¿Quién es el propietario de Big Pharma + Big Media? Nunca lo adivinas.

BlackRock y Vanguard Group, las dos firmas de gestión de activos más grandes del mundo, se combinaron como propietarios de The New York Times y otros medios heredados, junto con Big Pharma.

Por el Dr. Joseph Mercola

Historia de un vistazo:

  • Big Pharma y los principales medios de comunicación son en gran parte propiedad de dos firmas de gestión de activos: BlackRock y Vanguard.
  • Las compañías farmacéuticas están impulsando las respuestas al COVID-19 —todas las cuales, hasta ahora, han puesto en peligro la salud pública en lugar de optimizarla— y los principales medios de comunicación han sido cómplices dispuestos a difundir su propaganda, una narrativa oficial falsa que lleva al público por mal camino y fomenta el miedo basado en mentiras.
  • Vanguard y BlackRock son los dos principales propietarios de Time Warner, Comcast, Disney y News Corp, cuatro de las seis compañías de medios que controlan más del 90% del panorama de los medios estadounidenses.
  • BlackRock y Vanguard forman un monopolio secreto que posee casi todo lo demás que se te ocurra también. En total, tienen la propiedad de 1.600 empresas estadounidenses, que en 2015 tenían ingresos combinados de 9,1 billones de dólares. Cuando se agrega el tercer propietario global más grande, State Street, su propiedad combinada abarca casi el 90% de todas las empresas del S&P 500.
  • Vanguard es el mayor accionista de BlackRock. Vanguard en sí, por otro lado, tiene una estructura única que hace que su propiedad sea más difícil de discernir, pero muchas de las familias más antiguas y ricas del mundo pueden vincularse a los fondos de Vanguard.

¿Qué tiene en común The New York Times y la mayoría de los otros medios heredados con las grandes farmacéuticas? Respuesta: Son en gran parte propiedad de BlackRock y Vanguard Group,las dos firmas de gestión de activos más grandes del mundo. Además, resulta que estas dos compañías forman un monopolio secreto que posee casi todo lo demás que se te ocurra también. Como se informó en el video destacado:

“Las acciones de las corporaciones más grandes del mundo son propiedad de los mismos inversores institucionales. Todos son dueños el uno del otro. Esto significa que las marcas “competidoras”, como Coca-Cola y Pepsi, no son realmente competidoras, en absoluto, ya que sus acciones son propiedad de exactamente las mismas compañías de inversión, fondos de inversión, compañías de seguros, bancos y, en algunos casos, gobiernos.

“Los inversores más pequeños son propiedad de inversores más grandes. Esos son propiedad de inversores aún más grandes. La parte superior visible de esta pirámide muestra sólo dos empresas cuyos nombres hemos visto a menudo … Son Vanguard y BlackRock.

“El poder de estas dos compañías está más allá de su imaginación. No sólo poseen una gran parte de las acciones de casi todas las grandes empresas, sino también las acciones de los inversores en esas empresas. Esto les da un monopolio total.

“Un informe de Bloomberg afirma que ambas compañías en el año 2028, juntas tendrán inversiones por la cantidad de 20 billones de dólares. Eso significa que serán dueños de casi todo'”.

¿Quiénes son los Vanguard?

La palabra “vanguardia” significa “la posición más importante en un ejército o flota que avanza hacia la batalla”, y /o “la posición de liderazgo en una tendencia o movimiento”. Ambas son descripciones adecuadas de este gigante global, propiedad de los globalistas que presionan por un Gran Reinicio,cuyo núcleo es la transferencia de riqueza y propiedad de las manos de muchos a las manos de unos pocos.

Curiosamente, Vanguard es el mayor accionista de BlackRock, a partir de marzo de 2021. La propia Vanguardia, por otro lado, tiene una estructura corporativa “única” que hace que su propiedad sea más difícil de discernir. Es propiedad de sus diversos fondos, que a su vez son propiedad de los accionistas. Aparte de estos accionistas, no tiene inversores externos y no cotiza en bolsa. Como se informó en el video destacado:

“A la élite que posee Vanguard aparentemente no le gusta estar en el centro de atención, pero por supuesto no pueden esconderse de quién está dispuesto a cavar. Los informes de Oxfam y Bloomberg dicen que el 1% del mundo, en conjunto, posee más dinero que el otro 99%. Peor aún, Oxfam dice que el 82% de todo el dinero ganado en 2017 fue a este 1%.

“En otras palabras, estas dos compañías de inversión, Vanguard y BlackRock tienen un monopolio en todas las industrias del mundo y, a su vez, son propiedad de las familias más ricas del mundo, algunas de las cuales son de la realeza y que han sido muy ricas desde antes de la Revolución Industrial”.

