No creas todo lo que lees sobre las muertes por gripe (2014)

Este artículo es de 2014. Saquen vuestras propias conclusiones. Es muy interesante y clarificador. Nada se sabía de la pandemia del Covid-19.

01/24/2014 05:40 EST | Actualizado:03/26/2014 05:59h

No creas todo lo que lees sobre las muertes por gripe

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional.

Lawrence Salomón Columnista

La gripe provoca “entre 250.000 y 500.000 muertes anuales” en todo el mundo, nos dice Wikipedia. “La estimación típica es de 36,000 [muertes] al año en los Estados Unidos”, informa NBC, citando los Centros para el Control de Enfermedades. “Entre 4.000 y 8.000 canadienses al año mueren de gripe y sus complicaciones relacionadas, según la Agencia de Salud Pública de Canadá”, dice el Globe and Mail, agregando que “esas cifras son controvertidas porque son estimaciones”.

“Controversial” es un eufemismo, y no sólo en Canadá, y no sólo porque las cifras son estimaciones. Las cifras difieren enormemente de los sobrios recuentos registrados en los certificados de defunción -por ley cada certificado debe mostrar una causa- y reportados por las agencias oficiales que recopilan y mantienen estadísticas vitales.

Según el Sistema Nacional de Estadísticas Vitales en los EE.UU., por ejemplo, las muertes anuales por gripe en 2010 ascendieron a sólo 500 por año– menos que las muertes por úlceras (2.977), hernias (1.832) y embarazo y parto (825), y muy lejos de las grandes causas de muerte como las cardiopatías (597.689) y los cánceres (574.743). La historia es similar en Canadá, donde los asesinos poco probables también empequeñecen el recuento de muertes por gripe en Canadá.

Incluso esa cifra de 500 para Estados Unidos podría ser demasiado alta, según análisis en revistas autorizadas como el American Journal of Public Health y el British Medical Journal. Sólo alrededor del 15-20% de las personas que presentan síntomas similares a los de la gripe tienen el virus de la gripe– el otro 80-85% realmente contagió rinovirus u otros gérmenes que son indistinguibles de la verdadera gripe sin pruebas de laboratorio, que rara vez se hacen. En 2001, un año en el que los certificados de defunción enumeraban a 257 estadounidenses como que habían muerto de gripe, sólo 18 fueron identificados positivamente como verdaderas gripes. Los otros 239 simplemente se suponía que eran gripes y muy probablemente tenían pocas gripes verdaderas entre ellos.

“Los datos estadounidenses sobre las muertes por gripe son un desastre”, afirma un artículo de 2005 en el British Medical Journal titulado “¿Las cifras de mortalidad por gripe en Ee.UU. son más relaciones públicas que científicas?” Este artículo cuestiona la cifra de 36.000 muertes por gripe comúnmente reclamada, y con la descripción de la “gripe/neumonía” como la séptima causa de muerte en los Estados Unidos.

“¿Pero por qué se agrupan la gripe y la neumonía?”, se pregunta el artículo. “¿Es la relación tan fuerte o única para justificar su caracterización como una sola causa de muerte?”

La respuesta del artículo es no. La mayoría de las muertes por neumonía no están relacionadas con la gripe. Por ejemplo, “los medicamentos supresores del ácido estomacal están asociados con un mayor riesgo de neumonía adquirida por la comunidad, pero estos medicamentos y neumonía no se compilan como una sola estadística”, explicó el Dr. David Rosenthal, director de los Servicios de Salud de la Universidad de Harvard. “La gente no necesariamente muere, per se, del virus [de la gripe]: la viremia. De lo que mueren es de una neumonía secundaria”.

La neumonía, según la Asociación Americana del Pulmón, tiene más de 30 causas diferentes,siendo la gripe sólo una de ellas. El propio CDC reconoce la escasa relación, diciendo que “sólo una pequeña proporción de las muertes… sólo el 8,5% de todas las muertes por neumonía y gripe [están] relacionadas con la gripe.”

Debido a que los certificados de defunción desmienten las afirmaciones de numerosas muertes por gripe, los CDC reclutaron modelos informáticos para llegar a su estimación de 36.000 muertes por gripe. Pero incluso aquí necesitaba doblar la terminología médica convencional para llegar a cifras de muerte convincentes.

“Las estadísticas de causa de muerte se basan únicamente en la causa subyacente de la muerte [definida internacionalmente] como ‘la enfermedad o lesión que inició el tren de eventos que condujeron directamente a la muerte'”, explica el Centro Nacional de Estadísticas de Salud. Debido a que la gripe rara vez fue una “causa subyacente de muerte”, los CDC crearon el término sólido, “muerte asociada a la gripe”.

Usando esta nueva definición suelta, los modelos informáticos de los CDC podrían contar a las personas que murieron de una dolencia cardíaca u otras causas después de tener gripe. Como admitió William Thompson, del Programa Nacional de Inmunización de los CDC, la mortalidad asociada a la gripe es “una asociación estadística … No sé si diríamos que es la causa subyacente de la muerte”.

La decisión de los CDC de aumentar las muertes por gripe se remonta a una década atrás, cuando se dio cuenta de que el público no estaba siguiendo sus consejos sobre la vacuna contra la gripe. Durante la temporada de gripe de 2003 “los fabricantes nos decían que no estaban recibiendo muchos pedidos de vacunas”, dijo el Dr. Glen Nowak, director asociado de comunicaciones del Programa Nacional de Inmunización de los CDC, a la Radio Pública Nacional. “Realmente parecía que necesitábamos hacer algo para animar a la gente a vacunarse contra la gripe”.

La respuesta de los CDC fue su “receta de siete pasos para generar interés en la vacunación contra la gripe (o cualquier otra) vacuna”, una muestra de diapositivas que Nowak presentó en la Cumbre Nacional de Vacunas contra la Gripe de 2004.

Aquí está la “Receta que fomenta el interés y la demanda de la vacuna antigripal”, en el lenguaje truncado que aparece en sus diapositivas: “Los expertos médicos y las autoridades de salud pública [deberían] públicamente (por ejemplo a través de los medios de comunicación) declarar preocupación y alarma (y predecir resultados nefastos) – e instar a la vacunación contra la gripe.” Esta receta, indicó su presentación de diapositivas, daría lugar a “un interés y atención significativas de los medios de comunicación … en términos que motivan el comportamiento (por ejemplo, como ‘muy grave’, ‘más grave que los últimos o años pasados’, ‘mortal’). Otras recomendaciones emotivas incluyeron fomentar “la percepción de que muchas personas son susceptibles a un mal caso de gripe” y “Ejemplos visibles/tangibles de la gravedad de la enfermedad (por ejemplo, imágenes de niños, familias de los afectados que se acercan) y personas que se vacunan (las primeras para motivar, esta última para reforzar) “.

Los CDC decidieron descaradamente crear un mercado masivo para la vacuna antigripal al reclutar a los medios de comunicación para que entraran en pánico entre el público. Un medio de comunicación obediente e incuestionable obligado por la hipnotización de los números, y 10 años después todavía lo está obligando.

Don’t Believe Everything You Read About Flu Deaths | HuffPost Canada (huffingtonpost.ca)

El médico Sciuto desmonta versión oficial del coronavirus

Con el aplomo y la seguridad en sí mismo de quien se sabe portavoz de la verdad, el médico uruguayo Javier Sciuto, que en esta entrevista de 18 minutos aparece acompañado por los empresarios Fernando Vega y Fernando Ferreira, pone las cartas sobre la mesa y demuele la versión oficial de la Plandemia con la precisión de un cirujano:

https://lbry.tv/$/embed/ENTREVISTA-SciutoVegaFerreira/2b04e26db72d6694c7ddda79052dae2c53dc792c?r=3mqGPXDEfiAmZyZ1kW6B9b948ShEhX1G

Lo que dice este médico será en cuestión de tiempo aceptado como evidente, aunque ahora prevalezcan en los medios las mentiras de quienes mercadean con nuestra salud y nuestros derechos:

* “Si hacemos test serológicos a toda la población –que son los test que de verdad hay que hacer y no las PCRs-, en una semana se acaba la pandemia”.

* “Esto que estamos viviendo no es una pandemia causada por un virus, es una pandemia de falsos positivos por PCR”.

SIN TÍTULO

Siempre he comentado y pensado que hay títulos que merecen una obra. Ahí están “La insoportable levedad del ser” o “La sombra del ciprés es alargada”. Obras de arte que engloban y a la vez envuelven en una retroalimentación a la propia escritura de tomo y lomo, esto es al fin constructivo por el que fueron creadas, ingeniería para cruzar un río caudaloso donde al final sólo queda el puente y una cicatriz de lo que allí surcó.

Recién cumplida la cincuentena, no soy de este mundo. No he tirado la toalla ni vengo de vuelta. Ni entiendo ni quiero que me entiendan. Ya nos echaban de lado, pero con esto de la pandemia, todos empezamos de cero, pero a nosotros nos acompaña un decimal más.

El polvo es la gamuza, el arte es el receptor y la pandemia somos los vivos. La agilidad vital fundamenta la existencia, esa que es leve y alargada. La algarada mortal, la entropía inversa inunda las cabelleras hirsutas de la planicie alpina donde desembocan las almas enconadas sin raíces en la nueva realidad, monte sin plumas, venus helado y sombras claras. Después de cristo y antes de covid, en minúsculas, como nosotros.

Los textos cortos, como en Twitter, (aquí vendría ahora un emoticono) en mayúscula, universo cabreado. Los más jóvenes sólo quieren vídeos, no leen, esto es entender un mosaico, ellos entienden piedras sueltas. Es su mundo, no este, que yo ya tengo el mío, y como es redondo, no me van a echar de el. Es imposible.

Ahora, en esta estratosfera y psicoesfera sólo queda acomodarse en el peor sentido de la imagen. Ya no hay acomodadores en los cines y los ancianos degustan yogures y los niños ya no son niños, son levemente la estulticia de sus cortas sombras. Menos duró un imperio. Así, en minúsculas para el que se las merece.

G.R.M.

NO TITLE

I have always commented and thought that there are titles that deserve a work. There they are “The unbearable lightness of being” or “The shadow of the cypress is elongated.” Works of art that encompass and at the same time involve in a feedback to the own writing of volume and spine, this is the constructive end for which they were created, engineering to cross a mighty river where in the end only the bridge and a scar of what remains that there furrowed.

Just turned fifty, I’m not from this world. I have not thrown in the towel nor am I coming back. I neither understand nor want to be understood. They already put us aside, but with this pandemic, we all started from scratch, but we are accompanied by one more decimal place.

The dust is the chamois, the art is the receiver and the pandemic is the living. Vital agility bases existence, that which is light and long. The deadly riot, the inverse entropy floods the shaggy hair of the Alpine plain where the festering souls without roots flow into the new reality, a mountain without feathers, frozen Venus and clear shadows. After christ and before covid, in lowercase, like us.

The short texts, as in Twitter, (here now an emoticon would come) in capital letters, pissed off universe. The youngest only want videos, they don’t read, this is understanding a mosaic, they understand loose stones. It is their world, not this one, I already have mine, and since it is round, they will not throw me out of it. It is impossible.

Now, in this stratosphere and psychosphere, it only remains to accommodate in the worst sense of the image. There are no longer ushers in the cinemas and the elderly taste yogurts and children are no longer children, they are slightly the stupidity of their short shadows. An empire lasted less. Thus, in lowercase for those who deserve them.

COVID, GRIPE Y RESFRIADO (SENTIDO) COMÚN

Seré breve. Según la Universidad de Maryland, EE.UU. hizo un estudio allá por el “lejano” 2018: “Descubrimos que las personas que tienen gripe contaminan con virus el aire que les rodea simplemente al respirar, sin necesidad de toser ni estornudar“, reconoce Donald Milton, profesor de salud ambiental en Maryland y principal investigador del estudio. Este especialista explica que las personas con gripe generan aerosoles infecciosos, que son pequeñas gotas que permanecen suspendidas en el aire durante mucho tiempo, incluso cuando no están tosiendo, y especialmente durante los primeros días de la enfermedad.

¿Les suena? Por tanto la gripe no ha podido desaparecer, si así fuera, tampoco habría contagio por aerosoles de la Covid-19. Es curioso. Hasta ahora, ¡¡¡SEIS CASOS DE GRIPE en la temporada 2020/21 en España!!! Con sentido común, esto es imposible de creer.

Conclusión: Si tengo gripe y el año pasado o hace dos pasé un resfriado común por coronavirus, las PCR dan positivos en bastantes casos y tenemos parte de la ecuación resuelta. Un positivo por covid que en realidad es una gripe. Incluso muertes por gripe achacadas con PCR a la covid.

Si los aerosoles son el vehículo y el SarsCov-2 y el resfriado son coronavirus y viajan en el mismo vehículo, el resfriado común no ha desaparecido y la gripe tampoco. ¿Por qué motivo iban a desaparecer si utilizan la misma forma de propagarse? Quiero decir, si hay Covid, hay aerosoles y si hay aerosoles, hay gripe y resfriado común.

G.R.M.

COVID, FLU AND THE COMMON COLD

I’ll be quick. According to the University of Maryland, USA did a study back in the “distant” 2018: “We discovered that people who have the flu contaminate the air around them with viruses simply by breathing, without the need to cough or sneeze,” he acknowledges. Donald Milton, a Maryland professor of environmental health and the study’s principal investigator. This specialist explains that people with the flu generate infectious aerosols, which are small droplets that remain suspended in the air for a long time, even when they are not coughing, and especially during the first days of the illness.

Does it ring a bell? Therefore, the flu has not been able to disappear, if it were, there would be no spread by Covid-19 aerosols. It’s curious. So far, SIX CASES OF FLU in the 2020/21 season in Spain !!! With common sense, this is impossible to believe.

Bottom Line: If I have the flu and I had a common cold from coronavirus last year or two, PCR tests are positive in quite a few cases and we have part of the equation solved. A positive for covid that is actually a flu. Even deaths from influenza attributed with PCR to covid.

If the aerosols are the vehicle and the SarsCov-2 and the cold are coronavirus and they travel in the same vehicle, the common cold has not disappeared and neither has the flu. For what reason would they disappear if they use the same way of spreading? I mean, if there is Covid, there are sprays and if there are sprays, there is flu and the common cold.

GINA CARANO

La actriz Gina Carano ha sido despedida de su trabajo. ¿El problema? Ha mentado a los judíos. ¡Escuchen! Estados Unidos está dirigido por judíos así como los medios de comunicación, incluidos el cine y las series de televisión, manejan la producción, realización y la moderna distribución.

Es curioso, sus empresas lacayas de comunicación tienen la orden de dar un perfil bajo del Estado de Israel, esto quiere decir que ha de salir en los medios lo menos posible. Siempre han estado en las sombras, en las frías penumbras del poder.

Nadie puede criticar a los judíos, esto lo saben bien escritores, directores de cines, guionistas, productores, actores, catedráticos, políticos, presentadores de tv, empresarios y empresas, y un largo etc. Si lo hacen, su carrera está acabada. Es increíble el poder de esta secta del menos del 1% sobre el resto de la humanidad.

Es la prueba del algodón, ¿a quién no puedes criticar? a quien manda. Pues seamos un poquito rebeldes, propongo el hashtag #yocriticoalosjudios y dejar de ver “The Mandalorian” así como los productos de Lucasfilm y Disney.

Hagámosle ver que sin su “rebaño” goyim, esto es, gentiles, que quiere decir, los no judíos, no son nadie. Basta de dictaduras culturales, sociales y “democráticas”.

G.R.M.

GINA CARANO

Actress Gina Carano has been fired from her job. The problem? She has mentioned the Jews. Listen! The United States is run by Jews just as the media, including movies and television series, drive production, making, and modern distribution.

It is curious, their lackey communication companies have the order to give a low profile of the State of Israel, this means that it has to appear in the media as little as possible. They have always been in the shadows, in the cold gloom of power.

Nobody can criticize Jews, this is well known by writers, movie directors, screenwriters, producers, actors, professors, politicians, TV presenters, businessmen and companies, and much more. If they do, their career is over. The power of this sect of less than 1% over the rest of humanity is incredible.

It’s the cotton test, who can’t you fault? who’s boss Well, let’s be a little rebellious, I propose the hashtag #Icriticizethejews and stop watching “The Mandalorian” as well as Lucasfilm and Disney products.

Let’s make him see that without his “flock” goyim, that is, gentiles, which means, non-Jews, they are nobody. Enough of cultural, social and “democratic” dictatorships.

Iglesias, Navalni, Rhodes y Soros

Cuatro apellidos y cinco nacionalidades. El paraguas de Soros, judío, cubre a los otros tres. Iglesias cubre al otro judío, Rhodes, de los de clase alta de la City londinense, con paraguas sin abrir. Iglesias le cierra el paraguas a Navalni, pero en realidad no le cubría la cabeza, órdago.

¿El problema? Putin no necesita paraguas. Borrell cree que la lluvia de Europa moja igual que la de Rusia. Cala más. El paraguas se le queda pequeño. Soros lo sabe. Abre dos cortes con una navaja. Siempre le interesó una Europa débil, resquebrajada, dividida.

Pero aquí rozan muchos paraguas, se saltan ojos. Soros contra Putin. A los dos les interesa la Europa fragmentada. Los dos ven bien el conflicto catalán. Aquí no se moja ninguno. A Iglesias le presta Soros un paraguas ruso, se cala hasta los hombros. Rhodes toca el piano.

Borrell, cuando no llueve, se cierra el paraguas. Putin juega sus cartas. ¿A qué no sabes qué carta del tarot le han tirado? El paraguas. -¡Pero esa no existe! -Y menos de seis puntas. Tampoco se abre en un sitio cerrado. Ahí sólo se toca el piano.

Llueve en Europa, se empapa España. Se necesita paragüero. Siempre España. Abre las cartas, cierra el paraguas, suenan dos pianos a ocho manos pertenecientes a Soros, digo los pianos, no las manos ¿o sí?. Y suena una balalaika.

Y se hace la melodía.

G.R.M.

Iglesias, Navalni, Rhodes y Soros

Four surnames and five nationalities. Soros’s umbrella, a Jew, covers the other three. Iglesias covers the other Jew, Rhodes, of the upper class of the London City, with unopened umbrellas. Iglesias closes Navalni’s umbrella, but it wasn’t really covering his head, hell.

The problem? Putin does not need an umbrella. Borrell believes that Europe’s rain is just as wet as Russia’s. He seeps more. The umbrella is too small for him. Soros knows it. He opens two cuts with a razor. He was always interested in a weak, cracked, divided Europe.

But here many umbrellas touch, eyes pop. Soros against Putin. They are both interested in fragmented Europe. They both see the Catalan conflict well. None of them get wet here. Iglesias lends Soros a Russian umbrella, sinks down to his shoulders. Rhodes plays the piano.

Borrell, when it doesn’t rain, closes the umbrella. Putin plays his cards. Don’t you know what tarot card they have thrown? The umbrella. -But that doesn’t exist! -And less than six points. Nor does it open in a closed place. There you only play the piano.

It rains in Europe, Spain is soaked. Umbrella stand is needed. Always Spain. He opens the cards, closes the umbrella, two eight-handed pianos belonging to Soros are playing, I mean the pianos, not the hands, right? And a balalaika sounds.

And the melody is made.

EL COHETE ESQUIZOFRÉNICO

¿Y si la verdad está escrita en un blog como este? U otro cualquiera. Estamos viajando con una puerta abierta que no controlamos. Por esa puerta salen y entran deseos incontrolados, pensamientos, amigos, sentimientos, enemigos, silencios, aire, jaleos, futuros y desconocidos, amantes y males de ojos, antígenos, aguacates y agujas curvas. Entra y sale tu yo, acompañado en el peor kilometraje de demasiada compañía, a veces vacía, mucho vacío, tanto, que a veces hay que vaciar. Un viaje en retroceso, con más carga, la que vamos soltando en flashback y rescatamos in situ en el futuro rebobinado. Un futuro quieto, un pasado inquietante y un presente congelado. Es la fórmula para viajar. ¿Me acompañas?

Pues ya hemos llegado. Hemos salido. ¡Cierren la puerta! Ya estamos fuera, no podemos salir. Vi por la ventana a mis vecinos de asiento, me saludaban con las manos, sin bocas, decían adiós y hola a la vez. La puerta era capaz de esa artimaña, frontera de siempre la verdad, el espejo es la mentira, no el reflejo.

Una vez aterrizado seguíamos allí. Nos apeamos pero seguíamos allí. Y seguíamos. La puerta se cerró. ¡Pueden bajar! Entonces subieron. El sol me cegaba, la luz incontrolable hacía de la oscuridad un parto hermoso, hijo de la locura, padre del orden y bastardo de la entropía, encomienda familiar, estado puro: nacer, viajar, enloquecer. Hacer.

¡Abran! Nos quedamos en el planeta, conmigo. Ahora somos muchos, tantos y tan unidos que formamos parte de la corteza. La psicoesfera ya estaba, nació prematura y nos dice que todos retroviviremos. Ya estábamos aquí, curioso, porque también estaremos.

Un viaje estático, un viaje a lo desconocido. Y la puerta abierta…

G.R.M.

THE SCHIZOPHRENIC ROCKET

What if the truth is written on a blog like this? Or any other. We are traveling with an open door that we do not control. Through that door come and go uncontrolled desires, thoughts, friends, feelings, enemies, silences, air, hassles, futures and strangers, lovers and evil eyes, antigens, avocados and curved needles. Your self comes in and goes out, accompanied by the worst mileage of too much company, sometimes empty, much empty, so much so that sometimes you have to empty. A trip backwards, with more load, which we are releasing in flashback and we rescue in situ in the future rewind. A quiet future, a haunting past, and a frozen present. It is the formula for traveling. Will you accompany me.

Well, we have already arrived. We have dated. Close the door! We are already out, we cannot go out. I saw my neighbors sitting through the window, they waved to me, without mouths, said goodbye and hello at the same time. The door was capable of that trick, the usual border of truth, the mirror is the lie, not the reflection.

Once landed we were still there. We got out but we were still there. And we continued. The door closed. They can go down! Then they went up. The sun blinded me, the uncontrollable light made the darkness a beautiful birth, child of madness, father of order and bastard of entropy, family entrustment, pure state: being born, traveling, going crazy. Do.

Open up! We stay on the planet, with me. Now we are many, so many and so united that we are part of the crust. The psychosphere was already there, it was born prematurely and it tells us that we will all live back. We were already here, curious, because we will also be there.

A static journey, a journey into the unknown. And the open door …

¿POR QUÉ NO HAY UNA VACUNA CON VIRUS ATENUADO? (Covid19)

Supongo que en el mundo en el que vivimos hoy en día, se puede preguntar sin ser borrado de Internet y sin que te señalen como “negacionista”. Peligro.

Según la CDC (Centros para el Control y la Prevención de Enfermedades de EE.UU.), hay o habrá tres clases de vacunas para el COVID-19: 1) Las vacunas ARNm; 2) Las vacunas de subunidades proteicas y 3) Las vacunas de vectores.

Como bien dice la CDC, Para despertar la respuesta inmunitaria, el sistema de muchas vacunas consiste en inyectar el germen atenuado o inactivado en nuestros organismos. Pero ninguna de las tres vacunas propuestas, son del tipo “tradicional”. Pero ¿Por qué?

Hay tres opciones, empecemos por la última, no les da la gana. La primera, el virus SARS-Cov-2 no existe y la segunda, no han conseguido secuenciarlo y aislarlo al completo. Creo que la última es la correcta. No se puede hacer una vacuna de virus atenuado si este no se conoce del todo. Lógico.

Y hay más preguntas ¿saben los Gobiernos y estas grandes farmacéuticas algo que el vulgo no sabe? ¿Se ha traficado con información? ¿Puede que el SARS-Cov-2 sea una quimera de tres virus y al menos uno de ellos no tenga vacuna descubierta ni “futurible” ni “tradicional”?

Como alguien dijo, las preguntas no son indiscretas, lo son las respuestas… Pero en este caso, ¿Por qué?

G.R.M.

WHY IS THERE NO VACCINE WITH VIRUS ATTENUATED? (Covid19)

I suppose that in the world we live in today, you can ask without being deleted from the Internet and without being singled out as a “denier”. Danger.

According to the CDC, there are or will be three classes of vaccines for COVID-19: 1) mRNA vaccines; 2) Protein subunit vaccines and 3) Vector vaccines.

As the CDC says, To awaken the immune response, the system of many vaccines consists of injecting the attenuated or inactivated germ into our organisms. But none of the three proposed vaccines are of the “traditional” type. But why?

There are three options, let’s start with the last one, they don’t feel like it. The first, the SARS-Cov-2 virus does not exist and the second, they have not managed to sequence and isolate it completely. I think the last one is correct. An attenuated virus vaccine cannot be made if the virus is not fully known. Logical.

And there are more questions. Do the governments and these big pharmaceutical companies know something that the common people do not? Has information been trafficked? Could it be that SARS-Cov-2 is a chimera of three viruses and at least one of them does not have a discovered, “future” or “traditional” vaccine?

As someone said, the questions are not indiscreet, the answers are … But in this case, why?

En la gripe asiática de 1957-58, rechazaron los encierros

Jeffrey A. Tucker – 12 de enero de 2021

La gripe asiática de 1957-58 fue una pandemia mortal con un alcance más amplio para resultados graves que Covid-19 de 2020. Mató entre 1 y 4 millones de personas en todo el mundo, y 116.000 en los Estados Unidos en un tiempo con la mitad de la población. Fue un importante contribuyente a un año en el que Estados Unidos vio 62.000 muertes en exceso.

A nivel mundial, podría haber sido cinco veces más mortal que Covid-19, medido por muertes per cápita. Era inusualmente letal para las personas más jóvenes: el 40 por ciento de las muertes se habían producido entre personas menores de 65 años, mientras que la edad promedio de muerte de Covid-19 es de 80, con sólo el 10-20% de las muertes menores de 65 años.

Lo que llama la atención es cómo los funcionarios de salud pública manejaron la pandemia. Tuvo una respuesta diametralmente opuesta a la que los responsables políticos persiguieron en 2020. Se podría suponer que esto se debió a la negligencia y la falta de sofisticación en la comprensión de la necesidad de encierro. ¡Seguro que no sabían hace 65 años lo que sabemos hoy!

En realidad, esto es completamente falso. De hecho, los expertos en salud pública consideraron el cierre de escuelas, el cierre de negocios y la prohibición de los eventos públicos, pero todo el espíritu de la profesión los rechazó. Había dos motivos para este rechazo: los bloqueos serían demasiado perturbadores, inhabilitando la capacidad de los profesionales médicos para hacer frente competentemente a la crisis, y también porque esas políticas serían inútiles porque el virus ya estaba aquí y se estaba propagando.

Mientras que los bloqueos en el caso Covid-19 podrían haber contribuido a alargar la crisis retrasando la inmunidad del rebaño, el período en el que la gripe asiática tuvo las consecuencias más graves fue de sólo tres meses. Los periódicos apenas lo cubrían y la mayoría de la gente no se daba cuenta. Las historias de la época apenas lo mencionan, mientras que la historia temprana de 2020 hablará principalmente sobre el virus y los encierros. Esto no se debe a la pandemia, sino a la brutal respuesta de la política de pandemia.

El mejor artículo único sobre la respuesta de la política de gripe asiática de 1957-58 es “Salud Pública y Respuestas Médicas a la Pandemia de Influenza 1957-58” por el gran epidemiólogo Donald A. Henderson y otros entre sus colegas en Johns Hopkins. Apareció en 2009 en la revista Biosecurity and Bioterrorism: Biodefense Strategy, Practice, and Science. Se incrusta al final de este artículo.

El artículo es de vital importancia porque demuestra que no bloquear fue una decisión deliberada, no algún tipo de fracaso. La negativa a perturbar la sociedad y restringir la libertad en presencia de un patógeno fue un logro de las ideas modernas de salud pública. Desde el mundo antiguo hasta el siglo XIX, la respuesta típica a la enfermedad era atribuirla al aire corrupto y huir mientras demonizaba y excluyeba a los enfermos. Los avances médicos modernos, con el descubrimiento de virus y bacterias, antibióticos, terapias antivirales y el funcionamiento del sistema inmunitario humano, aconsejaron la calma de la comunidad y las relaciones médico-paciente.

El organismo de salud pública más influyente en ese momento era la Asociación de Oficiales de Salud Estatales y Territoriales (ASTHO). Se conocieron el 27 de agosto de 1957. Llegaron a la conclusión de que deberían recomendar la atención domiciliaria tanto como sea posible para evitar que los hospitales se abarroten. Instruirían a las personas a buscar atención médica si los síntomas se vuelven graves.

De lo contrario, ASTHO concluyó de la siguiente manera: «’No hay ninguna ventaja práctica en el cierre de escuelas ni en la restricción de las reuniones públicas en lo que se refiere a la propagación de esta enfermedad».

En particular, las escuelas no estaban cerradas porque los expertos en salud pública observaron que los niños simplemente recogerían el virus en otros lugares. “El Comisionado de Salud del Condado de Nassau en Nueva York”, señala Henderson, “declaró que ‘las escuelas públicas deben permanecer abiertas incluso en una epidemia’ y que ‘los niños se enfermarían con la misma facilidad para salir de la escuela'”.

Hemos oído incesantemente que Covid-19 requirió cierres porque es una nueva cepa para la que no hubo una vacuna. Bueno, la gripe asiática ya era nueva y tampoco había vacuna. Para cuando llegó uno, era sólo 60% eficaz y no ampliamente utilizado. Henderson comenta: “Es evidente que la vacuna no tuvo ningún efecto apreciable en la tendencia de la pandemia”.

¿Tal vez tuvimos que cerrar debido a casos asintomáticos? No es verdad. Henderson señala sobre la gripe asiática: “Las tasas de ataque en las escuelas oscilaron entre el 40% y el 60%. Las encuestas serológicas revelaron que la mitad de los que no reportan enfermedad de la gripe mostraban evidencia serológica de infección”.

Para estar seguro de que hubo interrupciones. No ocurrieron por la fuerza, sino por necesidad debido al ausentismo. Fueron efímeros. Los millones de personas expuestas al virus desarrollaron anticuerpos y continuaron. Esto era cierto en particular para los escolares:

“El ausentismo escolar alcanzó su máximo con 280.000 ausencias el 7 de octubre. Esto equivalía al 29% de todos los asistentes a la escuela. La tasa más alta se registró para las escuelas de Manhattan, que tenían una tasa general de 43% de ausencia. Ese día, 4.642 profesores (11%) no se reportó al trabajo debido a estar enfermo. Los establecimientos comerciales, sin embargo, no reportaron un aumento significativo del ausentismo. Dentro de las 2 semanas después del pico,las tasas de absentismo escolar casi volvieron a la normalidad, alrededor del 7%”.

Los informes de periódicos en ese momento no ofrecen ningún registro de cancelaciones generalizadas de eventos públicos y mucho menos cierres forzosos. A veces, los partidos de fútbol de la universidad y de la escuela secundaria se pospusieron debido a ausencias por enfermedad. Algunas convenciones fueron canceladas por los organizadores. Pero eso es todo.

El único editorial del New York Timessobre la gripe asiática reflejó la sabiduría de salud pública: “Mantengamos la cabeza fría sobre la gripe asiática a medida que comienzan a acumularse las estadísticas sobre la propagación y la virulencia de la enfermedad”.

Henderson concluye lo siguiente:

La pandemia de 1957-58 fue una enfermedad tan rápidamente diseminada que se hizo rápidamente evidente para los funcionarios de salud estadounidenses que los esfuerzos para detener o frenar su propagación eran inútiles. Por lo tanto, no se hicieron esfuerzos para poner en cuarentena a individuos o grupos, y se tomó la decisión deliberada de no cancelar o posponer grandes reuniones como conferencias, reuniones de la iglesia o eventos deportivos con el fin de reducir la transmisión.

No se hizo ningún intento de limitar el viaje o de otros casos examinar a los viajeros. Se hizo hincapié en la prestación de atención médica a las personas afectadas y en mantener el funcionamiento continuo de los servicios comunitarios y de salud. Las enfermedades febriles y respiratorias llevaron a un gran número de pacientes a clínicas, consultorios médicos y salas de emergencia, pero un porcentaje relativamente pequeño de los infectados requirieron hospitalización.

El ausentismo escolar debido a la gripe era alto, pero las escuelas no estaban cerradas a menos que el número de estudiantes o maestros cayera a un número lo suficientemente bajo como para justificar el cierre. Sin embargo, el curso del brote en las escuelas fue relativamente breve, y muchos podrían volver fácilmente a las actividades en un plazo de 3 a 5 días. Se dijo que un número significativo de trabajadores sanitarios estaban afectados por la gripe, pero los informes indican que los hospitales eran capaces de adaptarse adecuadamente para hacer frente a las cargas de los pacientes.

Los datos disponibles sobre el absentismo industrial indican que las tarifas eran bajas y que no se interrumpió los servicios esenciales ni de la producción. El impacto global sobre el PIB fue insignificante y probablemente dentro del rango de variación económica normal.

Los funcionarios de salud tenían la esperanza de que los suministros significativos de vacunas pudieran estar disponibles a su debido tiempo, y se hicieron esfuerzos especiales para acelerar la producción de vacunas, pero las cantidades que se disponían eran demasiado tarde para afectar el impacto de la epidemia. La propagación nacional de la enfermedad fue tan rápida que en 3 meses había arrasado por todo el país y había desaparecido en gran medida.

Uno lee este relato detallado de cómo la salud pública respondió entonces en comparación con ahora y la respuesta es llorar. ¿Cómo pudo pasarnos esto? Sabíamos con seguridad que los encierros eran terribles para la salud pública. Lo sabemos desde hace 100 años.

El cierre de una economía contradice rotundamente un principio fundacional de la Organización Mundial de la Salud: “El desarrollo económico y la salud pública son inseparables y complementarios… el desarrollo social, cultural y económico de una comunidad, y su estado de salud, son interdependientes”.

En 1957-58, los funcionarios de salud pública se tomaron en serio esa observación. Esta gripe muy grave se produjo y se produjo con una mínima perturbación social y económica. Sistemas inmunes en los Estados Unidos y en todo el mundo adaptados a la nueva cepa de la gripe.

Diez años más tarde, llegó una nueva mutación de esta gripe. La salud pública respondió de la misma manera, con sabiduría, calma y sin intervenciones en los derechos y libertades de las personas. El funcionamiento social y económico se consideró acertadamente crucial para una visión global de la salud pública.

Los bloqueos fueron descartados en el pasado precisamente para que el daño de una pandemia se minimizara y pudiéramos superarlo más rápidamente. Esta era la ciencia. Esta fue la ciencia hasta la primavera de 2020, cuando todo cambió. De repente, la “ciencia” favoreció olvidar todo lo que hemos aprendido del pasado y reemplazarlo por políticas brutales que destrozaron la economía y la vida de las personas, al tiempo que no lograban nada en términos de minimizar el daño pandémico.

Habíamos pensado en nosotros un vocabulario completamente nuevo diseñado para disfrazar lo que se nos estaba haciendo. No estábamos bajo arresto domiciliario, nuestros negocios destrozados, las escuelas cerradas, las artes en vivo y los deportes abolidos, nuestros planes de viaje destrozados y separados por la fuerza de sus seres queridos. No, sólo estábamos experimentando “mitigación de enfermedades” a través de “contención en capas dirigidas”, “intervenciones no farmacológicas” y “distanciamiento social”.

