u otro impedimento físico”. (3) La salud, por tanto, es un concepto amplio que va más allá de lo físico y también se relaciona con el bienestar emocional y social del individuo. Bélgica también tiene el deber, desde el punto de vista de la suscripción de los derechos humanos fundamentales, de incluir estos derechos humanos en su toma de decisiones cuando se trata de medidas adoptadas en el contexto de la salud pública. (4)

Las actuales medidas globales adoptadas para combatir el SARS-CoV-2 violan en gran medida esta visión de la salud y los derechos humanos. Las medidas incluyen el uso obligatorio de máscarillas  (también al aire libre y durante las actividades deportivas, y en algunos municipios, incluso cuando no hay otras personas en los alrededores), el distanciamiento físico, el aislamiento social, la cuarentena obligatoria para algunos grupos y las medidas de higiene.

La pandemia predicha con millones de muertes

Al comienzo de la pandemia, las medidas eran comprensibles y contaban con un amplio apoyo, incluso si había diferencias en la implementación en los países que nos rodean. La OMS predijo originalmente una pandemia que cobraría un 3,4% de víctimas, es decir, millones de muertes, y un virus altamente contagioso para el que no se disponía de tratamiento ni vacuna. Esto pondría una presión sin precedentes sobre las unidades de cuidados intensivos (UCI) de nuestros hospitales.

Esto condujo a una situación de alarma global, nunca vista en la historia de la humanidad: el “aplanamiento” de  la curva” estuvo representado por un bloqueo que cerró a toda la sociedad y la economía y puso en cuarentena a las personas sanas. El distanciamiento social se convirtió en la nueva normalidad antes de una vacuna de rescate.

Los hechos sobre covid-19

Gradualmente, la campana de alarma fue sonando desde muchas fuentes: los hechos objetivos mostraban una realidad completamente diferente. (5, 6)

El curso de covid-19 siguió el curso de una ola normal de infección similar a una temporada de gripe. Como cada año, vemos una mezcla de virus de la gripe siguiendo la curva: primero los rinovirus, luego los virus de influenza A y B, seguidos de los coronavirus. No hay nada diferente a lo que vemos normalmente.

John Magufuli

Presidente John Magufuli de Tanzania: “Incluso la papaya y las cabras están dando resultado corona positiva”

El uso de la prueba de PCR inespecífica, que produce muchos falsos positivos, mostró un panorama exponencial. Esta prueba se apresuró a realizar con un procedimiento de emergencia y nunca se autocomprobó seriamente. El creador advirtió expresamente que esta prueba estaba destinada a la investigación y no al diagnóstico. (7)

La prueba de PCR funciona con ciclos de amplificación de material genético: cada vez se amplifica una parte del genoma. Cualquier contaminación (por ejemplo, otros virus, restos de genomas de virus antiguos) puede dar como resultado falsos positivos. (8)

La prueba no mide cuántos virus hay en la muestra. Una infección viral real significa una presencia masiva de virus, la llamada carga de virus.Si alguien da positivo, esto no significa que esa persona en realidad esté clínicamente infectada, esté enferma o vaya a enfermarse . El postulado de Koch no se cumplió (“El agente puro que se encuentra en un paciente con quejas puede provocar las mismas quejas en una persona sana”).

Dado que una prueba de PCR positiva no indica automáticamente una infección activa o infectividad, esto no justifica las medidas sociales tomadas, que se basan únicamente en estas pruebas. (9, 10)

Bloqueo

Si comparamos las oleadas de infección en países con políticas estrictas de bloqueo con países que no impusieron bloqueos (Suecia, Islandia…), vemos curvas similares. Por tanto, no existe ningún vínculo entre el bloqueo impuesto y el curso de la infección. El bloqueo no ha dado lugar a una tasa de mortalidad más baja.

Si miramos la fecha de aplicación de los bloqueos impuestos, vemos que los bloqueos se establecieron después de que el pico ya había pasado y el número de casos disminuyó. Por tanto, la caída no fue el resultado de las medidas adoptadas. (11)

Como cada año, parece que las condiciones climáticas (clima, temperatura y humedad) y la creciente inmunidad tienen más probabilidades de reducir la ola de infección.

Nuestro sistema inmunológico

Durante miles de años, el cuerpo humano ha estado expuesto diariamente a la humedad y a las gotitas que contienen microorganismos infecciosos (virus, bacterias y hongos).

La penetración de estos microorganismos se evita mediante un mecanismo de defensa avanzado: el sistema inmunológico. Un sistema inmunológico fuerte depende de la exposición diaria normal a estas influencias microbianas. Las medidas excesivamente higiénicas tienen un efecto perjudicial sobre nuestra inmunidad. (12, 13) Solo las personas con un sistema inmunológico débil o defectuoso deben protegerse mediante una higiene intensiva o un distanciamiento social.

La influenza reaparecerá en otoño (en combinación con el covid-19) y una posible disminución de la capacidad de recuperación natural puede provocar más víctimas.

Nuestro sistema inmunológico consta de dos partes: un sistema inmunológico congénito no específico y un sistema inmunológico adaptativo.

El sistema inmunológico inespecífico forma una primera barrera: piel, saliva, jugo gástrico, moco intestinal, células ciliadas vibratorias, flora comensal,… y evita la adhesión de microorganismos a los tejidos.

Nuestro sistema inmunológico puede vencer al covid 19

Nuestro sistema inmunológico encuentra naturalmente
sus defensas contra el covid-19

Si se adhieren, los macrófagos pueden hacer que los microorganismos se encapsulen y destruyan.

El sistema inmunológico adaptativo está formado por inmunidad de las mucosas (anticuerpos IgA, producidos principalmente por células en el intestino y el epitelio pulmonar), inmunidad celular (activación de células T), que puede generarse en contacto con sustancias extrañas o microorganismos, e inmunidad humoral (IgM y anticuerpos IgG producidos por las células B).

Investigaciones recientes muestran que ambos sistemas están muy enredados.

Parece que la mayoría de las personas ya tienen inmunidad congénita o general a, por ejemplo, la influenza y otros virus. Esto es confirmado por los hallazgos en el crucero Diamond Princess, que fue puesto en cuarentena debido a que algunos pasajeros murieron de covid-19. La mayoría de los pasajeros eran ancianos y se encontraban en una situación ideal de transmisión en el barco. Sin embargo, el 75% no parecía estar infectado. Entonces, incluso en este grupo de alto riesgo, la mayoría eran resistentes al virus.

Un estudio en la revista Cell muestra que la mayoría de las personas neutralizan el coronavirus mediante la inmunidad mucosa (IgA) y celular (células T), mientras experimentan pocos o ningún síntoma. (14)

Los investigadores encontraron hasta un 60% de reactividad del SARS-Cov-2 con las células T CD4 + en una población no infectada, lo que sugiere una reactividad cruzada con otros virus del resfriado (corona). (15)

Por lo tanto, la mayoría de las personas ya tienen una inmunidad congénita o cruzada porque ya estaban en contacto con variantes del mismo virus.

La formación de anticuerpos (IgM e IgG) por las células B solo ocupa una parte relativamente pequeña de nuestro sistema inmunológico. Esto puede explicar por qué, con un porcentaje de anticuerpos del 5-10%, puede haber una inmunidad de grupo de todos modos. La eficacia de las vacunas se evalúa precisamente en función de si tenemos o no estos anticuerpos. Esta es una tergiversación.