Si bien tomaría tiempo examinar todos los fondos de Vanguard para identificar a los accionistas individuales y, por lo tanto, a los propietarios de Vanguard, una rápida mirada sugiere Rothschild Investment Corp. y el Holding Edmond De Rothschild son dos de esas partes interesadas. Mantenga el nombre Rothschild en su mente mientras sigue leyendo, ya que aparecerá de nuevo más tarde.

El video de arriba también identifica a la familia italiana Orsini, la familia estadounidense Bush, la familia real británica, la familia du Pont, los Morgan, Vanderbilts y Rockefeller, como propietarios de Vanguard.

BlackRock/Vanguard poseen Big Pharma

Según Simply Wall Street, en febrero de 2020, BlackRock y Vanguard eran los dos mayores accionistas de GlaxoSmithKline, con un 7% y un 3,5% de las acciones respectivamente. En Pfizer,la propiedad se invierte, con Vanguard siendo el principal inversor y BlackRock el segundo mayor accionista.

Tenga en cuenta que los ratios de propiedad de acciones pueden cambiar en cualquier momento, ya que las empresas compran y venden de forma regular, así que no se quede colgado de los porcentajes. La conclusión es que BlackRock y Vanguard, individualmente y combinados, poseen suficientes acciones en un momento dado que podemos decir que controlan fácilmente tanto big pharma como los medios heredados centralizados, y luego algunos

¿Por qué importa esto? Importa porque las compañías farmacéuticas están impulsando las respuestas al COVID-19 —todas las cuales, hasta ahora, han puesto en peligro la salud pública en lugar de optimizarla— y los principales medios de comunicación han sido cómplices dispuestos a difundir su propaganda,una narrativa oficial falsa que ha llevado, y sigue siendo, al público por mal camino y fomenta el miedo basado en mentiras.CHD pide a la FDA que desproteta las vacunas contra el COVID del mercado – Envíe un comentario

Para tener alguna posibilidad de corregir esta situación, debemos entender quiénes son los actores centrales, de dónde vienen los dictados dañinos y por qué se están creando estas narrativas falsas en primer lugar.

Como se señala en el informe de diciembre de 2020 de Global Justice Now “La horrible historia de las grandes farmacéuticas”, simplemente no podemos permitir que las compañías farmacéuticas —”que tienen un largo historial de priorizar las ganancias corporativas sobre la salud de las personas”— continúen dictando las respuestas de COVID-19.

En él, revisan la vergonzosa historia de las siete principales compañías farmacéuticas del mundo que ahora están desarrollando y fabricando medicamentos y “vacunas” basadas en genes contra el COVID-19, mientras que los principales medios de comunicación han ayudado a suprimir la información sobre medicamentos más antiguos fácilmente disponibles que han demostrado tener un alto grado de eficacia contra la infección.

BlackRock/Vanguard son dueños de los medios de comunicación

En lo que respecta a The New York Times, a mayo de 2021, BlackRock es el segundo mayor accionista con el 7,43% del total de acciones, justo después de The Vanguard Group, que posee la mayor parte (8,11%).

Además de The New York Times, Vanguard y BlackRock son también los dos principales propietarios de Time Warner, Comcast, Disney y News Corp, cuatro de las seis compañías de medios que controlan más del 90% del panorama de los medios estadounidenses.

No hace falta decir que, si usted tiene el control de esta gran cantidad de medios de comunicación, usted puede controlar naciones enteras por medio de la propaganda centralizada cuidadosamente orquestada y organizada disfrazada de periodismo.

Si tu cabeza ya está girando, no estás solo. Es difícil describir relaciones circulares y estrechamente entrelazadas de manera lineal. El mundo de la propiedad corporativa es laberínfico, donde todo el mundo parece ser dueño de todos, hasta cierto punto.

Sin embargo, el mensaje clave para llevar a casa es que dos compañías destacan cabeza y cuello por encima de todas las demás, y esas son BlackRock y Vanguard. Juntos, forman un monopolio oculto sobre las tenencias de activos globales, y a través de su influencia sobre nuestros medios centralizados, tienen el poder de manipular y controlar gran parte de la economía y los eventos del mundo, y cómo el mundo lo ve todo.

Teniendo en cuenta que BlackRock anunció en 2018 que tiene “expectativas sociales” de las compañías en las que invierte, no se puede pasar por alto su papel potencial como centro central en el Gran Reset y el plan de “reconstruir mejor”.

Si a esto le sumamos la información que muestra que “socava la competencia a través de la poseid de acciones en compañías competidoras” y “desdibuja los límites entre el capital privado y los asuntos gubernamentales al trabajar en estrecha colaboración con los reguladores”, sería difícil no ver cómo BlackRock /Vanguard y sus propietarios globalistas podrían facilitar el Gran Reajuste y la llamada revolución “verde”, los cuales son parte del mismo esquema de robo de riqueza.