Todo esto es Owelliano con la sabiduría tradicional de salud pública habiendo sido derribado por el agujero de la memoria. La ciencia real no cambió. La salud pública tradicional nos implora que consideremos no sólo un patógeno, sino todas las variables que afectan a la salud, no sólo a corto plazo, sino también a largo plazo. Así fue y así es hoy.

In the Asian Flu of 1957-58, They Rejected Lockdowns – AIER

JewSA

A veces, ahora en este tiempo digital, los comentarios en los artículos son una parte inherente del mismo, una especie de receptor espejo que lo transforma en un todo emisor, es decir, es o son parte del artículo en sí mismo.

Este caso es un comentario del artículo El Congreso está desnudo. La ocupación del Capitolio y el populismo post-Trump. De JOHN MORGAN • 8 DE ENERO DE 2021 en http://www.unz.com con Nick Priss Factor:

Sometimes, now in this digital age, comments on articles are an inherent part of it, a kind of bouncing receiver that transforms it into a whole emitter, that is, it is or are part of the article itself.

This case is a comment on the article The Congress Has No Clothes.The Capitol Occupation & Post-Trumpian Populism. From JOHN MORGAN • JANUARY 8, 2021 at http://www.unz.com with Nick Priss Factor:

[ Todos estos expertos en medios de comunicación, demócratas y cuckservatives llamando a la demolición del Estado Profundo de 1/6 una “insurrección” es realmente ROTFL.

Quiero decir, ¿cuáles fueron los cuatro años de la Administración Trump pero insurrección ininterrumpida de judíos, Deep State, Big Media, Big Tech, e instituciones financieras. Sus acciones iban de encubiertas a despreociadas, pero todo lo que hicieron fue socavar y frustrar la Presidencia y la agenda de Trump. Obama, el Estado Profundo y Big Media se confabularon para impulsar el engaño de colusión de Rusia e incluso espiaron la campaña de Trump sobre “pruebas” que sabían que era falsa. Esto fue 100 veces peor que Watergate, pero si eres parte del club de hombres ‘hechos’, puedes salirte con la tuya con cualquier cosa. Los judíos gobiernan, y eso significa que cualquiera que colabore con los judíos está a salvo sin importar lo que haga. Y cuando estos planes conspiratorios y nefastos no funcionaron, los judíos del Estado Profundo prepararon el escándalo de Ucrania. La mayoría de los involucrados eran judíos. Estos judíos trabajaron con elementos “neonazis” en Ucrania para derrocar a un gobierno elegido democráticamente a través de un golpe violento. E instalaron un régimen de marionetas que hizo lo que les dijo a los políticos estadounidenses que, a su vez, están controlados por la mafia judía. Y Joe Biden se entrometió en los asuntos de ese país y socavó su proceso legal, lo cual fue una broma para empezar. Pero Biden es un “hombre hecho” a los ojos de los judíos y el Estado Profundo, así que no importaba lo que hiciera. En Washington, lo que haces importa mucho menos que quien eres. El viejo adagio de “¿Sabes quién soy?” es de lo que se trata esa ciudad: Poder > Principios. Siempre fue así, pero se atemorizó bajo los judíos que ni siquiera tienen el mínimo de honor que las élites de la Avispa alguna vez tuvieron.

Trump, a pesar de ser presidente, no era un “hombre hecho”. No era parte del club. Los judíos le habían permitido hacerse rico en Nueva York y servir como la cara de los magnates inmobiliarios cuando, de hecho, los judíos dominan la industria. Trump fue útil como un juguete goy: Era la idea de la clase trabajadora de lo que se trata de las riquezas. Por lo tanto, los “deplorables” podrían verlo como un multimillonario de celebridades, una historia de super-éxito, pero judíos y élites lo consideraron grosero y crudo. Fue útil cuando jugó el juego, pero intolerable como el mejor, especialmente cuando cabalgó a la victoria en la ola de revuelta populista.

¿Cómo se sintió Trump realmente por su papel como presidente? ¿Dio prioridad a la voluntad de las personas que votaron por él pero no lograron ganar tracción debido a las fuerzas profundamente arraigadas que le rodeaban? No. En vano, narcisista, arrogante e inseguro al mismo tiempo, usó su estatus de vagabundo principalmente para ganar la aprobación de las super-élites y ser aceptado como un “hombre hecho”. Pero eso no iba a suceder. Dijo demasiadas cosas que enfurecieron a los judíos e insultaron al Estado Profundo. ‘America First’ desencadenó a los judíos sobre el “antisemitismo” al estilo de Charles Lindbergh. Los judíos tomaron el “globalismo” como una palabra clave para el Poder Judío. Y al Estado Profundo no le gustaba que le llamaran el “swamp”. En vanidoso y mocoso, a pesar de ser escoria de chelín y criaturas pantanosas, los Deep Staters se consideran los Mejores y los Más Brillantes que están trabajando honorablemente para el imperio.

Ahora, si Trump hubiera ido realmente en contra del Estado Profundo y el globalismo, habría sido condenado como presidente de un solo mandato. Pero iba a ser un presidente de un período sin importar lo que hiciera porque los judíos y el Estado Profundo nunca le perdonarían por su campaña de 2016. Si, al menos, Trump se hubiera aferrado a alguna apariencia de un camino de principios, podría haber perdido con cierta medida de honor y autoestima. Pero incluso cuando se convirtió en presidente meando en el pantano, esperaba ganar la reelección y ser aceptado como un infiltrado y ‘hecho hombre’ lanzando lirios al pantano una vez que se convirtió en presidente. Mira a las criaturas del pantano con las que se rodeó. (Y pensó que estaba ganando a los políticos republicanos a su agenda populista cuando, de hecho, los cucks estaban jugando para ganar votos entre los rubíes. Los políticos republicanos sabían que Trump probablemente duraría cuatro años o, como mucho, ocho, ¿y luego qué? Sin la energía populista sostenida por Trump, la política volverá a lo mismo de costumbre y eso significa atornarte a los judíos en casi todo. Los republicanos necesitaban apoyar a Trump en favor de los votos populistas, pero, a espaldas de Donald, tenían que asegurar a los judíos que sólo estaban jugando y realmente despreciaban a Trump y que trabajarían con judíos tras bambalinas para desbancarlo. La política es “negocio”. Es como Si Sal en EL PADRINO se encienda el Corleones una vez que se da cuenta de que el nuevo caballo fuerte es Barzini. Trump, lleno de sí mismo, pensó que los republicanos y las criaturas del Pantano en su administración estaban de su lado porque sonreían y lo llamaban “Mr. President”, pero todo fue sólo un acto. Sabían que, una vez que Trump se haya ido, el único juego en la ciudad va a ser el poder judío jugando ‘Simon Says’, y la única manera de salvar sus perspectivas a largo plazo era guiñar un guiño a los judíos que “sólo estaba fingiendo estar en el equipo de Trump, pero realmente estaba trabajando contra él todo el tiempo”. Pero entonces, el truco de Trump no era tan diferente del shtick republicano Cuck. Trump usó el populismo para convertirse en presidente para ganarse el respeto de las élites, y los republicanos de Cuck usaron el Trumpismo para ganar votos de la base populista y permanecer en el cargo, mientras buscaban mantener buenas gracias con los todopoderosos judíos.)

Las contradicciones de Trump eran contraproducentes, y el único resultado fue perder con deshonra. No sólo no pudo ganar la aceptación y el respeto del Estado Profundo, sino que también perdió el apoyo de sus partidarios incondicionales. El Estado Profundo lo perseguió desde el primer día, y para retroceder, tuvo que llamar al pantano. Pero al insultar tanto al Estado Profundo, enajenó aún más las instituciones que intentaba cortejar para ganarse el “respeto”. ¿Y qué planeaban obsesivamente los judíos todos los días durante los cuatro largos años? Cómo deshacerse de Trump. Cuando los judíos quieren algo, nunca se dan por venados y siguen royendo como roedores. Cuando lo de Rusia y Ucrania no lo desbancó, Trump pensó que estaba por encima del obstáculo y relajó su guardia. Pero los judíos y el Estado Profundo estaban tramando la mayor insurrección de todos ellos. Hunde la economía y la aprobación de Trump con la histeria de Covid. Entonces, el mayor activo de Trump desapareció en el aire. Y fue manchado como un asesino de todas esas víctimas de Covid. Y la comunidad médica, también dirigida por judíos, jugaba.

Lo que pasa con los judíos es que siempre elegirán el poder sobre los principios. Son jugadores que ven el mundo como un concurso sin fin de los kers y los tontos, y no quieren ser tontos. Los judíos no sentirían así si los goyim fueran más inteligentes que los judíos, pero los judíos se sienten más inteligentes y creen que pueden correr círculos alrededor de dimwit goyim. Los judíos piensan: “¿Por qué debemos ser gobernados por los mismos principios que se aplican al goyim inferior?” Por lo tanto, su principal prioridad es mantener la supremacía sobre el goyim inferior. Los judíos ven a los goyim como adultos miran a los niños. Los adultos quieren autoridad sobre los niños, no la igualdad con ellos. Y en cierto modo, podemos entender de dónde vienen los judíos porque los goyim son tan tontos. Son tontos como el idiota en TOMAR EL DINERO Y CORRER que azota la sombra en lugar del prisionero.

Goyim debe ser inferior porque chupan totalmente a los judíos como perros. Cuando miras a los judíos y al goyim en los EE.UU., la relación es de amo y perro. El deseo más íntimo del dogoy es obtener la aprobación del maestro, y este sentimiento es común incluso entre la derecha disidente que mencionará el JQ pero orará por el día en que los judíos superiores vendrán al lado blanco.

De todos modos, cuando los actos insurrecciones del Estado Profundo contra Trump fracasaron, los judíos hicieron todas las paradas con disturbios de Covid-Hysteria y BLM. Los judíos, temerosos de que la economía de Trump y su estilo exagerador pudieran ganarse a un número récord de negros en las elecciones de 2020, decidieron ser un cerdo entero para deificar a los negros como santos. Así, con la aprobación total de judíos, Estado Profundo, Cucks Militares, alcaldes de la Gran Ciudad y los medios de comunicación dirigidos por judíos, se permitió a los negros correr salvajes, disturbios, violaciones y botín. Los negros podían hacer todo eso, pero la narrativa era “en su mayoría manifestantes pacíficos” están luchando contra el “racismo sistémico”.
Los judíos, que habían estado presionando a Globo-Homo para eclipsar problemas negros, usando la gentrificación y la Sección 8 para eliminar a los negros de las ciudades, aplicando políticas de leyes y orden más duras para encerrar a criminales negros, y favoreciendo a los inmigrantes sobre los negros, de repente todos sobre los NEGROS para convencerlos de que se mantuvieran con el Partido Demócrata. No importaba que BLM y Antifa estuvieran quemando ciudades, saqueando e incluso creando estragos totales en Washington D.C., muchas partes de las cuales estaban en llamas. Y cuando Trump pidió a los militares estadounidenses que intensificaran y hicieran algo, los altos mandos, en sintonía con el Estado Profundo y sus maestros judíos, rechazaron al presidente y no hicieron nada. Si esto no fue una insurrección desde dentro y sin, no sé qué es.

Y, estaban los medios de comunicación judíos y los Pollsters de los partidarios de Trump, diciéndoles que se quedaran en casa y no votaran porque Biden está liderando las encuestas por 10-15 puntos. Y luego la elección en sí fue masivamente fraudulenta. Tal vez, Biden realmente venció a Trump, pero ¿cómo podríamos saber con certeza cuándo ocurrieron tantas cosas divertidas e irregularidades? Y por supuesto, los medios de comunicación acaban de ir de acuerdo con la Gran Mentira. Si hubiera sido al revés con casos totalmente flagrantes de fraude electoral llevados a cabo por los republicanos, por supuesto el FBI, el estado profundo y los grandes medios habrían hecho todo lo posible para investigar cada queja. Imagínate si un condado blanco intimidara y echara a los observadores negros de las encuestas. Habría sido un escándalo nacional. Y, por supuesto, la Covid-Hysteria puso las bases para el fraude masivo por correo. Todos estos eran actos de insurrección, pero fueron hechos por ‘hombres hechos’ y sus esbirros. Al final, no es lo que haces, sino quién eres. Pero entonces, el Pen y Trump nunca hicieron frente al hecho de que los judíos son los “hombres hechos” más toppermost de Estados Unidos. De hecho, incluso después de las elecciones, ¿qué hizo Trump sino perdonar a algunas de las peores basuras judías? Es todo tan vergonzoso.

En cualquier caso, en lo que se refiere a la Narrativa Oficial, la insurrección del Estado Profundo no era una insurrección porque fue hecha por expertos, “expertos”, las élites, los judíos en la parte superior y los negros en la parte inferior. Es como si nunca fuera terrorismo cuando Estados Unidos, Israel o sauditas lo hacen. Pero si una nación como Irán utiliza la contra-violencia contra la violencia entre Estados Unidos e Israel, eso es “terrorismo”. Cada vez que agentes israelíes asesinan a alguien en Irán con ataques con bombas, observe que el New York Times pone el “terrorismo” entre comillas. Pero si árabes o musulmanes hacen estallar judíos, eso está bien. Todo asunto de quién/quién que

qué/no. Si eres parte del club ‘hecho’, lo que sea que hagas está bien. Así que Biden podría entrometerse en los asuntos de Ucrania. Pero si eres odiado por el club, incluso tus nobles actos son “traiciones”. Pero, ¿qué es la lealtad y la traición en un país donde la mayoría de los políticos-putas hacen poco más que chupar a los judíos supremacistas globalistas cuya única preocupación real es el poder tribal? Los judíos piensan así: El poder es #1. El juego es #2. El principio es #3. Como el poder es lo primero, los judíos cambiarán el juego para ganar. Vimos eso en 2020 con nuevas reglas electorales que hacían mucho más fácil hacer trampa. A los judíos les encanta el juego porque la victoria inteligente sobre los tontos. Es como si el ajedrez fuera un juego de ingenio que favorece a los inteligentes. Como los judíos saben que son más inteligentes, les encanta jugar el juego y ganar. Pero, ¿son buenos perdedores en ocasiones en las que pierden, como en 2016? No, son los perdedores más amables y van a cambiar las reglas del juego para ganar. Después de haber perdido el juego de Poker ante Trump en 2016, los judíos tenían muchas cartas en la manga en 2020. Los judíos recurren a los principios como tercera opción. Así que, cuando los judíos no estaban en la cima, fingían ser por la libertad de expresión y los derechos constitucionales. Los judíos de la ACLU apestaba mucho a la libertad, incluso defendiendo el discurso de los nazis y el KKK. Pero míralos ahora. Están totalmente bien con Big Tech silenciando a todo el mundo y hacer la vista gorda a la supresión de BDS. Con los judíos, pierdes.

Cuando los judíos difunden mentiras, es “libertad de prensa”. Aparentemente, las “noticias falsas” son difundidas sólo por la gente que los judíos odian. Cuando los judíos propagan el terror y logran golpes de estado en todo el mundo, es para “democracia liberal” o “derechos humanos”. Pero cuando los gobiernos nacionales se oponen al globohegemonismo judío, son “autocracias”. Según los judíos, los verdaderos valores europeos se trata de abrir el continente a Africa, Asia y Oriente Medio para que los “nuevos europeos” reemplacen a los “europeos racistas blancos” que no tienen derecho a identidad y cultura. Por lo tanto, la única manera adecuada para que un europeo sea un buen “europeo” es entregar su derecho de nacimiento, historia y territorio. Al igual que Barbara Specter dijo la horrible sionista: “Europa no puede sobrevivir” a menos que aprenda a dar la bienvenida al Gran Reemplazo. Pero entonces, los goyim blancos son tan tontos como para caer en esto. Si un sueco en Israel le dijera a los judíos que Israel no puede sobrevivir a menos que los judíos acojon a toneladas de africanos, hindúes, chinos y musulmanes como “nuevos israelíes”, los judíos se reirían de él. Pero el goyim blanco, tan idólatramente adorado por los judíos, escucha con un suspiro abanimado a la “sabiduría judía”, que en realidad es mentiras judías para debilitar y controlar los dominios goy a través de la estrategia de división y gobierno. Los judíos son ttingy con el poder. Cuando los judíos dan consejos a los goyim, no es enseñar a los goyim a ser más exitosos y más independientes, sino a ser más débiles y más dependientes de los judíos. ¿Qué pueblo y nación desde el final de la Guerra Fría se han beneficiado de recibir consejos de los judíos? ¿Qué pasó con Rusia en los años 90? ¿Cuál es el Plan Judío para Hungría?

Pero entonces, los blancos van de la mano con el status quo sin nombrar al judío. Apuesto a que incluso los “insurrectos” el 6 de enero creen que China, Irán, Rusia o Venezuela fueron los principales culpables del fraude electoral cuando, de hecho, fue EL JEWS. La gente tan tonta, delirante o desdiñada no ganará. Las grandes cosas deben crecer desde una base sólida. Esta es la razón por la que no se plantan semillas en rocas y guijarros o en el océano. Los planta en el suelo con mucha humedad y luz solar. No nombrar al judío es como plantar semillas en el desierto. Sidney Powell puede culpar a Venezuela, Linh Wood puede culpar a China, el general Flynn puede culpar a Irán, y los deplorables pueden culpar a la “izquierda”, pero son los judíos. (Si la verdadera izquierda está a cargo, ¿cómo es que BDS es suprimido por todos los lados? BdS se asocia generalmente con la izquierda, ya que pide JUSTICIA IGUAL para judíos y palestinos que siempre favorecer a los judíos uber palestinos. Si la izquierda real domina América, BDS estaría protegido por la Constitución. Pero apenas hay una izquierda real en los EE.UU. que esté controlada por judíos. La idolatría del Poder Judío, no la ideología de los principios izquierdistas, es el único manual real en la tierra.)
El árbol de la verdad y el poder crecerá y dará frutos para los blancos SOLO SI los blancos identifican y exponen a los judíos como las élites gobernantes de América. Cuando la gente se da cuenta de este conocimiento, todas las razas e ideologías mirarán hacia los judíos en cuanto a por qué está sucediendo lo que está sucediendo. Es peor para los blancos no nombrar al judío porque los judíos están 24/7 en nombrar a los blancos o ‘supremacismo blanco’ o ‘racismo sistémico’ (por el cual los blancos están hechos para soportar el 99% de la culpa) como la causa de todos los problemas.
Es como si los blancos estuvieran atrapados en un juego de slapper invisible. Un hombre sigue siendo abofeteado pero no ve quién lo está abofeteando. Por lo tanto, culpa a otros sin identificar nunca quién está realmente poniendo su cara en rojo. Y así, la bofetada continúa y continúa, y el tonto abofeteado pierde la cabeza y elige peleas con aquellos que no lo están abofeteando. Pero entonces, incluso los blancos que sí saben que los judíos los están abofeteando giran la otra mejilla porque si alguna vez se quejan, se les pone latón en la cara. Por supuesto, los judíos tienen aliados, y estos socios en el crimen tienen el blanco para que el judío abofetee. Pero la mentalidad blanca actual es culpar a los que lo sostienen sin mencionar nunca al que lo está abofeteando. Hablar duro sin hablar honestamente es realmente inútil. Mira a Linh Wood hablando duro pero sin nombrar al judío. Inútil. ]

https://www.bitchute.com/embed/Mq0gchHajYps/

The Congress Has No Clothes, by John Morgan – The Unz Review

Biden aún no está inaugurado y el “establishment” ya está fomentando la guerra civil

PAUL CRAIG ROBERTS • JANUARY 9, 2021

Trump fue demonizado antes de ser inaugurado. Fue demonizado porque fue percibido correctamente por el Establecimiento como una amenaza para el Establecimiento. La elección de Trump sorprendió al Establecimiento. El Establecimiento pensó que el control del Establecimiento sobre los medios de comunicación garantizaba su poder y se sorprendió al darse cuenta de que suficientes votantes estadounidenses vieron a través de sus mentiras y propaganda para elegir a una figura que no era de establecimiento.

El mundo no entiende que el Establecimiento Americano tenga una organización de propaganda que averguenza a la reunida por Joseph Goebbels. Los medios estadounidenses, nunca muy independientes, perdieron toda apariencia de independencia durante el régimen de Clinton cuando el 90% de los medios estadounidenses se concentró en seis manos y se convirtió en una herramienta completamente obediente del Establecimiento. Cualquiera que dude de esto debe explicar por qué en cada tema los preprimidos hablan con una sola voz, que nunca es la voz del pueblo.

Es extraordinario que alguien pudiera haber caído en la línea del Establecimiento que Trump conspiró con Putin para robarle las elecciones a Hillary, pero muchos lo hicieron. El Establecimiento no podía permitir la comprensión de que el Establecimiento Americano había sido rechazado por el pueblo estadounidense en las elecciones de 2016. Usando la CIA y el FBI, el Establecimiento se puso a trabajar en Trump. Sus cuatro años enteros fueron utilizados en la lucha orquestada Russiagate investigaciones y un impeachment orquestado. La mayoría de la gente en el mundo no sabe nada más de estos cuatro años que los titulares de la prensata de prensa estadounidense les dijeron.

En la Unión Soviética, el control estatal policial de Stalin le permitió incriminar al líder bolchevique Nikolai Bukharin como espía capitalista. En la democracia estadounidense, el Establecimiento ha sido capaz en la vista de robar la reelección de Trump y ahora lo está acusando de insurreccionista. El poder de este establecimiento es tan grande que los republicanos se han marchitado y se arrodillan ante el Establecimiento para protegerse. Los designados de Trump están dimitiendo y corriendo por sus vidas y reputación.

El complejo militar/de seguridad que utiliza el DNC y los medios de comunicación ha sido capaz de hacer lo que Stalin hizo: eliminar a la oposición.

El Establecimiento ha presentado ahora llamamientos a represalias contra senadores y representantes estadounidenses que apoyaron el intento de Trump de que se examinaran las pruebas de fraude electoral. He visto presentaciones de las pruebas de profesionales no partidistas, y la evidencia de fraude electoral es abrumadora. Sin embargo, se ha mantenido un profundo seis sin ser examinado nunca. En lugar de examinar, desde el primer día los preabasteces, ninguno de los cuales miraba las pruebas, repitieron sin cesar que no había pruebas. Trump, y no la elección robada, fue culpada por desacreditar la democracia estadounidense.

El Establecimiento Americano no ha terminado con Trump y sus partidarios. Las campañas de propaganda contra ellos bien podrían terminar en pruebas de espectáculos.

Facebook, Twitter y YouTube, al igual que los medios impresos y de televisión y NPR, se emplean para cerrar las explicaciones no de establecimiento. En consecuencia, nuevas organizaciones de medios sociales, como Parler han surgido como foros sin censura. A juzgar por la información enviada a Mark Crispin Miller y publicada en Notes from Underground (https://markcrispinmiller.com), Parler está ahora bajo ataque: “BREAKING – Apple ha dado #Parler un ULTIMATUM de 24 HORAS para implementar un “plan de moderación” o está siendo limpiado de la tienda de aplicaciones.” Si esto aún no ha pasado, lo hará. “Moderación”, por supuesto, significa el cumplimiento de los deseos del Establecimiento.

Los estadounidenses y los pueblos occidentales en general son personas muy insouciantes. El Establecimiento ha utilizado la Política de Identidad para desunirse a blancos, negros, hispanos, asiáticos, hombres y mujeres. Una población en guerra consigo misma no tiene perspectivas de enfrentarse al Establecimiento que ejerce el poder en su interés independientemente de los intereses del pueblo. En tal sistema, la democracia no es más que una cobertura para el gobierno oligárquico. Nadie está permitido en cargos públicos que no sea un servidor del Establecimiento. Todos los que de alguna manera lleguen allí son eliminados. La redistritación se utilizó para librar al Establecimiento de Dennis Kucinich. Ron Paul fue eliminado por el RNC por “una campaña sistemática de fraude electoral en las convenciones estatales” de acuerdo con una demanda en un tribunal federal de distrito. Si estos métodos de eliminación no están disponibles, las mujeres son sacadas para alegar acoso sexual o corrupción o enmarcamientos de impuestos se utilizan. Aquellos que no van de acuerdo con el Establecimiento no tienen una carrera. Esto también es cierto en el empleo corporativo y las universidades.

El miedo y la demonización son poderosas armas de establecimiento. La verdad y el logro humano de la libertad civil son sus víctimas.

Biden declara la guerra a los votantes de Trump

La guerra de Biden (el Establishment) contra el terrorismo interno es una guerra contra los deplorables de Trump. Como te dije, los americanos blancos normales están en ello. Aquí está Glenn Greenwald para contarle al respecto:

https://www.rt.com/usa/511976-greenwald-capitol-terror-crackdown/

Con la censura unilateral de un presidente estadounidense en funciones, Big Tech ha demostrado que es más poderoso que cualquier gobierno:

https://www.rt.com/op-ed/511958-social-media-politicians-censorship-riots/

Pelosi consulta con latón militar sobre cómo mantener nuclear CODES fuera de las manos de Trump:

https://www.rt.com/usa/511975-trump-departure-nuclear-riot-pelosi/

¿Matar al unificador? El presidente electo compara a Cruz, Hawley con el propagandista nazi Goebbels, dice que comparten la culpa de incitar a la violencia:

https://www.rt.com/usa/511984-biden-unity-goebbels-cruz/

Los demócratas de la Cámara de Estado filtran el borrador de Trump IMPEACHMENT para “incitar a la insurrección”:

https://www.rt.com/usa/511982-trump-insurrection-impeachement-draft-leaked/

Biden Is Not Yet Inaugurated and the Establishment Is Already Fomenting Civil War, by Paul Craig Roberts – The Unz Review

EL VIRUS CAE DEL CIELO

The virus falls from the sky

Que no del espacio exterior. Buscando y leyendo desde que empezó el tema del coronavirus, a falta de la coherencia oficial, como que en octubre de 2020 la OMS cambiara la versión y significado de “inmunidad de rebaño”, he leído de todo, hay que saber buscar. En los medios de comunicación masivos sólo hay un mensaje, dirigido y teledirigido a base de acallar al otro, al que piensa diferente pero también científicamente. Hay de todo, malo, bueno y barato, tanto en el mensaje oficial (ridículo, porque en realidad están diciendo que no sabemos nada de este virus, y más bien de los virus en general) como en los mensajes digamos extraoficiales, al menos llenos de matices y colmando un vacío que proporcionado a sabiendas, la propia naturaleza humana lo ocupa a veces hasta rebozar. Bueno, somos humanos, tan naturales como un virus, bueno, o no.

Yoichi Shimatsu, periodista y escritor en una saga de 28 escritos o artículos que van del 9 de enero al 16 de noviembre de 2020 para rense.com que hacen de el un verdadero ensayo. En la entrega o parte 20 tiene una teoría de la propagación de esta quimera (virus) al menos un tanto curiosa y no menos científica, nunca antes ni oída ni vista para con los virus y su propagación.

Os dejo aquí la parte del artículo que nos concierne, y yo me pregunto, ¿alguien nos está ocultando información? Si se dan cuenta, las autoridades tienen una obsesión con la noche, no quieren que salgamos a la calle digamos de 12 a 6 am. ¿Pero porqué? ¿Qué nos esconden?

Aquí la parte del artículo 20, por cierto, está escrito (los tiempos son importantes) el 23 de abril de 2020 titulado Nublado con una probabilidad de caídas de los cadáveres dispersos COVID en las islas de calor urbano – Parte 20 / Cloudy With A Chance Of Scattered Cadavers COVID Fallout On Urban Heat Islands – Part 20 :

Arquitecto de soluciones Urban Heat Island

Mi área de especialización en periodismo de crisis con especial atención a los desastres, con enfoque en los factores humano-causales y el impacto social, se enriqueció mucho al cooperar con el profesor de arquitectura Stephen Lau, el pionero más importante de Asia en los efectos de la isla de calor urbana (UHI) entonces en la Universidad de Hong Kong y más recientemente en la Universidad Nacional de Singapur. La concentración de calor sobre ciudades y ciudades más grandes es un fenómeno probado por la investigación con un impacto importante en la salud pública, como se muestra en este contagio del coronavirus.

Fuera del campo arquitectónico, el efecto Isla de Calor Urbano (UHI) no es bien conocido debido a la desafortunada dominación mediática por dudosos estudios ambientales de la teoría del “calentamiento global”, la mayoría de ellos un fraude promovido por la industria de la energía nuclear para perpetuar el mito de que el uranio es seguro, limpio, barato y “verde” (como la kriptonita es para Superman). El monopolio mediático de la agenda climática alimentada por la energía nuclear es el principal factor para que el público desconocie el papel de la corriente de chorro en la transmisión del COV a las metrópolis del hemisferio norte.

Ciudades en una burbuja

En la parte superior de una burbuja de calor sobre cualquier ciudad dada, hay un diferencial de temperatura de mediodía diario mensurable de alrededor de 7 grados C (alrededor de 12 F) más alto que la atmósfera circundante, mientras que los modelos de cambio climático, que no se basan en la investigación de campo real, estiman menos de un aumento de 1 grado durante un siglo. LA UHI es palpable y a veces insoportable, mientras que el “calentamiento global” es imperceptible en un termómetro de mercurio. Casi todos los activistas del cambio climático residen y crecen en las grandes ciudades, confundiendo un punto de calor localizado para una condición general del mundo. En esta premisa falsa, la percepción distorsionada se extrapola utilizando datos de estaciones meteorológicas metropolitanas para aumentar los hallazgos de los centros de meteorología rurales, sesgando los resultados a un nivel más alto posible de 1 grado C durante cien años, no es gran cosa en absoluto. Cientos de millones de dólares.han sido desperdiciados en este ejercicio de distracción por la industria de la energía nuclear, mientras que las grandes ciudades se han quedado indefensas contra las enfermedades infecciosas transmitidas por la corriente de chorro y el efecto UHI. Nuclear siempre se escapa de sus crímenes, incluyendo Three Mile Island, Chernobyl y Fukushima, castigados con una bofetada en la mano y nada cercano a la indemnización para las víctimas de sus inversores, y mucho menos multas punitivas.

Este tipo de fraude científico y colusión política han suscitado malas decisiones políticas por parte de los ayuntamientos y los gobiernos nacionales en favor de la urbanización de alta densidad y la concentración de población dentro de las megaciudades en beneficio de los grandes bancos, el capital privado, los inversores institucionales, los desarrolladores inmobiliarios y las cadenas minoristas corporativas. Desde esta perspectiva, el contagio del coronavirus es principalmente culpa de la política estatal corrupta en favor de los desarrolladores de propiedades y el capitalismo de consumo en oposición al interés nacional a largo plazo servido por una mezcla de baja densidad de ciudades rodeadas por un campo financieramente estable de granjas familiares, el modelo basado en la democracia Jeffersoniana en lugar del favoritismo hamiltoniano hacia los bancos centrales y las finanzas de Wall Street.

Plume sobre Wuhan

Para comprender cómo los virus de Wuhan y Chongqing rodearon el planeta para converger e infectar ciudades con una enorme bio-caída, debemos comenzar al principio, en los 84 hornos en crematorios en Wuhan y aproximadamente la mitad de ese número aguas arriba en la guarnición de Chongqing del Grupo PLA 77, donde posiblemente más de 2.000 soldados murieron de infección por COV por el ataque de la guerra contra el CISM. Como se evidencia en la larga franja amarilla a la izquierda de la imagen del satélite Windy, sus cuerpos de soldados infectados durante y después de los juegos militares de Wuhan fueron eliminados en secreto en los crematorios en todo el municipio de Chongqing, aparentemente todavía sin notificación de sus parientes más cercanos. Este trato de los jóvenes caídos no es el honor que se debe dar a los jóvenes patrióticos que protegieron a los atletas militares extranjeros, se reunieron en defensa de la ciudadanía wuhan y evitaron una propagación aún peor por todo el mundo. Especialmente después de meditar en el aro de los medios de comunicación de Beijing sobre “ganar una guerra popular en Wuhan”, me entristece aún más pensar en términos del costo humano de las profundidades a las que la propaganda del régimen puede hundirse a expensas de vidas innecesariamente perdidas consideradas meras carnes de cañón. ¿Qué tan importante es salvar la cara cuando las víctimas inocentes están perdiendo la vida en masa?

Dado el recuento repetido de falsos cuerpos, el número total de cremaciones sigue siendo cuestionable, incluso con el nuevo recuento revisado de 3.869 muertes en Wuhan, aparentemente sin incluir a los oficiales de policía y a los condenados a prisiones. Una estimación conservadora de 6.000 muertes militares y civiles también puede ser una subestimación, al considerar el tamaño de la neblina de azufre sobre las dos ciudades durante más de un mes de cremaciones sin parar. El aparejo de números es intolerable, bárbaro e inhumano, especialmente para los parientes más cercanos de los muertos.

La temperatura dentro de un horno de crematorio es ideal en el rango de 975 C (1.750 F), más o menos cien grados, para hacer un cuerpo a cenizas en una hora. Durante las semanas centrales de la crisis de Wuhan, las temperaturas de combustión deben haber aumentado para acelerar la eliminación de cuerpos para evitar la descomposición y la liberación de virus. Las altas temperaturas constantes del horno, sin embargo, causan la descamación y roturas de las tuberías de alimentación de gas, añadiendo más presión sobre los equipos de trabajo agotados. El intervalo entre cremaciones implica la reducción de la temperatura con el fin de eliminar las cenizas e insertar el siguiente cadáver. Este nivel de calor más bajo durante el período de reinicio permitió a los virus escapar a través de las chimeneas relativamente cortas para montar el penacho de calor de enfriamiento en el cielo.

Debido a la amenaza potencial para que los equipos de emergencia que transportaban cuerpos de los hospitales a los crematorios, los cadáveres frescos fueron desempolvados con polvo de azufre para evitar que las infecciones bacterianas se expandieran las pústulas en llagas abiertas que liberan virus en el aire. Este tipo de método pragmático es uno de los aspectos más desconcertantes para manejar los cuerpos de los muertos, que no se reporta en los medios de comunicación o incluso en la literatura académica, que presencié cuando era un niño y ayudante en la funeraria de mi tío para crear un parecido del difunto para una visión de ataúd abierto por los dolientes. Bombear formaldehído en las venas como un antiséptico, un conservante, consume demasiado tiempo e inapropiado para una emergencia como Wuhan y tal arte no tiene sentido cuando un cuerpo requiere eliminación inmediata a medida que la descomposición se instala, la propagación del hedor, los líquidos y las bacterias junto con los virus en el aire. Un cadáver infectado que se desintegró en una acera en Wuhan habría sido desastroso, por lo que algunas toallas y azufre tuvieron que ser suficientes para el traseso del hospital y el viaje en furgoneta de una hora de duración a un crematorio. Saludo a esos héroes no cantados, los trabajadores de emergencia, por su gran resistencia a luchar a través de ese infierno en la Tierra.

Cube-Sat infrarrojo sobre la pira

El sitio de desinformación de la CIA Snopes, hace mucho tiempo desacreditado en mis artículos de años atrás, está arrojando tonterías sobre supuestos gráficos falsos del servicio meteorológico Windy. Además del polvo de azufre para evitar la descomposición de la piel, se encuentran cantidades adicionales de dióxido de azufre y óxido nitroso en el gas natural de menor calidad de las plantas de separación de gases. Por el contrario, se filtra el gas de cocina para su cocina a un alto costo. Como nadie está cenando en la carne asada, el gas más barato tiene que ser suficiente. Las imágenes ventosas de las emisiones de azufre y nitrógeno no son gráficos informáticos fantasiosos basados en el modelado teórico, como afirma falsamente Snopes, sino basados en la vigilancia de los satélites de observación de la Tierra utilizados para detectar liberaciones y explosiones químicas.