La mayoría de las personas que dan positivo en la prueba (PCR) no tienen quejas. Su sistema inmunológico es lo suficientemente fuerte. Fortalecer la inmunidad natural es un enfoque mucho más lógico. La prevención es un pilar importante, insuficientemente destacado: nutrición sana y completa, ejercicio al aire libre, sin mascarilla, reducción del estrés y contactos emocionales y sociales nutritivos.

Consecuencias del aislamiento social en la salud física y mental

El aislamiento social y el daño económico llevaron a un aumento de la depresión, la ansiedad, los suicidios, la violencia intrafamiliar y el abuso infantil. (16) Los estudios han demostrado que cuanto más compromisos sociales y emocionales tienen las personas, más resistentes son a los virus. Es mucho más probable que el aislamiento y la cuarentena tengan consecuencias fatales. (17)

Las medidas de aislamiento también han llevado a la inactividad física de muchas personas mayores debido a que se han visto obligadas a permanecer en el interior. Sin embargo, el ejercicio suficiente tiene un efecto positivo sobre el funcionamiento cognitivo, reduciendo los síntomas depresivos y la ansiedad y mejorando la salud física, los niveles de energía, el bienestar y, en general, la calidad de vida. (18) El miedo, el estrés persistente y la soledad inducidos por el distanciamiento social tienen una influencia negativa demostrada en la salud psicológica y general. (19) ¿

Un virus altamente contagioso con millones de muertes sin ningún tratamiento?

La mortalidad resultó ser muchas veces menor de lo esperado y cercana a la de una gripe estacional normal (0,2%) . (20)

El número de muertes por corona registradas, por lo tanto, todavía parece estar sobreestimado.

Número de muertos Covid-19

El número de muertos por covid-19 fue muy exagerado y sembró el pánico

Existe una diferencia entre la muerte por un corona y la muerte por otro  corona. Los seres humanos a menudo son portadores de múltiples virus y bacterias potencialmente patógenas al mismo tiempo. Teniendo en cuenta el hecho de que la mayoría de las personas que desarrollaron síntomas graves sufrieron patologías adicionales, no se puede simplemente concluir que la corona-infección fue la causa de la muerte. En la mayoría de los casos, esto no se tuvo en cuenta en las estadísticas.

Los grupos más vulnerables pueden identificarse claramente. La gran mayoría de los pacientes fallecidos tenían 80 años o más. La mayoría (70%) de los fallecidos, menores de 70 años, tenían algún trastorno subyacente, como sufrimiento cardiovascular, diabetes mellitus, enfermedad pulmonar crónica u obesidad. La gran mayoría de las personas infectadas (> 98%) no se enfermaron o apenas se enfermaron o se recuperaron espontáneamente.

Mientras tanto, existe una terapia asequible, segura y eficiente disponible para aquellos que muestran síntomas graves de enfermedad en forma de HCQ (hidroxicloroquina), zinc y AZT (azitromicina). Esta terapia aplicada rápidamente conduce a la recuperación y, a menudo, evita la hospitalización. Casi nadie tiene que morir ahora.

Esta terapia eficaz ha sido confirmada por la experiencia clínica de colegas en el campo con resultados impresionantes. Esto contrasta fuertemente con la crítica teórica (fundamentación insuficiente de estudios doble ciego) que en algunos países (por ejemplo, los Países Bajos) incluso ha llevado a la prohibición de esta terapia. Un metaanálisis en The Lancet, que no pudo demostrar un efecto de HCQ, fue retirado. Las fuentes de datos primarias utilizadas demostraron ser poco fiables y 2 de cada 3 autores estaban en conflicto de intereses. Sin embargo, la mayoría de las pautas basadas en este estudio se mantuvieron sin cambios … (48, 49)

Tenemos serias dudas sobre este estado de cosas.

En los EE. UU., Un grupo de médicos en el campo, que atienden a los pacientes a diario, se unieron en “los médicos de primera línea de Estados Unidos” y dieron una conferencia de prensa que ha sido vista millones de veces. (21, 51)

Prof. Didier Rauolt

EPIDEMIAS – Peligros reales y alertas falsas – De la gripe aviar a Covid-19

El profesor francés Didier Raoult del Institut d’Infectiologie de Marseille (IHU) también presentó esta prometedora terapia combinada ya en abril. El médico de cabecera holandés Rob Elens, que curó a muchos pacientes en su consulta con HCQ y zinc, llamó a sus colegas en una petición por la libertad de terapia. (22)

La evidencia definitiva proviene del seguimiento epidemiológico en Suiza: tasas de mortalidad en comparación con y sin esta terapia. (23)

A partir de las imágenes angustiosas de los medios de comunicación de SDRA (síndrome de dificultad respiratoria aguda), donde las personas se asfixiaban y recibían respiración artificial en agonía, ahora sabemos que esto fue causado por una respuesta inmune exagerada con coagulación intravascular en los vasos sanguíneos pulmonares. La administración de anticoagulantes y dexametasona y la evitación de la ventilación artificial, que se encontró que causa daño adicional al tejido pulmonar, significa que esta temida complicación tampoco es virtualmente fatal. (47)

Por lo tanto, no es un virus asesino, sino una afección que se puede tratar bien.

Propagación

La propagación se produce por infecciones por goteo (solo para pacientes que tosen o estornudan) y aerosoles en habitaciones cerradas y sin ventilación. Por tanto, la contaminación no es posible al aire libre. Los estudios epidemiológicos y de rastreo de contactos muestran que las personas sanas (o portadores asintomáticos sometidos a pruebas positivas) son prácticamente incapaces de transmitir el virus. Las personas sanas, por tanto, no se ponen en peligro unas a otras. (24, 25) La transferencia a través de objetos (por ejemplo, dinero, carritos de la compra o de la compra) no está científicamente probada. (26, 27, 28)

Todo esto cuestiona seriamente toda la política de distanciamiento social y mascarillas bucales obligatorias para las personas sanas; no hay base científica para ello.

Mascarillas

Las máscaras orales pertenecen a contextos donde tienen lugar contactos con grupos de riesgo comprobados o personas con problemas de las vías respiratorias superiores, y en un contexto médico / entorno de hospital-casa de retiro. Reducen el riesgo de infección por gotitas al estornudar o toser. Las mascarillas orales en individuos sanos son ineficaces contra la propagación de infecciones virales. (29, 30, 31)

Las mascarillas son ineficaces

Las mascarillas son ineficaces para el covid-19 y producen efectos secundarios nocivos para la salud

El uso de una máscara no está exento de efectos secundarios. (32, 33) La deficiencia de oxígeno (dolor de cabeza, náuseas, fatiga, pérdida de concentración) ocurre con bastante rapidez, un efecto similar al mal de altura. Todos los días vemos a pacientes que se quejan de dolores de cabeza, problemas de los senos nasales, problemas respiratorios e hiperventilación debido al uso de máscaras. Además, el CO2 acumulado provoca una acidificación tóxica del organismo que afecta nuestra inmunidad. Algunos expertos incluso advierten de un aumento de la transmisión del virus en caso de uso inadecuado de la máscara. (34)

Nuestro Código Laboral (Codex 6) se refiere a un contenido de CO2 (ventilación en los lugares de trabajo) de 900 ppm, máximo 1200 ppm en circunstancias especiales. Después de usar una máscara durante un minuto, este límite tóxico se supera considerablemente a valores que son de tres a cuatro veces superiores a estos valores máximos. Cualquiera que use una máscara se encuentra, por lo tanto, en una habitación extremadamente mal ventilada. (35)

Por lo tanto, especialistas reconocidos en seguridad no recomiendan a los trabajadores el uso inadecuado de máscaras sin un archivo completo de pruebas cardiopulmonares médicas.