BlackRock y Vanguard son dueños del mundo

Esa afirmación se volverá aún más clara una vez que te des cuenta de que la influencia de este dúo no se limita a las grandes farmacéuticas y los medios de comunicación. Es importante destacar que BlackRock también trabaja en estrecha colaboración con los bancos centrales de todo el mundo, incluida la Reserva Federal de Estados Unidos, que es una entidad privada, no federal. Presta dinero al banco central, actúa como asesor del mismo y desarrolla el software del banco central.

BlackRock/Vanguard también posee acciones de una larga lista de otras compañías,incluyendo Microsoft, Apple, Amazon, Facebook y Alphabet Inc. Como se ilustra en el gráfico de la red de propiedad de BlackRock y Vanguard a continuación, que aparece en el artículo de 2017 “These Three Firms Own Corporate America” en The Conversation,sería casi imposible enumerarlas todas.

En total, BlackRock y Vanguard tienen la propiedad de unas 1.600 firmas estadounidenses, que en 2015 tenían ingresos combinados de 9,1 billones de dólares. Cuando se agrega el tercer propietario global más grande, State Street, su propiedad combinada abarca casi el 90% de todas las empresas del S&P 500.

Blackrock and Vanguard ownership

Un monopolio global del que pocos saben nada

Para descubrir la influencia general de BlackRock y Vanguard en el mercado global, asegúrese de ver el video de 45 minutos de duración que aparece en la parte superior de este artículo. Proporciona un resumen de amplia visión de la red de monopolios ocultos de las corporaciones propiedad de Vanguard y BlackRock, y su papel en el Gran Reinicio. Un segundo video mucho más corto (arriba) ofrece una revisión adicional de esta información.

¿Cómo podemos vincular a BlackRock/Vanguard —y a las familias globalistas que los poseen— con el Gran Reset? Salvo una confesión pública, tenemos que analizar las relaciones entre estas gigantescas corporaciones de propiedad globalista y considerar la influencia que pueden ejercer a través de esas relaciones. Como señaló Lew Rockwell:

“Cuando Lynn Forester de Rothschild quiere que Estados Unidos sea un país de partido único (como China) y no quiere que se aprueben leyes de identificación de votantes en Los Estados Unidos, para que se pueda perpetrar más fraude electoral para lograr ese fin, ¿qué hace?

“Ella mantiene una conferencia telefónica con los 100 principales directores ejecutivos del mundo y les dice que denuncien públicamente como ‘Jim Crow’ la aprobación de una ley anticorrupción en Georgia y ordena a sus obedientes directores ejecutivos boicotear el Estado de Georgia, como vimos con Coca-Cola y las Grandes Ligas de Béisbol e incluso la estrella de Hollywood, Will Smith.

“En esta conferencia telefónica, vemos sombras del Gran Reinicio, la Agenda 2030, el Nuevo Orden Mundial. La ONU quiere asegurarse, al igual que [el fundador y presidente ejecutivo del Foro Económico Mundial Klaus] Schwab, de que en 2030, la pobreza, el hambre, la contaminación y las enfermedades ya no asolan la Tierra.

“Para lograr esto, la ONU quiere que los impuestos de los países occidentales sean divididos por las mega corporaciones de la élite para crear una sociedad completamente nueva. Para este proyecto, la ONU dice que necesitamos un gobierno mundial, es decir, la propia ONU”.

Como he revisado en muchos artículos anteriores, parece bastante claro que la pandemia de COVID-19 fue orquestada para lograr este Nuevo Orden Mundial – el Gran Reinicio – y el video de 45 minutos que aparece en la parte superior del artículo hace un buen trabajo al explicar cómo se hizo esto. Y en el corazón de todo, el “corazón” hacia el que fluyen todas las corrientes de riqueza global, encontramos BlackRock y Vanguard.

Publicado originalmente por Mercola.

Big Media, Big Pharma y Big Tech son propiedad de las mismas entidades corporativas transnacionales | SOTN: Noticias alternativas, análisis y comentarios (stateofthenation.co)

Una teoría de la conspiración loca que se puede probar. Covid-21

A crazy conspiracy theory that can be tested. Covid-21

¿Y si la siguiente hoja de ruta loca de la teoría de la conspiración se hace realidad?

Esta hoja de ruta fue “filtrada” por un ex-miembro del Partido Verde de Alemania (David Siber). Hace que la lectura impactante, pero muy cerca de palomas con uno filtrado de Canadá. No tengo un enlace a la primera filtración porque se publica en un canal de Telegram que sigo (David Siber’s). Sin embargo, realmente no creo que la validez de su fuente importe en ningún lugar tan cerca como de su posible poder predictivo.