El EOS de teledetección (satélite de observación de la Tierra) es un dispositivo de monitoreo en forma de cubo o “cúbico” con un detector hiperespectral (multi-longitud de onda altamente sensible) en el ancho de banda infrarrojo, que también se puede utilizar para detectar preparaciones de lanzamiento para cohetes y rastrear incendios forestales, cualquier cosa que emita calor. Los datos son procesados por ordenador en imágenes precisas codificadas por colores, en este caso particular por el servicio meteorológico Windy con sede en Praga, República Checa. Lo imaginante no es una especie de ficción, como afirma Snopes, pero es muy precisa y científica.

Esta distorsión es otro ejemplo de la gran cantidad de desinformación oficial en respuesta al peor evento terrorista de la historia reciente, mucho más allá del 911. La operación de desninfo del Estado Profundo debe ser investigada, desmantelada y los funcionarios a cargo encarcelados. Demasiada gente está muerta y muriendo por este tipo de interferencia política y chicanería mediática. ¡Muchas gracias al equipo Windy por la gran captura, Dekuji!

Exploding Body Fat

Los virus del COV permanecen activos dentro de los cadáveres y pueden ser infecciosos durante un período indeterminable, como recientemente se descubrió en el shock de un forense en Tailandia. El cuerpo de un adulto no se convierte fácilmente en cenizas, siendo tan pesado como una vaquilla con contenido de agua en alrededor del 55 por ciento del peso corporal. La fase inicial de la cremación tiene que representar gran parte del contenido de agua como vapor, lo que impide la incineración. Otro problema para la quemadura es la grasa subcutánea, y los chinos de hoy tienden a tener sobrepeso de una dieta aceitosa. La grasa del vientre explota y silba, soplando partículas de sangre y carne en la columna de calor hacia el cielo. Sería como poner al máximo tu parrilla de barbacoa y añadir un lanzallamas, soplando ese asado de cerdo como un petardo en pocos segundos.

Dado que las chimeneas del crematorio son más cortas que una chimenea de chimenea, liberando prematuramente partículas de carne crujientes en la superficie exterior, pero no completamente “cocinadas”, ni siquiera medio rara pero rara. La incineración apresurada dio lugar a miles de millones y probablemente billones de virus en espiral hacia arriba en el borde del vórtice de calor que se elevan a los confines más bajos de la corriente de chorro para ser transportados a tierras extranjeras.

En un día normal, el penacho de cremación se elevará a 3.000 metros, pero Wuhan fue un extraordinario evento de super-bonfire, que va las 24 horas del día durante semanas, con una enorme efusión de energía térmica que proporciona un enorme aumento, alcanzando fácilmente 8.000 metros (5 millas), la altitud del último invierno y la corriente de chorro de primavera temprana moviéndose a más de 250 mph. Las bacterias, que contienen agua, se congelarán y morirán en estas condiciones. Los virus, sin embargo, no son organismos, sino más bien máquinas y pueden sobrevivir al frío extremo durante una larga duración, como lo muestran las partículas de ARN en el permafrost siberiano a -50C o -55F, que pueden ser revividos por los microbiólogos.

A estas alturas, un mes después del final de las cremaciones masivas, probablemente sea demasiado tarde para llevar un paraguas contra cualquier consecuencia de carne humana y virus activos. El peligro inmediato de los cielos ha pasado, aparte de la posibilidad de que los virus escapen de las cremaciones en Corea del Sur, Japón, partes de Estados Unidos y Europa, y en todo el planeta. Has oído la expresión “Está lloviendo gatos y perros afuera” para que puedas decirle a tus nietos: “Yo estaba allí cuando llovía cadáveres”.

Decencia del entierro

La indignidad de la incineración masiva en una fría y cruel respuesta urbana a una epidemia contrasta con los lentos ritos que presencié en el sur de Tailandia, como voluntario para la labor de búsqueda y rescate después del tsunami asiático que azotó el día después de la Navidad de 2004. Un cuidador con un templo local al norte de Phuket apiló madera alrededor de una víctima de ahogamiento mientras un monje cantaba una bendición, y luego puso una antorcha en los troncos. La pira ardió durante horas hasta la reducción final a cenizas y algunos huesos, que fueron rastrillados y colocados en una caja de madera con otra oración. En ese momento, me dirigí de regreso a la costa para reincorporarme a un equipo tailandés y coreano mientras el explorador olfateaba cuerpos atrapados bajo edificios, bajo montones de escombros o embistido por la presión de las olas en las raíces de las palmeras. Mi sentido del olfato era mucho mejor que otros, debido al hábito coreano de comer kimchee y los tailandeses que consumen salsa picante tipo Sri Racha, así que se dejó a mi nariz de tofu aburridamente sosa para ser el perro de búsqueda.

Días más tarde llegó una reunión de Nochevieja en silencio para voluntarios cansados desgastados por el hedor de cuerpos hinchables en descomposición mientras buscaban marcas de identificación para escribir en carteles para familias angustiadas antes de cerrar las bolsas del cuerpo. En una colina era el único lugar para que los voluntarios pasaran la noche en las vacaciones. Los tailandeses de Bangkok, canadienses, holandeses y algunos otros se reunieron sobre cajas de cerveza y almuerzos de cajas de expiración pasada para compartir tranquilamente su trauma una larga sombra del sol que se pone en el mar de Andamán se deslizó a través del amplio balcón.

Cuando un joven expresó su sentimiento de culpa por beber después de una experiencia tan horrible, como la persona mayor allí les dije a todos que cada uno de ellos se ganó este momento y relajarse en una rara noche especial aparta un año aterrador y dará a todos fuerzas para el calvario de mañana por la mañana y para el resto de sus vidas. Por cualquier razón que hayamos venido aquí, cada uno sabe ahora a través del testimonio personal que la vida termina con la muerte y por eso hemos aprendido a acercarnos a la muerte con calma no como algo horrible, sino como un tributo a la vida de otra persona. Entonces, ¿qué mejor momento para un brindis por ustedes valientes voluntarios? En los primeros albores del año 2005, cada individuo partió por un camino diferente a lo largo de la interminable línea del tsunami, cada uno de acuerdo en que aunque llegamos como extraños y quedamos traumatizados por esta experiencia fue la mejor Nochevieja que esta breve existencia podría permitirse.

Arco de la pandemia

Tokio – El penacho que sale de Wuhan llega a la costa del Pacífico en media hora, en el Mar de China Oriental, donde los primeros aviones de primavera se curvan hacia el noreste hacia Japón, mientras que las nevadas de finales de primavera se convierten en lluvias lluviosas sobre las primeras grandes islas de calor urbano de los distritos de negocios de Shinjuku, Maruchiuno y Shimbashi de Tokio. A medida que los equipos de limpieza apagan las luces de las torres de oficinas, una corriente descendente empuja innumerables virus hacia los suburbios periféricos donde sus compañeros de oficina se dirigen a la estación local, sin saber que están caminando a través de una niebla viral. En la hora punta de la mañana temprano, los virus llegan al centro con las hordas de viajeros empacados en el metro.

La capital japonesa es altamente radiactiva, como se muestra en el monitoreo de datos de un grupo ciudadano que ha encontrado docenas de puntos críticos. El nivel de radiactividad ha matado las algas en la bahía de Tokio, pero los virus corona son sólo 120 nanómetros de ancho, tres veces más pequeños que los poros en una máscara facial médica. No se ha investigado, pero los virus son probablemente lo suficientemente pequeños como para evitar impactos directos de la radiación gamma sobre la región de Tokio. Los pasajeros a bordo del crucero Diamond Princess nunca tuvieron la oportunidad, especialmente una noche, contra los miles de millones de virus que caen de la corriente de chorro hacia la bahía de Tokio, siendo estos lo suficientemente pequeños como para pasar a través del sistema de filtración de aire de la nave. Esta es la razón por la que mi equipo de microbiólogos en la crisis del SARS de Hong Kong abogó por los limpiadores de aire con la generación UV de radicales libres de dióxido de titanio para desinfectar el aire interior. El resto del mundo no se ha puesto al día y no ha mostrado mucho interés en estas tecnologías eficaces.

Trans-Pacífico – El flujo continuo de virus en el chorro de flujo que viaja hacia el norte hasta el estrecho de Bering y luego hacer una trayectoria balística hacia el sur para hacer tierra en Seattle, la primera ciudad estadounidense con una gran cantidad de infecciones, aunque muchos de ellos son parientes de Navy SEALS que participaron en los juegos de Wuhan, y luego procediendo hacia el sur a través del área de la bahía y Los Angeles , girando antes de la frontera con México hacia vastos tramos vacíos de Texas. La población de la costa oeste ha sufrido mucho daño en el tejido pulmonar por Fukushima y la radiactividad local, los incendios forestales relacionados y ahora las pruebas 5G, por lo que una alta tasa de mortalidad por virus transmitidos por chorros es una inaltería.

Nueva Orleans – Los celebrantes que convergían para Mardi Gras a finales de febrero capturaron la altura misma de las consecuencias del virus de origen Wuhan. Contrariamente a la historia de brujas sin sentido de Fauci y sus brujos, los que se fueron de fiesta de esos estados del medio oeste y del sur estaban libres de infecciones, y en su lugar los virus cayeron sobre sus cabezas después de descender a lo largo del camino de deslizamiento sobre las frías aguas del Misisipi. Nueva Orleans es una isla de calor urbano ubicada entre dos cuerpos de agua que atraen virus, el Poderoso Misisipi y el Golfo de México. Sea cual sea la forma en que sopla el viento, los virus están fluyendo hacia Bourbon Street, lo cual es una pena ya que un buen momento es tener un linint up de botellas de cerveza Dixie, pero no se trague las ostras de aguas profundas. El mundo se ha deteriorado desde aquellos días universitarios que me autogané a Nawlins para disfrutar de música y toda la noche.

Fort Lauderdale y Miami – El diferencial de temperatura de Sunny Florida entre las áreas interiores y la costa significa que las cascadas de coronavirus fluyen en corriente descendente directamente hacia las playas y son soplados de vuelta hacia la costa por la brisa de las olas, empapando en parte a los estudiantes universitarios vestidos en las vacaciones de primavera y de Pascua. Ya no enseñan ciencias en la universidad cuando la mojito mixología y el sexo son las especialidades más populares entre los jóvenes y tontos.

Nueva York – Poco después de que el Polar Vortex se desplazara hacia el este desde la región de Ohio hacia el noreste, la siguiente gran oportunidad para la infección masiva fue en la línea de abejas a Nueva York y Boston, ambos puertos con ríos y rascacielos imponentes con calor de vapor a plena ráfaga. Estas son las clásicas Islas de Calor Urbana, con potentes cambios de presión de aire como pistones. Por lo tanto, durante el día, la burbuja de calor de Manhattan arroja virus hasta los espacios abiertos de Brooklyn y Staten Island. Por la noche, después de que las oficinas cierran sus puertas y la temperatura del suelo se desploma, los virus bajan en Central Park y luego en las aceras llenas de visitantes a la Gran Manzana. Los cañones de estructuras altas atrapan virus, vertiendo por las entradas del metro, a través de puertas giratorias y en los conductos de ventilación de los taxis. El Apple es un refugio de virus, que se remata cada noche, mientras que los equipos de emergencia en carretillas elevadoras que cargan cuerpos en camiones refrigerados que están sirviendo a una morgue temporal hasta que 45 nuevas unidades de almacenamiento de cadáveres se establecen en toda la metrópolis. Hart Island se utiliza como un lugar de entierro masivo. Esto es primitivo, de vuelta a la Edad Oscura. La ciudad de Nueva York no tiene espacio para los cuerpos, que comenzarán a engordarse con billones de nuevos virus a medida que el clima se calienta a finales de abril. Wall Street está rodeada por la ola de la muerte que creó.

Londres, Madrid y Milán – Lo mismo ocurre con Europa, cuando la corriente de propulsión giraba hacia el sur sobre Londres, se dirigió a Madrid y se desmayó sobre Milán, en la peor campaña de bombardeos desde la Segunda Guerra Mundial. Desde allí el flujo de aire cruzó sobre Moscú “inmune”, que ahora se está descongelando a una floración viral. El chorro de agua ya se ha ido hacia el norte sobre Beijing y la región de Dongbei del noreste de China alrededor de Shenyang y luego Corea del Norte, donde el Gran Líder cayó repentinamente enfermo cuando CoV comenzó a mejorar en el calentamiento de las temperaturas al aire libre. El Grim Reaper es una bestia de mil millones de virus acechando la tierra para nuevas víctimas.

Aprender de los desafíos de la vida

Basado en la práctica de las contramedidas de Urban Heat Island, incluyendo “techos verdes” para reducir la burbuja de calor y el uso de agua subterránea como refrigerante en lugar de sistemas de enfriamiento de techos generadores de calor, los virus no caerían al nivel del suelo en tal abundancia, sino que circularían en la corriente de chorro hasta que la radiación solar los destruyera. La solución es así de simple. Los flujos de aire en oficinas, restaurantes y hogares que canalizan el aire rancio hacia arriba y fuera de los interiores hasta el nivel del techo reducirían las probabilidades de infección en un millón de veces más. Un mejor diseño de inodoros y urinarios, y especialmente secadores de manos, que ahora soplan virus de las manos a la cara, era parte de las propuestas de mi equipo de microbiología, con algunos adoptados en Hong Kong y el continente y otros ignorados, lo que de hecho ha ahorrado a Hong Kong la peor parte de este contagio. Pequeños pasos marcan una gran diferencia en la salud pública, ya que es más eficaz para combatir enfermedades infecciosas en el entorno construido que dentro de su cuerpo.

Si la sociedad va a revivir y sobrevivir, no puedes olvidar esta pandemia como un mal sueño cuando el encierro ha terminado y vuelve a vivir como un cerdo en un estilete. Si no se realizan cambios, entonces el próximo brote podría ser el último. Es muy importante, ya que he estado haciendo hincapié en no quedar atrapado en conceptos abstractos sin apoyo por datos convincentes, como el calentamiento global y la teoría del cambio climático, que son responsables de descarrilar los pasos básicos que fueron defendidos por el movimiento temprano del Día de la Tierra de desarrollar una sociedad de reciclaje para hacer frente a las montañas de residuos tóxicos, para eliminar radicalmente la mayoría de los pesticidas y otras contaminaciones químicas , para promover estilos de vida saludables en una mezcla de campo y ciudad en lugar de mega-ciudades, y homeopatía y terapias herbales en lugar de montones de productos farmacéuticos.

El coronavirus está aquí porque las personas eran perezosas y mentalmente laxas, permitiendo que algunos actores cínicos desarrollaran virus en armas de destrucción masiva porque se dieron cuenta de que no había medidas de bioseguridad en su lugar, ni siquiera los hábitos simplemente de saneamiento personal. Esta es probablemente la última llamada, porque si no respondes y actúas y aplicas presiones políticas y boicoteas a las corporaciones malvadas, la próxima será la última llamada.

La vida dentro de una burbuja

Las megaciudades son el problema y no la solución. Los estados centrales del medio oeste tienen los menos niveles de infecciones por coronavirus y también están en las peores condiciones financieras debido al dominio de la agroindustria corporativa que se beneficia de las exportaciones de soja y maíz a China y a los banqueros y comerciantes de materias primas que lo financian. Mientras tanto, las granjas familiares han sufrido deudas crónicas e impagos hipotecarios debido a las políticas de préstamos de ingeniería financiera en favor de los propietarios de tierras corporativas a megaescala implementadas por Wall Street y State Street, los mismos intereses plutocráticos responsables de la actual pandemia del CoV y la guerra biológica que la desató.

La promoción neoliberal de las megaciudades y el despojo de las comunidades agrarias es esencial para el control corporativo-bancario-político de todos los recursos naturales, desde minerales y energía hasta la producción de alimentos y fuentes de agua, mientras empaquetaba a la gente en recintos cada vez más ajustados, con un bloqueo esencial para el reciclaje psicológico de las expectativas “poco realistas” de lo que era normal no hace mucho tiempo, mientras que los miembros multimillonarios de la junta poseen múltiples mansiones, islas de playa y centros personales. El aislamiento social impuesto a los Estados del Medio Oeste sin apenas casos COVID es una prueba del internamiento masivo de una sociedad una vez libre basada en la autonomía de los hogares agrícolas y de la comunidad local. Siempre he entendido que el internamiento en tiempo de guerra de mi kinfolk fue un experimento de lavado de cerebro por parte de los liberales globalistas Roosevelt, un juicio por un eventual asalto total a los derechos constitucionales. El intento desesperado de la élite fascista neoliberal de destruir los valores y formas de vida tradicionales es una agresión sin barnizar, una guerra de clases por parte de las instituciones criminales ricas y poco representativas contra una democracia de base comprometida con la vida, la libertad y la búsqueda de la felicidad.

BIDEN / ISRAEL ATACARÁ A IRÁN

Papá, ¿Qué es un neocon? Un neocon es Israel. Pero Biden es demócrata. Hijo, Israel está en todos lados, arriba, abajo, a la derecha y a la izquierda. ¿Es como dios? O como el diablo.

Si leen el título, no pone “atacarán”, pues en política exterior en general y en Oriente Medio en particular, Israel tiene secuestrado a Estados Unidos. ¿Y con Trump? bueno, Donald es de los que sólo se deja atar una mano que no es poco para Israel, pero era un presidente impredecible, muy personalista. En cambio los demócratas están atados por las dos manos por Israel y Biden es la palma de sus extremidades.

Los tentáculos judíos en la Casa Blanca son como las columnas de esta, nunca se van, cambian los presidentes pero ellos siguen allí. Da igual el nombre, la ideología, la escuela de donde vengan. Incluso están pero no se ven, como el otro Donald, Rumsfeld o Cheney. ¿Trabajaban para Israel? ¿Eran espías, traidores? No, como he dicho antes no son ni lo uno ni lo otro, pues son lo mismo. Los únicos traicionados son los estadounidenses, el pueblo americano.

Si no tienes apoyo judío, jamás serás presidente de los EE.UU., a veces te quitan de en medio, por varios medios, pero te quitan. A veces no han necesitado la ayuda necesaria que ellos hubieran querido darte, como Trump, que quizás sólo necesitó una ayuda del 60%, poca cosa comparada con Biden, que puede estar alrededor de un 80% y si el otro 20% saben, que lo saben con quien se andan, es como si estuviera amarrado a cien candelabros de siete brazos. Para dos manos, es mucho peso.

Volvamos al principio del principio. La mayoría de los judíos o sus familiares, se han cambiado el apellido. Esta vez también. Israel se apellida ahora Biden que hará el trabajo sucio y como siempre, los judíos ganarán la guerra que la llamarán derrota, por eso de despistar.

Israel ha conseguido que Irak, Libia y Siria sean estados fallidos, eran sus principales enemigos. Son tal sus tentáculos que luchan otros por ellos. Corea del Norte es un teatro para el americano medio. Queda Irán. Y será Biden quien ataque y otros quien pierdan. Siempre igual, los judíos ganaron la Segunda Guerra Mundial. Todos los demás la perdieron, todos, solo que unos a corto plazo y otros a largo en el tiempo, de miles de formas y sombras de deudas que imanan del oro.

G.R.M.

BIDEN / ISRAEL WILL ATTACK IRAN

Dad, what is a neocon? A neocon is Israel. But Biden is a Democrat. Son, Israel is everywhere, above, below, to the right and to the left. Is it like god? Or like the devil.

If you read the title, it does not say “they will attack”, because in foreign policy in general and in the Middle East in particular, Israel has kidnapped the United States. And with Trump? Well, Donald is one of those who only allows himself to be tied a hand which is not a small thing for Israel, but he was an unpredictable president, very personalistic. Instead the Democrats are tied by both hands by Israel and Biden is the palm of his limbs.

The Jewish tentacles in the White House are like the columns of this, they never leave, the presidents change but they are still there. No matter the name, the ideology, the school they come from. They are even there but not seen, like the other Donald, Rumsfeld or Cheney. Did they work for Israel? Were they spies, traitors? No, as I said before, they are neither one nor the other, they are the same. The only ones betrayed are the Americans, the American people.

If you don’t have Jewish support, you will never be president of the USA, sometimes they take you out of the way, by various means, but they take you away. Sometimes they have not needed the necessary help that they would have wanted to give you, like Trump, who perhaps only needed 60% help, little compared to Biden, who can be around 80% and if the other 20% know, what They know who they hang out with, it is as if he were tied to a hundred seven-branched chandeliers. For two hands, it is a lot of weight.

Let’s go back to the beginning of the beginning. Most of the Jews or their relatives have changed their surnames. This time too. Israel is now called Biden who will do the dirty work and as always, the Jews will win the war that they will call defeat, for that reason to mislead.

Israel has made Iraq, Libya and Syria failed states, they were its main enemies. Their tentacles are such that others fight for them. North Korea is a theater for the average American. Iran remains. And it will be Biden who attacks and others who lose. Always the same, the Jews won the Second World War. All the others lost it, all, only some in the short term and others in the long term, of thousands of forms and shades of debt that magnetize gold.

ZUMBIDOS EN EL OÍDO / EAR RINGING

No voy a preguntarle al doctor Google, sólo voy a hacer un juego de domingo aburrido. Voy a consultar al mayor consultado del universo mundial. Sí, Google, quizás antes de que el mayor censurador del mundo lo haga. Sí, Google y adyacentes, que censura la calidad, no la cantidad.

El juego consiste en lo siguiente, buscaré en Google zumbido oído de diez años para atrás y veremos los resultados en número de búsquedas por años, del 2011 al 2020 y la misma búsqueda sin años. Luego haré lo mismo pero en inglés con ear ringing con los mismos años. Veamos los resultados:

  • Zumbido oído 2011: 135.000 resultados.
  • Zumbido oído 2012: 149.000 resultados.
  • Zumbido oído 2013: 135.000 resultados.
  • Zumbido oído 2014: 162.000 resultados.
  • Zumbido oído 2015: 150.000 resultados.
  • Zumbido oído 2016: 167.000 resultados.
  • Zumbido oído 2017: 160.000 resultados.
  • Zumbido oído 2018: 166.000 resultados.
  • Zumbido oído 2019: 206.000 resultados.
  • Zumbido oído 2020: 368.000 resultados.
  • Zumbido oído: 448.000 resultados.

¿Qué quiero demostrar con estos datos? Mejor sería preguntar ¿Qué puedo demostrar? Pues no sirvo para realizar estadísticas así que lo dejo aquí. Decir que la búsqueda en Google, tanto en español como en inglés, en el primer caso casi dobla 2020 al 2019 y en el segundo caso, en inglés, lo supera con creces. ¿Qué ha pasado en 2020? Bueno, sería largo de contar por sus aristas e intenso y corto por su profundidad, pero diríamos que está el coronavirus y el 5G.

EAR RINGING

I’m not going to ask Dr. Google, I’m just going to make a boring Sunday game. I am going to consult the most consulted in the world universe. Yes, Google, maybe before the world’s biggest censor does. Yes, Google and adjacent, who censor quality, not quantity.

The game consists of the following, I will search Google for ear ringing ten years ago and we will see the results in number of searches by years, from 2011 to 2020 and the same search without years. Let’s see the results:

  • Ear ringing 2011: 4.590.000 results.
  • Ear ringing 2012: 5.360.000 results.
  • Ear ringing 2013: 5.310.000 results.
  • Ear ringing 2014: 5.540.000 results.
  • Ear ringing 2015: 5.550.000 results.
  • Ear ringing 2016: 6.440.000 results.
  • Ear ringing 2017: 6.930.000 results.
  • Ear ringing 2018: 6.670.000 results.
  • Ear ringing 2019: 6.740.000 results.
  • Ear ringing 2020: 15.700.000 results.
  • Ear ringing: 78.600.000

What do I want to demonstrate with this data? It would be better to ask what can I prove? Well, I’m not good for statistics so I’ll leave it here. To say that the search in Google, both in Spanish and in English, in the first case almost doubles 2020 to 2019 and in the second case, in English, it far exceeds it. What happened in 2020? Well, it would be long to count because of its edges and intense and short because of its depth, but we would say that there is the coronavirus and 5G.

La OMS elimina la inmunidad adquirida naturalmente de su sitio web

WHO Deletes Naturally Acquired Immunity from Its Website

Jeffrey A. Tucker – 23 de diciembre de 2020. Tiempo de lectura: 5 minutos

¿Quizás tienes la sensación de que algo sospechoso está pasando? Mismo. Si no es una cosa, es otra.

El coronavirus vivió en superficies hasta que no lo hizo. Las máscaras no funcionaban hasta que lo hacían, entonces no lo hicieron. Hay una transmisión asintomática, pero no la hay. Los bloqueos funcionan para controlar el virus, excepto que no lo hacen. Todas estas personas están enfermas sin síntomas hasta que, a mal tiempo, las pruebas de PCR son tremendamente inexactas porque nunca fueron diseñadas para ser herramientas de diagnóstico. Todos están en peligro del virus, excepto que no. Se propaga en las escuelas, pero no lo hace.

En él va. Diario. No es de extrañar que tanta gente haya dejado de creer cualquier cosa que digan “autoridades de salud pública”. En combinación con los gobernadores y otros autócratas que hacen sus órdenes, se propusieron quitarles la libertad y los derechos humanos y esperaban que les agradeciémos por salvarnos la vida. En algún momento de este año (para mí era el 12 de marzo) la vida comenzó a sentirse como una novela distópica de su elección.

Bueno, ahora tengo otra prueba que añadir a la pila de desorden de peces. La Organización Mundial de la Salud, por razones desconocidas, ha cambiado repentinamente su definición de una concepción básica de la inmunología: la inmunidad del rebaño. Su descubrimiento fue uno de los principales logros de la ciencia del siglo XX, emergiendo gradualmente en la década de 1920 y luego cada vez más refinado a lo largo del siglo XX.

La inmunidad al rebaño es una observación fascinante que se puede rastrear a la realidad biológica o a la teoría de probabilidad estadística, lo que prefiera. (Ciertamente no es una “estrategia”, así que ignore cualquier fuente de medios que la describa de esa manera.) La inmunidad del rebaño habla directamente, y con poder explicativo, a la observación empírica de que los virus respiratorios son generalizados y en su mayoría leves (frío común) o muy graves y de corta duración (ébola).

¿Por qué es esto? La razón es que cuando un virus mata a su huésped – es decir, cuando un virus sobrecarga la capacidad del cuerpo para integrarlo, su huésped muere y por lo tanto el virus no se propaga a otros. Cuanto más ocurre esto, menos se propaga. Si el virus no mata a su huésped, puede saltar a otros a través de todos los medios habituales. Cuando obtienes un virus y lo combates, tu sistema inmunitario codifica esa información de una manera que crea inmunidad a él. Cuando le sucede a suficientes personas (y cada caso es diferente por lo que no podemos poner un número claro en él, especialmente dadas tantas inmunidades cruzadas), el virus pierde su calidad de pandemia y se vuelve endémico, es decir predecible y manejable. Cada nueva generación incorpora esa información a través de una mayor exposición.

Esto es lo que uno llamaría Virología/Inmunología 101. Es lo que lees en todos los libros de texto. Se ha enseñado en biología celular de noveno grado durante probablemente 80 años. Observar las operaciones de este fenómeno evolutivo es bastante maravilloso porque aumenta el respeto por la forma en que la biología humana se ha adaptado a la presencia de patógenos sin enloquecer absolutamente.

Y el descubrimiento de esta fascinante dinámica en biología celular es una de las principales razones por las que la salud pública se volvió tan inteligente en el siglo XX. Mantuvimos la calma. Gestionamos virus con profesionales médicos: relaciones médico/paciente. Evitamos la tendencia medieval a correr con el pelo en llamas, sino que usamos racionalidad e inteligencia. Incluso el New York Times reconoce que la inmunidad natural es poderosa con Covid-19, lo cual no es en lo más mínimo sorprendente.

Hasta que un día, esta extraña institución llamada Organización Mundial de la Salud, una vez gloriosa porque era la principal responsable de la erradicación de la viruela, ha decidido de repente eliminar todo lo que acabo de escribir de los conceptos básicos de la biología celular. Literalmente ha cambiado la ciencia de una manera soviética. Se ha eliminado con la clave de eliminación cualquier mención de inmunidades naturales de su página web. Ha dado el paso adicional de caracterizar realmente la estructura y el funcionamiento de las vacunas.

Para que me creas, trataré de ser lo más preciso posible. Aquí está el sitio web del 9 de junio de 2020. Puedes verlo aquí en Archive.org. Usted tiene que mover hacia abajo la página y haga clic en la pregunta sobre la inmunidad del rebaño. Ves lo siguiente.

Eso es bastante preciso en general. Incluso la afirmación de que el umbral “todavía no está claro” es correcta. Hay inmunidades cruzadas a Covid de otros coronavirus y hay memoria de células T que contribuye a la inmunidad natural.

Algunas estimaciones son tan bajas como 10%, que está muy lejos de la estimación modelada del 70% de la inmunidad al virus que es estándar dentro del ámbito farmacéutico. La vida real es mucho más complicada que los modelos, en economía o epidemiología. La declaración pasada de la OMS es una descripción sólida, si “pop”.

Sin embargo, en una captura de pantalla fechada el 13 de noviembre de 2020, leemos la siguiente nota que de alguna manera pretende como si los seres humanos no tuvieran sistemas inmunes en absoluto, sino que dependen enteramente de grandes farmacias para inyectar cosas en nuestra sangre.

Lo que ha hecho esta nota en la Organización Mundial de la Salud es eliminar lo que equivale a toda la historia del millón de años de la humanidad en su delicada danza con patógenos. Sólo se podía obtener de esto que todos nosotros no somos más que pizarras en blanco e inaprobables en las que la industria farmacéutica escribe su firma.

En efecto, este cambio en la OMS ignora e incluso elimina 100 años de avances médicos en virología, inmunología y epidemiología. Es completamente poco científico: chelines para la industria de las vacunas exactamente como los teóricos de la conspiración dicen que la OMS ha estado haciendo desde el comienzo de esta pandemia.

Lo que es aún más extraño es la afirmación de que una vacuna protege a las personas de un virus en lugar de exponerlas a ella. Lo sorprendente de esta afirmación es que una vacuna funciona precisamente disparando el sistema inmunitario a través de la exposición. Por qué tuve que escribir esas palabras está realmente más allá de mí. Esto se conoce desde hace siglos. Simplemente no hay manera para que la ciencia médica reemplace por completo el sistema inmunitario humano. Sólo se puede jugar a través de lo que solía llamarse inoculación.

Toma de esto lo que quieras. Es un signo de los tiempos. Durante casi un año completo, los medios de comunicación nos han estado diciendo que la “ciencia” requiere que cumplamos con sus dictados que van en contra de cada principio del liberalismo, cada expectativa que hemos desarrollado en el mundo moderno que podemos vivir libremente y con la certeza de los derechos. Entonces la “ciencia” se hizo cargo y nuestros derechos humanos fueron criticados. Y ahora la “ciencia” en realidad está eliminando su propia historia, aerógrafo sobre lo que solía saber y reemplazarlo por algo engañoso en el mejor de los casos y evidentemente falso en el peor.

No puedo decir por qué, exactamente, la OMS hizo esto. Sin embargo, dados los acontecimientos de los últimos nueve o diez meses, es razonable suponer que la política está en juego. Desde el comienzo de la pandemia, aquellos que han estado presionando los bloqueos y la histeria sobre el coronavirus han resistido la idea de inmunidad natural del rebaño, en cambio insistiendo en que debemos vivir encerrados hasta que se desarrolle una vacuna.

Es por eso que la Declaración del Gran Barrington,escrita por tres de los epidemiólogos preeminentes del mundo y que abogaba por abrazar el fenómeno de la inmunidad del rebaño como una forma de proteger a los vulnerables y minimizar los daños a la sociedad, fue recibida con tal veneno. Ahora vemos a la OMS también sucumbiendo a la presión política. Esta es la única explicación racional para cambiar la definición de inmunidad del rebaño que ha existido durante el siglo pasado.

La ciencia no ha cambiado; sólo la política tiene. Y es precisamente por eso que es tan peligroso y mortal someter la gestión del virus a las fuerzas de la política. Eventualmente la ciencia también se inclina hacia el carácter duplicado de la industria política.

Cuando los libros de texto existentes que los estudiantes usan en la universidad contradicen los últimos pronunciamientos oficiales de las autoridades durante una crisis en la que la clase dominante claramente está tratando de apoderarse del poder permanente, tenemos un problema.

WHO Deletes Naturally Acquired Immunity from Its Website – AIER

Una teoría de la conspiración loca que se puede probar. Covid-21

A crazy conspiracy theory that can be tested. Covid-21

¿Y si la siguiente hoja de ruta loca de la teoría de la conspiración se hace realidad?

Esta hoja de ruta fue “filtrada” por un ex-miembro del Partido Verde de Alemania (David Siber). Hace que la lectura impactante, pero muy cerca de palomas con uno filtrado de Canadá. No tengo un enlace a la primera filtración porque se publica en un canal de Telegram que sigo (David Siber’s). Sin embargo, realmente no creo que la validez de su fuente importe en ningún lugar tan cerca como de su posible poder predictivo.

Mi traducción de la filtración alemana (supongo que fue una fuga de septiembre/octubre, como la canadiense):

  1. Introducir el segundo bloqueo. Los cierres secundarios deben extenderse desde las ciudades hasta las áreas circundantes de una manera arrastrándose. Fecha límite: finales de noviembre de 2020.
  2. Establecimiento de centros de aislamiento en todos los estados y municipios federales. Fecha límite: finales de diciembre de 2020.
  3. Las cifras diarias de infecciones por COVID-19 están aumentando tan rápidamente que las autoridades están alcanzando los límites de su capacidad de prueba. Fecha límite: finales de noviembre de 2020.
  4. Bloqueo completo y final (restricciones más estrictas que el primer bloqueo). Fecha límite: finales de diciembre de 2020 – a partir de enero de 2021.
  5. Reforma del programa de prestaciones por desempleo y Hartz IV hacia la renta básica universal. Fecha límite: primer trimestre de 2021 – es decir, a finales de marzo de 2021.
  6. Mutación del virus COVID-19 en un virus más peligroso llamado COVID-21, que inicia una tercera oleada de infecciones con una alta tasa de mortalidad y mayores tasas de infección. Fecha límite: antes de febrero de 2021.
  7. Las nuevas infecciones diarias de COVID-21 abruman a las clínicas y hospitales. Fecha límite: trimestre 1 – trimestre 2 2021.
  8. Introducción del tercer encierro con más restricciones a la vida pública restante. Se prohibirá viajar entre estados federales e incluso ciudades. Fecha límite: trimestre 2 2021.
  9. Introducir a todos en un programa de ingresos básicos universales. Fecha límite: mediados del trimestre 2 2021.
  10. Una gran inestabilidad económica conduce al colapso de las cadenas de suministro y, por lo tanto, a la escasez de bienes en las tiendas. Fecha límite: trimestre 2 – trimestre 3 2021.
  11. Operaciones del ejército interno dentro de las principales ciudades y en autopistas. El objetivo es evitar el movimiento y los viajes de los ciudadanos y proporcionar apoyo logístico en las ciudades. Fecha límite: antes del trimestre de 2021.
  12. Se da a los ciudadanos la oportunidad de cancelar todos los préstamos personales en el marco del llamado “Programa Mundial de Restablecimiento de la Deuda”. El Estado recibe los recursos financieros necesarios del FMI (Fondo Monetario Internacional). Para adherirse a este programa, los ciudadanos deben transferir todos los derechos de propiedad a los bienes existentes y también a todos los futuros. Además, el ciudadano se compromete a aceptar las vacunas COVID-19 y COVID-21 sin resistencia. Con el nuevo pase de vacunación, se levantan todas las restricciones a cada ciudadano que cumpla con las normas. Los ciudadanos que se oponen a la vacunación y al programa de pago de la deuda se convertirán en un “riesgo para la salud de los demás”. Sólo serán liberados de las restricciones de bloqueo después de aceptar el programa de pago de la deuda y permitirse vacunarse. 