Los hospitales tienen un ambiente estéril en sus quirófanos donde el personal usa máscaras y hay una regulación precisa de la humedad / temperatura con un flujo de oxígeno monitoreado adecuadamente para compensar esto, cumpliendo así con estrictos estándares de seguridad. (36) ¿

Una segunda oleada corona?

Ahora se está debatiendo una segunda ola en Bélgica, con un mayor endurecimiento de las medidas como resultado. Sin embargo, un examen más detenido de las cifras de Sciensano (último informe del 3 de septiembre de 2020) (37) muestra que, aunque ha habido un aumento en el número de infecciones desde mediados de julio, no hubo un aumento en los ingresos hospitalarios o muertes en ese momento. Por lo tanto, no se trata de una segunda ola de corona, sino de la denominada “química del caso” debido a un mayor número de pruebas. (50)

El número de ingresos hospitalarios o defunciones mostró un aumento mínimo de corta duración en las últimas semanas, pero al interpretarlo hay que tener en cuenta la reciente ola de calor. Además, la gran mayoría de las víctimas aún se encuentran en el grupo de población> 75 años.

Esto indica que la proporción de las medidas adoptadas en relación con la población activa y los jóvenes es desproporcionada con los objetivos previstos.

La gran mayoría de las personas “infectadas” con pruebas positivas se encuentran en el grupo de edad de la población activa, que no desarrolla ningún síntoma o simplemente presenta síntomas limitados, debido al buen funcionamiento del sistema inmunológico.

Así que nada ha cambiado, se acabó el pico.

Fortalecimiento de una política de prevención

Las medidas de la corona contrastan notablemente con la política mínima seguida por el gobierno hasta ahora, cuando se trata de medidas bien fundamentadas con beneficios para la salud comprobados como el impuesto al azúcar, la prohibición de los cigarrillos (electrónicos) y la elaboración de alimentos saludables, ejercicio. y redes de apoyo social económicamente atractivas y ampliamente accesibles. Es una oportunidad perdida para una mejor política de prevención que podría haber provocado un cambio de mentalidad en todos los sectores de la población con resultados claros en términos de salud pública. En la actualidad, solo el 3% del presupuesto sanitario se destina a la prevención. (2)

El juramento hipocrático

Hipócrates

Los médicos están moralmente obligados a seguir el juramento hipocrático

Como médico, hicimos el Juramento Hipocrático:

“Sobre todo cuidaré a mis pacientes, promoveré su salud y aliviaré su sufrimiento”.

“Informaré a mis pacientes correctamente”.

“Incluso bajo presión, no usaré mis conocimientos médicos para prácticas que sean contra la humanidad”.

Las medidas actuales nos obligan a actuar contra este juramento.

Otros profesionales de la salud tienen un código similar.

El ‘ primum non nocere ‘, que todo médico y profesional de la salud asume, también se ve socavado por las medidas actuales y por la perspectiva de la posible introducción de una vacuna generalizada, que no está sujeta a extensas pruebas previas.

Vacuna

Los estudios de encuestas sobre vacunas contra la influenza muestran que en 10 años solo hemos logrado tres veces desarrollar una vacuna con una tasa de eficiencia de más del 50%. Vacunar a nuestros ancianos parece ineficaz. Más de 75 años, la eficacia es casi inexistente. (38)

Debido a la continua mutación natural de los virus, como también vemos todos los años en el caso del virus de la influenza, una vacuna es a lo sumo una solución temporal, que requiere nuevas vacunas cada vez después. Una vacuna no probada, que se implementa mediante un procedimiento de emergencia y para la cual los fabricantes ya obtuvieron inmunidad legal ante posibles daños, plantea serias preguntas. (39, 40) No deseamos utilizar a nuestros pacientes como conejillos de indias.

A escala mundial, se esperan 700.000 casos de daño o muerte como resultado de la vacuna. (41)

Si el 95% de las personas experimentan covid-19 prácticamente sin síntomas, el riesgo de exposición a una vacuna no probada es irresponsable.

El papel de los medios de comunicación y el plan oficial de comunicación

En los últimos meses, los fabricantes de periódicos, radio y televisión parecían estar casi acríticamente detrás del panel de expertos y del gobierno, allí donde es precisamente la prensa la que debe ser crítica y prevenir comunicación gubernamental unilateral. Esto ha llevado a una comunicación pública en nuestros medios de comunicación, que era más una propaganda que un informe objetivo.

En nuestra opinión, es tarea del periodismo llevar las noticias de la manera más objetiva y neutral posible, con el objetivo de encontrar la verdad y controlar críticamente el poder, y los expertos disidentes también tienen un foro en el que expresarse.

Esta visión está respaldada por los códigos deontológicos periodísticos. (42)

La historia oficial de que era necesario un bloqueo, que ésta era la única solución posible y que todos estaban detrás de este bloqueo, dificultaba que las personas con una visión diferente, así como los expertos, expresaran una opinión diferente.

Las opiniones alternativas fueron ignoradas o ridiculizadas. No hemos visto debates abiertos en los medios de comunicación, donde se puedan expresar diferentes puntos de vista.

Los medios propagan el pánico

Un medio poco ético propaga el pánico y censura la información objetiva

También nos sorprendieron los muchos videos y artículos de muchos expertos científicos y autoridades, que fueron y aún están siendo eliminados de las redes sociales. Creemos que esto no encaja con un Estado constitucional democrático libre, tanto más cuanto conduce a una visión de túnel. Esta política también tiene un efecto paralizante y alimenta el miedo y la preocupación en la sociedad. En este contexto, ¡rechazamos la intención de censurar a los disidentes en la Unión Europea! (43)

La forma en que los políticos y los medios de comunicación han retratado a covid-19 tampoco le ha hecho ningún bien a la situación. Los términos bélicos eran populares y no faltaba el lenguaje bélico. A menudo se ha mencionado una “guerra” con un “enemigo invisible” que debe ser “derrotado”. El uso en los medios de comunicación de frases como ‘héroes del cuidado en primera línea’ y ‘víctimas de la corona’ ha alimentado aún más el miedo, al igual que la idea de que estamos lidiando globalmente con un ‘virus asesino’.

El implacable bombardeo con cifras, que se desató sobre la población día tras día, hora tras hora, sin interpretar esas cifras, sin compararlas con las muertes por gripe en otros años, sin compararlas con las muertes por otras causas, ha inducido una verdadera psicosis de miedo en la población. Esto no es información, es manipulación.

Deploramos el papel de la OMS en esto, que ha pedido que la infodemia (es decir, todas las opiniones divergentes del discurso oficial, incluidas las de expertos con puntos de vista diferentes) sea silenciada por una censura de medios sin precedentes. (43, 44) ¡

Hacemos un llamado urgente a los medios de comunicación para que asuman sus responsabilidades aquí!

Exigimos un debate abierto en el que se escuche a todos los expertos.

Ley de emergencia versus derechos humanos

El principio general de buena gobernanza exige sopesar la proporcionalidad de las decisiones gubernamentales a la luz de los estándares legales más altos: cualquier interferencia del gobierno debe respetar los derechos fundamentales protegidos en el Convenio Europeo de Derechos Humanos (CEDH). La interferencia de las autoridades públicas solo está permitida en situaciones de crisis. En otras palabras, las decisiones discrecionales deben ser proporcionadas a una necesidad absoluta.