Mi traducción de la filtración alemana (supongo que fue una fuga de septiembre/octubre, como la canadiense):

  1. Introducir el segundo bloqueo. Los cierres secundarios deben extenderse desde las ciudades hasta las áreas circundantes de una manera arrastrándose. Fecha límite: finales de noviembre de 2020.
  2. Establecimiento de centros de aislamiento en todos los estados y municipios federales. Fecha límite: finales de diciembre de 2020.
  3. Las cifras diarias de infecciones por COVID-19 están aumentando tan rápidamente que las autoridades están alcanzando los límites de su capacidad de prueba. Fecha límite: finales de noviembre de 2020.
  4. Bloqueo completo y final (restricciones más estrictas que el primer bloqueo). Fecha límite: finales de diciembre de 2020 – a partir de enero de 2021.
  5. Reforma del programa de prestaciones por desempleo y Hartz IV hacia la renta básica universal. Fecha límite: primer trimestre de 2021 – es decir, a finales de marzo de 2021.
  6. Mutación del virus COVID-19 en un virus más peligroso llamado COVID-21, que inicia una tercera oleada de infecciones con una alta tasa de mortalidad y mayores tasas de infección. Fecha límite: antes de febrero de 2021.
  7. Las nuevas infecciones diarias de COVID-21 abruman a las clínicas y hospitales. Fecha límite: trimestre 1 – trimestre 2 2021.
  8. Introducción del tercer encierro con más restricciones a la vida pública restante. Se prohibirá viajar entre estados federales e incluso ciudades. Fecha límite: trimestre 2 2021.
  9. Introducir a todos en un programa de ingresos básicos universales. Fecha límite: mediados del trimestre 2 2021.
  10. Una gran inestabilidad económica conduce al colapso de las cadenas de suministro y, por lo tanto, a la escasez de bienes en las tiendas. Fecha límite: trimestre 2 – trimestre 3 2021.
  11. Operaciones del ejército interno dentro de las principales ciudades y en autopistas. El objetivo es evitar el movimiento y los viajes de los ciudadanos y proporcionar apoyo logístico en las ciudades. Fecha límite: antes del trimestre de 2021.
  12. Se da a los ciudadanos la oportunidad de cancelar todos los préstamos personales en el marco del llamado “Programa Mundial de Restablecimiento de la Deuda”. El Estado recibe los recursos financieros necesarios del FMI (Fondo Monetario Internacional). Para adherirse a este programa, los ciudadanos deben transferir todos los derechos de propiedad a los bienes existentes y también a todos los futuros. Además, el ciudadano se compromete a aceptar las vacunas COVID-19 y COVID-21 sin resistencia. Con el nuevo pase de vacunación, se levantan todas las restricciones a cada ciudadano que cumpla con las normas. Los ciudadanos que se oponen a la vacunación y al programa de pago de la deuda se convertirán en un “riesgo para la salud de los demás”. Sólo serán liberados de las restricciones de bloqueo después de aceptar el programa de pago de la deuda y permitirse vacunarse. 

Bill Gates aparece en el video vinculado a arriba. Afirma rotly que “pandemia 2” será peor que “pandemia 1”. El video también muestra a él y a su esposa Melinda luciendo extrañamente complacidos con la perspectiva de la variante más mortífera aún por venir. ¿Cómo puede saber estas cosas? ¿Por qué la prensa no está en todas estas afirmaciones extraordinarias? ¿Quién es responsable de estos horarios posiblemente filtrados? ¿Los horarios son creíbles?

Independientemente de las posibles respuestas a tales preguntas, una teoría es buena si puede ser falsificada. Las predicciones claras cumplen ese criterio aquí. ¿Qué pasa con The Great Reset, “Build Back Better” que se utiliza simultáneamente en todo el mundo de habla inglesa, un medio de comunicación de masas de una sola melodía en todo el mundo y predicciones más transparentes sobre futuras mutaciones de virus y letalidad de un ex jefe de una gran compañía de software, si este conjunto de predicciones (declaraciones) comenzara a hacerse realidad – y parecen ser ya – , que probaría la “teoría de la conspiración”, ¿no? ¿Qué otra explicación podría explicar todos estos hechos?

Si mi lógica es sólida, entonces compartir esta información con todos y el sol es de suma importancia. Me gustaría que este horario fuera el producto de un loco en alguna parte, pero las cosas han estado más allá de la locura durante ocho meses, así que creo que esto merece atención.

Econosophy and other musings: A crazy conspiracy theory that can be tested (thdrussell.blogspot.com)

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.


La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?


El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.


Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.


La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.


El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.