Bill Gates aparece en el video vinculado a arriba. Afirma rotly que “pandemia 2” será peor que “pandemia 1”. El video también muestra a él y a su esposa Melinda luciendo extrañamente complacidos con la perspectiva de la variante más mortífera aún por venir. ¿Cómo puede saber estas cosas? ¿Por qué la prensa no está en todas estas afirmaciones extraordinarias? ¿Quién es responsable de estos horarios posiblemente filtrados? ¿Los horarios son creíbles?

Independientemente de las posibles respuestas a tales preguntas, una teoría es buena si puede ser falsificada. Las predicciones claras cumplen ese criterio aquí. ¿Qué pasa con The Great Reset, “Build Back Better” que se utiliza simultáneamente en todo el mundo de habla inglesa, un medio de comunicación de masas de una sola melodía en todo el mundo y predicciones más transparentes sobre futuras mutaciones de virus y letalidad de un ex jefe de una gran compañía de software, si este conjunto de predicciones (declaraciones) comenzara a hacerse realidad – y parecen ser ya – , que probaría la “teoría de la conspiración”, ¿no? ¿Qué otra explicación podría explicar todos estos hechos?

Si mi lógica es sólida, entonces compartir esta información con todos y el sol es de suma importancia. Me gustaría que este horario fuera el producto de un loco en alguna parte, pero las cosas han estado más allá de la locura durante ocho meses, así que creo que esto merece atención.

Econosophy and other musings: A crazy conspiracy theory that can be tested (thdrussell.blogspot.com)

La Agenda Secreta del Banco Mundial y el FMI

Por Peter Koenig

El Banco Mundial y el Fondo Monetario Internacional (FMI) trabajan de la misma mano – sin problemas. No sólo están prestando regularmente enormes sumas de dinero a regímenes de terror de todo el mundo, sino que chantajean a las naciones pobres para que acepten condiciones draconianas impuestas por Occidente. En otras palabras, el BM y el FMI son culpables de los abusos más atroces contra los derechos humanos.

No se podía decir, cuando se lee sobre la entrada del Banco Mundial la noble frase, “Nuestro sueño es mundial libre de pobreza”. A esta hipocresía sólo puedo añadir, “… Y nos aseguramos de que siga siendo un sueño”. Esto dice ambas cosas, la mentira y el carácter criminal de las dos Instituciones Financieras Internacionales, creadas bajo la Carta de las Naciones Unidas, pero instigadas por los Estados Unidos.

El frente de estas instituciones es brillante. Lo que le parece a las inversiones en infraestructura social, en escuelas, sistemas de salud, necesidades básicas como agua potable, saneamiento, incluso protección del medio ambiente, sobre todo “Alivio de la pobreza”, es decir, un mundo libre de pobreza. Pero lo falso que es esto hoy en día y ya estaba en los años 1970 y 1980 es asombroso. Poco a poco la gente está abriendo los ojos a una realidad abyecta, de explotación y coerción y chantaje total. Y eso, bajo los auspicios de las Naciones Unidas. ¿Qué le dice sobre el sistema de las Naciones Unidas? ¿En qué manos están las Naciones Unidas? – La organización mundial fue creada en San Francisco, California, el 24 de octubre de 1945, justo después de la Segunda Guerra Mundial, por 51naciones, comprometidas con el mantenimiento de la paz y la seguridad internacionales, el desarrollo de relaciones amistosas entre las naciones y la promoción del progreso social, mejores niveles de vida y derechos humanos.

La ONU reemplazó a la Sociedad de Naciones que formaba parte del Acuerdo de Paz después de la Primera Guerra Mundial, el Tratado de Versalles. Entró en vigor el 10 de enero de 1920, tenía su sede en Ginebra, Suiza, con el propósito de desarme, prevenir la guerra a través de la seguridad colectiva, resolver disputas entre países, mediante la diplomacia de negociación y mejorar el bienestar mundial. En retrospectiva, es fácil ver que todo el sistema de las Naciones Unidas se estableció como una farsa hipócrita, haciendo creer a la gente que sus poderosos líderes sólo querían la paz. Estos poderosos líderes eran todos occidentales; el mismo que menos de 20 años después de la creación de la noble Sociedad de Naciones, comenzó la Segunda Guerra Mundial.

*

Esta pequeña introducción proporciona el contexto para lo que eventualmente se convertiría en el resultado de las Naciones Unidas para el robo global, para las naciones empobrecidas, en todo el mundo, para la explotación de las personas, para los abusos contra los derechos humanos y para palear enormes cantidades de activos desde el fondo, desde el pueblo hasta la oligarquía, la élite corporativa cada vez más pequeña, las llamadas Instituciones de Bretton Woods.

En julio de 1944, más de 700 delegados de 44 Naciones Aliadas (aliados con los ganadores de la Segunda Guerra Mundial, incluida la Unión Soviética) se reunieron en el Mount Washington Hotel, situado en Bretton Woods, New Hampshire, Estados Unidos, para regular el orden monetario y financiero internacional después de la Segunda Guerra Mundial. Seamos seguros, esta conferencia se llevó a cabo bajo los auspicios de los Estados Unidos, el auto-declarado ganador de la Segunda Guerra Mundial, y a partir de ahora el maestro sobre el orden financiero del mundo, que no era inmediatamente visible, una agenda oculta a simple vista.

El FMI fue creado oficialmente para “regular” las monedas occidentales, llamadas convertibles, aquellas que se suscribieron para aplicar las reglas del nuevo estándar de oro, es decir, US$ 35 / Onza Troya (alrededor de 31,1 gramos). Tenga en cuenta que el patrón oro, aunque aplicable por igual a 44 naciones aliadas estaba vinculado al precio del oro nominado en dólares estadounidenses,no basado en una cesta del valor de las 44 monedas nacionales. Esto ya era razón suficiente para cuestionar el futuro sistema. Y cómo va a salir. Pero nadie cuestionó el arreglo. Difícil de creer, sin embargo, el de todos estos economistas nacionales, ninguno se atrevió a cuestionar la naturaleza traicionera de la configuración del patrón oro.

El Banco Mundial, o el Banco de Reconstrucción y Desarrollo (IBRD), se creó oficialmente para administrar el Plan Marshall para la Reconstrucción de Europa destruida por la guerra. El Plan Marshall fue una donación de los Estados Unidos y fue nombrado en honor al Secretario de Estado de los Estados Unidos George Marshall, quien lo propuso en 1947. El plan dio 13.200 millones de dólares en ayuda exterior a los países europeos que habían sido devastados física y económicamente por la Segunda Guerra Mundial. Se iba a implementar de 1948 a 1952, que por supuesto era un tiempo demasiado corto, y se extendió hasta principios de la década de 1960. En los términos actuales, el plan Marshall valdría unas 10 veces más, o unos 135 mil millones de dólares EE.UU.

El Plan Marshall era y sigue siendo un Fondo Rotatorio, devuelto por los países en cuestión, para que pudiera ser cedido. El dinero del Plan Marshall fue prestado varias veces y, por lo tanto, fue muy eficaz. La contraparte europea del Fondo Marshall administrado por el Banco Mundial fue un banco de reciente creación creado bajo el Ministerio de Finanzas alemán, el Banco Alemán de Reconstrucción y Desarrollo (KfW – acrónimo alemán de “Kreditanstalt f’r Wiederaufbau”).

KfW, como contraparte europea del Banco Mundial sigue existiendo y se dedica principalmente a proyectos de desarrollo en el Sur Global, ahora principalmente con fusores del Gobierno alemán y tomados prestados de los mercados de capitales alemanes y europeos. KfW a menudo coopera en proyectos conjuntos con el Banco Mundial. Hoy en día todavía hay un Departamento especial dentro de KfW que se ocupa exclusivamente del dinero del Fondo del Plan Marshall. Estos fondos todavía rotatorios se utilizan para prestar a las regiones pobres del sur de Europa, y también para apuntalar las economías de Europa del Este, y se utilizaron especialmente para integrar a la antigua Alemania Oriental en la actual “Gran Alemania”.

Dos elementos del Plan Marshall son particularmente llamativos y dignos de mención. En primer lugar, el plan de reconstrucción creó un lazo, una dependencia entre los Estados Unidos y Europa, la misma Europa que fue destruida en gran medida por las fuerzas aliadas occidentales, mientras que básicamente la Segunda Guerra Mundial fue ganada en gran medida por la Unión Soviética, los enormes sacrificios de la URSS, con un estimado de 25 a 30 millones de muertes. Por lo tanto, el Plan Marshall también fue diseñado como un escudo contra la Rusia comunista, es decir, la URSS.

Mientras que oficialmente la Unión Soviética era un aliado de las potencias occidentales, Estados Unidos, Reino Unido y Francia, en realidad la URSS comunista era un archienemigo del oeste, especialmente de los Estados Unidos. Con el dinero del Plan Marshall, Estados Unidos compró la alianza europea, una dependencia que no ha terminado hasta el día de hoy, y que todavía está impidiendo a Europa establecer relaciones normales con Rusia, a pesar de que la Unión Soviética ha desaparecido hace tres décadas. La guerra fría subsiguiente después de la Segunda Guerra Mundial contra la URSS, también basada en mentiras flagrantes, fue un testimonio directo de otra farsa propagandística occidental, que hasta el día de hoy, la mayoría de los europeos aún no han captado.

En segundo lugar, la imposición estadounidense de un fondo de reconstrucción con sede en dólares estadounidenses no sólo estaba creando una dependencia del dólar europeo, sino que también estaba sentando las bases para una moneda singular, eventualmente para invadir Europa – lo que sabemos hoy, se ha convertido en el euro. El euro no es más que el hijo adoptivo del dólar, ya que fue creado bajo la misma imagen que el dólar estadounidense: es una moneda fiduciaria, respaldada por nada. La Europa Unida, o ahora llamada Unión Europea, nunca fue realmente una unión. Nunca fue una idea europea, pero presentada por los Servicios Secretos de los Estados Unidos disfrazados de unos cuantos honchos europeos traicioneros. Y cada intento de crear una Europa Unida, una Federación Europea, con una Constitución Europea, similar a los Estados Unidos, fue amargamente saboteado por los Estados Unidos, principalmente a través del topo estadounidense en la UE, a saber, el Reino Unido.

Estados Unidos no quería una Europa fuerte, tanto económica como posiblemente con el tiempo también militarmente (pop. 450 millones de la UE, frente a US pop. 330 millones; 2019 PIB de la UE US$ 20,3 billones equivalentes, frente al PIB de EE.UU. 21,4 billones. La mayoría de los economistas estarían de acuerdo en que una moneda común para un grupo de países sueltos no tiene futuro, no es sostenible. No existe una Constitución común, por lo tanto, no hay un objetivo común, financiera, económica y militarmente. Una moneda común no es sostenible a largo plazo en estas circunstancias inestables. Esto es más que visible sólo 20 años después del euro. La eurozona es un desastre desesperado. En el Banco Central Europeo (BCE), también una creación inspirada en la FED y el Tesoro de los Estados Unidos. El BCE no tiene realmente ninguna función del Banco Central. Es más bien un perro de observación. Porque cada país miembro de la UE todavía tiene su propio Banco Central, aunque con una soberanía drásticamente reducida que los países de la eurozona concedieron al BCE, sin recibir ningún derecho equivalente.

De los 27 miembros de la UE, sólo 19 forman parte de la zona euro. Aquellos países que no forman parte de la Eurozona, es decir, la República Checa, Dinamarca, Hungría, Suecia, y más, han preservado su política financiera soberana y no dependen del BCE. Esto significa que si Grecia hubiera optado por no participar en la Eurozona cuando se vieron afectados por la “crisis” fabricada en 2008/2009, Grecia estaría ahora en camino hacia la recuperación completa. No habrían sido objeto de los caprichos y dictados del FMI, la infame troika, la Comisión Europea (CE), el BCE y el FMI, pero podrían haber optado por organizar su deuda internamente, ya que la mayor parte de la deuda era deuda interna, sin necesidad de endeudarse del extranjero.

En un referéndum de rescate de 2015, la población griega votó abrumadoramente en contra del rescate, lo que significa contra la nueva deuda gigantesca. Sin embargo, el entonces presidente griego Tsipras, siguió adelante como si el referéndum nunca hubiera tenido lugar y aprobó el enorme rescate a pesar de casi el 70% del voto popular en su contra.

Esto es una clara indicación de fraude, que no estaba pasando juego limpio. Tsipras y / o sus familias pueden haber sido coaccionados para aceptar el rescate – o de lo contrario. Tal vez nunca sepamos la verdadera razón por la que Tsipras vendió a su pueblo, el bienestar del pueblo griego a los oligarcas detrás del FMI y el Banco Mundial, y los puso en abyecta miseria, con el mayor desempleo en Europa, pobreza desenfrenada y tasas de suicidio disparadas.

Grecia puede servir de ejemplo sobre cómo pueden llevar a otros países de la UE si no se “comportan”, lo que significa adherirse a las reglas de oro no escritas de obediencia a los maestros del dinero internacional.

Esto da miedo.

*

Y ahora, en estos tiempos de covid, es relativamente fácil. Los países pobres, en particular en el Sur Mundial, ya endeudados por el plandemic, están aumentando su deuda externa para satisfacer a sus poblaciones necesidades básicas. O eso te hacen creer. Gran parte de la deuda acumulada por los países en desarrollo es deuda interna o interna, como la deuda del Norte Global. Realmente no necesita instituciones de préstamos extranjeras para eliminar la deuda local. ¿O ha visto a uno de los países ricos del Norte Global pedir prestado al FMI o al Banco Mundial para dominar su deuda? – Difícilmente.

Entonces, ¿por qué caería el Sur Global? Corrupción parcial, coacción parcial y chantaje parcial. – Sí, el chantaje, uno de los crímenes más grandes internacionales imaginables, fue cometido por las principales instituciones financieras internacionales de las Naciones Unidas, el BM y el FMI.

Por ejemplo, el mundo entero se pregunta cómo es que un enemigo invisible, un virus coronazo a los 193 países miembros de la ONU a la vez, por lo que el Dr. Tedros, Director General de la OMS, declara el 11 de marzo una pandemia -sin razón alguna ya que sólo hubo 4.617 casos en todo el mundo-, pero el resultado previsto fue un bloqueo mundial total el 16 de marzo de 2020. Sin excepciones. Había algunos países que no se lo tomaban tan en serio, como Brasil, Suecia, Bielorrusia, algunos países africanos, como Madagascar y Tanzania, desarrollaron sus propias reglas y se dieron cuenta de que el uso de máscaras hacía más daño que bien, y el distanciamiento social destruiría el tejido social de sus culturas y las generaciones futuras.

Pero el estado satánico y oscuro no quería tener nada que ver con los países “independientes”. Todos ellos tuvieron que seguir el dictado desde muy arriba, desde las Puertas, Rockefeller, Soroses, et al elite, pronto para ser reforzados por Klaus Schwab, sirviendo como el secuaz jefe del Foro Económico Mundial (WEF). De repente, se ve en Brasil, un aumento drástico en nuevos “casos”, sin preguntas, pruebas masivas, no importa que las infames pruebas de PCR no valen nada, según los científicos más serios – ver “La prueba COVID-19 RT-PCR: Cómo engañar a toda la humanidad. Usando una “Prueba” para encerrar a la Sociedad (por Pascal Sacré – 5 de noviembre de 2020) (sólo los científicos vendidos y corruptos, los pagados por las autoridades nacionales, seguirían insistiendo en las pruebas RT-PCR). El brasileño Bolsonaro se enferma con el virus y el recuento de muertes aumenta exponencialmente, a medida que la economía brasileña se desmorona.

¿Coincidencia? Apenas.

En los países del Banco Mundial y/o el FMI, ofreciendo ayuda masiva principalmente alivio de la deuda, ya sea como subvenciones o como préstamos a bajo interés. Pero con enormes ataduras: Debe seguir las reglas establecidas por la OMS, debe seguir las reglas sobre las pruebas masivas en materia de vacunación, cuando estén disponibles, vacunación de mandatarias – si se ajusta a estas y otras reglas específicas de cada país, como dejar que las corporaciones occidentales toquen sus recursos naturales, continuar privatizando su infraestructura social y servicios – puede recibir asistencia del BM y el FMI.

Ya en mayo de 2020, el Grupo del Banco Mundial anunció que sus operaciones de emergencia para luchar contra el COVID-19 ya habían llegado a 100 países en desarrollo, hogar del 70% de la población mundial con préstamos de 160 mil millones de dólares ee.UU. más. Esto significa, para hoy, 6 meses más tarde y en medio de la “Segunda Ola”, el número de países y el número de préstamos o subvenciones de “alivio” debe haber aumentado exponencialmente, habiendo llegado a cerca de los 193 países miembros de la ONU. Lo que explica cómo todos, literalmente todos los países, incluso los países africanos más importantes, como Madagascar y Tanzania, entre los más pobres de los pobres, han sucumbido a la coacción o chantaje de las infames instituciones de Bretton Woods.

Estas instituciones no tienen disputas en la generación de dólares, ya que el dólar es dinero fiduciario, no respaldado por ninguna economía, sino que puede ser producido literalmente desde el aire caliente y prestado a los países pobres, ya sea como deuda o como subvención. Estos países, a partir de ahora y por la presión de las instituciones financieras internacionales, dependerán para siempre de los maestros occidentales de la salvación. Covid-19 es la herramienta perfecta para que los mercados financieros palanen activos de abajo a arriba.

Con el fin de maximizar la concentración de las riquezas en la parte superior, tal vez una o dos o incluso tres nuevas ondas covid pueden ser necesarias. Todo eso está planeado, el WEF ya ha previsto los próximos escenarios, por su libro tiránico “Covid-19 – El Gran Reinicio”. Está todo dispuesto. Y nuestros intelectuales occidentales lo leen, lo analizan, lo critican, pero no lo destrozamos, lo dejamos pararse y observamos cómo se mueve la palabra en la dirección Restablecer. Y el plan es ejecutado debidamente por el Banco Mundial y el FMI, todo bajo el pretexto de hacer el bien para el mundo.

¿Qué es diferente del papel del Banco Mundial y el FMI ante el plandemic covid? – Nada. Sólo la causa de la explotación, el indevolcimiento, la esclavitud. Cuando Covid llegó se hizo fácil. Antes de eso y hasta finales de 2019, los países en desarrollo, en su mayoría ricos en recursos naturales como los codiciados occidentales, el petróleo, el oro, el cobre y otros minerales, como las tierras raras, serían abordados por el BM, el FMI o ambos.

Podrían recibir alivio de la deuda, los llamados préstamos de ajuste estructural, sin importar si realmente necesitaban o no esa deuda. Hoy en día estos préstamos vienen en todos los nombres, formas, formas y colores, literalmente como las revoluciones de color, por ejemplo, a menudo como operaciones de apoyo presupuestario – simplemente los llamo cheques en blanco – nadie controla lo que está sucediendo con el dinero. Sin embargo, los países tienen que reestructurar sus economías, racionalizar sus servicios públicos, privatizar el agua, la educación, los servicios de salud, la electricidad, las carreteras, los ferrocarriles y otorgar concesiones extranjeras para la explotación de los recursos naturales.

La mayor parte de este fraude –el fraude al “robar” los recursos nacionales, pasa sin ser visto por el público en general, pero los países se vuelven cada vez más dependientes de los paymasters occidentales – la soberanía de los pueblos y la soberanía institucional se ha ido. Siempre hay un corruptor y un corrupto. Desafortunadamente, siguen estando omnipresentes en el Sur Global. A menudo, por una porción de dinero, los países se ven obligados a votar con los Estados Unidos a favor o en contra de ciertas resoluciones de la ONU que son de interés para los Estados Unidos. Aquí vamos, el sistema corrupto de la ONU.

Y, por supuesto, cuando se crearon las dos organizaciones de Bretton Woods en 1944, el sistema de votación decidió que no es un país, un voto como en teoría es en la ONU, pero Estados Unidos tiene un derecho absoluto de veto en ambas organizaciones. Sus derechos de voto se calculan en función de su contribución de capital que deriva de una fórmula compleja, basada en el PIB y otros indicadores económicos. En ambas instituciones, el derecho de voto de los Estados Unidos y también el derecho de veto es de alrededor del 17%. Ambas instituciones tienen 189 países miembros. Ninguno de estos otros países tiene un derecho de voto superior al 17%. La UE lo habría hecho, pero los Estados Unidos nunca les permitieron convertirse en un país o una Federación.

*

Covid ha puesto al descubierto, si no antes, cómo estas instituciones financieras internacionales “oficiales” de Bretton Woods, constituidas por las Naciones Unidas, están plenamente integradas en el sistema de las Naciones Unidas, en el que la mayoría de los países todavía confían, tal vez por falta de algo mejor.

Pregunta, sin embargo: ¿Qué es mejor, un sistema corrupto hipócrita que proporciona la “apariencia”, o la abolición de un sistema distópico y el valor de crear uno nuevo, en nuevas circunstancias democráticas y con derechos soberanos por cada país participante?

*

Nota para los lectores: haga clic en los botones de compartir arriba o abajo. Reenvía este artículo a tus listas de correo electrónico. Crosspost en su sitio de blog, foros de Internet. etcetera.

Este artículo fue publicado originalmente en New Eastern Outlook.

Peter Koenig es economista y analista geopolítico. También es especialista en recursos hídricos y medio ambiente. Trabajó durante más de 30 años con el Banco Mundial y la Organización Mundial de la Salud en todo el mundo en los campos del medio ambiente y el agua. Da conferencias en universidades de Estados Unidos, Europa y Sudamérica. Escribe regularmente para revistas en línea como Global Research; ICH; Nueva Perspectiva Oriental (NEO) y más. Es autor de Implosion – Un Thriller Económico sobre Guerra, Destrucción Ambiental y Codicia Corporativa – ficción basada en hechos y en 30 años de experiencia en el Banco Mundial en todo el mundo.

Peter también es coautor del libro de Cynthia McKinney “When China Sneezes: From the Coronavirus Lockdown to the Global Politico-Economic Crisis” (ClarityPress – 1 de noviembre de 2020)

Peter Koenig es investigador asociado del Centro de Investigación sobre la Globalización.

La fuente original de este artículo es Global Research. Derechos de autor © Peter Koenig, Global Research, 2020

The Secret Agenda of the World Bank and the IMF – Global ResearchGlobal Research – Centre for Research on Globalization

¿Una vacuna contra el ARN alterará permanentemente mi ADN?

Will an RNA vaccine permanently alter my DNA?

Dr. Doug Corrigan

“Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas”.

Cuando la gente escucha las palabras vacuna contra el ARN, la primera pregunta que viene a la mente de la persona promedio es: “¿Esta vacuna alterará permanentemente mi ADN?” La segunda pregunta es: “Si la vacuna altera mi ADN, ¿Cuáles son los posibles impactos a largo plazo en la salud?”

Estas son preguntas justas. Desafortunadamente, estas preguntas generalmente son dejadas a un lado, ignoradas, minimizadas o descontadas por el ecosistema farmacéutico. Esta preocupación por la modificación genética es normalmente respondida por el siguiente argumento: el ARN no alterará permanentemente su ADN porque es una molécula temporal que rápidamente se destruye en la célula, y porque es fundamentalmente diferente del ADN. El ARN no se integra en el ADN, y el ARN no permanece en la célula permanentemente porque la célula destruye el ARN relativamente rápido. Por lo tanto, no existe el riesgo potencial de que una vacuna contra el ARN modifique genéticamente el genoma de una persona.

En la superficie, esto parece una respuesta sólida. Es la respuesta de libro de texto que ganaría un 100% de grado en un examen para una clase de biología molecular a nivel universitario.

Sin embargo, las células de nuestro cuerpo no saben nada de los exámenes que están realizando los estudiantes de posgrado.

En primer lugar, permítanme describir brevemente cómo funciona una vacuna contra el ARN. En segundo lugar, permítanme mostrarles vías celulares viables donde una vacuna contra el ARN podría abrirse camino en el material genético permanente de alguien.

Una vacuna contra el ARN funciona convirtiendo una pequeña porción de las células de nuestro cuerpo en una fábrica de producción de vacunas. Tanto el ARN como el ADN son moléculas portadoras de información. Llevan instrucciones sobre cómo construir proteínas específicas. Nuestras células leen esta información, y luego construyen proteínas de acuerdo con las instrucciones. En el caso de una vacuna contra el ARN, las instrucciones de ARN entregado instruyen a nuestras células a construir una réplica casi perfecta de una proteína muy específica que reside en el exterior del virus SARS-CoV-2 llamada proteína “Spike”. Esta proteína Spike normalmente reside en el exterior del virus y funciona como una correa que permite que el virus entre en una célula humana. Debido a que la proteína Spike reside en el exterior del virus, es un inmueble de primera para nuestro sistema inmunológico para apuntar.

Por lo tanto, cuando se le administre una vacuna contra el ARN, este ARN entrará en una pequeña porción de las células, y estas células comenzarán a eliminar una réplica de la proteína púa viral spike. Es importante darse cuenta de que las células no están produciendo todo el virus, solo una porción del virus: la proteína Spike. Debido a que es extraño al cuerpo, esta proteína Spike producida celularmente le pedirá a las células inmunitarias que aprendan a desarrollar anticuerpos que reconozcan específicamente la proteína Spike. En este punto, usted está “vacunado” porque ha adquirido anticuerpos que reconocen el virus (a través de la proteína Spike), así como células de memoria que pueden producir más del anticuerpo en caso de estar infectado con el virus real. Si su cuerpo está expuesto al coronavirus, estos anticuerpos reconocerán la proteína Spike en el exterior del virus. Cuando el virus está recubierto de anticuerpos, es “neutralizado” y ya no puede infectar a otras células.

La mayoría de las otras vacunas funcionan administrando la proteína Spike directamente en el cuerpo o introduciendo un virus atenuado o inactivado que contiene la proteína Spike. En estos tipos de vacunas tradicionales, la proteína Spike se fabricaba previamente en un centro de producción de vacunas. En una vacuna contra el ARN, no hay proteína Spike en la vacuna. En su lugar, la vacuna proporciona a las células instrucciones sobre cómo construir la proteína Spike. Esencialmente, sus células se han convertido en la fábrica de producción de vacunas. Después de algún tiempo, este ARN entregado será destruido por nuestras células, y las células dejarán de producir la proteína Spike. Nuestro cuerpo debe permanecer inalterado, excepto por la presencia de anticuerpos y células inmunitarias que ahora reconocen la proteína Spike del virus.

En teoría, así es como debería funcionar la vacuna. Suena genial en el papel, ¿no?

Antes de llegar a conclusiones reduccionistas, vayamos un nivel más profundo en la biología molecular para responder a la pregunta de si este ARN extraño podría alterar potencialmente nuestro ADN de forma permanente. Creo que la respuesta a esta pregunta es sí.

Es bien sabido que el ARN puede ser “transcrito” en el ADN. En nuestras células se encuentran enzimas llamadas “transcriptasas inversas”. Estas enzimas convierten el ARN en ADN. Existen múltiples fuentes para esta clase de enzimas dentro de nuestras células. Estas transcriptasas inversas normalmente son hechas por otros virus llamados “retrovirus”. El VIH es un retrovirus y también la hepatitis B, pero hay muchos otros retrovirus que caen en esta categoría. Además de estos virus externos, hay virus que están cableados en nuestro ADN genómico llamados retrovirus endógenos (ERV). Estos ERVs albergan instrucciones para producir transcriptasa inversa. Además de los ERVs, hay elementos genéticos móviles que residen en nuestro ADN llamados LTR-retrotransposones que también codifican para las enzimas transcriptasa inversa. Para árcerlo todo, la transcriptasa inversa es utilizada naturalmente por nuestras células para extender los telómeros al final de los cromosomas.

Estas enzimas endógenas de la transcriptasa inversa pueden esencialmente tomar ARN de una sola cadena y convertirlo en ADN de doble cadena. Este ADN se puede integrar en el ADN en el núcleo a través de una enzima llamada integrasa de ADN.

Con tantas fuentes de transcriptasa inversa, es muy probable que el ARN introducido en nuestras células a través de la vacuna podría ser transcrito inversamente en un segmento de ADN de doble cadena, y luego integrado en nuestro material genético central en el núcleo de la célula. Una variedad de condiciones específicas necesitan estar presentes para que esto ocurra, pero es posible si ocurre la convergencia correcta. La biología es desordenada y no siempre perfectamente predecible, incluso cuando las “reglas” se conocen a priori.

A pesar de que la vacuna inicial sólo se introduce en una porción relativamente pequeña de nuestras células, si este proceso de transcripción inversa se produce en las células madre, entonces esta célula modificada genéticamente puede ser replicada y amplificada a una porción más grande de células que componen los tejidos del cuerpo. Las células madre sirven como un reservorio para producir nuevas células de manera perpetua. De esta manera, con el tiempo, un mayor porcentaje de nuestras células somáticas puede ser reemplazado por estos precursores de células madre modificados genéticamente. Este tipo de reemplazo modificado genéticamente de células se observa en algunos pacientes que han recibido trasplantes de médula ósea de otros pacientes. En estos pacientes, incluso las células germinales como los espermatozoides pueden heredar estas modificaciones genéticas, a pesar de que la vía para esta modificación de la línea germinal todavía no se entiende. En estos pacientes, se violaron las llamadas “reglas” que presumiblemente presumían prevenir tal resultado.

Creo que la mayoría de los biólogos moleculares miraban mi tesis y la descontaban como improbables, y no discutía con ellas con demasiada fuerza. Después de todo, si estas vías inversas del ARN al ADN fueran activamente posibles, ¿no causaría el mismo problema una infección normal por el virus? ¿No serviría el ARN introducido por una infección viral del SARS-CoV-2 como sustrato potencial para la modificación genética permanente del ADN celular, al igual que el ARN de la vacuna?

Yo también respondería que esta posibilidad existe. Sin embargo, creo que la probabilidad de ARN viral en este proceso es mucho menor por varias razones. En primer lugar, el ARN viral se empaqueta en partículas virales que actúan como una cáscara. Estas moléculas de ARN se desenvasan temporalmente de esta cáscara mientras que dentro de la célula para producir más ARN viral y proteínas virales, que se secuestran rápidamente y se vuelvan a empaquetar en nuevas partículas virales. Además, el ARN viral es inherentemente inestable debido a las peculiaridades específicas de la secuencia exclusivas del ARN viral, y es rápidamente reconocido por las enzimas celulares para su destrucción.

Por lo tanto, la cantidad de tiempo disponible para que la transcriptasa inversa trabaje en ARN viral “bare” es muy baja. En contraste con esto, el ARN proporcionado a las células a través de una vacuna ha sido alterado en el laboratorio para aumentar su estabilidad de tal manera que persiste en la célula durante mucho más tiempo. Se realizan una serie de modificaciones para aumentar la estabilidad y la longevidad de este ARN suministrado por la vacuna. Esta ingeniería artificial de ARN está diseñada para producir ARN que cuelga en la célula mucho más tiempo que el ARN viral, o incluso el ARN que nuestra célula produce normalmente para la producción normal de proteínas. El propósito de esta longevidad diseñada es aumentar la producción de proteína Spike por nuestras células para maximizar la eficacia de la vacuna. Además, este ARN no secuestra rápidamente en nuevas partículas virales. Por lo tanto, la probabilidad de que se pueda encontrar una vía molecular que resulte en que este ARN se convierta en ADN es mucho mayor, en mi opinión.

Esta probabilidad puede ser minúscula, y puede que ni siquiera se note en experimentos in vitro, o incluso en ensayos clínicos en decenas de miles de pacientes. Las probabilidades de que esto ocurra pueden ser de 1 en 1 seguida de muchos ceros; sin embargo, esa minúscula probabilidad vuela por la ventana cuando se entiende que el cuerpo humano promedio tiene 30 billones de células, y la vacuna se desplegará en hasta 7 mil millones de personas. Si multiplicas estas pequeñas probabilidades a través de estos grandes números, la probabilidad de que esto pueda ocurrir en un número modestamente grande de personas es muy real.

¿Qué sucede si esto ocurre? Hay dos posibles resultados que no son mutuamente excluyentes. En primer lugar, la modificación de las células somáticas, y en particular, las células madre, podría dar lugar a un segmento de la población con un porcentaje cada vez mayor de sus tejidos convertidos en células modificadas genéticamente. Estas células modificadas genéticamente poseen la secuencia genética para producir Spike Protein. Debido a que la proteína Spike es una proteína extraña para el cuerpo humano, los sistemas inmunes de estos individuos atacarán las células de su cuerpo que expresan esta proteína. Estas personas casi inevitablemente desarrollarán condiciones autoinmunes que son irreversibles, ya que este antígeno proteico extraño está ahora permanentemente conectado a las instrucciones contenidas en su ADN.

La segunda posibilidad se basa en una vía que se encuentra que transfiere esta modificación genética a las células germinales (huevo y espermatozoides). Esta es sin duda una posibilidad más remota, pero si ocurriera, esta mutación genética de inserción se encontraría en todas las generaciones futuras derivadas de este individuo o individuos. Debido a que se trata de una modificación de la línea germinal y no una modificación somática, este nuevo elemento genético estará presente en cada célula de estos individuos. Esto significa que potencialmente cada tejido en su cuerpo podría expresar la proteína Spike. Debido a que esta proteína está presente desde el nacimiento, el sistema inmunitario reconocerá esta nueva proteína como “yo” en lugar de no ser uno mismo (extranjero). Si estos individuos están infectados con coronavirus, su sistema inmunitario no reconocería la proteína Spike del virus como extraña, y estos individuos tendrán una capacidad sustancialmente menor para defenderse del coronavirus. Por lo tanto, con el tiempo en las generaciones futuras, un porcentaje creciente de la población sería más susceptible a una infección grave por el coronavirus debido a la función inmune limitada.

Ahora, ninguno de los escenarios descritos anteriormente se basa en el riesgo posterior de desarrollar una mejora dependiente de los anticuerpos (ADE), que es un problema importante con cualquier vacuna desarrollada para coronavirus. ADE es un riesgo para cualquier tipo de vacuna, incluidas las vacunas contra el ARN. Las vacunas actuales contra el ARN que se están avanzando sólo se han probado durante unos meses, y ADE no levantaría su fea cabeza durante varios años, aunque podría ocurrir antes. Por lo tanto, los datos actuales de los ensayos clínicos no están cerca de ser suficientes para descartar el riesgo para la salud de ADE. Si ade ocurre en un individuo, entonces su respuesta al virus podría ser fatal cuando realmente están expuestos al virus después de la vacunación. Para obtener más información sobre la posibilidad de ADE, haga clic aquí para leer mi artículo —> “Es una vacuna contra el coronavirus una bomba de tiempo de marca.”

Además de los riesgos mencionados anteriormente, otro riesgo se hace evidente: Si la célula está infectada con un virus externo, o retrovirus endógenos, mientras que la vacuna está activa en la célula, esto de la vacuna podría ser empalmado genéticamente en el genoma existente de otro virus. Este virus entonces ganaría una proteína de Spike funcional, que luego le permitiría infectar los tejidos respiratorios y otros órganos del cuerpo. Esto significa que los virus que normalmente estaban aislados a ciertos tejidos de repente ganarían la capacidad de infectar una gama mucho más amplia de tejidos, haciéndolos más patógenos o mortales.