Las medidas actualmente adoptadas se refieren a la injerencia en el ejercicio, entre otras cosas, del derecho al respeto de la vida privada y familiar, la libertad de pensamiento, conciencia y religión, la libertad de expresión y la libertad de reunión y asociación, el derecho a la educación, etc. , y por tanto debe respetar los derechos fundamentales protegidos por el Convenio Europeo de Derechos Humanos (CEDH).

Estado de emergencia de Covid

No hay emergencia, no debe haber violaciones de los derechos de las personas.

Por ejemplo, de conformidad con el artículo 8 (2) del CEDH, la injerencia en el derecho a la vida privada y familiar solo está permitida si las medidas son necesarias en interés de la seguridad nacional, la seguridad pública y el bienestar económico del país. , la protección del orden público y la prevención de delitos, la protección de la salud o la protección de los derechos y libertades de los demás, el texto normativo en el que se base la injerencia debe ser suficientemente claro, previsible y proporcionado a los objetivos perseguidos. (45)

La pandemia predicha de millones de muertes pareció responder a estas condiciones de crisis, lo que llevó al establecimiento de un gobierno de emergencia. Ahora que los hechos objetivos muestran algo completamente diferente, la condición de incapacidad para actuar de otra manera (no hay tiempo para evaluar a fondo si hay una emergencia) ya no existe. El Covid-19 no es un virus del resfriado, sino una afección bien tratable con una tasa de mortalidad comparable a la de la gripe estacional. En otras palabras, ya no existe un obstáculo insuperable para la salud pública.

No hay estado de emergencia. Inmenso daño causado por las políticas actuales

Una discusión abierta sobre las medidas de corona significa que, además de los años de vida ganados por los pacientes de corona, también debemos tener en cuenta otros factores que afectan la salud de toda la población. Estos incluyen daños en el dominio psicosocial (aumento de la depresión, ansiedad, suicidios, violencia intrafamiliar y abuso infantil) (16) y daños económicos.

Si tenemos en cuenta este daño colateral, la política actual está fuera de toda proporción, el proverbial uso de un mazo para romper una nuez.

Nos sorprende que el gobierno invoque la salud como motivo de la ley de emergencia.

Como médicos y profesionales de la salud, ante un virus que, en términos de nocividad, mortalidad y transmisibilidad, se acerca a la influenza estacional, solo podemos rechazar estas medidas extremadamente desproporcionadas.

  • Por tanto, exigimos el fin inmediato de todas las medidas.
  • Estamos cuestionando la legitimidad de los expertos asesores actuales, que se reúnen a puerta cerrada.
  • A raíz de ACU 2020 46 pedimos un examen en profundidad del papel de la OMS y la posible influencia de los conflictos de intereses en esta organización. También estuvo en el centro de la lucha contra la “infodemia”, es decir, la censura sistemática de todas las opiniones disidentes en los medios de comunicación. Esto es inaceptable para un Estado democrático gobernado por el estado de derecho. (43)

Distribución de esta carta

Nos gustaría hacer un llamamiento público a nuestras asociaciones profesionales y compañeros cuidadores para que den su opinión sobre las medidas actuales.

Llamamos la atención y pedimos un debate abierto en el que los cuidadores puedan y se atrevan a hablar.

Con esta carta abierta, enviamos la señal de que el progreso en pie de igualdad hace más daño que bien, y pedimos a los políticos que se informen de forma independiente y crítica sobre la evidencia disponible, incluida la de expertos con diferentes puntos de vista, siempre que sea posible. basado en ciencia sólida – al implementar una política, con el objetivo de promover una salud óptima.

Con preocupación, esperanza y a título personal [firmamos esta carta].

La locura del virus: el obvio absurdo de todo

Artículo de Gary D. Barnett

“El hombre se encuentra cara a cara con lo irracional. Siente en su interior su anhelo de felicidad y de razón. Lo absurdo nace de esta confrontación entre la necesidad humana y el irrazonable silencio del mundo ”.

Albert Camus (2012). “El mito de Sísifo: y otros ensayos”, p.28, Vintage, (ensayo filosófico de 1942 de Albert Camus)

Cuando el absurdo se convierte en la base aceptada del pensamiento de las masas, cuando el adoctrinamiento del rebaño es de naturaleza universal, y cuando la narrativa estatal de la clase dominante se toma como un hecho, entonces se completa el círculo de poder. El poder creado en esta circunstancia consume tanto que fácilmente puede superar cualquier resistencia de los pocos pensadores de la minoría. Es una situación difícil y una amenaza mortal para la sociedad.

En el caso de hoy, este escenario macabro no solo ha consumido a este país, sino al mundo entero. Solo si hubieran actuado fuerzas muy siniestras se podría haber logrado algo de esta magnitud y alcance. Esta es la razón por la que esta “pandemia” fabricada es tan peligrosa para la humanidad. Solo el miedo abrumador debido a la ignorancia y la presión social forzada de los compañeros podrían haber permitido que esta actitud de la manada se volviera tan frecuente.

Ahora nos enfrentamos a la perspectiva de una toma total tecnocrática por parte de las fuerzas siniestras que protagonizaron este golpe desde el principio. Si bien esta trama se había diseñado anteriormente y se había presentado gradualmente al público durante un largo período de tiempo, se ha implementado agresivamente este año. Algo tan grande y ominoso nunca hubiera sido posible en el pasado, pero hoy parece haber sido una tarea fácil engañar a la mayoría de las personas para que aceptaran la sumisión y, a su vez, siguieron las órdenes en una medida tan grandiosa que la totalidad de El núcleo de este país, así como la mayoría de los demás, se ha alterado horriblemente, y todo por mentira.

La naturaleza fraudulenta de esta conspiración es tan obvia que contrasta radicalmente con la realidad, pero muchos no pueden ver, o más exactamente, no quieren aceptar esta verdad. La frustración que esto trae a las personas pensantes es brutal, porque aunque se ha demostrado una y otra vez que la narrativa del estado está llena de agujeros y mentiras, es como si la ceguera total se hubiera apoderado de la sociedad en general. Esta respuesta apática está siendo adoptada debido al miedo a la verdad, pero las consecuencias de esta actitud serán fatales para muchos y peligrosas para todos menos para la clase alta.

Este llamado coronavirus, si es que existe, nunca ha sido un problema real o una amenaza para las poblaciones del mundo, no más que cualquier otra gripe normal, pero la respuesta del estado es tan mortal que podría provocar un horror generalizado que afectaría todo el mundo en el planeta. No estaría aislado de ningún país o región específicos, aunque podría ser peor en algunos lugares más que en otros, pero devastador para todos. Esta respuesta es tan extrema que podría eliminar toda la libertad de las personas en todo el mundo. Todas las personas buscan la libertad porque es una necesidad para una vida feliz y plena, pero si no se detiene esta toma de poder por parte de la clase dominante de élite, si no se detiene, nos destruirá a todos, dejando solo un páramo controlado, desprovisto de amor, cuidado, comunidad y alegría. Destruiría el espíritu humano y, por tanto, destruiría a la humanidad. Este es el futuro tal como está hoy, a menos que se produzca un despertar de proporciones enormes. ¿Aceptará la gente de este país este terrible destino o encontrará el coraje para resistir?

Mire los pasos que se están tomando en todo el mundo y comprenda que toda la tiranía y la opresión que se ven en los países individuales pronto consumirán a todos los países. Cada medida que se tome en China, en Europa, en Australia, en Asia y en otros lugares, incluidos los Estados Unidos, no estará aislada por mucho tiempo en un país u otro, sino que será la norma en todas partes. Este es el plan, y no es accidental, ya que muchas de las medidas totalitarias que se imponen a las personas en todo el mundo son pruebas para juzgar el cumplimiento y, si se implementan con éxito en un país, se transferirán a todos en el tiempo. Solo considere el comienzo de este fiasco y la aceptación por parte de las sociedades occidentales de los métodos chinos que fueron falsamente reclamados como exitosos y, por lo tanto, se dijo que eran importantes para usar en todas partes.