Probablemente sea bueno señalar en esta etapa de la discusión que una vacuna contra el ARN nunca ha sido aprobada para su uso en seres humanos. Esta sería la primera vez en la historia que tal enfoque se utilizaría a gran escala. Se han realizado aproximadamente 50 ensayos clínicos en vacunas contra el ARN para el tratamiento del cáncer, y alrededor de una docena de vacunas basadas en ARN están en desarrollo para SARS-CoV-2. Dos candidatos, uno de Pfizer/BioNTech (BNT162b2) y el otro de Moderna (mRNA-1273), son los más lejanos, y han demostrado una eficacia decente en los ensayos clínicos de Fase III (aunque yo diría firmemente que los tamaños de muestra de individuos infectados en ambos experimentos eran tan pequeños que hacer esta afirmación de eficacia es bastante dudosa en esta etapa). Si ha leído las noticias últimamente, estas vacunas se están apresurando de cabeza para ser desplegadas a gran escala con poca atención a las posibles ramificaciones.

Mi opinión profesional es que dado que las vacunas contra el ARN son un nuevo modo de administrar vacunas, deben someterse a pruebas de prueba durante 5-10 años para demostrar que la modificación genética no es una preocupación importante. Además, todas las vacunas contra el coronavirus, independientemente del tipo, deben analizarse durante la misma duración para demostrar que ade ades no es una preocupación. Es absolutamente imposible descartar estas preocupaciones de seguridad en menos de un año.

Solo comparto esta información para que las personas estén informadas y puedan sopesar los riesgos y beneficios potenciales. La conclusión es que la elección depende de usted; sin embargo, para que las personas toban una decisión tan importante, necesitan poseer toda la información.

Fuente: Ciencia con el Dr. Doug

Will an RNA Vaccine Permanently Alter My DNA? – Anti-Empire (anti-empire.com)

TEORÍA DEL HUECO JUDÍO

Son pocos y muy inteligentes pero eso no basta o no da luz a esta psicoteoría tétrica (de tetris, el videojuego de los huecos que entran ensamblados a la perfección) y holística donde las piezas y engarces hacen un todo y este todo vuelve a reclamar piezas. Las piden y exigen azules, si no las hay, entonces buscan de otro color, pero en todo caso se benefician del arco iris por igual. Pongamos que el color azul son los judíos.

Pasa con actores, directores de cine, empresarios, cantantes, escritores, etc., y diría que políticos también, pero en este caso quedarían muy descubiertos y rompería el juego por la dilatación y contracción que estos personajes públicos necesitan para sobrevivir y en muchos casos no encajarían en el juego (tetris) por su tamaño en colores camaleónico.

Pongamos un caso. El creador de Facebook. Es judío. En el momento de crearse una empresa tal, hay varios contendientes que sacan una idea así, suele pasar que en el tiempo y el espacio coincidan grandes ideas o inventos pero uno tiene que ser el elegido. Si hay dos, o tres o más, la empresa o idea que triunfará será la judía. No hay otra opción. A las demás la hundirán o no tendrá financiación. O la judía verá facilidades que la harán volar muy alto sin opción de réplica. Estamos hablando de altos vuelos.

Esto se da en muy alta proporción en Hollywood y la ciudad de NY. Casi todos los directores, productores y actores son judíos. Si alguno no lo es, es porque no había en ese momento un judío que lo pudiese igualar, no ya mejorar, pero hará ganar el mismo dinero a las piezas azules, que la rodean y amparan. Eso sí, ha de ser un buen goyim, esto es un no judío, un chico bueno no judío. Si no fuera así, su carrera descenderá a sus infiernos. Pregúntenle a Mel Gibson.

Amazon, el creador es un buen goyim, no es judío y es muy listo. Las piezas azules vieron los grandes beneficios de esta pieza de otro color y lo adelantada que estaba. Iba como una flecha a su posición, miraron a su alrededor y dijeron: no hay nadie, va un paso o dos por delante. Es un buen chico. Dejémosle un hueco, su color entona y huele a oro.

Son muchos los ejemplos. No hay judíos para todos los puestos, pero saben dar cobertura a este contratiempo o Game Over.

G.R.M.

THEORY OF THE JEWISH HOLLOW

They are few and very intelligent but that is not enough or does not give birth to this gloomy psychotheory (of tetris, the video game of the holes that enter perfectly assembled) and holistic where the pieces and settings make a whole and this whole returns to claim pieces . They ask for and demand blue, if there are none, then they look for another color, but in any case they benefit from the rainbow equally. Let’s say the color blue is the Jews.

It happens with actors, film directors, businessmen, singers, writers, etc., and I would say that politicians too, but in this case they would be very uncovered and would break the game due to the expansion and contraction that these public figures need to survive and in many cases they would not fit in the game (tetris) because of their size in chameleon colors.

Let’s put a case. The creator of Facebook. He is Jewish. At the time of creating such a company, there are several contenders who come up with an idea like this, it usually happens that in time and space great ideas or inventions coincide but one has to be the chosen one. If there are two, or three or more, the company or idea that will succeed will be the Jewish one. No choice. The others will be sunk or will not have funding. Or the bean will see facilities that will make it fly very high without the option of replication. We are talking about high flights.

This occurs in a very high proportion in Hollywood and the city of NY. Almost all the directors, producers and actors are Jewish. If someone is not, it is because at that time there was not a Jew who could match him, not to improve, but he will earn the same money for the blue pieces that surround and protect him. Of course, he must be a good goyim, this is a non-Jew, a good non-Jewish boy. If not, your career will descend into your hells. Ask Mel Gibson.

Amazon, the creator is a good goyim, he is not Jewish and he is very clever. The blue pieces saw the great benefits of this piece of another color and how advanced it was. He was going like an arrow to his position, they looked around him and said: there is no one, he is a step or two ahead. He’s a good boy. Let’s leave a hole, its color tones and smells like gold.

There are many examples. There are not Jews for all positions, but they know how to cover this setback or Game Over.

El ascenso y la represión de la negación del Holocausto

Aquí os traigo un capítulo de un largo artículo que casi podríamos llamar ensayo. Va de un tema con un trasfondo muy actual como es el coronavirus. La aplastante vulnerabilidad de quien antepone una verdad a la trituradora de la propaganda oficial que por algún motivo oculto no se atreve a dialogar ni tratar académicamente, un objetivo que pasa de ser un hecho a convertirse en dogma de fe. Intocable. Y esto debe de tener algún motivo claro: el dogma se debe erosionar con un leve soplo de viento. La mascarilla mental.

Desde que el Holocausto había sido casi desconocido en Estados Unidos hasta mediados de la década de 1960, la negación explícita del Holocausto era igualmente inexistente, pero a medida que el primero crecía en visibilidad después de la publicación del libro de Hilberg de 1961, el segundo pronto comenzó a despertar también.

La vilipendiación de Lipstadt de Barnes como el “padrino” de la negación del Holocausto contiene una pizca de verdad. Su revisión de 1968 publicada póstumamente respaldando el análisis negacionista de Rassinier parece ser la primera declaración tan sustancial publicada en cualquier lugar de Estados Unidos, al menos si excluimos la muy casual desestimación de beaty de 1951 de las afirmaciones judías, que parecen haber atraído una atención pública insignificante.

Cerca de finales de la década de 1960, un editor de derecha llamado Willis Carto se encontró con un manuscrito corto y sin pulir de negación del Holocausto, aparentemente producido algunos años antes, e ignoró las bellezas legales simplemente poniéndolo impreso. El supuesto autor entonces demandó por plagio, y aunque el caso fue finalmente resuelto, su identidad finalmente se filtró como la de David L. Hoggan, un protegido de Barnes con un Doctorado en Historia de Harvard sirviendo como miembro de la facultad junior en Stanford. Su deseo de anonimato estaba dirigido a prevenir la destrucción de su carrera, pero fracasó en ese esfuerzo, y más citas académicas se secaron rápidamente.

Mientras tanto, Murray Rothbard, el padre fundador del libertarismo moderno, siempre había sido un firme partidario del revisionismo histórico, y admiraba mucho a Barnes, que durante décadas había sido la figura principal en ese campo. Barnes también había insinuado brevemente su escepticismo general sobre el Holocausto en un largo artículo de 1967 que apareció en el Rampart Journal,una publicación libertaria de corta duración, y esto puede haberse notado dentro de esos círculos ideológicos. Parece que a principios de la década de 1970, la negación del Holocausto se había convertido en un tema de discusión dentro de la comunidad libertaria de estados Unidos, pero ferozmente librepensada, y esto iba a tener una consecuencia importante.

Un profesor de Ingeniería Eléctrica en Northwestern llamado Arthur R. Butz estaba visitando casualmente alguna reunión libertaria durante este período cuando notó un panfleto denunciando el Holocausto como un fraude. Nunca antes había pensado en el tema, pero una afirmación tan impactante capturó su atención, y comenzó a investigar el asunto a principios de 1972. Pronto decidió que la acusación era probablemente correcta, pero encontró la evidencia de apoyo, incluyendo la presentada en el libro inacabado y anónimo de Hoggan, demasiado esbozada, y decidió que necesitaba ser realizada de una manera mucho más detallada y completa. Procedió a emprender este proyecto en los próximos años, trabajando con la diligencia metódica de un ingeniero académico capacitado.

Su obra principal, El engaño del siglo XX, apareció impresa por primera vez a finales de 1976, e inmediatamente se convirtió en el texto central de la comunidad de negación del Holocausto, una posición que todavía parece conservar hasta el día de hoy, mientras que con todas las actualizaciones y apéndices, la longitud ha crecido a más de 200.000 palabras. Aunque ninguna mención de este próximo libro apareció en el número de febrero de 1976 de Reason, es posible que la palabra de la publicación pendiente se hubiera acercado a los círculos libertarios, lo que provocó el repentino nuevo enfoque en el revisionismo histórico.

Butz fue un respetable profesor titular en Northwestern, y la publicación de su libro que establece el caso de negación del Holocausto pronto se convirtió en una sensación menor, cubierta por el New York Times y otros medios de comunicación en enero de 1977. En uno de sus libros, Lipstadt dedica un capítulo completo titulado “Entering the Mainstream” a la obra de Butz. Según un artículo de comentarios de diciembre de 1980 de Dawidowicz, los donantes judíos y activistas judíos se movilizaron rápidamente, tratando de que Butz disparara por sus puntos de vista heréticos, pero en ese entonces la permanencia académica todavía se mantuvo firme y Butz sobrevivió, un resultado que parece haber irritado enormemente a Dawidowicz.

Un libro tan detallado y completo que establece el caso de la negación del Holocausto naturalmente tuvo un impacto considerable en el debate nacional, especialmente porque el autor era un académico general y aparentemente apolítico, y una edición estadounidense del libro de Butz pronto apareció en 1977. Estoy muy contento de haber hecho arreglos para incluir el volumen en mi colección de libros HTML controversiales, por lo que los interesados pueden leerlo fácilmente y decidir por sí mismos. El engaño del siglo XX El caso contra el presunto exterminio de los judíos europeos ARTHUR R. BUTZ • 1976/2015 • 225.000 PALABRAS

Al año siguiente, estas tendencias de negación del Holocausto parecían ganar más impulso cuando Carto abrió una pequeña nueva empresa editorial en California llamada El Instituto de Revisión Histórica (IHR), que lanzó una revista trimestral titulada The Journal of Historical Review en 1980. Tanto el RSI como su publicación del RSI centraron sus esfuerzos en torno al revisionismo en general, pero con la negación del Holocausto como su principal foco. Lipstadt dedica un capítulo entero al RSI, señalando más tarde que la mayoría de los principales autores de la edición de la razón de febrero de 1976 pronto se afiliaron a ese proyecto o a otras empresas de Carto, al igual que Butz, mientras que el consejo editorial del JHR pronto estuvo bien abastecido con numerosos doctorados, a menudo ganados en universidades de gran reputación. Durante el próximo cuarto de siglo más o menos, el RSI celebraba pequeñas conferencias cada año o dos, con David Irving eventualmente convirtiéndose en un presentador regular, e incluso figuras plenamente dominantes como el historiador ganador del Premio Pulitzer John Toland apareciendo ocasionalmente como oradores.

Como un ejemplo importante de los esfuerzos del RSI, en 1983 la organización publicó The Dissolution of Eastern Europe Jewry, un análisis cuantitativo muy detallado de la demografía subyacente y los movimientos de población en torno al período abarcado por la Segunda Guerra Mundial, aparentemente el primer estudio de este tipo realizado. El autor, escribiendo bajo el seudónimo Walter N. Sanning, trató de revisar el análisis de población extremadamente simplista casualmente asumido por los historiadores del Holocausto.

Antes de la guerra, millones de judíos habían vivido en Europa del Este, y después de la guerra, esas comunidades habían desaparecido en su mayoría. Este hecho innegable ha sido durante mucho tiempo como un pilar central implícito de la narrativa tradicional del Holocausto. Pero aprovechando fuentes totalmente convencionales, Sanning demuestra persuasivamente que la situación era en realidad mucho más complicada de lo que podría parecer. Por ejemplo, se informó ampliamente en el momento en que un gran número de judíos polacos habían sido transportados por los soviéticos a lugares profundos dentro de su territorio, tanto en términos voluntarios como involuntarios, con el futuro Primer Ministro israelí Menachem comenzar a incluir esas transferencias. Además, un gran número de judíos soviéticos fuertemente urbanizados fueron evacuados de manera similar antes que las fuerzas alemanas en 1941. El tamaño exacto de estos movimientos de población ha sido durante mucho tiempo incierto y discutido, pero el análisis cuidadoso de Sanning de los datos del censo soviético de posguerra y otras fuentes sugiere que los totales eran probablemente hacia el extremo superior de la mayoría de las estimaciones. Sanning no afirma que sus hallazgos sean definitivos, pero incluso si sólo son parcialmente correctos, esos resultados sin duda impedirían la realidad de las cifras tradicionales del Holocausto.

Otro participante regular del RSI fue Robert Faurisson. Como profesor de literatura en la Universidad de Lyon-2, comenzó a expresar su escepticismo público sobre el Holocausto durante la década de 1970, y el medio de comunicación resultante llevó a los esfuerzos para sacarlo de su posición, mientras que una petición fue firmada en su nombre por 200 eruditos internacionales, incluyendo al famoso profesor del MIT Noam Chomsky. Faurisson se aferró a sus opiniones, pero los ataques persistieron, incluyendo una brutal paliza de militantes judíos que lo hospitalizó, mientras que un candidato político francés que defendía puntos de vista similares fue asesinado. Las organizaciones activistas judías comenzaron a presionar por leyes para prohibir ampliamente las actividades de Faurisson y otros, y en 1990, poco después de que cayera el Muro de Berlín y la investigación en Auschwitz y otros sitios del Holocausto de repente se hizo mucho más fácil, Francia aprobó un estatuto que criminalizaba la negación del Holocausto, aparentemente la primera nación después de derrotar a Alemania en hacerlo. Durante los años siguientes, un gran número de otros países occidentales hicieron lo mismo, sentando el inquietante precedente de resolver disputas académicas a través de penas de prisión, una forma más suave de la misma política seguida en la Rusia estalinista.

Dado que Faurisson era un erudito literario, no es del todo sorprendente que uno de sus principales intereses fuera El diario de Ana Frank,generalmente considerado como el icónico clásico literario del Holocausto, contando la historia de una joven judía que murió después de ser deportada de Holanda a Auschwitz. Argumentó que el texto era sustancialmente fraudulento, escrito por otra persona después del final de la guerra, y durante décadas varios individuos determinados han argumentado el caso de ida y vuelta. No puedo evaluar adecuadamente ninguno de sus argumentos complejos, que aparentemente implican preguntas de tecnología de bolígrafos y elogios textuales, ni he leído nunca el libro en sí.

Pero para mí, el aspecto más llamativo de la historia es el destino real de la chica bajo la narrativa oficial, como se relata en la entrada de Wikipediacompletamente establishmentaria. Aparentemente la enfermedad arreciaba en su campamento a pesar de los mejores esfuerzos de los alemanes para controlarla, y pronto se enfermó bastante, en su mayoría quedando postrada en la enfermería, antes de morir de tifus en la primavera de 1945 en un campamento diferente unos seis meses después de su llegada inicial. Me parece bastante extraño que una joven judía que cayó gravemente enferma en Auschwitz hubiera pasado tanto tiempo en los hospitales del campamento y eventualmente muriera allí, dado que se nos dice que el propósito principal de Auschwitz y otros campos de este tipo era el exterminio eficiente de sus reclusos judíos.

A mediados de la década de 1990, el movimiento de negación del Holocausto parecía estar ganando visibilidad pública, presumiblemente ayudado por las dudas suscitadas después del anuncio oficial de 1992 de que las muertes estimadas en Auschwitz se habían reducido en unos 3 millones.

Por ejemplo, el número de febrero de 1995 de Marco Polo,una revista japonesa brillante con una tirada de 250.000, llevaba un largo artículo declarando que las cámaras de gas del Holocausto eran un engaño propagandístico. Israel y los grupos judío-activistas respondieron rápidamente, organizando un boicot publicitario generalizado de todas las publicaciones de la empresa matriz, una de las editoriales más respetadas de Japón, que rápidamente se retiró ante esa grave amenaza. Todas las copias del número fueron retiradas de los periódicos, los empleados fueron despedidos, y toda la revista fue cerrada pronto, mientras que el presidente de la empresa matriz se vio obligado a renunciar.

Al explorar la historia de la negación del Holocausto, he notado este mismo tipo de patrón recurrente, generalmente involucrando a individuos en lugar de instituciones. Alguien muy considerado y plenamente mainstream decide investigar el controvertido tema, y pronto llega a conclusiones que se desvían bruscamente de la verdad oficial de las dos últimas generaciones. Por varias razones, esos puntos de vista se hacen públicos, y es demonizado inmediatamente por los medios de comunicación dominados por los judíos como un extremista horrible, tal vez mentalmente trastornado, mientras que es perseguido implacablemente por una voraz de fanáticos judíos-activistas. Esto generalmente provoca la destrucción de su carrera.

A principios de la década de 1960, el historiador de Stanford David Hoggan produjo su manuscrito anónimo El mito de los seis millones,pero una vez que entró en circulación y su identidad se dio a conocer, su carrera académica fue destruida. Una docena de años más tarde, algo en la misma línea sucedió con el profesor de Ingeniería Eléctrica del Noroeste Arthur Butz, y sólo su permanencia académica lo salvó de un destino similar.

Fred Leuchter fue ampliamente considerado como uno de los principales especialistas expertos de Estados Unidos en la tecnología de las ejecuciones, y un largo artículo en The Atlantic lo trató como tal. Durante la década de 1980, Ernst Zundel, un prominente Denier del Holocausto canadiense, se enfrentaba a un juicio por su incredulidad en las cámaras de gas de Auschwitz, y uno de sus testigos expertos era un director de prisión estadounidense con cierta experiencia en tales sistemas, que recomendó involucrar a Leuchter, una de las figuras más importantes en el campo. Leuchter pronto hizo un viaje a Polonia e inspeccionó de cerca las supuestas cámaras de gas de Auschwitz, luego publicó el Informe Leuchter, concluyendo que obviamente eran un fraude y que posiblemente no podrían haber funcionado de la manera que los eruditos del Holocausto siempre habían afirmado. Los feroces ataques que siguieron pronto le costaron toda su carrera empresarial y destruyeron su matrimonio.

David Irving se había clasificado como el historiador más exitoso del mundo en la Segunda Guerra Mundial, con sus libros vendiendo en medio de una brillante cobertura en los principales periódicos británicos cuando accedió a aparecer como testigo experto en el juicio de Zundel. Siempre había aceptado previamente la narrativa convencional del Holocausto, pero leer el Informe Leuchter cambió de opinión, y concluyó que las cámaras de gas de Auschwitz eran sólo un mito. Rápidamente fue sometido a incesantes ataques mediáticos, que primero dañaron gravemente y finalmente destruyeron su ilustre carrera editorial,y más tarde incluso cumplió condena en una prisión austriaca por sus opiniones inaceptables.

El Dr. Germar Rudolf fue un joven químico alemán de éxito que trabajó en el prestigioso Instituto Max Planck cuando se enteró de la controversia sobre el Informe Leuchter, que encontró razonablemente persuasivo pero que contenía algunas debilidades. Por lo tanto, repitió el análisis sobre una base más exhaustiva, y publicó los resultados como la Química de Auschwitz,que llegó a las mismas conclusiones que Leuchter. Y al igual que Leuchter antes que él, Rudolf sufrió la destrucción de su carrera y su matrimonio, y como Alemania trata estos asuntos de manera más dura, finalmente cumplió cinco años en prisión por su imprudencia científica.

Más recientemente, el Dr. Nicholas Kollerstrom, que había pasado once años como historiador de la ciencia en el personal del University College de Londres, sufrió este mismo destino en 2008. Sus intereses científicos en el Holocausto provocaron una tormenta mediática de vilipendio, y fue despedido con un solo día de aviso, convirtiéndose en el primer miembro de su institución de investigación jamás expulsado por razones ideológicas. Anteriormente había proporcionado la entrada de Isaac Newton para una enciclopedia biográfica masiva de astrónomos, y la revista científica más prestigiosa de Estados Unidos exigió que toda la obra fuera pulpada, destruyendo el trabajo de más de 100 escritores, porque había sido fatalmente contaminado por tener un colaborador tan villano. Relató esta desafortunada historia personal como una introducción a su libro de 2014 Breaking the Spell, que recomiendo encarecidamente.

El texto de Kollerstrom resume efectivamente gran parte de las pruebas más recientes de negación del Holocausto, incluidos los libros oficiales de muerte de Auschwitz devueltos por Gorbachov después del final de la Guerra Fría, que indican que las muertes judías fueron un 99% inferiores al total ampliamente creído. Además, las muertes judías mostraron en realidad un fuerte declive una vez que llegaron abundantes suministros de Zyklon B, exactamente en contra de lo que se podría haber esperado bajo la cuenta convencional. También analiza las interesantes nuevas evidencias contenidas en los descifrados británicos en tiempos de guerra de todas las comunicaciones alemanas entre los diversos campos de concentración y la sede de Berlín. Gran parte de este material se presenta en una interesante entrevista de dos horas en Red Ice Radio, convenientemente disponible en YouTube:https://www.bitchute.com/embed/yqjW4EghPeO8/

Las vidas y carreras de un número muy considerable de otras personas han seguido esta misma secuencia desafortunada, que en gran parte de Europa a menudo termina en proceso penal y encarcelamiento. Más notablemente, una abogada alemana que se volvió un poco demasiado audaz en sus argumentos legales pronto se unió a su cliente tras las rejas, y como consecuencia, se ha vuelto cada vez más difícil para los acusados Holocaust Deniers asegurar una representación legal efectiva. Según las estimaciones de Kollerstrom, muchos miles de personas están cumpliendo actualmente condena en toda Europa para la negación del Holocausto.

EuropeanDenial

Mi impresión es que a finales de la década de 1960, los antiguos países soviéticos del bloque habían dejado de encarcelar a la gente simplemente por cuestionar el dogma marxista-leninista, y reservaban sus prisiones políticas sólo para aquellos que se organizan activamente contra el régimen, mientras que la negación del Holocausto se trata hoy de manera mucho más dura. Una diferencia clara es que la creencia real en la doctrina comunista se había desvanecido por completo a casi nada, incluso entre los propios dirigentes comunistas, mientras que en estos días la Holocaustianidad sigue siendo una fe joven y profundamente arraigada, al menos dentro de una pequeña porción de la población que ejerce una influencia enormemente desproporcionada sobre nuestras instituciones públicas.

Otro factor obvio son los muchos miles de millones de dólares actualmente en juego en lo que Finkelstein ha caracterizado acertadamente como “la industria del Holocausto”. Por ejemplo, ahora se están reabriendo nuevas reclamaciones potencialmente enormes contra Polonia por bienes judíos que se perdieron o confiscaron durante la Segunda Guerra Mundial.

En Estados Unidos, la situación es algo diferente, y nuestra Primera Enmienda todavía protege a los Negadores del Holocausto contra el encarcelamiento, aunque los esfuerzos de la ADL y varios otros grupos para criminalizar la “discurso de odio” están claramente dirigidos a eliminar ese obstáculo. Pero mientras tanto, las sanciones sociales y económicas paralizantes se utilizan a menudo para perseguir los mismos objetivos.

Además, varios monopolios de Internet se han ido persuadiendo o cooptado gradualmente para impedir la fácil distribución de información disidente. Ha habido historias en los medios de comunicación en los últimos años de que Google ha estado censurando o redireccionando sus resultados de búsqueda del Holocausto lejos de aquellos que disputan la narrativa oficial. Aún más ominosamente, Amazon, nuestro actual minorista casi monopolístico de libros, dio el paso sin precedentes de prohibir miles de obras de negación del Holocausto,presumiblemente para que no “confundan” a los lectores curiosos, por lo que es una suerte que yo hubiera comprado la mía un par de años antes. Estos paralelismos con el 1984 de George Orwell son realmente bastante sorprendentes, y el “Curtain Over America” que Beaty había advertido en su libro de 1951 de ese título parece mucho más cercano a convertirse en una realidad completa.

Varias figuras de la comunidad de negación del Holocausto han intentado mitigar esta lista negra informativa, y el Dr. Rudolf hace algún tiempo estableció un sitio web HolocaustHandbooks.com,lo que permite comprar o leer fácilmente un gran número de volúmenes clave en línea en una variedad de formatos diferentes. Pero la creciente censura de Amazon, Google y otros monopolios de Internet reduce en gran medida la probabilidad de que alguien se encuentre fácilmente con la información.

Obviamente, la mayoría de los partidarios de la narrativa convencional del Holocausto preferirían ganar sus batallas en los campos de igualdad de actuación en lugar de utilizar medios económicos o administrativos para incapacitar a sus oponentes. Pero he visto pocas pruebas de que hayan tenido un éxito serio en este sentido.

Aparte de los diversos libros de Lipstadt, que me pareció de mala calidad y bastante poco convincentes, uno de los partidarios más enérgicos del Holocausto de las últimas décadas parece haber sido Michael Shermer, el editor de la revista Skeptic, que se había licenciado en psicología y la historia de la ciencia.

En 1997, publicó Why People Believe Weird Things, buscando desacreditar todo tipo de creencias irracionales populares en ciertos círculos, con el subtítulo del libro describiendo estas como “pseudo-ciencia” y “superstición”. Su texto de portada se centró en ESP, secuestros alienígenas y brujería, pero refutar la negación del Holocausto fue la mayor parte de ese libro, abarcando tres capítulos completos. Su discusión sobre este último tema fue bastante superficial, y probablemente socavó su credibilidad al agruparlo junto con su desacreditación de la realidad científica de la “raza” como una falacia de derecha similar, también desde hace mucho tiempo desmentida por los científicos convencionales. Con respecto a este último tema, continuó argumentando que las supuestas diferencias en blanco y negro reclamadas en obras como The Bell Curve de Richard Herrnstein y Charles Murray eran un disparate pseudocientísta, y enfatizó que el libro y los similares habían sido promovidos por los mismos grupos pro-nazis que abogaban por la negación del Holocausto, con esas dos doctrinas perniciosas estrechamente vinculadas entre sí. Shermer había reclutado al profesor de Harvard Stephen Jay Gould para escribir el prólogo de su libro y eso plantea serias preguntas sobre su conocimiento o su juicio, ya que Gould es ampliamente considerado como uno de los fraudes científicos más notorios de finales del siglo XX.

En 2000, Shermer regresó a la batalla, publicando Denying History, totalmente centrado en refutar la negación del Holocausto. Esta vez reclutó al erudito del Holocausto Alex Grobman como su coautor y reconoció el generoso apoyo financiero que había recibido de varias organizaciones judías. Una gran parte del texto parecía centrarse en la psicología y la sociología de Losniers del Holocausto, tratando de explicar por qué la gente podía creer en tonterías tan absurdas. De hecho, se dedicó tanto espacio a esas cuestiones que se vio obligado a saltar por completo la reducción oficial del recuento de cadáveres de Auschwitz en unos 3 millones de años antes, evitando así cualquier necesidad de explicar por qué este gran cambio no había tenido ningún impacto en la cifra canónica del Holocausto de Seis Millones.

Aunque varios escritores como Shermer pueden haber sido alentados por generosos subsidios financieros para hacer el ridículo, sus aliados más violentos en la franja extrema probablemente han tenido un mayor impacto en el debate sobre el Holocausto. Aunque las sanciones judiciales y económicas pueden disuadir a la gran mayoría de los Negadores del Holocausto de mostrar su rostro, la violencia extrajudicial también se ha desplegado a menudo contra esas almas resistentes que permanecen indiferidas.

Por ejemplo, durante la década de 1980 las oficinas y almacenes del RSI en el sur de California fueron bombardeados por fuego y totalmente destruidos por militantes judíos. Y aunque Canadá ha tenido tradicionalmente poca violencia política, en 1995 la gran casa destartalada que sirvió como residencia y oficina de negocios del canadiense Ernst Zundel, uno de los principales editores y distribuidores mundiales de literatura de negación del Holocausto, fue igualmente bombardeada por fuego y quemada hasta el suelo. Zundel ya había enfrentado varios procesos penales acusados de difundir “noticias falsas”, y finalmente cumplió años en prisión, antes de ser deportado de vuelta a su Alemania natal, donde cumplió prisión adicional. Varios otros deniers prominentes del Holocausto incluso se han enfrentado a amenazas de asesinato.

La mayoría de los historiadores y otros académicos son almas tranquilas, y seguramente la amenaza inminente de una violencia terrorista tan grave debe haber disuadido a muchos de ellos de involucrarse en temas tan obviamente controvertidos. Mientras tanto, la implacable presión financiera y social puede desgastar gradualmente tanto a individuos como a organizaciones, lo que hace que eventualmente abandonen el campo o se vuelvan mucho menos activos, y sus lugares a veces son ocupados por los recién llegados.

Un año después de los ataques del 11 de septiembre, la JHR dejó de publicarse. El crecimiento de Internet fue probablemente un factor importante que contribuyó, y con el enfoque nacional cambiando tan bruscamente hacia la política exterior y el Medio Oriente, su organización matriz del RSI se volvió mucho menos activa, mientras que gran parte del debate en curso en Revisionismo y negación del Holocausto se trasladó a varios otros lugares en línea. Pero en algún momento a lo largo de los años, el JHR digitalizó muchos cientos de sus artículos y los publicó en su sitio web, proporcionando más de tres millones de palabras de contenido histórico generalmente de muy alta calidad.

Durante los últimos dos meses, me ha sorprendido repetidamente descubrir que los historiadores asociados con el RSI habían publicado artículos sobre temas bastante paralelos a algunos de los míos. Por ejemplo, después de publicar un artículo sobre la hipótesis de Suvorov de que el ataque de Barbarroja de Alemania había adelantado el ataque planeado de Stalin y la conquista de Europa, alguien me informó de que un crítico había discutido ampliamente el mismo libro de Suvorov veinte años antes en un número de JHR. También descubrí varias piezas del desertor de la CIA Victor Marchetti,una figura importante para los investigadores del asesinato de JFK, que habían recibido poca atención en los medios de comunicación convencionales. También hubo artículos sobre el destino del ataque israelí contra el USS Liberty,un tema casi totalmente excluido de los medios de comunicación.

Navegando casualmente por algunos de los archivos, me quedé bastante impresionado con su calidad, y como los archivos estaban disponibles libremente para que cualquiera los reedite, seguí adelante y los incorporé, haciendo que los millones de palabras de su contenido de revisionista y de negación del Holocausto estuvieran mucho más convenientemente disponibles para los lectores interesados. El material se puede buscar completamente, y también organizado por Autor, Tema y Período de tiempo, con algunos enlaces de muestra incluidos a continuación:

The Journal of Historical Review, 1980-2002 Issues

Archivos de autor:

Archivos de temas:

Así que para aquellos particularmente interesados en la negación del Holocausto, más de un millón de palabras de tal discusión pueden estar convenientemente disponibles, incluyendo obras de muchos de los autores que alguna vez fueron tan altamente considerados por los primeros editores de la revista Reason.

Aquí el artículo completo American Pravda: Holocaust Denial, by Ron Unz – The Unz Review

La vacuna Covid-19; ¿Es la inmunidad o la despoblación el objetivo?

Por Mike Whitney • Unz Review • 4 de diciembre de 2020

“No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos”. Dr. Mike Yeadon PhD, ex Vicepresidente y Científico Jefe de Alergia y Enfermedades Respiratorias de Pfizer

“Lo que sabemos sobre el coronavirus a partir de 30 años de experiencia es que una vacuna contra el coronavirus tiene una peculiaridad única, que es cualquier intento de hacer la vacuna ha dado lugar a la creación de una clase de anticuerpos que realmente enferman a las personas vacunadas cuando finalmente sufren exposición al virus salvaje”. Robert F. Kennedy Jr.

Esto es lo que creo que está sucediendo actualmente en nuestro país y en gran parte del mundo occidental. Una crisis de salud pública, que fue fabricada y descompuesta antes del brote inicial en Wuhan, China, se ha utilizado para cortocircuitar las libertades civiles de larga duración, fortalecer la autoridad de los líderes políticos, colapsar la economía, rehacer dramáticamente las relaciones sociales básicas e imponer un control absoluto sobre el trabajo, la escuela, las reuniones y las actividades recreativas. La política pública está ahora establecida por tecnócratas no electos que operan detrás de la cobertura de organizaciones de sonido elevado que están totalmente controladas por las corporaciones más grandes del mundo y los oligarcas más ricos. El presidente Dwight Eisenhower anticipó este preocupante escenario hace 70 años cuando dijo:

“Sin embargo, al mantener la investigación científica y el descubrimiento en el respeto, como debemos, también debemos estar atentos al peligro igual y opuesto de que las políticas públicas puedan convertirse en la cautiva de una élite científico-tecnológica”.

Bingo. Esta es la situación actual en Estados Unidos. Todo el poder real ha sido concedido a una oligarquía globalista que opera detrás de la cortina de funcionarios gubernamentales corruptos y expertos en salud pública. Esto plantea la cuestión de si el aro que rodea el Coronavirus surgió como una reacción espontánea y apropiada a una pandemia letal y de rápida propagación o si la histeria ha sido muy exagerada (Tasa de Fatalidad de Infección es 0.26% o 1 en 400) para implementar una agenda político-social transformadora que no sólo erradicará la democracia y los derechos humanos básicos, sino que también allanará el camino para las vacunas peligrosas que reducirán drásticamente el crecimiento de la población , que es un objetivo que se comparte ampliamente entre las élites adineradas.

¿Le sorprendería saber que se han utilizado vacunas en Africa, Filipinas, Nicaragua y México para poner fin a la fertilidad? ¿Te sorprendería saber que los mandarines “hacer-bueno” -que quieren salvar al mundo de la sobrepoblación y el calentamiento global- han utilizado vacunas tóxicas contra mujeres jóvenes desprevenidos que no se dieron cuenta de que estaban siendo utilizadas como ratas de laboratorio en un experimento de eugenesia maligna? Esto es de un artículo en Global Research :

“Según LifeSiteNews, una publicación católica, la Asociación de Médicos Católicos de Kenia está acusando a UNICEF y a la OMS de esterilizar a millones de niñas y mujeres al versión de un programa de vacunación contra el tétanos patrocinado por el gobierno keniano…

… las seis muestras dieron positivo para el antígeno HCG. El antígeno HCG se utiliza en vacunas contra la fertilidad, pero se encontró presente en las vacunas contra el tétanos dirigidas a niñas jóvenes y mujeres en edad fértil. El Dr. Ngare, portavoz de la Asociación de Médicos Católicos de Kenia, declaró en un boletín publicado el 4 de noviembre:

“Esto demostró tener razón en nuestros peores temores; que esta campaña de la OMS no se trata de erradicar el tétanos neonatal, sino de un ejercicio de esterilización masiva de control de la población con fuerza bien coordinado utilizando una vacuna de regulación de la fertilidad probada. Estas pruebas se presentaron al Ministerio de Salud antes de la tercera ronda de inmunización, pero fueron ignoradas”.
(“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?“, Investigación Global)

Todo suena bastante sospechoso, ¿no es así, sobre todo porque no hubo crisis de tétanos en Kenia para empezar. Kenya no era más que el campo de pruebas de las vacunas destinados a alcanzar objetivos más diabólicos. Por ejemplo, ¿por qué una campaña contra el tétanos sólo se dirigiría a mujeres de entre 14 y 49 años? ¿Por qué la campaña excluyó a las niñas, los niños y los hombres que eran igualmente susceptibles al tétanos?

¿por qué?

Sabes por qué. Es porque el verdadero objetivo no tenía nada que ver con el tétanos. El tétanos era simplemente el pretexto que se utilizaba para ocultar las actividades de las élites globalistas que trabajaban en las torceduras de su estrategia de despoblación. Eche un vistazo a esta declaración de prensa de la Conferencia de Obispos Católicos de Kenia sobre la Campaña Nacional de Vacunación contra el Tétanos:

“No estamos convencidos de que el gobierno haya asumido la responsabilidad adecuada de garantizar que la vacuna contra el tétanos Toxoid (TT) con la subunidad Beta de gonadotropina coriónica humana (b-HCG) no esté siendo utilizada por los socios de desarrollo patrocinadores. Esto ha sido utilizado previamente por las mismas parejas en Filipinas, Nicaragua y México para vacunar a las mujeres contra el embarazo futuro. La subunidad Beta HCG es una hormona necesaria para el embarazo.

Cuando se inyecta como vacuna a una mujer no embarazada, esta subunidad Beta HCG combinada con toxoide del tétanos desarrolla anticuerpos contra el tétanos y hcG para que si el óvulo de una mujer se fertiliza, su propio HCG natural será destruido haciéndola permanentemente infértil. En esta situación, la vacunación contra el tétanos se ha utilizado como método anticonceptivo”. (“Esterilización masiva”: Médicos kenianos encuentran agente antialcrítil en la vacuna contra el tétanos de las Naciones Unidas?)

Sé lo que estás pensando. Estás pensando que podrían haber llevado a cabo estos programas de despoblación en Africa, pero nunca harían algo así en los Estados Unidos, donde nuestros medios siempre vigilantes expondrían lo que estaban haciendo. ¿Correcto?

Desafortunadamente, los medios de comunicación son propiedad de cerradura, stock y barril por las mismas personas que crean crisis para avanzar en su propia agenda egoísta. Covid-19 probablemente no es diferente en ese sentido. El hecho de que la infección sea modestamente letal en realidad ayuda a alcanzar el objetivo más amplio de remodelar la sociedad, reestructurar la economía, abandonar el gobierno representativo y reducir la población a niveles más sostenibles. Estos son los verdaderos objetivos de esta farsa políticamente impulsada. Echa un vistazo a este artículo en Bloomberg (2019) que ayuda a arrojar luz sobre los desarrollos actuales de Covid. El artículo se titula acertadamente “La Tierra necesita menos gente, dicen los científicos”:

“Hace cuarenta años, científicos de 50 naciones se dieron convergieron en Ginebra para discutir lo que entonces se llamaba el “problema del co2clima”. … Ahora, cuatro décadas después, un grupo más grande de científicos está sonando otra alarma mucho más urgente. Más de 11.000 expertos de todo el mundo piden una adición crítica a la estrategia principal de dumping de combustibles fósiles para energías renovables: tiene que haber muchos menos seres humanos en el planeta…

“Declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática”, escribieron los científicos en una dura advertencia publicada el martes…

Cuando se absorben en secuencia, las cartas establecen una tendencia devastadora para la salud planetaria. Desde el consumo de carne, las emisiones de gases de efecto invernadero y la pérdida de hielo hasta el aumento del nivel del mar y los fenómenos meteorológicos extremos, establecen un retrato sombrío de 40 años de oportunidades despilfarradas. Los científicos hacen llamamientos específicos para que los responsables de la formulación de políticas implementen rápidamente cambios sistémicos en las políticas energéticas, alimentarias y económicas. Pero van un paso más allá, hacia el territorio políticamente cargado de control de la población. “Debe “estabilizarse —e idealmente, reducirse gradualmente— dentro de un marco que garantice la integridad social”, escriben. (“La Tierra necesita menos gente, dicen los científicos”, Bloomberg)

Forbes publicó un artículo similar titulado “Más de 11.000 científicos declaran una emergencia climática”. Aquí hay un clip corto:

“Más allá de simplemente sonar la alarma más fuerte que en el pasado, la carta también ofrece pasos inmediatos que se deben tomar en seis áreas clave para frenar el cambio climático y sus impactos…. Los pasos representan una reordenación bastante drástica de la sociedad mundial y sus sistemas de base,empezando por la eliminación gradual de los combustibles fósiles, reemplazando la limpieza de tierras a gran escala por esfuerzos de reforestación, estabilizando la población mundial y reduciendo en gran medida la cantidad de carne y productos animales que consumimos…”. (“Más de 11.000 científicos declaran una emergencia climática”, Forbes)

Por último, está esta declaración publicada en la revista BioScience por docenas de científicos y respaldada por otros 11.000 de 153 naciones. Los científicos dicen que los cambios urgentes necesarios incluyen poner fin al crecimiento de la población, dejar combustibles fósiles en el suelo, detener la destrucción de los bosques y cortar la alimentación de carne:

“Los científicos tienen la obligación moral de advertir claramente a la humanidad de cualquier amenaza catastrófica y de “contarla como es”. Sobre la base de esta obligación y de los indicadores gráficos que se presentan a continuación, declaramos, con más de 11.000 científicos signatarios de todo el mundo, de forma clara e inequívoca que el planeta Tierra se enfrenta a una emergencia climática.

Todavía aumentando en aproximadamente 80 millones de personas por año, o más de 200.000 por día (figura 1a–b), la población mundial debe estabilizarse —e idealmente, reducirse gradualmente—en un marco que garantice la integridad social. Existen políticas probadas y eficaces que fortalecen los derechos humanos al tiempo que reducen las tasas de fertilidad y disminuyen los impactos del crecimiento de la población en las emisiones de GEI y la pérdida de biodiversidad. Estas políticas hacen que los servicios de planificación familiar estén disponibles para todas las personas, eliminan las barreras a su acceso y logran una equidad de género completa…” (“Advertencia de científicos mundiales de una emergencia climática” )

(Observe cómo el control de la población es un tema recurrente, un tema que coincide con la agenda de “cero emisiones” de las élites y los “filántropos” autoanutados.”)

El hecho es que existe un consenso cada vez mayor entre los líderes corporativos y otras élites de que nos enfrentamos a una “emergencia climática” que requerirá cambios inmediatos y draconianos en nuestras estructuras políticas, sociales y económicas. ¿Es demasiado descabellado pensar que Covid-19 fue conjurado para implementar esos cambios sin revelar la verdadera razón? Después de todo, el público está bastante dividido en el cambio climático, lo que significa que la oposición probablemente estaría organizada, bien financiada y feroz. Sin duda, eso es algo que los oligarcas querían evitar por completo. Una pandemia mundial muy exagerada fue la mejor opción. Con los medios de comunicación ya en remolque, y suficientes expertos en salud pública y gobernadores demócratas para hacer el trabajo pesado, las perspectivas de éxito deben haber parecido bastante prometedoras. 8 meses después de la operación actual, el indicador a cuadros está ahora a la vista. Los gobernadores estatales siguen sin oposición en su usurpamiento de “poderes de crisis” especiales, Fauci y su yema siguen siendo ampliamente venerados, las máscaras están en todas partes, los cierres rodantes y las restricciones cada vez más estrictas siguen siendo el orden del día, y estamos a pocas semanas de la guinda de la torta, el adelgazamiento del rebaño con una “vacuna a base de nanopartículas”. En otras palabras, los ejercicios de esterilización sigilosa que se llevaron a cabo en Africa no fueron más que un ensayo para el evento principal, la inyección sumaria de miles de millones de personas en todo el mundo en un esfuerzo por reducir significativamente la población mundial. ¿Ya llegamos?

Todavía no, pero pronto.

Los equipos de psicólogos que trabajaron con gobiernos (para vender el terror de Covid) y que descubrieron que la realidad mundana debe volverse en su cabeza, a través del distanciamiento social, máscaras, órdenes de refugio en el lugar, cierre de escuelas, empresas, reuniones públicas y servicios religiosos, con el fin de (crear un entorno desorientador y aterrador) para marcar el inicio de un nuevo sistema autoritario en el que la libertad personal no se extiende más allá de seleccionar las compras en línea de Costco o Amazon. Estos psicólogos merecen gran parte del crédito por la transformación del mundo occidental en un estado policial encierro gobernado por inquejanos que ahora decidirán nuestro futuro por nosotros.

LA VACCINE– La culminación de 8 meses de desinformación e histeria implacables

Si bien está claro que el progreso de las vacunas se retrasó deliberadamente hasta después de las elecciones presidenciales , (con el fin de dañar las perspectivas de reelección de Trump) muy pocos se dan cuenta de la razón por la que las vacunas se están desplegando tan rápidamente. En pocas palabras, la epidemia está acabando rápidamente obligando a los fabricantes de vacunas a buscar una aprobación apresura para que la distribución pueda comenzar. Esta es una cuestión de gran urgencia que significa que la FDA sin duda se hundirá en la presión política y aprobará posibles vacunas mucho antes de que los ensayos demuestren que son seguras. El miércoles:

“El Reino Unido se convirtió en el primer país el miércoles en aprobar formalmente la vacuna Pfizer y BioNTech Covid-19… Las primeras inoculaciones se desplegarán la próxima semana… La vacuna ha sido autorizada mucho más rápidamente que cualquier otra en la historia, su desarrollo relámpago supera los 15 a 20 años que suele tardar en desarrollar este tipo de medicamentos”. (“Reino Unido se convierte en el primer país en aprobar la vacuna Pfizer-BioNTech Covid-19”NBC News)

Naturalmente, la seguridad no tiene en cuenta la creación de una vacuna que normalmente requiere 10 años para desarrollarse, sino que se abla rápidamente y se comercializa en tan solo 8 meses. Por definición, una vacuna de este tipo no es segura.

Más de NBC: “En los Estados Unidos, tanto Pfizer-BioNTech como Moderna han presentado solicitudes a la FDA para una autorización de uso de emergencia. Richard Engel, CEO de BioNTech, dijo a Richard Engel de NBC News que estaba “seguro de que una autorización en los EE.UU. también podría ocurrir en las próximas dos semanas”.

Mientras tanto, la Organización Mundial de la Salud dijo a Reuters que había recibido datos de las empresas y los estaba revisando para “posible lista para uso de emergencia”, lo que significa que podría implementarse más rápido en los países en desarrollo”. (NBC Noticias)

¿Por qué estos pavos están siendo llevados al mercado?

Como hemos señalado anteriormente, la distribución de vacunas se está precipitando debido al hecho de que la pandemia se está acabando, de hecho, a todos los efectos prácticos, ya ha terminado. En los Estados Unidos, los datos de hospitalización y muerte se están inflando deliberadamente para perpetuar la histeria, (lo explicaremos más adelante) mientras que en el Reino Unido, las muertes atribuibles a Covid (en la falsa “Segunda Ola”) nunca han excedido el promedio de 5 años de “muertes excesivas”, que es el barómetro para decidir si hay un aumento inusual en la mortalidad o no. La Segunda Ola no existe. Es pura fabricación. Echa un vistazo a este borrón del Dr. Mike Yeadon, ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer. Yeadon descarta la teoría de la “Segunda Ola” como tonterías no científicas. Esto es lo que dice:

“Los virus no hacen olas… He pedido repetidamente ver el trove de artículos científicos utilizados para predecir una ‘segunda ola’ y construir un modelo para calcular su tamaño y tiempo probables. Nunca han estado al día. Es casi como si no hubiera tal literatura fundacional… No ha habido ejemplos de múltiples ondas desde entonces y el coronavirus novedoso más reciente con cualquier propagación real (SARS) realizó una onda cada uno en cada región geográfica afectada. No puedo adivinar por qué se construyó un modelo con una ‘segunda ola’. …

A pesar de la ausencia de pruebas para una “segunda ola”y de la evidencia de ausencia de ondas para esta clase de virus respiratorios, hubo una campaña de plataforma multi-medios de comunicación diseñada para plantar la idea de una “segunda ola” en la mente de todos. Esto duró continuamente muchas semanas. Tuvo éxito: una encuesta de los GPs mostró que casi el 86% de ellos afirmaron que esperaban una “segunda ola” este invierno.

Como investigación para esta pieza, busqué la primera mención de una ‘segunda ola’. Los profesores Heneghan y Jefferson, el 30 de abril, señalaron que se nos advirtió que esperáramos una “segunda ola” y que el primer ministro había advertido, el 27 de abril, de una “segunda ola”. Los profesores advirtió a cualquiera que hiciera predicciones seguras de una “segunda” y una “tercera ola” de que el registro histórico no proporciona apoyo para hacer .

Busqué menciones de la BBC de una ‘segunda ola’. El 3 y 6 de marzo, se menciona una sola onda SARS-CoV-2 con la mayoría (95%) del impacto desde el principio. Lo que parece ser el documento final, el 29 de marzo, todavía se refiere a una ola. Esto es lo que enseña la historia y la inmunología…

A pesar de esta molesta rareza sobre una “segunda ola” y casi como si hubiera un plan para una, la infraestructura de pruebas PCR (reacción en cadena de la polimerasa) en el Reino Unido comenzó a ser remodelada… el alto tribunal portugués determinó hace dos semanas que esta prueba de PCR no es una manera confiable de determinar el estado de salud o infecciosidad de los ciudadanos…. Con la validez científica de esta prueba bajo graves desafíos, creo que debe retirarse inmediatamente del uso.” (“El PCR pseudo-epidemia falsa “, escépticos de bloqueo)

¿Ninguna segunda ola?

No, es 100% bunkum. Pero “había un plan para uno”, es decir, había un plan para amplificar el pánico para lograr los objetivos de las élites. Eso está claro.

Yeadon luego explica cómo las pruebas de PCR fueron retiradas de los laboratorios del NHS (Servicio Nacional de Salud) y entregadas a “centros de pruebas masivas” de propiedad privada que reemplazaron a “científicos biomédicos registrados por el Consejo de Profesiones de Salud y Desposeítamente (HCPC, por suscribidos por el CONSEJO de Profesiones de salud y de cuidado) “” “principalmente por personal voluntario no registrado en laboratorios no acreditados que se han establecido en pocas semanas”. Naturalmente, esto puso en entre qué poner en entre qué poner en entre eso la fiabilidad general de los resultados de las pruebas que, a su vez, produjo un gran número de falsos positivos que de ninguna manera reflejaban el impacto cada vez menor del virus.

Como afirma Yeadon: tales pruebas en masa trae consigo, cuando se utiliza PCR como método, un grave riesgo de lo que llamamos una “pseudoequipción de falso positivo PCR”. Esto nunca podría suceder si no estuviéramos usando pruebas masivas de PCR. Cuando se utilizó una prueba más fiable en Liverpool (prueba de flujo lateral o LFT) que muestra que un porcentaje menor de personas estaban infectadas, la prueba se descartó en favor de la prueba de PCR.

“En septiembre, la gran mayoría de las pruebas de PCR estaban siendo ejecutadas por grandes laboratorios privados, algunos de los cuales se llaman Lighthouse Labs.” Fue entonces cuando el número de infecciones comenzó a aumentar bruscamente, lo que era completamente incompatible con el comportamiento de las epidemias en el pasado.

Yeadon: “¿Cómo podemos cuadrar estas afirmaciones de decenas de miles de “casos” diarios y una “segunda ola” sin precedentes de muertes con la cantidad inviable de pruebas utilizando una técnica considerada por expertos en bancos difícil de realizar de manera confiable incluso a pequeña escala?”

Eso es fácil. Toda la farsa fue manipulada para hacer que los falsos positivos de PCR parezcan una verdadera epidemia. Tenga en cuenta que esta no es mi observación poco profesional, pero el ex Vicepresidente y Científico Jefe de Alergia y Respiratoria de Pfizer.

Y basta con mirar hasta qué punto se mantuvo esta farsa. Aquí está Yeadon explicando cómo las definiciones se extienden hasta el punto de ruptura para exagerar el número de muertes de Covid:

“Un “caso” es una prueba positiva de PCR. No hay síntomas involucrados. Un “ingreso COVID-19” a un hospital es una persona que realiza pruebas positivas por PCR antes, en el momento de la entrada o en cualquier momento durante una estancia hospitalaria, sin importar el motivo del ingreso o los síntomas que el paciente está presentando. Una “muerte COVID-19″ es cualquier muerte dentro de los 28 días de una prueba positiva de PCR.”

Por lo tanto, supongamos que tiene un ataque cardíaco masivo y muere, pero una prueba de PCR muestra que tiene fragmentos de ARN inofensivos en el torrente sanguíneo, entonces la muerte se etiqueta como “Covid”. ¿Entiendes? Yeadon resume este pañuelo en una frase:

“Tenemos pruebas muy sólidas de que las pruebas en masa de PCR que se llevan a cabo actualmente no valen nada.” (Yeadon y un panel de expertos han presentado desde entonces un documento de 10 puntos al consejo editorial de eurosurveillance que desafía la ciencia en la que se basa la prueba de PCR “que ha dado lugar a un diagnóstico erróneo mundial de las infecciones atribuidas al SARS-CoV-2 y asociadas con la enfermedad COVID-19. Nos enfrentamos a estrictos bloqueos que han destruido la vida y los medios de vida de muchas personas, el acceso limitado a la educación y estas restricciones impuestas por los gobiernos de todo el mundo son un ataque directo a los derechos básicos de las personas y sus libertades personales, lo que resulta en daños colaterales para economías enteras a escala mundial.”)

Según Yeadon y su equipo de investigadores independientes:

“La pandemia había terminado en junio y la inmunidad del rebaño fue la principal fuerza que convirtió la pandemia y la puso en retirada. En el otoño, los “casos” reclamados son un artefacto de un sistema de pruebas trastornado…. Mientras que hay algunos COVID-19 en la línea de la “ondulación secundaria” … ha ocurrido principalmente en regiones, ciudades y distritos que fueron menos afectados en la primavera. Real COVID-19 es autolimitante y puede que ya haya alcanzado su punto máximo en algunas ciudades del norte. No volverá en vigor…

Eso es todo. Todo lo demás es una pseudoequipción de PCR falso positivo. La cura, por supuesto, como lo ha sido en el pasado cuando la PCR ha reemplazado la pandemia en sí misma como la amenaza en la tierra, es detener las pruebas masivas de PCR.” (“The PCR False Positive Pseudo-Epidemic” Dr. Mike Yeadon, Lockdown Skeptics)

El análisis de Yeadon es similar al de Genevieve Briand, director asistente del programa de maestría de Economía Aplicada en John Hopkins. Briand quería ver el efecto que Covid tuvo en el exceso de muertes usando los propios datos de los CDC. Lo que encontró fue extraordinario, pero consistente con el análisis de Yeadon. Este es un breve resumen de lo que descubrió:

“Desde mediados de marzo hasta mediados de septiembre, las muertes totales de EE. UU. han alcanzado los 1,7 millones, de los cuales 200.000, es decir, el 12% del total de las muertes, están relacionadas con COVID-19…

Después de recuperar datos en el sitio web de los CDC, Briand compiló un gráfico que representa los porcentajes de muertes totales por categoría de edad desde principios de febrero hasta principios de septiembre,que incluye el período desde antes de que COVID-19 se detectara en los EE.UU. hasta después de que las tasas de infección se elevaran.

Sorprendentemente, las muertes de personas mayores se mantuvieron iguales antes y después de COVID-19. Dado que COVID-19 afecta principalmente a los ancianos, los expertos esperaban un aumento en el porcentaje de muertes en grupos de edad avanzada. Sin embargo, este aumento no se ve de los datos de los CDC. De hecho, los porcentajes de muertes entre todos los grupos de edad siguen siendo relativamente los mismos.

“La razón por la que tenemos un mayor número de muertes reportadas de COVID-19 entre individuos mayores que individuos más jóvenes es simplemente porque cada día en los Estados Unidos los individuos mayores mueren en un número más alto que los individuos más jóvenes”, dijo Briand.

Briand también señaló que se observan entre 50.000 y 70.000 muertes antes y después de COVID-19, lo que indica que este número de muertes era normal mucho antes de que surgió COVID-19. Por lo tanto, según Briand, no sólo COVID-19 no ha tenido ningún efecto en el porcentaje de muertes de personas mayores, sino que tampoco ha aumentado el número total de muertes.

Estos análisis de datos sugieren que, a diferencia de la mayoría de las suposiciones de las personas, el número de muertes por COVID-19 no es alarmante. De hecho, no tiene relativamente ningún efecto sobre las muertes en los Estados Unidos.

…”Todo esto no apunta a ninguna evidencia de que COVID-19 haya creado muertes excesivas. Los números totales de muerte no están por encima de los números normales de muerte. No encontramos pruebas de lo contrario”, concluyó Briand”. (“Una mirada más cercana a las muertes de EE.UU. debido a COVID-19”JB Wells News)

La investigación de Yeadon y Brand ayuda a mostrar cómo los resultados de pruebas falsas, los datos de mortalidad manipulados, el engaño implacable y los mandatos estatales desorientadores (máscaras, encierro, etc.) han alimentado la histeria pública creando la población obediente que nuestros gobernantes buscan. Después de 8 meses de este psíquico-drubbing, las élites ahora están listas para dar el golpe de gracia, una vacuna que contiene sustancias potencialmente tóxicas que cambiará el curso de la historia.

¿Exagero?

Tal vez, pero hay muchas razones para preocuparse. Tenga en cuenta que los defensores más entusiastas de estas vacunas experimentales (medios de comunicación) son las mismas personas:

  1. Que mintió sobre Trump-Rusia durante 3 años sin parar.
  2. Que censuraron agresivamente cualquier información sobre la operación de tráfico masivo de influencias de Hunter Biden.
  3. Quién encubría cualquier información relacionada con las elecciones presidenciales robadas del mes pasado.

Los medios de comunicación son el enemigo del pueblo, y lo han demostrado muchas veces. Pero, ¿cómo podemos aplicar esta regla a la implantación de las nuevas vacunas?

Podemos suponer que los intereses de los adineradas potenciadores, que son dueños de los medios de comunicación y establecen su agenda, tendrán prioridad sobre las personas que están en la fila para ser vacunadas. Es todo. Sus intereses tendrán prioridad sobre su seguridad. Así es como funciona.

Por lo tanto, uno debe ser extremadamente cauteloso con las vacunas que se apresuran al mercado en un tiempo récord, del mismo modo que deben sospechar de los motivos de las personas que ven el “escepticismo” o la “vacilación” como una “amenaza para la seguridad nacional”. No se puede confiar en esta gente. Es así de simple.

¿Por qué, por ejemplo, el gobierno británico alistaría“inteligencia militar para buscar y erradicar lo que El Times llama “militantes antivacunas” y “contenido propagandístico” relacionado en el ciberespacio??

¿Por qué los gigantes de las redes sociales eliminarían artículos que critican las vacunas?

¿Por qué todos los medios de comunicación y expertos en salud pública están presionando para la vacunación masiva?

¿por qué?

La respuesta es obvia, ¿no?

Es porque los ricos powerbrokers que están orquestando esta operación.quieren ver que el pueblo vacunado en masa. De eso se trata todo esto.

Entonces, la pregunta es: ¿Por qué? ¿Por qué es tan importante para ellos? ¿Es porque quieren salvar vidas?

No, eso no es todo. Obviamente hay algo más que no sabemos. Tal vez sea el cambio climático, tal vez es sobrepoblación, o tal vez es una determinación colectiva para transformar la sociedad en una distopía tecnocrática. (“El Gran Reinicio”). No lo sabemos, pero una cosa es cierta, todo este ballyhoo sobre Covid es un arenque rojo. Simplemente desvía la atención de la agenda real, razón por la cual debemos ser cautelosos con respecto a las vacunas. La vacunación masiva podría, de hecho, ser el objetivo final. Echa un vistazo a la versión de Yeadon sobre las vacunas en una reciente edición de LifeSite News:

No hay absolutamente ninguna necesidad de vacunas para extinguir la pandemia… No vacunas a personas que no están en riesgo de contraer una enfermedad. Tampoco se dispone a planear la planificación de vacunar a millones de personas sanas y en forma con una vacuna que no ha sido ampliamente probada en seres humanos…

Dado que es demostrable que “alrededor del 30% de la población tenía inmunidad previa”, y si uno incluye a algunos niños pequeños que son “resistentes”, el 40%, y si bien considera que la tasa de infección está “en algún lugar [de unos 20 a 30 por ciento”, esto significa que alrededor del 65 al 72% de la población tiene actualmente inmunidad al COVID-19.

Y teniendo en cuenta la realidad de la inmunidad del rebaño, cuando la susceptibilidad a un virus cae tan baja, alrededor del 28 al 35%, “esa población ya no puede soportar un brote creciente de enfermedad”, y por lo tanto el virus “disminuye y desaparece… La pandemia ha terminado de manera efectiva y puede ser manejada fácilmente por un NHS (Servicio Nacional de Salud) que funcione correctamente. En consecuencia, se debe permitir inmediatamente al país volver a la vida normal”. (“Ex Vicepresidente de Pfizer: ‘No hay necesidad de vacunas’, ‘la pandemia ha terminado efectivamente”LifeSite News)

¿Tiene razón? ¿Son las vacunas un riesgo innecesario que no sirve para nada? Aquí hay más de Yeadon sobre los posibles efectos a la baja de las nuevas vacunas basadas en EL ARNm que son “toda la rabia”.

“La formación de los llamados “anticuerpos no neutralizantes” puede conducir a una reacción inmune exagerada,especialmente cuando la persona de la prueba se enfrenta al virus real, “salvaje” después de la vacunación.”

– Se espera que las vacunas produzcan anticuerpos contra las proteínas de pico del SARS-CoV-2. Sin embargo, las proteínas de espiga también contienen proteínas sincronía-homóloticas, que son esenciales para la formación de la placenta en mamíferos como los humanos. Debe descartarse que una vacuna contra el SARS-CoV-2 podría desencadenar una reacción inmunitaria contra la sincronía-1, ya que, de lo contrario, podría dar lugar a una infertilidad de duración indefinida en mujeres vacunadas.

– Las vacunas contra el ARNm de Pfizer/BioNTech contienen polietilenglicol (PEG). Esto significa que muchas personas pueden desarrollar reacciones alérgicas, potencialmente mortales a la vacunación.

 La duración demasiado corta del estudio no permite una estimación realista de los efectos tardíos. Al igual que en los casos de narcolepsia después de la vacunación contra la gripe porcina, millones de personas sanas estarían expuestas a un riesgo inaceptable si se concediera una aprobación de emergencia y se diera la posibilidad de observar los efectos tardíos de la vacunación.” (“That Was Quick”, Lockdown Skeptics)

Vamos a resumir:

  1. Las nuevas vacunas contra el ARN mensajero podrían hacer que los receptores sean más susceptibles a enfermedades graves o muerte.
  2. Las proteínas Spike pueden“desencadenar una reacción inmunitaria” que “resultará en infertilidad”. (Una vez más, Control de población)
  3. Las nuevas vacunas contienen polietilenglicol (PEG) que puede ser“potencialmente mortal”.
  4. Los ensayos no fueron lo suficientemente largos para determinar si las vacunas son seguras o no. La aprobación de la FDA no significa “seguro”. Todo lo contrario. La FDA es “capturada” de la misma manera que se captura la FAA. (Piense: Boeing 737 Max)

El nuevo régimen de las vacunas Covid-19 es innecesario y arriesgado. Los lectores deben ignorar el bombo y hacer su propia investigación. Asumir la responsabilidad de su propia salud y bienestar. No espere que los medios de comunicación o los funcionarios de salud pública digan la verdad. No lo harán. Quieren usarte como conejillo de indias en su desquiciado experimento de laboratorio. No coopere, no cumpla, no aquieste, no ceda.

No te rindas.

Original and in english The Covid-19 Vaccine; Is the Goal Immunity or Depopulation? « Aletho News

Alemania: Ursula Haverbeck, disidente y presa política, enviada de vuelta a prisión; Puede convertirse en la reclusa femenina más anciana del mundo

Y esto pasa en Europa a día de hoy…

Apenas una semana después de terminar una condena de dos años y medio de prisión por “negación del Holocausto”, Ursula Haverbeck, de 92 años, ha sido condenada de nuevo por los tribunales alemanes, esta vez por una entrevista que dio en 2018 que afirmó su opinión de que los judíos no fueron asesinados sistemáticamente durante la Segunda Guerra Mundial y que las cámaras de gas en Auschwitz son una mentira políticamente motivada.

Si la sentencia del tribunal federal de un año en el caso más reciente de Haverbeck se mantiene, Alemania tendrá la dudosa distinción de encarcelar a la mujer más vieja del mundo, un título anteriormente en poder de la estadounidense Lucille Keppen, que fue encarcelada por disparar a su vecina y fue liberada a los 93 años.

El gobierno alemán ha estado arrastrando a Haverbeck a los tribunales durante décadas por disputar las demandas judías de cámaras de gas y el asesinato sistemático. Haverbeck ha protestado famosamente por las cortes canguro que humillan y difaman a veteranos de guerra de edad avanzada usando testimonios falsos de “supervivientes”.

Numerosos funcionarios de alto rango del Tercer Reich, soldados y trabajadores de campos de concentración han cuestionado la narrativa del Holocausto desde 1945, incluyendo al oficial de la Wehrmacht Otto Ernst Remer, el empleado de Auschwitz Thies Christophersen, Erich Priebke, Leon Degrelle, y el soldado de las SS Karl Muenter, este último que murió antes de que comenzara su juicio por la negación del Holocausto a la edad de 96 años.

El difunto esposo de Haverbeck, Werner Georg Haverbeck, era un influyente miembro del NSDAP que se opuso a la difamación de sangre contra el pueblo alemán conocido como die Auschwitz luge (la mentira de Auschwitz).

El sistema legal del BRD ha sido despiadado con Haverbeck. Al no extranjero, que es un preso de conciencia, se le negó la liberación después de cumplir 2/3 de su condena de prisión como es costumbre en Alemania. Mientras que el estado liberó a 1.000 delincuentes antes de tiempo debido a COVID en marzo pasado, Haverbeck sólo fue dejado salir a mediados de noviembre.

No hay señales de verguenza o preocupaciones de derechos humanos en el país, con el juez en el último caso subrayando que Haverbeck seguirá siendo castigada hasta que aprenda a mantener la boca cerrada. Uno sólo puede imaginar la contracción de las ONG liberales si Irán, China o Rusia encarcelaron a una anciana sólo por cuestionar la línea del gobierno.

El poderoso espíritu de Haverbeck se ha convertido en una inspiración para los patriotas en Alemania y en todo el mundo. En 2019, se postuló como candidata parlamentaria europea desde entre rejas y recibió 25.000 votos, lo que fue muy perturbador para el establecimiento de medios europeos. Cada año, en su cumpleaños, cientos de alemanes se reunieron fuera de su centro de detención exigiendo su liberación.

Intelectuales y activistas de toda Europa, las Américas y Japón han expresado su consternación por su maltrato y la falta de libertad en la tierra que dice ser una “democracia”. En JVA Bielefeld, donde Haverbeck fue alojado, los funcionarios de prisiones lucharon por procesar la avalancha de cartas y flores que su famoso prisionero recibió a lo largo de su sentencia.

Para el prisionero más viejo de Alemania, está claro que no se acobardará ante la ira de los grupos judíos dirigiendo burócratas profesionales. Es en interés reputacional del estado alemán dejar de atormentar a Haverbeck, sin embargo, el temor religioso de Occidente al debate sobre lo que ocurrió durante la Segunda Guerra Mundial sigue ocupando un precedente sobre todas las demás preocupaciones.

Germany: Political Dissident Ursula Haverbeck Sent Back To Prison; May Become Oldest Female Inmate In The World, by Eric Striker – The Unz Review

El Mossad y el asesinato de JFK

Os traigo aquí un artículo muy curioso con el tema hiper manido JFK. Y ya que estamos, pregunto, si se pueden “quitar” presidentes, ¿también se podrán “poner”?

John-F-Kennedy.net

“Israel no necesita disculparse por el asesinato o la destrucción de aquellos que tratan de destruirlo. La primera orden de negocios para cualquier país es la protección de su pueblo.” – Semana Judía de Washington , 9 de octubre de 1997

***

En marzo de 1992, el Representante de Illinois Paul Findley dijo en The Washington Report on Middle East Affairs: “Es interesante, pero no sorprendente, observar que en todas las palabras escritas y pronunciadas sobre el asesinato de Kennedy, la agencia de inteligencia de Israel, el Mossad, nunca ha sido mencionada”.

Teniendo en cuenta que el Mossad es posiblemente la agencia de inteligencia más despiadada y eficiente del mundo, es peculiar que nunca hayan sido escrutados en relación con el asesinato de Kennedy, especialmente cuando prácticamente todas las otras entidades del mundo (menos que los imitadores de Elvis) han sido implicadas. Pero todo eso cambió en enero de 1994 con el lanzamiento de Juicio Final de Michael Collins Piper. En este libro, Piper dice, “El Mossad de Israel fue un jugador principal (y crítico) detrás de las escenas en la conspiración que puso fin a la vida de JFK. A través de sus vastos recursos y a través de sus contactos internacionales en la comunidad de inteligencia y en el crimen organizado, Israel tenía los medios, tenía la oportunidad y tenía el motivo de desempeñar un papel importante en primera línea en el crimen del siglo, y lo hizo.”

¿Su motivo? El muy promocionado primer ministro de Israel, David Ben-Gurion, que gobernó ese país desde su creación en 1948 hasta que renunció el 16 de junio de 1963, se enfureció tanto en John F. Kennedy por no permitir que Israel se convirtiera en una potencia nuclear que, según Collins, en sus últimos días en el cargo mandó a los Mossad que se involucraran en un complot para matar al presidente de Estados Unidos.

Ben-Gurion estaba tan convencido de que la supervivencia misma de Israel estaba en grave peligro que en una de sus cartas finales a JFK dijo: “Señor Presidente, mi pueblo tiene derecho a existir, y esta existencia está en peligro”.