Esto incluyó cierres masivos, cuarentena, vigilancia, rastreo, rastreo, uso de máscaras mortales, destrucción económica en todos los niveles, excepto en los más altos, y mucho más. Todas esas cosas se pusieron en práctica en todo el mundo, incluso en los EE. UU. En ese momento, la gente en este país se burló de tal tiranía, pero muy rápidamente se engañó para que la aceptara sin cuestionarla. Todo lo que se necesitó fue el miedo a la gripe para llevar la política de China a los EE. UU. Debería ser evidente a estas alturas que todas las potencias mundiales están trabajando mano a mano para engañar a sus poblaciones para que acepten su propia esclavitud y renuncien a sus libertades debido al falso miedo. .

El Primer Ministro de Australia ayer, Scott Morrison, declaró que

“Australia debería hacer que cualquier vacuna contra el coronavirus sea obligatoria para sus 25 millones de ciudadanos y prohibir las exenciones médicas”. Esto viene con el conocimiento de que las muertes totales exageradas en Australia han llegado a solo 400 de los 25 millones de ciudadanos. Esa es una tasa de mortalidad de .000016%. ¿Alguien no ve la naturaleza increíble y ridícula de una declaración tan absurda? Obviamente, fue una táctica destinada a infundir un gran miedo en la mente de la gente para que se pueda lograr el control total. Este fue un mandato político que podría poner a prueba las aguas de la disidencia, y una vez que esa disidencia sea aplastada, el mandato podría hacerse efectivo. Cualquier vacuna en esta etapa no estaría probada y sería muy peligrosa, y además, infectaría a toda una población basándose en nada más que ganar el control de una nación. Como mencioné anteriormente, si sucede en Australia, también se intentará aquí.

A medida que se acerca el otoño, esta trama pandémica aumentará aún más de lo que hemos visto este año. Con poblaciones debilitadas aquí y en todo el mundo, las muertes por gripe serán más evidentes de lo normal, pero estas muertes nunca se atribuirán al hecho de que la respuesta del estado a este engaño ha causado la destrucción del sistema inmunológico justo a tiempo para la temporada de normalidad. enfermedad. Esto permitirá el mayor bombardeo de propaganda jamás visto en la tierra. En el apogeo de esta temporada de gripe, o antes, vacunar al mundo con una vacuna venenosa, una vacuna de ARN posiblemente (probablemente) llena de muchos ingredientes desconocidos, será la agenda principal de los monstruos que controlan la locura de este virus. No se dejará nada fuera de la mesa, ya que las órdenes draconianas masivas se transmitirán desde lo alto. Con un público mucho más asustado que se ha visto inundado por la fatalidad pandémica de la segunda ola, se eliminarán todas las paradas, ya que el estado intenta apoderarse de toda la humanidad, matando lo que queda del espíritu humano en el proceso.

Afortunadamente, ha habido un poco más de retroceso últimamente, pero esta trama es mucho más grande de lo que puede concebir una población ahora temerosa y débil. Se necesita desesperadamente más disidencia, y el incumplimiento masivo de las órdenes del gobierno es todo lo que puede evitar un apocalipsis económico de proporciones de época y la destrucción de todos los aspectos de la libertad que se hayan alcanzado.

“Decídete a no servir más y serás libre”.

“Discurso sobre la servidumbre voluntaria”. Libro de Étienne de La Boétie, 1576.

Original in English: Virus Insanity: The Obvious Absurdity of it All


 

PANDEMIA 5.0

1.0) Las muertes en Europa han caído a casi CERO.

2.0) Los MEDIOS DE COMUNICACIÓN y sus titulares de “Segunda Ola*” están contando “nuevos casos”, NO MUERTES.

3.0) Estos casos son casi todas personas jóvenes y sanas que NO presentan SÍNTOMAS.

4.0) Los POLÍTICOS están siendo irresponsables y asustando a los ciudadanos INNECESARIAMENTE.

5.0) Los CIENTÍFICOS no creen en las medidas que están prescribiendo y están rompiendo sus propias REGLAS.

“La sociedad ha aprendido que la ciencia no produce verdades últimas, sino que gracias al método científico se gestionan de manera racional, rigurosa y metódica las incertidumbres sobre la COVID-19

Ahí radica el problema, “la ciencia no produce verdades últimas”, esto es, no produce verdades. Y si no se parte de una primera verdad, por supuesto por desconocimiento, como en el caso del virus SARS-CoV-2, ya se puede racionalizar la gestión rigurosa y metódicamente, que en vez de ser incertidumbres, se convierten en errores.

* Ahora viene la “Tercera Ola” en las escuelas. Supongo que los medios de comunicación tendrán ya sus titulares preparados. Va a haber tantas olas como sean necesarias para un fin que desconozco, pero imagino.

G.R.M.

PANDEMIC 5.0

1.0) Deaths in Europe have fallen to almost ZERO.

2.0) The MEDIA and their “Second Wave *” headlines are counting “new cases”, NO DEATHS.

3.0) These cases are almost all young and healthy people with NO SYMPTOMS.

4.0) POLITICIANS are being irresponsible and scaring citizens UNNECESSARILY.

5.0) SCIENTISTS do not believe in the measures they are prescribing and are breaking their own RULES.

“Society has learned that science does not produce ultimate truths, but rather that, thanks to the scientific method, uncertainties about COVID-19

Therein lies the problem, “science does not produce ultimate truths”, that is, it does not produce truths. And if one does not start from a first truth, of course due to ignorance, as in the case of the SARS-CoV-2 virus, management can now be rigorously and methodically rationalized, which instead of being uncertainties, turn into errors.

* Now comes the “Third Wave” in schools. I guess the media will already have their headlines ready. There will be as many waves as are necessary for a purpose that I do not know, but imagine.

¿REBROTE? HAZ PCR. ASEGURADO 10-30% POSITIVOS

covid_Nada más que decir. Esto no es más que un “resfriado común” causado por coronavirus que ha mutado al igual que muta la gripe (influenza) casi todos los años. Y eso que soy analfabeto. O lo han mutado. No miréis el dedo, mirar la luna. Paralizar la economía mundial. Ellos saben por qué.