En los días previos a la renuncia de Ben-Gurion al cargo, él y JFK habían estado involucrados en un debate no publicitado y polémico sobre la posibilidad de que Israel tuviera capacidades nucleares. Su desacuerdo finalmente se convirtió en una guerra de palabras de pleno derecho que fue prácticamente ignorada en la prensa. Ethan Bronner escribió sobre esta batalla secreta entre JFK y Ben-Gurion años más tarde en un artículo del New York Times el 31 de octubre de 1998, llamándolo un “sujeto ferozmente oculto”. De hecho, las conversaciones Kennedy/Ben-Gurion siguen siendo clasificadas por el Gobierno de los Estados Unidos. Tal vez este sea el caso porque la rabia y la frustración de Ben-Gurion se volvieron tan intensas , y su poder tan grande dentro de Israel – que Piper sostiene que fue el centro de la conspiración para matar a John Kennedy. Esta postura es apoyada por el banquero neoyorquino Abe Feinberg, quien describe la situación como tal: “Ben-Gurion podría ser vicioso, y tenía tal odio hacia el viejo [Joe Kennedy, Padre, padre de JFK]”. Ben-Gurion despreciaba a Joe Kennedy porque sentía que no sólo era un antisemita, sino que también se había puesto del lado de Hitler durante los años 1930 y 40. [Tocaremos este aspecto de la historia en un próximo artículo titulado La CIA y el crimen organizado: dos caras de la misma moneda].

De todos modos, Ben-Gurion estaba convencido de que Israel necesitaba armas nucleares para asegurar su supervivencia, mientras que Kennedy estaba en contra. Esta incapacidad para llegar a un acuerdo causó problemas obvios. Uno de ellos giró en torno a la decisión de Kennedy de que haría de Estados Unidos su máxima prioridad en lo que respecta a la política exterior, ¡y no a Israel! Kennedy planeaba honrar la Declaración Tripartita de 1950 que decía que Estados Unidos tomaría represalias contra cualquier nación en el Medio Oriente que atacara a cualquier otro país. Ben-Gurion, por otro lado, quería que la Administración Kennedy les vendiera armas ofensivas, particularmente misiles Hawk.

Los dos líderes participaron así en un brutal intercambio de cartas, pero Kennedy no se movería. Ben-Gurion, obsesionado por este tema, se deslizó en la paranoia total, sintiendo que la obstinación de Kennedy era una amenaza flagrante a la existencia misma de Israel como nación. Piper escribe: “Ben-Gurion había dedicado toda una vida a crear un Estado judío y guiarlo a la arena mundial. Y, a los ojos de Ben-Gurion, John F. Kennedy era un enemigo del pueblo judío y de su amado estado de Israel”. Continúa: “La ‘opción nuclear’ no sólo estaba en el núcleo mismo de la visión personal del mundo de Ben-Gurion, sino en la base misma de la política de seguridad nacional de Israel”.

Ben-Gurion estaba tan preocupado por obtener armas nucleares que el 27 de junio de 1963, once días después de renunciar al cargo, anunció: “No conozco a ninguna otra nación cuyos vecinos declaren que desean terminarla, y no sólo declararla, sino prepararse para ello por todos los medios a su alcance. No debemos hacerse ilusiones de que lo que se declara cada día en El Cairo, Damasco e Irak son sólo palabras. Este es el pensamiento que guía a los líderes árabes … Estoy seguro … que la ciencia es capaz de proporcionarnos las armas que servirán a la paz y dester casarán a nuestros enemigos”.

Avner Cohen, en Israel y la Bomba, publicado por Columbia University Press, refuerza este sentido de urgencia escribiendo: “Imbuido de lecciones del Holocausto, Ben-Gurion fue consumido por temores a la seguridad … La ansiedad por el Holocausto llegó más allá de Ben-Gurion para infundir el pensamiento militar de Israel”. Añade además combustible a este punto señalando: “Ben-Gurion no tenía reparos en la necesidad de Israel de armas de destrucción masiva”, y “la visión mundial de Ben-Gurion y su estilo de gobierno decisivo dieron forma a su papel crítico en la instigación del progreso nuclear de Israel”.

Kennedy, por otro lado, fue firme en su negativa a promover la ascensión de Israel a la etapa nuclear. Avener Cohen, en Israel y la Bomba, subraya: “Ningún presidente estadounidense estaba más preocupado por el peligro de la proliferación nuclear que John Fitzgerald Kennedy. Estaba convencido de que la propagación de armas nucleares haría que el mundo fuera más peligroso y socavara los intereses estadounidenses”. Cohen continúa al final de este pasaje: “El único ejemplo que Kennedy utilizó para hacer este punto fue Israel”.

Al darse cuenta de que Kennedy no cambiaría de opinión, Ben-Gurion decidió unir fuerzas con la China comunista. Ambos países estaban muy interesados en crear programas nucleares, por lo que comenzaron sus relaciones conjuntas secretas. Trabajando al unísono a través del intermediario Shaul Eisenberg, quien era socio del corredor de armas del Mossad y contador Tibor Rosenbaum, Israel y China procedieron a desarrollar sus propias capacidades nucleares sin el conocimiento de los Estados Unidos.

Si encuentras este escenario improbable, te insto encarecidamente a leer el excelente libro de Gordon Thomas, Seeds of Fire, donde expone cómo el Mossad y el CSIS (servicio secreto chino) han conspirado en muchas ocasiones no sólo para robar secretos militares estadounidenses, sino también para doctorar programas de inteligencia estadounidenses como el software PROMISE del Departamento de Justicia. Este caso, me temo decirlo, no es más que el primero en el que los ecos del asesinato del JFK todavía se pueden sentir hoy reverberando a través de nuestro mundo posterior al 9-11. El peligro de que Israel desarrollara la Bomba al unísono con China se convirtió en una situación muy volátil, y fue vigilado de cerca por la CIA.

Con la intención de seguir este camino, el israelí construyó una instalación nuclear en Dimona. Cuando Kennedy exigió que Estados Unidos inspeccionara esta planta, Ben-Gurion estaba tan indignado que erigió otra instalación de PHONY que no tenía evidencia de investigación y desarrollo nuclear. (¿Este escenario suena muy familiar para el juego que estamos jugando con Saddam Hussein en Irak en este momento?) Sin embargo, fue totalmente consciente de sus travesuras, JFK le dijo a Charles Bartlett: “Los hijos de puta me mienten constantemente sobre su capacidad nuclear”.

Avner Cohen, en Israel y la Bomba, reitera esta afirmación diciendo que Ben-Gurion había tomado el tema nuclear tan de cerca que “concluyó que no podía decir la verdad sobre Dimona a los líderes estadounidenses, ni siquiera en privado”.

El Dr. Gerald M. Steinberg, profesor de ciencias políticas del Centro BESA de Estudios Estratégicos de la Universidad de Bar-Ilan en Tel Aviv, pesa: “Entre 1961 y 1963, la administración Kennedy ejerció una gran presión sobre Ben-Gurion en el esfuerzo por presionar para la aceptación de la inspección internacional de Dimona y la abdicación israelí de sus armas nucleares. Aparentemente, esta presión no alteró la política israelí, pero fue un factor que contribuyó a la renuncia de Ben-Gurion en 1963”.

Para transmitir la gravedad de esta situación en términos modernos, mire lo que está sucediendo en Iraq con los equipos de seguridad de las Naciones Unidas inspeccionando los palacios reales y búnkeres en busca de armas y materiales nucleares. Este asunto es tan urgente que nuestra nación está al borde de la guerra. Cuarenta años antes, el calor que JFK estaba poniendo sobre Ben-Gurion fue igual de fuerte que lo que George Bush está poniendo sobre Saddam Hussein hoy.

En Israel y la bomba, Avner Cohen refuerza este punto. “Para obligar a Ben-Gurion a aceptar las condiciones, Kennedy ejerció la influencia más útil disponible para un presidente estadounidense para tratar con Israel: una amenaza de que una solución insatisfactoria pondría en peligro el compromiso y el apoyo del gobierno de Estados Unidos con Israel”.

La presión sobre Ben-Gurion fue tan inmensa que terminó dejando el cargo. Pero Kennedy, al más puro estilo pitbull, no dejó que el sucesor de Ben-Gurion, Levi Eshkol, informa Avner Cohen. “Kennedy le dijo a Eshkol que el compromiso y el apoyo de Estados Unidos a Israel ‘podría estar seriamente en peligro’ si Israel no dejaba que Estados Unidos obtuviera ‘información confiable’ sobre sus esfuerzos en el campo nuclear. Las demandas de Kennedy no tenían precedentes. Fueron, en efecto, a un ultimátum. Cohen concluye este pensamiento afirmando: “La carta de Kennedy precipitó una situación cercana a la crisis en la oficina de Eshkol”.

Al final, como todos sabemos, Kennedy fue asesinado en noviembre de 1963; pero menos conocida es que China llevó a cabo su primera prueba nuclear en octubre de 1964. Lo que hace que este evento sea más profundo es la afirmación de Piper de que a pesar de que Israel dijo que sus primeras pruebas nucleares tuvieron lugar en 1979, ¡en realidad ocurrieron en octubre de 1964 junto con los chinos! Si esto es cierto, aparte de agosto de 1945, cuando Estados Unidos lanzó bombas atómicas sobre Hiroshima y Nagasaki, octubre de 1964 podría ser el mes más peligroso de la historia del siglo XX.

Volvamos, sin embargo, al asesinato de JFK y a los resultados directos del mismo con respecto al lobby judío, la política exterior estadounidense y la militarización de Israel. Para entender lo poderoso que es el lobby israelí en este país, el venerable senador J. William Fulbright dijo a CBS Face the Nation el 15 de abril de 1973: “Israel controla el Senado de los Estados Unidos. El Senado es sumiso, demasiado; deberíamos estar más preocupados por los intereses de Estados Unidos en lugar de hacer la oferta de Israel. La gran mayoría del Senado de los Estados Unidos, en algún lugar alrededor del 80%, está completamente en apoyo de Israel; todo lo que Israel quiera; Israel se pone. Esto se ha demostrado una y otra vez, y esto ha hecho que [la política exterior] sea difícil para nuestro gobierno”.

¿Oyes lo que dijo el senador Fulbright? Esto no es un teórico de la conspiración loco o un antisemita del KKK. Es un senador de EE.UU. muy respetado diciendo que alrededor del 80% del Senado está en el bolsillo de la cadera de Israel. Añadiendo influencia a este argumento está el representante Paul Findley, quien fue citado en The Washington Report on Middle East Affairs en marzo de 1992, “Durante la campaña de John Kennedy para la presidencia, un grupo de judíos de Nueva York se había ofrecido en privado para satisfacer sus gastos de campaña si les dejaba establecer su política en Oriente Medio. No es necesario… Como presidente, sólo brindó un apoyo limitado a Israel”.

Para entender cuán importantes fueron las decisiones de Kennedy durante su efímera presidencia, tenemos que examinar el tema de las finanzas de las campañas. Teniendo en cuenta lo influyente que es el lobby israelí en el Senado de los Estados Unidos (escuchando las palabras del senador Fulbright), tuvieron que haberse enfurecido cuando el presidente Kennedy realmente quiso separarse de los métodos actuales de financiamiento de campaña porque hizo que los políticos dependan tanto de las enormes incrustaciones de efectivo de los grupos de intereses especiales. Lamentablemente, Kennedy no tuvo tiempo para implementar este programa, y hasta el día de hoy nuestro sistema político sigue siendo monopolizado por grupos de presión de los mismos grupos de interés especial. Uno sólo puede imaginar qué cambios habrían ocurrido con respecto a nuestra política exterior si Kennedy hubiera erradicado estas víboras y chupasangre de los pasillos del Congreso.

Trágicamente, las ideas de Kennedy nunca llegaron a buen término, y su acalorada batalla con el Primer Ministro Ben-Gurion sobre si se debía permitir a Israel desarrollar un programa nuclear se perdió finalmente. La razón es que Lyndon Baines Johnson, a quien Kennedy tenía la intención de retirarse de su boleto en 1964 debido a su extrema aversión por, tuvo una reversión completa en la política exterior. Como verán, el programa nuclear de Israel no sólo se adelantó sin control; también se convirtieron en el principal beneficiario de nuestra ayuda exterior.

Pero este cambio absoluto no habría ocurrido si Kennedy no hubiera sido asesinado. Hasta que LBJ se convirtió en presidente, Kennedy trató con oriente Medio de una manera que más benefició a los Estados Unidos. Su objetivo principal, y que más mantendría la paz, era un equilibrio de poder en el Medio Oriente para que todas y cada una de las naciones estuvieran seguras. Esta decisión se adhirió a la Declaración Tripartita que los Estados Unidos firmaron en 1950. Pero bajo la administración Johnson, este frágil equilibrio fue anulado, y en 1967 -sólo cuatro años después del asesinato de Kennedy- Estados Unidos era el principal proveedor de armas de Israel, y NUESTROs mejores intereses se pusieron muy por detrás de los de Israel!

Como escribe Michael Collins Piper: “La conclusión es la siguiente: JFK estaba firmemente decidido a impedir que Israel construyese la bomba nuclear. LBJ simplemente miró para otro lado. La muerte de JFK resultó beneficiosa para las ambiciones nucleares de Israel y las pruebas lo demuestran”.

Reuven Pedatzer, en una revisión de Israel y la Bomba de Avner Cohen, en el periódico israelí Ha’aretz el 5 de febrero de 1999 escribió: “El asesinato del presidente estadounidense John F. Kennedy puso fin abruptamente a la presión masiva que está aplicando la administración estadounidense sobre el gobierno de Israel para suspender su programa nuclear”. Continúa: “Kennedy dejó muy claro al Primer Ministro israelí que bajo ninguna circunstancia aceptaría que Israel se convirtiera en un estado nuclear”. Pedatzer concluye: “Si Kennedy hubiera permanecido vivo, es dudoso que Israel hoy tenga una opción nuclear” y que “la decisión de Ben-Gurion de dimitir en 1963 se tomó en gran medida en un contexto de la tremenda presión que Kennedy estaba aplicando sobre él con respecto a la cuestión nuclear”.

Si aún no estás convencido; ¿Qué tal algunos números? En el último año del presupuesto fiscal de Kennedy de 1964, la ayuda israelí fue de 40 millones de dólares. En el primer presupuesto de LBJ de 1965, se disparó a 71 millones de dólares, y en 1966 más que se triplicó de dos años antes a 130 millones de dólares. Además, durante la administración de Kennedy, casi ninguna de nuestra ayuda a Israel fue de naturaleza militar. En lugar de ello, se dividió a partes iguales entre los préstamos para el desarrollo y la asistencia alimentaria en el marco del Programa PL480. Sin embargo, en 1965 bajo la administración Johnson, el 20% de nuestra ayuda a Israel fue para el ejército, mientras que en 1966, el 71% se utilizó para materiales relacionados con la guerra.

Continuando en esta misma línea, en 1963 la administración Kennedy vendió 5 misiles Hawk a Israel como parte de un sistema de defensa aérea. En 1965-66, sin embargo, LBJ puso 250 tanques en Israel, 48 aviones de ataque Skyhawk, además de cañones y artillería que eran todos de naturaleza ofensiva. Si alguna vez te has preguntado cuándo se creó la Máquina de Guerra Israelí, ¡esto es todo! LBJ era su padre.

Según Stephen Green en Taking Sides: America’s Secret Relations with a Militant Israel, “Los 92 millones de dólares en asistencia militar proporcionada en el año fiscal 1966 fueron mayores que el total de toda la ayuda militar oficial proporcionada a Israel acumulativamente en todos los años que se remontan a la fundación de esa nación en 1948”.

Green continúa, “el 70% de toda la asistencia oficial de Estados Unidos a Israel ha sido militar. Estados Unidos ha dado a Israel más de 17.000 millones de dólares en ayuda militar desde 1946, prácticamente la totalidad de las cuales, más del 99%, se ha proporcionado desde 1965”.

¿Puedes ver lo que está pasando aquí? A los dos años del asesinato de JFK, Israel pasó de ser un miembro débil y superado de la volátil comunidad de Oriente Medio que no se le permitió desarrollar armas nucleares a uno que estaba bien en camino de convertirse en una fuerza militar innegable en la escena mundial. John Kennedy firmemente puso el pie en el pie y se negó a permitir que Israel desarrollara un programa nuclear, mientras que LBJ se inclinó hacia atrás para facilitarlos y fortalecerlos. O, como escribió Seymour Hersh en The Samson Option, “Para 1968, el presidente no tenía intención de hacer nada para detener la bomba israelí”.

El resultado de este cambio de enfoque de la administración Kennedy a Johnson es, en mi opinión, la razón PRINCIPAL detrás de nuestros problemas actuales en Oriente Medio que culminó con los ataques del 9-11 y nuestra próxima guerra con Irak (y más allá). Tengo mucha confianza en esta declaración, ya que como señala Michael Collins Piper, aquí están los resultados del asesinato de John F. Kennedy:

1) Nuestra ayuda extranjera y militar a Israel aumentó dramáticamente una vez que LBJ se convirtió en presidente.

2) En lugar de tratar de mantener un BALANCE en el Medio Oriente, Israel emergió repentinamente como la fuerza dominante.

3) Desde la administración de LBJ, Israel siempre ha tenido armamento que era superior a cualquiera de sus vecinos directos.

4) Debido a este innegable y obvio aumento de la Máquina de Guerra de Israel, se ha perpetuado una lucha constante en Oriente Medio.

5) LBJ también permitió a Israel continuar con su desarrollo nuclear, lo que resultó en que se convirtiera en la 6a fuerza nuclear más grande del mundo.

6) Por último, nuestros enormes desembolsos de ayuda extranjera a Israel (aproximadamente 10.000 millones de dólares al año cuando todo está dicho y hecho) han creado una situación de ataques y represalias interminables en el Oriente Medio, además de desprecio y enemistad absolutamente contra los Estados Unidos por desempeñar el papel de facilitador militar de Israel.

En los ojos de Israel, y especialmente de David Ben-Gurion, entonces, ¿cuáles eran sus alternativas: permanecer debilitados (o al menos equilibrados) en relación con sus vecinos y esposados por la negativa de JFK a ceder a su voluntad, o matar al único hombre que se interpone en su camino para convertirse en dominante en el Medio Oriente, el receptor de enormes cantidades de ayuda militar y una de las principales fuerzas nucleares del mundo? Es algo en lo que pensar.

Mossad And The JFK Assassination « Aletho News

La COVID-19 no se transmite por vía aérea

María José Martínez Albarracín es licenciada en medicina y cirugía por la Universidad de Murcia, catedrática de procesos diagnósticos clínicos, y forma parte de la alianza internacional de Médicos por la Verdad.

Por María José Martínez Albarracín

1º) La ciencia acepta que el receptor viral del Sars-CoV-2 es el enzima ACE2. Este receptor no se expresa en el pulmón, como demostró el equipo descubridor de dicho enzima ACE2 en el año 2000 en un trabajo publicado en Journal of Biological Chemistry con el título: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE” cuya primera autora es la Dra. Sarah R. Tipnis.

El siguiente estudio, de 2020, cuyo título traducido es: “El perfil de expresión de
proteínas ACE2 en tejidos humanos” publicado en Molecular Systems Biology (doi:
10.15252/msb.20209610) de fecha 31 de marzo de 2020, analiza de forma exhaustiva los perfiles de expresión molecular de dicho receptor en diferentes tejidos y corrobora que ACE2 no se expresa en pulmón y tampoco en vías respiratorias. El equívoco se produjo en el año 2003 como explica detalladamente el documento elaborado por LA JUNTA ARGENTINA DE REVISIÓN CIENTÍFICA titulado Cronología Target Vacuna Covid-19.

2º) El Sars-CoV-2 no puede ser cultivado en células del alveolo pulmonar (A549), como demuestra este estudio publicado en Elsevier el 12/9/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) for diagnostic and research purposes”, cuyo primer autor es Sacha Stelzer-Braid. En el pulmón sólo es posible cultivarlo en células de cáncer metastásico, y las células metastásicas no son específicas de pulmón. En la ficha de la vacuna de AstraZeneca se admite esto de forma equívoca al decir textualmente que estas células A549 no permiten la replicación “del vector”.

3º) La transmisión por vía aérea (gotas y aerosoles) no está probada científicamente. Dicha transmisión sólo puede probarse mediante cultivo y secuenciación de la muestra objeto del estudio, sin embargo esto no se ha hecho tal y como admite el propio Ministerio de Sanidad Español. Cito textualmente:

“En todos los casos la cantidad de ARN detectada fue pequeña y el virus no se logró
cultivar”

Pág.8 del documento INFORMACIÓN CIENTÍFICO-TÉCNICA del Ministerio de Sanidad, CENTRO DE COORDINACIÓN DE ALERTAS Y EMERGENCIAS SANITARIAS. “Enfermedad por coronavirus, Covid-19” (actualización del 12 de noviembre de 2020).

4º) La neumonía característica de la Covid-19 es bilateral, simétrica e intersticial, lo que prueba que la patogenia se produce a través de la sangre, ya que en el intersticio pulmonar se encuentran los capilares sanguíneos.

EN CONCLUSIÓN:

Si aceptamos que la Covid-19 está producida por el Sars-CoV-2 y que el receptor celular de dicho coronavirus es ACE2, ya que este virus no puede ser cultivado en células pulmonares naturales y que el receptor ACE2 no se encuentra en tejido pulmonar, tenemos que concluir necesariamente que la Covid-19 no se transmite por vía aérea y que las mascarillas son inútiles para frenar la transmisión.

Ver este documento en formato PDF en el portal de Médicos por la Verdad.

La COVID-19 no se transmite por vía aérea – Medicos Por La Verdad

COVID-19 is not transmitted by air

1st) Science accepts that the viral receptor for Sars-CoV-2 is the enzyme ACE2. This receptor is not expressed in the lung, as the team that discovered the ACE2 enzyme demonstrated in 2000 in a work published in the Journal of Biological Chemistry with the title: “A Human homolog of Angiotensin-converting Enzyme CLONING AND FUNCTIONAL EXPRESSION AS A CAPTOPRIL INSENSITIVE CARBOXIPEPTIDASE ”whose first author is Dr. Sarah R. Tipnis. The following study, from 2020, whose translated title is: “The expression profile of ACE2 proteins in human tissues ”published in Molecular Systems Biology (doi: 10.15252 / msb.20209610) dated March 31, 2020, exhaustively analyzes the molecular expression profiles of said receptor in different tissues and corroborates that ACE2 is not expressed in the lung and neither in the respiratory tract. The mistake occurred in 2003, as explained in detail in the document prepared by THE ARGENTINE SCIENTIFIC REVIEW BOARD entitled Covid-19 Vaccine Target Chronology.

2nd) Sars-CoV-2 cannot be cultured in cells of the pulmonary alveolus (A549), as shown in this study published in Elsevier on 9/12/2020: “Virus isolation of severe acute respiratory syndrome coronavirus 2 (SARS-CoV- 2) for diagnostic and research purposes ”, whose first author is Sacha Stelzer-Braid. In the lung it is only possible to grow it in metastatic cancer cells, and metastatic cells are not lung specific. This is mistakenly admitted in the AstraZeneca vaccine file by stating verbatim that these A549 cells do not allow “vector” replication.

3º) Transmission by air (drops and aerosols) is not scientifically proven. Such transmission can only be proven by culturing and sequencing the sample under study, however this has not been done as the Spanish Ministry of Health itself admits. I quote verbatim: “In all cases the amount of RNA detected was small and the virus was not achieved cultivate” Page 8 of the document SCIENTIFIC-TECHNICAL INFORMATION of the Ministry of Health, CENTER FOR THE COORDINATION OF HEALTH ALERTS AND EMERGENCIES. “Coronavirus disease, Covid-19” (update November 12, 2020).

4th) The characteristic pneumonia of Covid-19 is bilateral, symmetric and interstitial, which proves that the pathogenesis occurs through the blood, since the blood capillaries are found in the pulmonary interstitium.

IN CONCLUSION: If we accept that Covid-19 is produced by Sars-CoV-2 and that the cellular receptor for said coronavirus is ACE2, since this virus cannot be cultured in natural lung cells and that the ACE2 receptor is not found in lung tissue , we have to necessarily conclude that Covid-19 is not transmitted by air and that masks are useless to stop the transmission.

Tribunal Portugués: Pruebas PCR “poco fiables” y Cuarentenas “Ilegales”

Una decisión legal importante se enfrenta al apagón total de los medios de comunicación en el mundo occidental

Un tribunal de apelaciones de Portugal ha dictaminado que el proceso de ITP no es una prueba fiable para el Sars-Cov-2, por lo que cualquier cuarentena forzada basada en esos resultados de pruebas es ilegal.

Además, el fallo sugería que cualquier cuarentena forzada aplicada a personas sanas podría ser una violación de su derecho fundamental a la libertad.

Lo que es más importante, los jueces dictaminaron que una sola prueba positiva de PCR no puede utilizarse como un diagnóstico eficaz de la infección.

Los detalles del caso se refieren a cuatro turistas que ingresan al país desde Alemania, todos ellos anónimos en la transcripción del caso, que fueron puestos en cuarentena por la autoridad sanitaria regional. De los cuatro, sólo uno había dado positivo para el virus, mientras que los otros tres se consideraban simplemente de “alto riesgo de infección” basado en la proximidad al individuo positivo. Los cuatro, en las 72 horas anteriores, habían dado negativo para el virus antes de partir de Alemania.

En su fallo, los jueces Margarida Ramos de Almeida y Ana Paramés se refirieron a varios estudios científicos. Más notablemente este estudio de Jaafar et al., que encontró que – cuando se ejecutan pruebas de PCR con 35 ciclos o más , la precisión cayó al 3%, lo que significa que hasta el 97% de los resultados positivos podrían ser falsos positivos.

La sentencia llega a la conclusión de que, sobre la base de la ciencia que leen, cualquier prueba de PCR que utilice más de 25 ciclos es totalmente poco fiable. Los gobiernos y los laboratorios privados han sido muy ajustados sobre el número exacto de ciclos que se ejecutan cuando se ejecutan las pruebas de PCR, pero se sabe que a veces es tan alto como 45. Incluso el fearmonger-en-chief Anthony Fauci ha declarado públicamente cualquier cosa sobre 35 es totalmente inutilizable.

Puede leer la regla completa en el portugués original aquí,y traducido al inglés aquí. También hay una buena escritura en él en Great Game India, además de un profesor portugués envió un largo correo electrónico sobre el caso a Lockdown Sceptics.

*

La reacción de los medios a este caso ha sido totalmente predecible, no lo han mencionado. En absoluto. Dondequiera. Nunca.

El fallo fue publicado el 11 de noviembre, y ha sido referenciado por muchos sitios de noticias alternativas desde… pero las tomas de corriente principales están manteniendo un apagón completo en él.

COVID19 – Evidencia de fraude global

Iain Davis

COVID 19, y las respuestas gubernamentales subsiguientes, parecen ser parte de una conspiración internacional para cometer fraude. Parece que no hay evidencia de que un virus llamado SARS-CoV-2 cause una enfermedad llamada COVID 19.

A veces tienes que ir con las tripas. No soy un experto en genética y, como siempre, puedo ser corregido. Sin embargo, mi atención se llamó la atención sobre algunas investigaciones publicadas por la revista médica española D-Salud-Discovery. Su consejo asesor de médicos y científicos eminentemente calificados da más credibilidad a sus investigaciones. Su afirmación es asombrosa.

Las imprimaciones genéticas y las sondas utilizadas en las pruebas RT-PCR para identificar el SARS-CoV-2 no apuntan a nada específico. Seguí las técnicas de búsqueda descritas en esta traducción al inglés de su informe y puedo corroborar la exactitud de sus afirmaciones sobre las secuencias de nucleótidos enumeradas en los protocolos de las Organizaciones Mundiales de la Salud. Puedes hacer lo mismo.

Estado D-Salud-Discovery no hay pruebas capaces de identificar SARS-CoV-2. En consecuencia, todas las afirmaciones sobre el supuesto impacto de COVID 19 en la salud de la población son infundarias.

Toda la narrativa oficial de COVID 19 es un engaño. Ostensiblemente, no hay fundamento científico para ninguna parte de ella.

Si estas afirmaciones son exactas podemos afirmar que no hay evidencia de una pandemia, simplemente la ilusión de una. Hemos sufrido pérdidas incalculables sin ninguna razón evidente, aparte de las ambiciones de déspotas sin escrúpulos que desean transformar la economía global y nuestra sociedad para adaptarse a sus propósitos.

Al hacerlo, esta “clase de parásitos” ha cometido potencialmente innumerables crímenes. Estos crímenes pueden y deben ser investigados y procesados en un tribunal de justicia.

¿IDENTIFICACIÓN DE QUÉ EXACTAMENTE?

La Organización Mundial de la Salud (OMS) clasificó COVID-19 (Enfermedad de COronaVIrus 2019). Declararon una pandemia global coVID 19 el 11 de marzo de 2019.

La orientación de la OMS en las pruebas de laboratorio establece:

El agente etiológico [causalidad de la enfermedad] responsable del grupo de casos de neumonía en Wuhan ha sido identificado como un nuevo betacoronavirus, (en la misma familia que SARS-CoV y MERS-CoV) a través de la secuenciación de próxima generación (NGS) a partir de virus cultivados o directamente de muestras recibidas de varios pacientes con neumonía.”

La afirmación de la OMS es que el virus SARS-CoV-2 causa la enfermedad COVID-19. También alegan que este virus ha sido claramente identificado por los investigadores en Wuhan.

En el Informe de Situación 2019-nCovde la OMS, afirman:

Las autoridades chinas identificaron un nuevo tipo de coronavirus, que fue aislado el 7 de enero de 2020…… El 12 de enero de 2020, China compartió la secuencia genética del nuevo coronavirus para que los países lo utilizaran en el desarrollo de kits de diagnóstico específicos.”

Estas dos declaraciones de la OMS sugieren claramente que el virus SARS-CoV-2 fue aislado (es decir, purificado para estudio) y luego se identificaron secuencias genéticas a partir de la muestra aislada. A partir de esto, se desarrollaron y distribuyeron kits de diagnóstico a nivel mundial para detectar el virus en ciudades, ciudades y comunidades de todo el mundo. Según la OMS y los investigadores chinos, estas pruebas encontrarán el virus que causa COVID 19.

Sin embargo, la OMS también afirma:

Trabajando directamente a partir de información de secuencia, el equipo desarrolló una serie de ensayos de amplificación genética (PCR) utilizados por los laboratorios.”

Los científicos de Wuhan desarrollaron sus ensayos de amplificación genética a partir de “información de secuencia” porque no había una muestra aislada y purificada del llamado virus SARS-CoV-2. También mostraron imágenes de microscopio electrónico de los viriones recién descubiertos (la bola de proteína puntiaguda que contiene el ARN viral).

Sin embargo, tales estructuras proteicas no son únicas. Se parecen a otras vesículas redondas, como vesículas endocíticas y exosomas.

Los virólogos afirman que no es posible “aislar” un virus porque sólo se replican dentro de las células huésped. Añaden que los postulados de Koch no se aplican porque se relacionan con bacterias (que son organismos vivos). En su lugar, los virólogos observan los efectos citopatógenos del virus (CPE), causando mutación y degradación celular, en cultivos celulares.

Cuando los investigadores chinos secuenciaron por primera vez el genoma completo del SARS-CoV-2 observaron CPE en células Vero E6 y Huh7. Vero E6 es una línea celular de mono inmortalizada y Los Huh7 son células de cáncer inmortalizada (tumorigénicas). Lo que significa que se han mantenido in vitro (en cultivos de platos petri) durante muchos años.

La idea de que es un virus zoonótico, capaz de salvar la brecha de especies de los animales a los humanos. Cuando los científicos de los CDC de los Estados Unidos “infectaron” varias células con el virus novedoso señalaron lo siguiente:

Examinamos la capacidad de SARS-CoV-2 para infectar y replicar en varias líneas celulares comunes de primates y humanos, incluyendo células humanas de adenocarcinoma (A549) [células pulmonares], células hepáticas humanas (HUH7.0), y células renales embrionarias humanas (HEK-293T), además de Vero E6 y Vero CCL81 [células de mono]… No se observó ningún efecto citopático en ninguna de las líneas celulares excepto en las células de Vero [células mono]… Las células HUH7.0 y 293T sólo mostraron una replicación viral modesta y las células A549 [células de tejido pulmonar humano] eran incompatibles con la infección por SARS-CoV-2.”

Los CDC no observaron ningún CPE en las células humanas. No vieron evidencia de que este presunto virus causara alguna enfermedad humana. Este supuesto virus humano tampoco mostró ninguna replicación notable en las células humanas, lo que sugiere que la infección de humano a humano sería imposible.

Tomando nota de este problema, un equipo de científicos polacos introdujo este “virus” secuenciado a las células humanas del epitetelio (vías respiratorias). Observaron los efectos en estas culturas HAE durante 5 días. Señalaron una replicación mucho mayor que los científicos de los CDC, pero en última instancia declararon:

“No observamos ninguna liberación del virus del lado basolateral de la cultura HAE”.

Lo que significa que no veían ninguna evidencia de los supuestos viriones que violaban la membrana de la pared celular. Una vez más sugiriendo que este llamado virus no es infeccioso en los seres humanos.

No está claro que el SARS-CoV-2 sea un virus humano capaz de causar enfermedades. Puede que ni siquiera exista físicamente. ¿No es más que un concepto basado en secuencias genéticas predictivas?

VIAJE DE DESCUBRIMIENTO

El Centro Wuhan para el Control y la Prevención de Enfermedades y el Centro Clínico de Salud Pública de Shanghái publicaron el primer genoma completo del SARS-CoV-2 (MN908947.1). Esto se ha actualizado muchas veces. Sin embargo, MN908947.1 fue la primera secuencia genética que describió el supuesto agente etiológico COVID 19 (SARS-CoV-2).

Todas las reclamaciones, pruebas, tratamientos, estadísticas, desarrollo de vacunas y políticas resultantes se basan en esta secuencia. Si las pruebas de este virus novedoso no identifican nada capaz de causar enfermedades en los seres humanos, toda la narrativa COVID 19 no es más que una farsa.

Los investigadores de WUHAN afirmaron que efectivamente habían unido la secuencia genética SARS-CoV-2 haciendo coincidir fragmentos encontrados en muestras con otras secuencias genéticas, previamente descubiertas. A partir del material recogido encontraron una coincidencia del 87,1% con el coronavirus del SARS (SARS-Cov). Utilizaron el ensamblaje de novo y la PCR objetivo y encontraron 29,891-base-pair que compartían una coincidencia de secuencia del 79,6% con SARS-CoV.

Tuvieron que usar el ensamblaje de novo porque no tenían conocimiento priori de la secuencia o el orden correctos de esos fragmentos. Sencillamente, la declaración de la OMS de que los investigadores chinos aislaron el virus el 7 de enero es falsa.

El equipo de Wuhan utilizó 40 rondas de amplificación RT-qPCR para que coincidan con fragmentos de ADNc (ADN complementario construido a partir de fragmentos de ARN muestreados) con el genoma del coronavirus SARS publicado (SARS-CoV). Desafortunadamente, tampoco está claro cuán preciso es el genoma original de SARS-CoV.

En 2003, un equipo de investigadores de Hong Kong estudió a 50 pacientes con síndrome respiratorio agudo grave (SARS). Tomaron muestras de 2 de estos pacientes y desarrollaron un cultivo en células hepáticas de monos fetales.

Crearon 30 clones del material genético que encontraron. Incapaz de encontrar evidencia de ningún otro virus conocido, en sólo una de estas muestras clonadas encontraron secuencias genéticas de “origen desconocido”.