Sacado de: https://es.wikipedia.org/wiki/Orthocoronavirinae

Los coronavirus humanos fueron descritos por primera vez en la década de 1960 en cavidades nasales de pacientes con un resfriado común. Estos virus fueron nombrados posteriormente coronavirus humano 229E y OC43. Otros dos miembros de esta familia han sido identificados, el HCoV-NL63 en 2004 y HKU1 en 2005. Los cuales circulan globalmente en la población humana y causan aproximadamente un tercio de los casos de resfriado común. Al igual que otros tipos de virus pueden causar enfermedades más graves del sistema respiratorio como bronquitis o neumonía especialmente en personas con factores de riesgo, ancianos, niños y pacientes inmunodeprimidos. Además de afecciones respiratorias también pueden causar enfermedades intestinales y neurológicas.30

Existen registros de siete cepas de coronavirus relacionados con enfermedades respiratorias en humanos (HCoV):

  1. Coronavirus humano 229E
  2. Coronavirus humano OC43
  3. SARS-CoV
  4. Coronavirus humano NL63
  5. Coronavirus humano HKU1
  6. Coronavirus del síndrome respiratorio de Oriente Medio (MERS-CoV).
  7. SARS-CoV-2 (COVID-19).3132

Después de la publicación del perfil de los brotes de SARS en 2003, resucitó entre los virólogos un interés por los coronavirus. Durante muchos años, los científicos sabían de solo dos coronavirus humanos (HCoV-229E y OC43-HCoV). El descubrimiento de SARS-CoV añadió un tercer coronavirus humano. A finales de 2004, tres laboratorios de investigación independientes informaron del descubrimiento de un cuarto coronavirus humano, nombrado NL63, NL, y coronavirus de New Haven simultáneamente por varios grupos de investigación. Los tres laboratorios siguen discutiendo sobre cuál de ellos descubrió el virus en primer lugar y por tanto tiene derecho a nombrarlo. A principios de 2005, un equipo de investigación de la Universidad de Hong Kong informó del hallazgo de un quinto coronavirus humano en dos pacientes con neumonía. Lo llamaron coronavirus humano HKU1. El brote de neumonía 2019-20 en Wuhan, China, llevó al hallazgo de un coronavirus nuevo, catalogado como 2019-nCoV por la OMS.

P.D.: Los medios de comunicación convencionales funcionan a base de talonarios, no a bases de noticias que regeneran beneficios. Esto es, vivir en un piso sobre papel sin construir.

covid

REBURSEMENT? DO PCR. INSURED 10-30% POSITIVE

Nothing more to say. This is nothing more than a “common cold” caused by a coronavirus that has mutated like the flu (influenza) almost every year. And that I am illiterate. Or they have mutated it. Don’t look at the finger, look at the moon. Paralyze the world economy. They know why.

Taken from: https://es.wikipedia.org/wiki/Orthocoronavirinae

Human coronaviruses were first described in the 1960s in the nasal cavities of patients with a common cold. These viruses were later named human coronavirus 229E and OC43. Two other members of this family have been identified, HCoV-NL63 in 2004 and HKU1 in 2005. Both of them circulate globally in the human population and cause approximately one third of the common cold cases. Like other types of viruses, they can cause more serious diseases of the respiratory system such as bronchitis or pneumonia, especially in people with risk factors, the elderly, children and immunosuppressed patients. In addition to respiratory conditions, they can also cause intestinal and neurological diseases.30

There are records of seven strains of coronavirus related to respiratory diseases in humans (HCoV):

Human coronavirus 229E
Human coronavirus OC43
SARS-CoV
Human coronavirus NL63
Human coronavirus HKU1
Middle East respiratory syndrome coronavirus (MERS-CoV).
SARS-CoV-2 (COVID-19) .31 32

After the publication of the profile of the SARS outbreaks in 2003, an interest in coronaviruses was resurrected among virologists. For many years, scientists knew of only two human coronaviruses (HCoV-229E and OC43-HCoV). The discovery of SARS-CoV added a third human coronavirus. In late 2004, three independent research labs reported the discovery of a fourth human coronavirus, named NL63, NL, and New Haven coronavirus simultaneously by multiple research groups. The three labs are still arguing over which of them discovered the virus first and therefore has the right to name it. In early 2005, a research team from the University of Hong Kong reported the finding of a fifth human coronavirus in two patients with pneumonia. They called it human coronavirus HKU1. The 2019-20 pneumonia outbreak in Wuhan, China, led to the discovery of a new coronavirus, listed as 2019-nCoV by the WHO.

PS: The mainstream media works on the basis of checkbooks, not news bases that generate profits. That is, living in a flat on unbuilt paper.

Horowitz: Los CDC confirman una tasa de mortalidad por coronavirus notablemente baja. ¿Dónde están los medios?

La mayoría de las personas son más propensas a terminar seis pies bajo debido a casi cualquier otra cosa bajo el sol que no sea COVID-19.

Los CDC acaban de publicar un informe que debería ser demoledor para la narrativa de la clase política, sin embargo, entrará en la espesa pila de datos vitales e información sobre el virus que no está saliendo al público. Por primera vez, los CDC han intentado ofrecer una estimación real de la tasa global de mortalidad para COVID-19,y bajo su escenario más probable, el número es 0.26%. Los funcionarios estiman una tasa de mortalidad del 0,4% entre los sintomáticos y proyectan una tasa del 35% de casos asintomáticos entre los infectados, lo que reduce la tasa general de mortalidad por infección (IFR) a solo 0,26%, casi exactamente donde los investigadores de Stanford la fijaron hace un mes.

Hasta ahora, hemos sido ridiculizados por pensar que la tasa de mortalidad era tan baja, frente a la estimación del 3,4% de la Organización Mundial de la Salud,que ayudó a impulsar el pánico y los bloqueos. Ahora los CDC están de acuerdo con la tasa más baja en tinta simple.

Además, en última instancia, podríamos descubrir que el IFR es aún menor porque numerosos estudios y recuentos duros de poblaciones confinadas han mostrado un porcentaje mucho mayor de casos asintomáticos. Simplemente ajustar por una tasa asintomática del 50% reduciría su tasa de mortalidad al 0,2%, exactamente la tasa de fatalidad proyectadapor el Dr. John Ionnidis de la Universidad de Stanford.

Más importante aún, como mencioné antes,la tasa global de mortalidad no tiene sentido porque las cifras están tan desequilibrados. Dado que al menos la mitad de las muertes se han ejecutado en residencias de ancianos, una estimación de la parte posterior de la venta mostraría que la tasa de mortalidad por infección para los residentes de hogares que no eran enfermeras sería sólo del 0,1% o 1 de cada 1.000. Y eso incluye a personas de todas las edades y todos los estados de salud fuera de los hogares de ancianos. Ya que casi todas las muertes son aquellas con comorbilidades.

Los CDC estiman que la tasa de mortalidad de COVID-19 para los menores de 50 años es de 1 de cada 5.000 para aquellos con síntomas, que sería de 1 de cada 6.725 en general, pero de nuevo, casi todos los que mueren tienen comorbilidades específicas o condiciones subyacentes. Aquellos sin ellos son más propensos a morir en un accidente de coche. Y los escolares, cuyas vidas, salud mental y educación estamos destruyendo, son más propensos a ser alcanzados por un rayo.

Para poner esto en perspectiva, un comentarista de Twitter yuxtapuesto las tasas de mortalidad por infecciones separadas por edad en España a la probabilidad media anual de morir de cualquier cosa para los mismos grupos de edad, basándose en datos de la Administración de la Seguridad Social. Usó España porque no tenemos una estimación detallada de la tasa de mortalidad por infección para cada grupo de edad de cualquier encuesta en los Estados Unidos. Sin embargo, sabemos que España fue peor que casi todos los demás países. Estos datos en realidad están trabajando con un IFR de primera línea del 1%, aproximadamente cuatro veces lo que los CDC estiman para los EE.UU., por lo que si acaso, los números correspondientes para los EE.UU. serán más bajos.

Como se puede ver, incluso en España, las tasas de mortalidad de COVID-19 para los más jóvenes son muy bajas y están muy por debajo de la tasa anual de mortalidad de cualquier grupo de edad en un año determinado. En el caso de los niños, a pesar de su corta edad, tienen entre 10 y 30 veces más probabilidades de morir por otras causas en un año determinado.

Si bien obviamente el factor de las tasas de mortalidad anual en innumerables causas de muerte y COVID-19 es sólo un virus, todavía proporciona una perspectiva muy necesaria para una respuesta de política pública que está completamente divorciada del riesgo para todas las personas menos las más viejas y enfermas del país.

Además, tenga en cuenta, estos números representan su probabilidad de morir una vez que ya ha contraído el virus, también conocido como la tasa de mortalidad por infección. Una vez que se combina la posibilidad de contraer el virus en primer lugar junto con la posibilidad de morir de él, muchas personas más jóvenes tienen una mayor probabilidad de morir de un rayo.

Cuatro médicos de enfermedades infecciosas en Canadá estiman que la tasa individual de muertes por COVID-19 para las personas menores de 65 años es de seis por millón de personas, es decir, del 0,0006%, de 1 en 166.666, lo que equivale “aproximadamente al riesgo de morir por un accidente automovilístico durante el mismo período de tiempo”. Estas cifras son para Canadá, que tuvo menos muertes per cápita que estados Unidos; sin embargo, si sacas la ciudad de Nueva York y sus condados circundantes de la ecuación, los dos países son prácticamente iguales. Además, recuerde que gran parte de la muerte se asocia con las decisiones políticas suicidas de ciertos estados y países para colocar a los pacientes COVID-19 en hogares de ancianos. Un asombroso 62 por ciento de todas las muertes por COVID-19 se confirmaron en los seis estados, a pesar de que sólo componen el 18 por ciento de la población nacional.

Destruimos todo nuestro país y suspendimos la democracia por una mentira, y esta gente perpetraba el grado poco científico de pánico. ¿Admitirán alguna vez las graves consecuencias de su error?

https://www.greenmedinfo.com/blog/horowitz-cdc-confirms-remarkably-low-coronavirus-death-rate-where-media

Escándalo: La secuencia de la primera prueba de coronavirus PCR de la OMS se encuentra en todo el ADN humano

WHO Primer

Esto era lo suficientemente importante como para que quisiera sacarlo inmediatamente. Mi investigación en la base de datos NCBI para secuencias de nucleótidos ha llevado a un descubrimiento impresionante. ¡Una de las secuencias de imprimación de la OMS en la prueba de PCR para SARS-CoV-2 se encuentra en todo el ADN humano!

La secuencia “CTCCCTTTGTTGTGTTGT” es una secuencia de imprimación de 18 caracteres que se encuentra en el documento de protocolo de pruebas de coronavirus PCR dela OMS. Las secuencias de imprimación son las que se amplifican por el proceso PCR para ser detectadas y designadas como resultado de la prueba “positiva”. ¡Sucede exactamente esta misma secuencia de 18 caracteres, textualmente, también se encuentra en el cromosoma 8 del Homo sapiens! Por lo que puedo decir, esto significa que los kits de prueba de la OMS deben encontrar un resultado positivo en todos los seres humanos. ¿Alguien puede explicar esto de otra manera?

Realmente no puedo exagerar la importancia de este hallazgo. Como mínimo, debería tener un impacto notable en los resultados de las pruebas.

WHO Primer 2

Homo sapiens cromosoma 8, GRCh38.p12

ID de secuencia de ensamblaje primario: NC_000008.11 Longitud: 145138636

Rango 1: 63648346 a 63648363 es “CTCCCTTTGTTGTGTGTGT”

Actualización: Después de un poco de esfuerzo, finalmente he descubierto una manera de mostrar la prueba (más allá de mis capturas de pantalla) que el cromosoma humano 8 tiene exactamente esta misma secuencia de 18 caracteres. Por favor, pruebe el siguiente enlace. La secuencia se muestra en la parte inferior de la página.

https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report-genbank&log$-nuclalign&from-63648346&to-63648363

Un virus que no actúa como un virus. ¿Es el coronavirus el nuevo VIH?

Esto es puramente un pensamiento de 4 de la madrugada. Corrígeme si me equivoco, pero se supone que las pandemias virales siguen una trayectoria. Pico en invierno, se fue en verano (donde están alcanzando su punto máximo en el hemisferio sur). Se dice que las mutaciones ocurren. El verano se vuelve invierno de nuevo. Me repito una vez más.

us_flu_deaths

Este coronavirus, sin embargo, parece ser un lo “malo” que representa todo el precedente histórico. Se sabe que el coronavirus común es altamente estacional. ¿Quién podría haber adivinado que COVID-19 sería la excepción de todas las excepciones?! Oh espera, lo adivinamos… sobre una base casi diaria desde el principio!

Esto está empezando a parecerse a una situación de VIH. Para obtener información sobre esa situación, consulte el trabajo fundacional de Mark aquí en Piece of Mindful sobre el tema.

SIDA: Una “plaga de sangre y sexo” inventada

En su artículo, Mark hace el mismo comentario, señalando el patrón de un brote de ébola como ejemplo. Cuando uno trama las infecciones por VIH en un mapa, no se comporta en absoluto como un brote viral. Se parece más a la relación entre los cigarrillos y el cáncer de pulmón. En palabras de Mark, se asemeja a “una enfermedad provocada por un agente”.

aids

Eso trae de vuelta al coronavirus. Bueno, amigos, este pánico del coronavirus parece otro brote de virus que no puede ser un brote de virus. En lugar de cualquier tipo de pico discernible, en cambio estamos viendo sólo una línea plana y constante para nuevas infecciones. No actúa como un brote viral. Especialmente no es un brote viral en una clase de virus conocidos por su naturaleza estacional y en un país con un clima que apoya los brotes de virus estacionales. En cambio, no obtenemos ningún cambio en los Estados Unidos entrando en la temporada de verano. Una línea plana.

SARSCOV-cases

La pregunta es la siguiente: ¿Por qué no hay ningún experto en los medios de comunicación que se pregunte por qué este virus parece inmune a actuar como un virus? ¿Por qué el virus continuaría con toda su fuerza durante el verano en los Estados Unidos?

El sentido común y las habilidades de pensamiento crítico están casi muertos en Estados Unidos. Se ríen activamente y se desalientan en el discurso público. Ahora nos quedaremos con el nuevo VIH. El nuevo virus que absolutamente no puede ser un virus.

Y no olvidemos que nadie ha respondido a la pregunta más cómica: ¿Qué quiere decir que la prueba en sí sólo tiene alrededor de una tasa de falsos positivos del 10%? ¿O qué pasa si el SARS-CoV-2 es realmente inofensivo (como dice Duesberg para el VIH) y no está relacionado con ninguna enfermedad específica?

¿Sabías que billones de virus te están lloviendo desde el cielo todos los días de tu vida? Postulé hace mucho tiempo que SARS-CoV-2 pudo haber sido elegido como “el mal de todos los males” porque sabían que sería fácil de detectar donde fuera necesario encontrarlo. Eso parece que es lo que estamos viendo en los datos. Eso, o simplemente falsos positivos.

Este es un brote viral que no puede ser un brote viral. Otra artimaña. Los datos que se nos dan parecen estar totalmente fabricados. Completamente inventado… Las personas se enferman estacionalmente, y alrededor del 10% de las personas enfermas parecen ser capaces de dar positivo en este coronavirus. Eso es todo esto. Ellos serán capaces de mantener esta ilusión permanentemente a lo largo de estos terrenos exactos.

Ahora, es verano en Estados Unidos. Ya no hay mucha gente enfermando, pero el público ha sido tan efectivamente engañado que ya ni siquiera notan ninguna relación entre los enfermos y los datos de televisión para los enfermos. ¡Sólo reflexiona sobre eso por un minuto! Tal vez, por encima de todo, sea por eso que tendremos el verano de falsa tensión racial. Más desorientación del truco de magia. Piense en la tensión racial inventada como la asistente del mago con “gran escote”.