Al examinar estas secuencias desconocidas de ARN encontraron 57% de coincidencia con el virus del coronavirus bovino y la hepatitis murina y dedujeron que era de la familia Coronaviridae. Teniendo en cuenta estas secuencias para sugerir un virus SARS-CoV recién descubierto (nuevos descubrimientos son ambrosía para los científicos), diseñaron imprimaciones RT-PCR para probar este virus novedoso. Los investigadores declararon:

Los primeros para detectar el nuevo virus fueron diseñados para la detección RT-PCR de este genoma coronavirus asociado a la neumonía humana en muestras clínicas. De las 44 muestras nasofaríngeas disponibles de los 50 pacientes con SRAS, 22 tenían evidencia de ARN coronavirus asociado a una neumonía humana.”

La mitad de los pacientes analizados, que todos tenían los mismos síntomas, dieron positivo para este nuevo virus alegado. Nadie sabe por qué la otra mitad dio negativo para este nuevo virus SARS-CoV. La pregunta no fue hecha.

Este supuesto virus tenía sólo una coincidencia de secuencia del 57% con coronavirus supuestamente conocido. El otro 43% estaba “ahí”. Los datos secuenciados se produjeron y registraron como un nuevo genoma como GenBank Adhesión No. AY274119.

Los investigadores de Wuhan posteriormente encontraron una coincidencia de secuencia del 79,6% con AY274119 y por lo tanto lo llamaron una cepa novedosa de SARS-CoV (2019-nCoV – finalmente renombrado SARS-CoV-2). Nadie, en ninguna etapa de este proceso, había producido ninguna muestra aislada y purificada de ningún virus. Todo lo que tenían eran coincidencias de secuencia porcentual con otras coincidencias de secuencia porcentual.

AISLAR NADA

Los científicos están muy molestos porque siguen diciendo que el virus ha sido aislado, pero nadie los cree. Esto se debe a que, hasta ahora, nadie ha proporcionado una sola muestra purificada del virus SARS-CoV-2. Lo que tenemos en cambio es un genoma completo y, como estamos a punto de descubrir, no es particularmente convincente.

Los periodistas de investigación Torsten Engelbrecht y Konstantin Demeter pidieron a algunos de los científicos que dijeron que tenían imágenes de viriones SARS-C0V-2 que confirmaran que eran imágenes de un virus aislado, purificado. Ninguno de ellos pudo.

En Australia, científicos del Instituto Doherty,anunciaron que habían aislado el virus SARS-CoV-2. Cuando se le pidió que aclarara a los científicos dijo:

“Tenemos secuencias cortas (ARN) de la prueba diagnóstica que se pueden utilizar en las pruebas diagnósticas”

Esto explica por qué el estado del gobierno australiano:

La fiabilidad de las pruebas COVID-19 es incierta debido a la limitada base de evidencia… Hay pruebas limitadas disponibles para evaluar la exactitud y la utilidad clínica de las pruebas COVID-19 disponibles.”

En el Reino Unido, en julio, un grupo de académicos interesados escribió una carta al primer ministro del Reino Unido Boris Johnson en la que le pidieron que:

Producir pruebas científicas revisadas de forma independiente que demuestren que el virus Covid-19 ha sido aislado”.

Hasta la fecha no han recibido una respuesta.

Del mismo modo, el investigador del Reino Unido Andrew Johnson hizo una Solicitud de Libertad de Información a la Salud Pública de Inglaterra (PHE). Les pidió que le proporcionaran sus registros describiendo el aislamiento de un virus SARS-COV-2. A lo que respondieron:

PHE puede confirmar que no contiene información de la manera sugerida por su solicitud.”

La investigadora canadiense Christine Massey hizo una solicitud de libertad de información similar, preguntando al gobierno canadiense lo mismo. A lo que el gobierno canadiense respondió:

Después de haber completado una búsqueda exhaustiva, lamentamos informarle que no pudimos localizar ningún registro que responda a su solicitud.”

En los Estados Unidos, el Panel de Diagnóstico RT-PCR del Centro para el Control y la Enfermedad (CDC) indica:

… No hay aislados de virus cuantificados de la 2019-nCoV están actualmente disponibles…….. La detección de ARN viral puede no indicar la presencia de virus infecciosos o que 2019-nCoV es el agente causante de los síntomas clínicos.”

Actualizados por última vez el 13 de julio de 2020, los CDC aún no han obtenido ninguna muestra viral pura de ningún paciente que se diga que tiene la enfermedad de COVID-19. Admiten abiertamente que sus pruebas no necesariamente muestran si SARS-CoV-2 está presente o causa COVID 19.

Se nos dice que nada de esto importa. Que somos ignorantes y no entendemos la virología. Por lo tanto, debemos, excepto imágenes de cosas que sabemos que podrían ser otra cosa y secuencias genéticas (que podrían ser cualquier otra cosa) como prueba concluyente de que este virus, y la enfermedad que se supone que causa, son reales.

PRUEBAS PARA NADA

La OMS, y todos los gobiernos, el think tank, el comité de dirección de políticas, el asesor científico del gobierno, las instituciones supranacionales y otros que promueven la narrativa oficial coVID 19, afirman que sarS-CoV-2 causa COVID 19.

Aunque nadie ha producido nunca una muestra de este supuesto virus, se ha publicadoel supuesto genoma sars-coV-2 . Es de dominio público.

Se dice que las secuencias genéticasclave, en el genoma del SARS-CoV-2, tienen funciones específicas. Estas son las proteínas diana que los científicos prueban para identificar la presencia del “virus”. Estos incluyen:

  • Gen de la ARN-polimerasa (Rd-Rp) – Esto permite que el ARN SARS-CoV-2 se replique dentro del citoplasma de las células epiteliales enfermas COVID 19.
  • Gen S (Orf2) – esta glicoproteína forma el pico en la superficie del virión SARS-CoV-2 que supuestamente facilita la unión SARS-CoV-2 a los receptores ACE2 en las células, permitiendo que el ARN dentro de la cáscara de la proteína de virión (capsid) pase a la célula ahora infectada.
  • Gen E (Orf1ab) – pequeña proteína de membrana utilizada en el ensamblaje viral
  • N gen (Orf9a) – el gen nucleocapsid que une el ARN en la formación de cápldores

La OMS mantiene un registro disponible al público de las imprimaciones y sondas RT-PCR utilizadas para detectar el SARS-CoV-2. Las imprimaciones son secuencias específicas de nucleótidos que se unen (anneal) a las hebras antisotriciales y de sentido del ADNr sintetizado (llamados imprimaciones hacia adelante y hacia atrás respectivamente.)

Las hebras de ADNc se separan cuando se calientan y se reforman cuando se enfrían. Antes del enfriamiento, las secuencias de nucleótidos llamadas sondas se introducen en el recocido a regiones específicas del genoma viral sospechoso. Durante la amplificación, como las regiones entre imprimaciones se alargan, cuando una imprimación golpea una sonda, la sonda decae liberando un fluorescente o tinte que luego puede ser leído por los investigadores.

Es la identificación de estos marcadores que los científicos afirman que demuestran la presencia de SARS-CoV-2 en una muestra.

Algo más que está disponible públicamente es la Herramienta Básica de Búsqueda de Alineación Local (BLAST). Esto permite a cualquier persona comparar secuencias de nucleótidos publicadas con todas las almacenadas por la base de datos genética de los Institutos Nacionales de Salud de los Estados Unidos (NIH) llamada GenBank. Por lo tanto, podemos BLAST las imprimaciones SARS-CoV-2 reclamadas, sondas y secuencias genéticas objetivo.

Los primeros delanteros y los protocolos de sondeo de la OMS, para el supuesto genoma viral SARS-CoV-2, se basan en perfiles genéticos RdRp, Orf1, N y E. Cualquiera puede ejecutarlos a través de BLAST para ver lo que encontramos.

La secuencia vital de nucleótidos RdRP, utilizada como imprimación directa es – ATGAGCTTAGTCCTGTTG. Si ejecutamos un NUCleótido BLAST esto se registra como un aislado completo SARS-CoV-2 con una identidad de secuencia 100% coincidente. Del mismo modo, la secuencia inversa de imprimación del gen E – ATATTGCAGCAGTACGCACACA – revela la presencia de la secuencia Orf1ab que también identifica SARS-CoV-2.

Sin embargo, BLAST también nos permite buscar en las secuencias de nucleótidos de los genomas microbianos y humanos. Si buscamos la secuencia RDRp SARS-CoV-2 revela 99 cromosomas humanos con una coincidencia de identidad de secuencia 100%. El Orf1ab (gen E) devuelve 90 con una coincidencia de identidad de secuencia del 100% con cromosomas humanos.

Haciendo lo mismo para estas secuencias con una búsqueda microbiana encuentra 92 microbios con una coincidencia del 100% con el gen SARS-CoV-2 E y 100 microbios emparejados, con una identidad de secuencia del 100%, con el gen vital SARS-CoV-2 RdRp.

Cada vez que comprobamos los llamados marcadores genéticos únicos para el SARS-CoV-2, registrados en los protocolos de la OMS, encontramos coincidencias completas o elevadas porcentuales con varios fragmentos del genoma humano. Esto sugiere que las secuencias genéticas, que se supone que identifican el SARS-CoV-2, no son únicas. Podrían ser cualquier cosa, desde secuencias microbianas hasta fragmentos de cromosomas humanos.

Los llamados verificadores de hechos,como el proyecto Health Feedback de Reuters, se han apresurado a desestimar las afirmaciones de aquellos que han notado la aparente falta de especificidad en el supuesto genoma del SARS-CoV-2.

Usando una serie de argumentos de paja como, “esta afirmación sugiere que cada prueba debe ser positiva”, (que no lo hace) su intento de desacreditación ejecuta algo como esto:

Los primeres están diseñados para unirse a secuencias específicas de nucleótidos que son exclusivas del virus. La imprimación delantera puede unirse a un cromosoma en particular, pero la imprimación inversa no se une al mismo cromosoma, por lo que el cromosoma no está presente en el virus SARS-CoV-2. Además, debido a que las imprimaciones delanteras y perversas envuelven la secuencia a amplificar, la secuencia cDMA entre imprimaciones es única para el virus.

Esto parece tergiversar deliberadamente la importancia de estas constataciones al transmitir un argumento que nadie, aparte de los propios verificadores de hechos, están formulando. Las búsquedas BLAST muestran que estas secuencias de destino no son exclusivas de SARS-CoV-2. Tampoco es necesario encontrar todos los objetivos para que un resultado se considere positivo.

Investigadores marroquíes investigaron la epidemiología de los supuestos casos marroquíes de SARS-CoV-2. El nueve por ciento fue positivo para tres genes, el dieciocho por ciento fue positivo para dos genes y el setenta y tres por ciento para sólo uno. Como acabamos de discutir, muchos pueden haber sido positivos para ninguno.

Esto está totalmente de acuerdo con las directrices de prueba de la OMS. Afirman:

“Un diagnóstico óptimo consiste en una NAAT [prueba de amplificación de ácido nucleico] con al menos dos dianas independientes del genoma del SARS-CoV-2; sin embargo, en áreas donde la transmisión está generalizada, se puede utilizar un algoritmo simple de un solo objetivo…… Uno o más resultados negativos no descartan necesariamente la infección SARS-CoV-2.”

Independientemente de los argumentos espurios de los verificadores de hechos bien financiados, si los primeros delanteros y inversos identifican basura, tal vez uno es el fragmento de un cromosoma y el otro una secuencia microbiana, entonces la región amplificada entre ellos es probablemente también basura.

El argumento de que RT-PCR sólo encuentra el ARN es especioso. La transcripción natural (la separación de las hebras de ADN) se produce durante la expresión génica. Nadie está diciendo que cromosomas enteros o microbios se secuencian en el supuesto genoma SARS-CoV-2. Aunque puedan, por lo que sabemos. Dicen que los supuestos marcadores, utilizados para probar este supuesto virus, no son aptos para el propósito.

Las pruebas RT-PCR no secuencian todo el genoma. Buscan incidentes de florescencia de sonda específica para indicar la presencia de secuencias que se dice que existen. Estas secuencias se definen mediante MN908947.1 y las actualizaciones posteriores. Estos primeros y sondas no podían revelar nada más que coincidencias de ARN extraídas de la no codificación, a veces llamada “basura”, ADN (ADNm).)

Por ejemplo, el gen SARS-CoV-2 S está destinado a ser muy específico para el genoma del virus SARS-CoV-2. La secuencia de destino es – TTGGCAAAATTCAAGACTCACTTTC. Una búsqueda BLAST microbiana devuelve 97 coincidencias microbianas con coincidencia de secuencia de identidad del 100%. La coincidencia de porcentaje de identidad más baja, dentro de los 100 primeros, es del 95%. Un BLAST del genoma humano también encuentra una coincidencia de secuencia del 100% con 86 fragmentos de cromosomas humanos.

No importa dónde mire en el supuesto genoma del SARS-CoV-2, no hay nada en los protocolos de prueba de la OMS que identifique claramente lo que es. Todo el genoma podría ser falso. Las pruebas no prueban la existencia de SARS-CoV-2. Todo lo que revelan es una sopa de material genético no especificado.

Si es así, como no hay aislados o muestras purificadas del virus, sin una prueba viable, no hay evidencia de que el SARS-CoV-2 exista. Por lo tanto, tampoco hay evidencia de que exista una enfermedad llamada COVID 19.

Esto deduce que no hay base científica para ninguna reclamación sobre el número de casos COVID 19, las cifras de ingresos hospitalarios o de mortalidad. Todas las medidas adoptadas para combatir este virus mortal posiblemente se basan en nada.

FRAUDE CONCLUYENTE

El fraude es un acto criminal. La definición legal de fraude es:

“Alguna práctica engañosa o dispositivo intencional, recurrió con la intención de privar a otro de su derecho, o de alguna manera para hacerle una lesión.”

La definición legal de una conspiración es:

“Una combinación o confederación entre dos o más personas formada con el propósito de cometer, mediante sus esfuerzos conjuntos, algún acto ilegal o delictivo”

Al parecer, aquellos que afirman que nos enfrentamos a una pandemia no han proporcionado ninguna evidencia que demuestre que un virus llamado SARS-CoV-2 causa una enfermedad llamada COVID 19. Toda la información que sugiere firmemente esta posibilidad está fácilmente disponible en el dominio público. Cualquiera puede leerlo.

Para que haya un fraude el engaño debe ser intencional. La intención debe ser privar deliberadamente a otros de sus derechos o herirlos de alguna otra manera. Si hay evidencia de colusión entre individuos ad / u organizaciones para cometer fraude, entonces esto es una conspiración (en las jurisdicciones de Derecho Común) o una Empresa Criminal Conjunta (JCE) bajo el Derecho Internacional.

Parece que COVID 19 ha sido utilizado deliberadamente como un casus belli para librar una guerra contra la humanidad. Hemos sido encarcelados en nuestros propios hogares, nuestra libertad de vagar restringidos, la libertad de expresión y de expresión erosionada, el derecho a protestar recortado, separado de sus seres queridos, nuestros negocios destruidos, bombardeados psicológicamente, amordaizados y aterrorizados.

Peor aún, si bien no hay evidencia de una mortalidad sin precedentes, hubo picos inestacionables de muertes. Estos se correlacionan precisamente con las medidas de bloqueo que vieron la retirada de los servicios de salud que pagamos y una reorientación de los servicios de salud pública para tratar una supuesta enfermedad excluyendo a todos los demás.

Además, los que han remitido la historia COVID 19 proponen que esta supuesta enfermedad justifica la reestructuración completa de la economía mundial, de nuestros sistemas políticos, de las sociedades, de las culturas y de la propia humanidad.

Para poder participar en su llamada “nueva normalidad”, que es la transformación mayorista de toda nuestra sociedad sin nuestro consentimiento, insisten en que nos sometamos a sus condiciones.

Estos incluyen, pero no se limitan a, la vigilancia biométrica de todos, el control y monitoreo centralizado de todas nuestras transacciones, las restricciones comerciales y sociales opresivas y una demanda efectiva de que no tenemos derecho a la soberanía sobre nuestros propios cuerpos. Esto constituye la condición de la esclavitud.

No hay duda de que hemos sido privados de nuestros derechos y heridos. En las jurisdicciones del Derecho Común se presume la inocencia, pero la evidencia de que el daño ha sido causado deliberadamente por una conspiración internacional es abrumadora. Las políticas destructivas, promulgadas por los gobiernos de todo el mundo, se originaron claramente entre los grupos de reflexión globalistas y las instituciones supranacionales mucho antes del surgimiento de esta pandemia inexistente.

En las jurisdicciones del Código Napoleónico, se presume la culpabilidad. Para que los conspiradores acusados demuestren su inocencia deben demostrar que, a pesar de sus inconmensurables recursos, han sido colectivamente incapaces de acceder o entender ninguna de las pruebas de libre disposición que sugieren que COVID 19 es un mito.

Los responsables del delito de conspiración para cometer fraude global deben ser juzgados. Si son encontrados culpables, deberían ser encarcelados mientras el resto de nosotros tratamos de reparar el daño que ya han infligido.

¿Nos están diciendo la verdad sobre COVID-19? | Prof. Sucharit Bhakdi

Prof. Sucharit Bhakdi (notas de la entrevista 11 de noviembre de 2020) Are We Being Told the Truth About COVID-19?

Cuando alguien da positivo decimos que dio positivo en Covid-19 pero esa es la enfermedad, no el virus, que es Sars-CoV-2. Ese es el primer problema. En segundo lugar, se hizo nuevo, cuando ni la enfermedad ni el virus son nuevos porque los coronavirus han estado con nosotros para siempre.

Estos virus coexisten con nosotros. Cada pocos meses mutan para que mi sistema inmunológico los acepte, de lo contrario serían reconocidos en la segunda visita y serían excluidos. Así que es completamente normal que los virus más exitosos del mundo, que mantienen vivo al huésped, que no quieren matarnos, cambien un poco todo el tiempo.

Cuando el número de casos cae por debajo de un cierto nivel, debe detener las pruebas. Porque si sigues probando a personas que no están infectadas, obtendrás más falsos positivos que positivos. Muchos laboratorios en Alemania estaban creando artefactos en el laboratorio a través de procedimientos deficientes. Crearon un grupo de 60 personas en Baviera. Al volver a probar resultó que 58 estaban claros.

El escenario dos es inmunidad. La ciencia es muy borrosa. Un brazo es el anticuerpo que atrapa el virus antes de que se adjunte a la célula, pero este anticuerpo combate uno a uno. Es una cuestión de números. El número de anticuerpos puede agotarse antes de que llegue más virus.

La idea de un pasaporte de inmunidad es estúpida. Incluso si está vacunado y tiene anticuerpos, solo puede protegerse si el número de virus es bajo.

También los anticuerpos alcanzan su punto máximo después de que te inmunizan, pero con el tiempo disminuyen. Su sistema inmunitario no funciona a menos que haya un propósito. Después de dos o tres meses, incluso con el pasaporte, usted no es inmune.

Nuestros viejos anticuerpos son parcialmente eficaces contra los nuevos coronavirus. Una vez que el nuevo virus entra en nuestras células, los productos de desecho del virus se sientan en el exterior de la célula. El segundo brazo del sistema inmunitario, los linfocitos asesinos emergen.

Los linfocitos detectan la similitud del nuevo virus con el antiguo y atacan a la célula. Un linfocitos asesino puede matar muchas células infectadas por virus.

Estas son las defensas naturales del cuerpo. Esta es la razón por la que más del 90% de las personas infectadas ya tienen inmunidad de antecedentes. Varios informes recientes han sugerido que las personas tienen estos linfocitos e incluso aquellos que no los muestran pueden tenerlos “esperando en las alas” en los ganglios linfáticos.

Es poco probable que las vacunas contra los coronavirus funcionen y podrían ser peligrosas, especialmente si pones el gen del virus en el cuerpo,supuestamente para hacer que las células produzcan las características del virus contra el cual se supone que actúan los anticuerpos.

Estas vacunas crearán productos de desecho y ahora los linfocitos asesinos pueden comenzar a atacar las células sanas. No puedo probar que esto haya sucedido, pero muchos ensayos de vacunas han tenido efectos secundarios tan graves, dolores, hinchazón, fiebre, dolor muscular. El juicio de Astra Zeneca tuvo que cambiar sus protocolos antes de continuar, lo cual no está permitido.

Entonces surgió la mielitis transversa. Hay razones para sospechar que los linfocitos asesinos pueden haber sido desencadenados en un ataque autoinmune.

En segundo lugar, supongamos que ha generado anticuerpos con éxito, pero también ha despertado esos linfocitos asesinos,como un boxeador, usted es más fuerte y listo para la próxima pelea. Ahora, cuando aparece el virus real, y supera los pocos anticuerpos que existen, tienes tantos linfocitos asesinos listos para la batalla que lo exageran.

Esto sería la mejora dependiente de la respuesta inmune que termina en una respuesta inmune demasiado fuerte.

¿Cómo van a probar que un virus es eficaz? Si usted es menor de 70 su probabilidad de morir de este virus es minúscula. Si está perdiendo 5 de cada 10.000 vidas, ¿cómo va a demostrar que una vacuna salva vidas? No es estadísticamente significativo.

En cuanto al encierro, están matando a personas que no son diagnosticadas de cáncer, enfermedades del corazón, de depresión, de suicidio y depresión económica que causa pobreza. Están matando mucho más de lo que ahorran.

Abogados de todo el mundo van a llevar a esa gente ante la justicia. Los primeros casos se están presentando actualmente en Alemania. Espero que los correctos sean llevados a los tribunales porque lo que están haciendo es criminal. No es una cuestión de creencia. Sabemos que la gente está muriendo en todo el mundo debido a estas medidas de bloqueo. Millones de personas mueren de hambre en la India y otros lugares.

Deberíamos estar tomando acerca de por qué y cómo nuestra sociedad ha permitido que estas cosas sucedan. Cómo y por qué y debemos obtener respuesta para que esto nunca vuelva a suceder.

EE.UU.: el 89% de nuestros senadores y el Congreso tienen doble ciudadanía con Israel

Este artículo tiene más de dos años, pero las elecciones de EE.UU. lo pone de nuevo en la palestra y actualidad entre muchas otras cosas, y no menores, por cierto.

El 89% de nuestros senadores y el Congreso tienen la doble ciudadanía con Israel y estamos en Siria debido a que Israel se pregunta quiénes son los verdaderos traidores al país sacrificando soldados estadounidenses en beneficio del país extranjero.

Senadores corporativos de EE.UU. y representantes que son ciudadanos duales de Israel

govbanknotes.wordpress.com/2017/06/07/us-senators-and-us-representatives-that-are-israel-dual-citizens/

Aquí hay una lista de políticos estadounidenses que tienen doble ciudadanía estadounidense/israelí. Tenga en cuenta los puestos de asesoramiento bancario y de política.


ADMINISTRACIÓN OBAMA

Jack Lew – Jefe de Gabinete del Presidente; Secretario del Tesoro

David Plouffe – Asesor Superior del Presidente

Danielle Borrin – Directora Asociada, Oficina de Participación Pública; Asistente Especial del Vicepresidente

Gary Gensler – Presidente de la Commodity Futures Trading Commission

Dan Shapiro – Embajador en Israel

Gene Sperling – Director del Consejo Económico Nacional

Mary Schapiro – Presidenta de la Comisión de Bolsa y Valores

Steven Simon – Jefe de la Mesa para Oriente Medio y el Norte de Africa en el Consejo de Seguridad Nacional

Eric Lynn – Asesor de Políticas de Oriente Medio

ADMINISTRACIÓN PASADA DE OBAMA

Rahm Emanuel (2009-2010) Jefe de Gabinete del Presidente

David Axelrod (2009-2011) Asesor Superior del Presidente

Elena Kagan (2009-2010) Procuradora General de los Estados Unidos

Peter Orszag (2009-2010) Director de la Oficina de Gestión y Presupuesto

Lawrence Summers (’09-’11) Director del Consejo Económico Nacional

Mona Sutphen (2009-2011) Jefe de Gabinete Adjunto de la Casa Blanca

James B. Steinberg (’09-’11 ) Secretario de Estado Adjunto

Dennis Ross (2009-2011) Asistente Especial del Presidente, Director Superior de la Región Central del Secretario de Estado

Ronald Klain (2009-2011) Jefe de Gabinete del Vicepresidente

Jared Bernstein (2009-2011) Economista Jefe y Asesor de Política Económica del Vicepresidente

Susan Sher (2009-2011) Jefa de Estado Mayor de la Primera Dama

Lee Feinstein (2009) Asesor de Política Exterior de la Campaña

Mara Rudman (2009) Asesor de Política Exterior Fuentes: Casa Blanca

112 CONGRESO (actual)

EL SENADO DE LOS ESTADOS UNIDOS [13]

Richard Blumenthal (D-CT) Barbara Boxer (D-CA) Benjamin Cardin (D-MD) Dianne Feinstein (D-CA) Al Franken (D-MN) Herb Kohl (D-WI) Frank Lautenberg (D-NJ) Joseph Lieberman (Independent-CT) Carl Levin (D-MI) Bernie Sanders (Independent-VT) Charles Schumer (D-) NY

CASA DE REPRESENTANTES [27]

Gary Ackerman (D-NY) Shelley Berkley (D-NV) Howard Berman (D-CA) Eric Cantor (R-VA) David Cicilline (D-RI) Stephen Cohen (D-TN) Susan Davis (D-CA) T Deutch (D-FL) Eliot Engel (D-NY) Bob Filner (D-CA) Barney Frank (D-MA) Gabrielle Giffords (D-AZ) Jane Harman (D-CA) Steve Israel (D-NY) Sander Levin (D-MI) Nita Lowey (D-NY) Jerrold Nadler (D-NY) Jared Polis (D-CO) Steve Rothman (D-NJ) Jan Schakowsky (D-IL) Allyson Schwartz (D-IL D-PA) Adam Schiff (D-CA) Brad Sherman (D-CA) Debbie Wasserman Schultz (D-FL) Henry Waxman (D-CA) Anthony Weiner (D-NY) John Yarmuth (D-KY)

¡Y esos son sólo los demócratas! Estoy seguro de que los republicanos son igual de malos si no peores, pero parece más difícil encontrar información. Aquí hay otra lista: american3rdposition.com/?p=12767

He aquí una explicación de cómo esto solía no ser permitido, entonces la ley fue cambiada, y también señala a muchos grandes titulares de doble ciudadanía en las administraciones de Bush y Clinton: www.viewzone.com/dualcitizen.html

¿Por qué está permitido? No está permitido que los ciudadanos regulares de Estados Unidos tengan doble ciudadanía, ¿verdad?

Creo que este tipo de cosas están permitidas porque los sionistas “Israel primero” son esencialmente dueños de nuestro gobierno, lo cual es porque los Rothschild poseen el sistema bancario central y tienen poderes de creación de dinero y promueven el sionismo. Así que juegas según sus reglas, o no obtienes mucho acceso a los dineros. Esta es la razón por la que la mayoría de los monopolios de la industria están encabezados por sionistas. No es una posibilidad aleatoria de que las cimas de la mayoría de las industrias son super gung-ho sobre Israel. Esta es también la razón por la que reciben la mayor ayuda, y por qué tienen los grupos de cabildeo más grandes.

Y para ser claros, no estoy hablando de judíos, la mitad de los cuales rechazan el sionismo. Hablo del sistema de creencias ideológicas, que dice que el gobierno israelí merece poseer el Monte Sión, también conocido como que Palestina necesita ser removida y la seguridad regional para Israel necesita ser asegurada en el Medio Oriente. Obama es un sionista, Biden es un sionista. Bush es un sionista. También Hillary, y Trump, como sus discursos de AIPAC mostraron con toda claridad.

Estos grandes banqueros necesitan dejar de ser capaces de tirar de las cuerdas de todos, pero eso no se detendrá hasta que la gente se dé cuenta de que sus habilidades de creación de dinero se basan en narrativas legales que provienen de falsas esperanzas y la falsa apariencia de autoridad. El gobierno debería ser capaz de crear su propio dinero, no pedir prestado a un banco privado en un sistema de creación de dinero basado en deudas donde siempre habrá, matemáticamente, más deuda adeudada de la que existe dinero, lo que les da poder sobre el gobierno porque son los cobradores de deudas.

Todo esto es una farsa absurda para cualquiera que vea la verdad de ello.

“Es bastante bien que la gente de la nación no entienda nuestro sistema bancario y monetario, porque si lo hicieran, creo que habría una revolución antes de mañana por la mañana”.

www.reddit.com/r/conspiracy/comments/4zm640/why_do_so_many_us_politicians_have_dual_usisraeli/?st=jf1r0ugy&sh=17467c91

 por IWB

https://www.investmentwatchblog.com/89-of-our-senators-and-congress-hold-dual-citizenship-citizenship-with-israel/

El plan de “gran reinicio” del Foro Económico Mundial para la industria: grandes beneficios alimentarios, pero no para las personas

“The Great Reset consiste en mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida.” — Vandana Shiva

Por Jeremy Loffredo

Klaus Schwab, fundador y presidente ejecutivo del Foro Económico Mundial. Foto por Heinz Tesarek

El Gran Reinicio del Foro Económico Mundial (WEF) incluye un plan para transformar las industrias alimentarias y agrícolas mundiales y la dieta humana. Los arquitectos del plan afirman que reducirá la escasez de alimentos, el hambre y las enfermedades, e incluso mitigará el cambio climático.

Pero una mirada más de cerca a las corporaciones y think tanks con los que el WEF se está asociando para dar inicio a esta transformación global sugiere que el verdadero motivo es un control corporativo más estricto sobre el sistema alimentario mediante soluciones tecnológicas.

Vandana Shiva, académica, ambientalista, defensora de la soberanía alimentaria y autora, dijo a The Defender: “El Gran Reinicio trata sobre las partes interesadas corporativas multinacionales en el Foro Económico Mundial que controlan tantos elementos de la vida planetaria como puedan. Desde los datos digitales que los humanos producen hasta cada bocado de alimentos que comemos”.

El WEF se describe a sí mismo como “la plataforma global para la cooperación público-privada” que crea asociaciones entre corporaciones, políticos, intelectuales, científicos y otros líderes de la sociedad para “definir, discutir y avanzar en temas clave en la agenda global”.

Según el fundador y presidente ejecutivo de WEF, Klaus Schwab, el foro se guía por el objetivo de posicionar a “las corporaciones privadas como fideicomisarios de la sociedad” para “abordar los desafíos sociales y ambientales”.

En julio, Schwab publicó un libro de 195 páginas,“COVID-19: The Great Reset”,en el que desafió a los líderes de la industria y a los responsables de la toma de decisiones a “hacer un buen uso de la pandemia al no dejar que la crisis se desperdicie”.

La revista TIME (cuyo propietario Marc Benioff es miembro de la junta directiva de WEF) se asoció recientemente con el WEF para cubrir The Great Reset y proporcionar una “mirada a cómo la pandemia COVID-19 proporciona una oportunidad única para transformar la forma en que vivimos”.

El Gran Restablecimiento está destinado a ser todo-encompassing. Sus organizaciones asociadas incluyen los mayores actores en la recopilación de datos, telecomunicaciones, fabricación de armas, finanzas, productos farmacéuticos, biotecnología y la industria alimentaria.

Los planes del WEF para el “restablecimiento” de la alimentación y la agricultura incluyen proyectos y asociaciones estratégicas que favorecen organismos modificados genéticamente, proteínas de laboratorio y productos farmacéuticos y productos químicos industriales como soluciones sostenibles a los problemas alimentarios y de salud.

Por ejemplo, WEF ha promovido y asociado con una organización llamada EAT Forum. Eat Forum se describe a sí mismo como un “Davos para la alimentación” que planea “añadir valor a los negocios y la industria” y “establecer la agenda política”.

EAT fue cofundada por Wellcome Trust, una organización establecida con fondos de GlaxoSmithKline y que todavía tiene alianzas estratégicas con el fabricante de drogas. EAT colabora con cerca de 40 gobiernos de ciudades en Europa, Africa, Asia, América del Norte, América del Sur y Australia. La organización también presta asistencia al Fondo de las Naciones Unidas para la Infancia (UNICEF) en la “creación de nuevas directrices dietéticas” y en las iniciativas de desarrollo sostenible.

Según Federic Leroy, profesor de ciencia alimentaria y biotecnología de la Universidad de Bruselas, eat interactúa estrechamente con algunas de las mayores empresas de carne de imitación, incluyendo Impossible Foods y otras empresas biotecnológicas, cuyo objetivo es reemplazar los alimentos nutritivos saludables por creaciones de laboratorio modificadas genéticamente.

“Lo enmarcan como saludable y sostenible, lo cual, por supuesto, no lo es”, dijo Leroy a The Defender.

Impossible Foods fue inicialmente cofinanciado por Google, Jeff Bezos y Bill Gates. Los últimos resultados de laboratorio mostraron que la carne de imitación de la compañía contenía niveles de glifosato 11 veces más altos que su competidor más cercano.

La mayor iniciativa de EAT se llama FReSH, que la organización describe como un esfuerzo para impulsar la transformación del sistema alimentario. Los socios del proyecto incluyen Bayer, Cargill, Syngenta, Unilever e incluso el gigante tecnológico Google.

“Empresas como Unilever y Bayer y otras compañías farmacéuticas ya son procesadores químicos, por lo que muchas de estas empresas están muy bien posicionadas para beneficiarse de este nuevo negocio de alimentos que gira en torno al procesamiento de productos químicos y extractos necesarios para producir estos alimentos elaborados en laboratorio a escala global”, dijo Leroy.

En el libro de Schwab, analiza cómo la biotecnología y los alimentos modificados genéticamente deben convertirse en un pilar central para reparar las cuestiones mundiales de escasez de alimentos, cuestiones que COVID ha revelado y exacerbado.

Escribe que “la seguridad alimentaria mundial sólo se logrará si se adaptan las regulaciones sobre alimentos modificados genéticamente para reflejar la realidad de que la edición de genes ofrece un método preciso, eficiente y seguro para mejorar los cultivos”.

Shiva no está de acuerdo. Ella le dijo a The Defender que “WEF está desfilando con la ciencia falsa” y “para que el Sr. Schwab promueva estas tecnologías como soluciones demuestra que The Great Reset se trata de mantener y potenciar una máquina de extracción corporativa y la propiedad privada de la vida”.

EAT desarrolló lo que se refiere como “la dieta de salud planetaria”,que el WEF defiende como la “solución dietética sostenible del futuro”. Pero según Leroy, es una dieta que se supone que reemplazará todo lo demás. “La dieta tiene como objetivo reducir la ingesta de carne y lácteos de la población mundial hasta en un 90% en algunos casos y la reemplaza por alimentos, cereales y aceites elaborados en laboratorio”, dijo.

Shiva explicó además: “La dieta propuesta por EAT no se trata en absoluto de nutrición, se trata de grandes negocios y se trata de una adquisición corporativa del sistema alimentario”.

Según los propios informes de EAT, los grandes ajustes que la organización y sus socios corporativos quieren hacer al sistema alimentario “es poco probable que tengan éxito si se dejan a la persona”, y los cambios que desean imponer a los hábitos alimenticios sociales y los alimentos “requieren la remodelación a nivel sistémico con intervenciones políticas duras que incluyan leyes, medidas fiscales, subsidios y sanciones, reconfiguración comercial y otras medidas económicas y estructurales”.

Pero Shiva dijo que este es el enfoque equivocado, porque “toda la ciencia” muestra que las dietas deben centrarse en la biodiversidad regional y geográfica. Explicó que “la dieta global uniforme de EAT se producirá con tecnología occidental y productos químicos agrícolas. Forzar esto a las naciones soberanas mediante el cabildeo multinacional es lo que yo llamo imperialismo alimentario”.