Todo es un truco de magia. Ahora son las 4:30 de la madrugada, y debería volver a dormir. En el sentido literal y metafórico. ¿Todo esto fue un sueño?

https://pieceofmindful.com/

Virus that doesn’t act like a Virus: Is Coronavirus the new HIV?

Virus that doesn’t act like a Virus: Is Coronavirus the new HIV?

This coronavirus, however, seems to be a boogeyman that bucks all historical precedent. Common coronavirus is known to be highly seasonal. Who could have guessed that COVID-19 would be the exception of all exceptions?! Oh wait, we guessed it…on almost a daily basis from the very beginning!

This is beginning to resemble an HIV situation. For a primer on that situation, please refer to Mark’s foundational work here at Piece of Mindful on the subject.

AIDS: A contrived ‘blood and sex plague’

In his piece, Mark makes the same comment, pointing to the pattern of an Ebola outbreak as an example. When one plots HIV infections on a map, it behaves nothing at all like a viral outbreak. It looks more like the relationship between cigarettes and lung cancer. In Mark’s words, it resembles “an illness brought about by an agent”.

aids

That brings is back to coronavirus. Well, folks, this coronavirus panic looks like another virus outbreak that cannot possibly be a virus outbreak. Rather than any kind of discernible peak, we are instead seeing just a flat, constant line for new infections. It does not act anything like a viral outbreak. Especially not a viral outbreak in a class of viruses known for their seasonal nature and in a country with a climate supporting seasonal virus outbreaks. Instead, we get no change whatsoever with the United States entering the summer season. A flat line.

SARSCOV-cases

The question is this: Why are there zero experts in the mainstream media asking why this virus seems immune from acting like a virus? Why would the virus be continuing at full strength through the summer in the United States?

Common sense and critical thinking skills are damn-near dead here in America. They are actively laughed at and discouraged in public discourse. We are now going to be left with the new HIV. The new virus that absolutely cannot be a virus.

And let’s not forget that nobody has ever answered the most comical question: What is to say that the test itself does not just have around a 10% false positive rate? Or what if SARS-CoV-2 is actually harmless (as Duesberg says for HIV) and unrelated to any specific sickness?

Did you know that trillions of viruses are raining down upon you from the sky every single day of your life? I postulated long ago that SARS-CoV-2 may have been chosen as the boogeyman because they knew it would be easy to find wherever they needed to find it. That sure looks like what we are seeing in the data. That or just outright false positives.

This is a viral outbreak that cannot be a viral outbreak. Another contrivance. The data we are given seems to be totally manufactured. Completely made up…just like your Presidential election results! People get sick seasonally, and around 10% of sick people seem to be able to test positive for this coronavirus. That is all this is. They will be able to maintain this illusion permanently along these exact grounds.

Now, it is summer in America. There are no longer very many people getting sick, but the public has been so effectively hoodwinked that they no longer even notice any relationship between sick people and TV data for sick people. Just reflect on that for a minute! Perhaps that, above all else, is why we will have the summer of fake racial tension. More misdirection from the magic trick. Think of the contrived racial tension as the magician’s assistant with the large breasts.

It is all a magic trick. Now it is 4:30AM, and I should be getting back to sleep. In the literal and metaphorical sense. Was this all a dream?

https://pieceofmindful.com/

Virus that doesn’t act like a Virus: Is Coronavirus the new HIV?

 

CORONAVIRUS SÉSAMO (BARRIO)

coronavirus_

¡Maldita sea, el coronavirus existe!. No lo niego pero reniego de lo que se sabe del virus, o sea, nada. Sólo sé que no se nada por lo tanto todos tenemos derecho a especular sin ser tachados de “negacionista”.

Investigadores de biología celular y molecular de mucho prestigio: los coronavirus con temperaturas altas se inactivan*. Empezando por aquí, puedo pensar que el SARS-COV-2 no es un coronavirus o tiene muy poco que ver con esta familia de virus. Es posible que sólo tenga la carcaza con ensamble adquirido. ¿Una máscara necesaria?

¿Al darse en otoño-invierno se puede pensar que en verano estamos todos ya inmunizados? ¿No verdad? Algo no cuadra.

¿Qué virus no se desactivan con el calor y en verano? No se si habrá una larga lista, pero con estos bastan, el Ébola y el VIH.

Y en esta estamos, ¿virus en busca de enfermedad o enfermedad en busca de virus? Y el término medio según biólogos renombrados, es si un virus es la causa o la consecuencia de una enfermedad. Si es esta última, estamos matando moscas a cañonazos, entre ellas, la economía y la sociedad. Si no es el virus para acabar coronando la caída de ellas con causas y consecuencias.

Porque la vida es convivir con virus y bacterias. No hay nada que pueda crear el hombre que no esté en la naturaleza (también futurible). Diferente es que lo haga a destiempo o esta no lo necesite, ni ahora y quizás nunca, este es el verdadero horror y por lo visto el gran reto. Tanto para los de arriba, como para los de abajo.

En todo caso se puede ser negacionista de la pandemia y por tanto de la OMS, que no del virus (creado o no en laboratorio). Por cierto, si fuera así, ¿es posible que haya dos virus? No hablo de cepas.

El segundo capítulo de “Coronavirus Sésamo” deben sintonizarlo en sus receptores a través de su cerebro.

* ¿Puedo enfermar de gripe en verano? Pues supongo que sí, pero todos sabemos que no es lo habitual. ¿Pero podemos afirmar que si nos realizan un test PCR a toda la población en la temporada estival, podemos dar positivos asintomáticos en un tanto por ciento como se da en esa misma población en invierno con sintomáticos de la influenza? Esto desbarataría a la pandemia como tal, que no al virus. Es una duda razonable.

G.R.M.Barrio_Sesamo

 

SESAME CORONAVIRUS (STREET)

Damn, the coronavirus exists!. I do not deny it but I deny what is known about the virus, that is, nothing. I only know that I know nothing, therefore we all have the right to speculate without being branded a “denier”.

Renowned Cell and Molecular Biology Researchers: High-temperature coronaviruses are inactivated*. Starting here, I can think that SARS-COV-2 is not a coronavirus or has very little to do with this family of viruses. You may only have the housing with purchased assembly. A necessary mask?

When it occurs in autumn-winter, can we think that in summer we are all already immunized? No right? Something is wrong.

What viruses are not deactivated in the heat and in summer? I don’t know if there will be a long list, but these are enough, Ebola and HIV.

And here we are, virus looking for disease or disease looking for viruses? And the middle ground according to renowned biologists, is whether a virus is the cause or the consequence of a disease. If it is the latter, we are killing flies with cannon shots, including the economy and society. If it is not the virus to end up crowning their fall with causes and consequences.

Because life is living with viruses and bacteria. There is nothing that man can create that is not in nature (also futurible). It is different if he does it at the wrong time or it does not need it, not now and perhaps never, this is the true horror and apparently the great challenge. Both for those above, and for those below.

In any case, you can be a denier of the pandemic and therefore of the WHO, not the virus (created or not in the laboratory). By the way, if so, is it possible that there are two viruses? I’m not talking about strains.

The second chapter of “Coronavirus Sesame” you must tune into your receptors through your brain.

* Can I get the flu in the summer? Well I guess so, but we all know that it is not usual. But can we affirm that if we carry out a PCR test on the entire population in the summer season, we can give asymptomatic positives in as many percent as occurs in the same population in winter with symptoms of influenza? This would derail the pandemic as such, not the virus. It’s a reasonable doubt.